>Feature sequence001 <1 553 gene locus_tag LOCUS_00010 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142736.1:transposase 931 1179 gene locus_tag LOCUS_00020 931 1179 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172914.1 protein_id gnl|my_center|LOCUS_00020 1465 3156 gene locus_tag LOCUS_00030 1465 3156 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 protein_id gnl|my_center|LOCUS_00030 3586 4692 gene locus_tag LOCUS_00040 3586 4692 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793128.1 protein_id gnl|my_center|LOCUS_00040 5207 6814 gene locus_tag LOCUS_00050 5207 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8811 7111 gene locus_tag LOCUS_00060 8811 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9922 8774 gene locus_tag LOCUS_00070 9922 8774 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124033.1 protein_id gnl|my_center|LOCUS_00070 11438 10599 gene locus_tag LOCUS_00080 11438 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143111.1 protein_id gnl|my_center|LOCUS_00080 12910 11663 gene locus_tag LOCUS_00090 gene wcaG 12910 11663 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125975.1 protein_id gnl|my_center|LOCUS_00090 13437 13102 gene locus_tag LOCUS_00100 13437 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14377 13622 gene locus_tag LOCUS_00110 gene cysH 14377 13622 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_00110 15845 14877 gene locus_tag LOCUS_00120 gene pys 15845 14877 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057400.1 protein_id gnl|my_center|LOCUS_00120 17327 15849 gene locus_tag LOCUS_00130 gene pds 17327 15849 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124322.1 protein_id gnl|my_center|LOCUS_00130 17863 17501 gene locus_tag LOCUS_00140 17863 17501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18354 19982 gene locus_tag LOCUS_00150 gene prfC 18354 19982 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGV7 protein_id gnl|my_center|LOCUS_00150 20700 22097 gene locus_tag LOCUS_00160 20700 22097 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_00160 22253 23299 gene locus_tag LOCUS_00170 22253 23299 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_00170 23427 25019 gene locus_tag LOCUS_00180 23427 25019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 25761 27155 gene locus_tag LOCUS_00190 25761 27155 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142772.1 protein_id gnl|my_center|LOCUS_00190 27164 27961 gene locus_tag LOCUS_00200 27164 27961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 28021 29688 gene locus_tag LOCUS_00210 28021 29688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 30297 30746 gene locus_tag LOCUS_00220 30297 30746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 30954 31907 gene locus_tag LOCUS_00230 30954 31907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 32111 33697 gene locus_tag LOCUS_00240 32111 33697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 34267 33749 gene locus_tag LOCUS_00250 gene ilvH 34267 33749 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 protein_id gnl|my_center|LOCUS_00250 34625 34966 gene locus_tag LOCUS_00260 34625 34966 CDS product phospholipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143796.1 protein_id gnl|my_center|LOCUS_00260 35896 34985 gene locus_tag LOCUS_00270 35896 34985 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056888.1 protein_id gnl|my_center|LOCUS_00270 36114 36644 gene locus_tag LOCUS_00280 gene infC 36114 36644 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIG8 protein_id gnl|my_center|LOCUS_00280 36838 39828 gene locus_tag LOCUS_00290 36838 39828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 40075 40566 gene locus_tag LOCUS_00300 40075 40566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 40673 44524 gene locus_tag LOCUS_00310 40673 44524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 45580 44528 gene locus_tag LOCUS_00320 45580 44528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 45726 45899 gene locus_tag LOCUS_00330 45726 45899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 47142 45892 gene locus_tag LOCUS_00340 47142 45892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 48456 47311 gene locus_tag LOCUS_00350 48456 47311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 48695 49276 gene locus_tag LOCUS_00360 48695 49276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057548.1 protein_id gnl|my_center|LOCUS_00360 49548 50531 gene locus_tag LOCUS_00370 gene bvdR 49548 50531 CDS product biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140852.1 protein_id gnl|my_center|LOCUS_00370 51681 50812 gene locus_tag LOCUS_00380 51681 50812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 51752 51919 gene locus_tag LOCUS_00390 51752 51919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 52178 52414 gene locus_tag LOCUS_00400 52178 52414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057624.1 protein_id gnl|my_center|LOCUS_00400 53413 52403 gene locus_tag LOCUS_00410 53413 52403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 55621 55944 gene locus_tag LOCUS_00420 55621 55944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00420 55950 56108 gene locus_tag LOCUS_00430 55950 56108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00430 56181 57284 gene locus_tag LOCUS_00440 56181 57284 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_00440 57392 57721 gene locus_tag LOCUS_00450 57392 57721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 59832 57919 gene locus_tag LOCUS_00460 59832 57919 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225606.1 protein_id gnl|my_center|LOCUS_00460 61722 60220 gene locus_tag LOCUS_00470 gene rfaG 61722 60220 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126029.1 protein_id gnl|my_center|LOCUS_00470 62065 63432 gene locus_tag LOCUS_00480 gene ndh 62065 63432 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_00480 63566 64546 gene locus_tag LOCUS_00490 gene ubiA 63566 64546 CDS product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 protein_id gnl|my_center|LOCUS_00490 64928 64728 gene locus_tag LOCUS_00500 64928 64728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 65466 66020 gene locus_tag LOCUS_00510 65466 66020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142405.1 protein_id gnl|my_center|LOCUS_00510 66770 66408 gene locus_tag LOCUS_00520 66770 66408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 68771 67386 gene locus_tag LOCUS_00530 68771 67386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 69665 69480 gene locus_tag LOCUS_00540 69665 69480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 70095 72467 gene locus_tag LOCUS_00550 70095 72467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 73756 72833 gene locus_tag LOCUS_00560 73756 72833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 74494 74745 gene locus_tag LOCUS_00570 74494 74745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 74963 78580 gene locus_tag LOCUS_00580 74963 78580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 78592 82374 gene locus_tag LOCUS_00590 78592 82374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 82422 82964 gene locus_tag LOCUS_00600 82422 82964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 83232 83738 gene locus_tag LOCUS_00610 83232 83738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 83975 95443 gene locus_tag LOCUS_00620 83975 95443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 95872 96201 gene locus_tag LOCUS_00630 95872 96201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 96164 96994 gene locus_tag LOCUS_00640 96164 96994 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185757.1 protein_id gnl|my_center|LOCUS_00640 97913 98452 gene locus_tag LOCUS_00650 97913 98452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 101041 101817 gene locus_tag LOCUS_00660 101041 101817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 102632 101925 gene locus_tag LOCUS_00670 102632 101925 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_00670 103526 104278 gene locus_tag LOCUS_00680 103526 104278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_00680 104672 106321 gene locus_tag LOCUS_00690 gene hemD 104672 106321 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141234.1 protein_id gnl|my_center|LOCUS_00690 106646 106948 gene locus_tag LOCUS_00700 106646 106948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 107959 107219 gene locus_tag LOCUS_00710 gene sfsA 107959 107219 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJU8 protein_id gnl|my_center|LOCUS_00710 109574 108231 gene locus_tag LOCUS_00720 109574 108231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 109753 111945 gene locus_tag LOCUS_00730 109753 111945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 protein_id gnl|my_center|LOCUS_00730 113292 116003 gene locus_tag LOCUS_00740 113292 116003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 116776 116399 gene locus_tag LOCUS_00750 116776 116399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121790.1 protein_id gnl|my_center|LOCUS_00750 117045 116773 gene locus_tag LOCUS_00760 117045 116773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 117469 117798 gene locus_tag LOCUS_00770 117469 117798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 118051 118914 gene locus_tag LOCUS_00780 118051 118914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 120170 119028 gene locus_tag LOCUS_00790 gene epsN 120170 119028 CDS product putative pyridoxal phosphate-dependent aminotransferase EpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q795J3 protein_id gnl|my_center|LOCUS_00790 121203 120460 gene locus_tag LOCUS_00800 121203 120460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 122457 121387 gene locus_tag LOCUS_00810 122457 121387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 123293 122655 gene locus_tag LOCUS_00820 123293 122655 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 protein_id gnl|my_center|LOCUS_00820 124978 123878 gene locus_tag LOCUS_00830 124978 123878 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_00830 126254 125172 gene locus_tag LOCUS_00840 126254 125172 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 protein_id gnl|my_center|LOCUS_00840 127642 126302 gene locus_tag LOCUS_00850 127642 126302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 128950 127856 gene locus_tag LOCUS_00860 128950 127856 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_00860 130173 129007 gene locus_tag LOCUS_00870 130173 129007 CDS product LPS N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772519.1 protein_id gnl|my_center|LOCUS_00870 131543 130170 gene locus_tag LOCUS_00880 131543 130170 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG3 protein_id gnl|my_center|LOCUS_00880 133148 131754 gene locus_tag LOCUS_00890 133148 131754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 136175 133350 gene locus_tag LOCUS_00900 136175 133350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 137560 136940 gene locus_tag LOCUS_00910 gene cpcT1 137560 136940 CDS product chromophore lyase CpcT/CpeT 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNH3 protein_id gnl|my_center|LOCUS_00910 139145 137937 gene locus_tag LOCUS_00920 139145 137937 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 protein_id gnl|my_center|LOCUS_00920 140907 139528 gene locus_tag LOCUS_00930 140907 139528 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_00930 142135 140984 gene locus_tag LOCUS_00940 gene gldA 142135 140984 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057886.1 protein_id gnl|my_center|LOCUS_00940 143262 142468 gene locus_tag LOCUS_00950 143262 142468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 144452 143535 gene locus_tag LOCUS_00960 gene murI 144452 143535 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM3 protein_id gnl|my_center|LOCUS_00960 146469 144583 gene locus_tag LOCUS_00970 146469 144583 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056106.1 protein_id gnl|my_center|LOCUS_00970 148360 146939 gene locus_tag LOCUS_00980 148360 146939 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056302.1 protein_id gnl|my_center|LOCUS_00980 149503 148619 gene locus_tag LOCUS_00990 149503 148619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 150125 150706 gene locus_tag LOCUS_01000 150125 150706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 151246 150869 gene locus_tag LOCUS_01010 151246 150869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 152703 153461 gene locus_tag LOCUS_01020 152703 153461 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 protein_id gnl|my_center|LOCUS_01020 154033 153584 gene locus_tag LOCUS_01030 gene ndk 154033 153584 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM56 protein_id gnl|my_center|LOCUS_01030 155157 154111 gene locus_tag LOCUS_01040 gene ddl 155157 154111 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH0 protein_id gnl|my_center|LOCUS_01040 155896 155174 gene locus_tag LOCUS_01050 155896 155174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 156991 155939 gene locus_tag LOCUS_01060 156991 155939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 159755 157089 gene locus_tag LOCUS_01070 159755 157089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 160405 160205 gene locus_tag LOCUS_01080 160405 160205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 161163 162059 gene locus_tag LOCUS_01090 161163 162059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_01090 >Feature sequence002 3 173 gene locus_tag LOCUS_01100 3 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 903 4127 gene locus_tag LOCUS_01110 903 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 4559 4768 gene locus_tag LOCUS_01120 4559 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 5170 6195 gene locus_tag LOCUS_01130 5170 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 7130 6393 gene locus_tag LOCUS_01140 7130 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 9054 7501 gene locus_tag LOCUS_01150 9054 7501 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088217.1 protein_id gnl|my_center|LOCUS_01150 12084 9343 gene locus_tag LOCUS_01160 12084 9343 CDS product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_01160 12679 12086 gene locus_tag LOCUS_01170 12679 12086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 12949 12815 gene locus_tag LOCUS_01180 12949 12815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 15553 14159 gene locus_tag LOCUS_01190 15553 14159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 17531 15783 gene locus_tag LOCUS_01200 17531 15783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 18606 17824 gene locus_tag LOCUS_01210 18606 17824 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 protein_id gnl|my_center|LOCUS_01210 20034 18781 gene locus_tag LOCUS_01220 20034 18781 CDS product myeloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143588.1 protein_id gnl|my_center|LOCUS_01220 21173 21544 gene locus_tag LOCUS_01230 21173 21544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 22673 21879 gene locus_tag LOCUS_01240 22673 21879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 23988 25889 gene locus_tag LOCUS_01250 23988 25889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 28584 26137 gene locus_tag LOCUS_01260 28584 26137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 31626 29020 gene locus_tag LOCUS_01270 31626 29020 CDS product cell wall anchor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895990.1 protein_id gnl|my_center|LOCUS_01270 32972 31746 gene locus_tag LOCUS_01280 32972 31746 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_01280 34523 33222 gene locus_tag LOCUS_01290 34523 33222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 37320 34888 gene locus_tag LOCUS_01300 37320 34888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 39227 37317 gene locus_tag LOCUS_01310 39227 37317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 42504 41356 gene locus_tag LOCUS_01320 42504 41356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 44552 43161 gene locus_tag LOCUS_01330 44552 43161 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_01330 45614 44679 gene locus_tag LOCUS_01340 gene rfbB 45614 44679 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 protein_id gnl|my_center|LOCUS_01340 47702 45891 gene locus_tag LOCUS_01350 gene lepA 47702 45891 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM20 protein_id gnl|my_center|LOCUS_01350 47871 48161 gene locus_tag LOCUS_01360 47871 48161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 48294 50015 gene locus_tag LOCUS_01370 48294 50015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 51866 51021 gene locus_tag LOCUS_01380 51866 51021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 52147 52797 gene locus_tag LOCUS_01390 52147 52797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 protein_id gnl|my_center|LOCUS_01390 53714 52923 gene locus_tag LOCUS_01400 53714 52923 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056899.1 protein_id gnl|my_center|LOCUS_01400 54676 57213 gene locus_tag LOCUS_01410 54676 57213 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143331.1 protein_id gnl|my_center|LOCUS_01410 57456 58091 gene locus_tag LOCUS_01420 57456 58091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 58972 59916 gene locus_tag LOCUS_01430 58972 59916 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260111.1 protein_id gnl|my_center|LOCUS_01430 60363 60079 gene locus_tag LOCUS_01440 60363 60079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 60740 60925 gene locus_tag LOCUS_01450 60740 60925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 62502 60922 gene locus_tag LOCUS_01460 gene speE1 62502 60922 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 protein_id gnl|my_center|LOCUS_01460 62886 62506 gene locus_tag LOCUS_01470 62886 62506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 63878 62883 gene locus_tag LOCUS_01480 63878 62883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 64880 65083 gene locus_tag LOCUS_01490 64880 65083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 65664 65867 gene locus_tag LOCUS_01500 65664 65867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 66250 67326 gene locus_tag LOCUS_01510 66250 67326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01510 67311 69803 gene locus_tag LOCUS_01520 67311 69803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01520 69822 70304 gene locus_tag LOCUS_01530 69822 70304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 70291 70863 gene locus_tag LOCUS_01540 70291 70863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 72705 71323 gene locus_tag LOCUS_01550 72705 71323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 80644 72800 gene locus_tag LOCUS_01560 80644 72800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 85425 80641 gene locus_tag LOCUS_01570 85425 80641 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973246.1 protein_id gnl|my_center|LOCUS_01570 93815 85440 gene locus_tag LOCUS_01580 93815 85440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 94936 93923 gene locus_tag LOCUS_01590 94936 93923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 95750 94905 gene locus_tag LOCUS_01600 95750 94905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 96807 97250 gene locus_tag LOCUS_01610 96807 97250 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393272.1 protein_id gnl|my_center|LOCUS_01610 97571 97338 gene locus_tag LOCUS_01620 97571 97338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 100619 99150 gene locus_tag LOCUS_01630 100619 99150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_01630 101982 100921 gene locus_tag LOCUS_01640 101982 100921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 102362 103432 gene locus_tag LOCUS_01650 102362 103432 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_01650 103446 106106 gene locus_tag LOCUS_01660 103446 106106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 106676 107344 gene locus_tag LOCUS_01670 106676 107344 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918521.1 protein_id gnl|my_center|LOCUS_01670 107345 108598 gene locus_tag LOCUS_01680 107345 108598 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_01680 108579 110630 gene locus_tag LOCUS_01690 108579 110630 CDS product FmtA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 protein_id gnl|my_center|LOCUS_01690 110879 111655 gene locus_tag LOCUS_01700 110879 111655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 113111 112092 gene locus_tag LOCUS_01710 113111 112092 CDS product hopanoid biosynthesis associated radical SAM protein HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_01710 114268 113297 gene locus_tag LOCUS_01720 114268 113297 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_01720 117200 114273 gene locus_tag LOCUS_01730 117200 114273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 117353 117928 gene locus_tag LOCUS_01740 117353 117928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 118525 117941 gene locus_tag LOCUS_01750 gene aat 118525 117941 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKJ8 protein_id gnl|my_center|LOCUS_01750 118846 119274 gene locus_tag LOCUS_01760 118846 119274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 119642 120892 gene locus_tag LOCUS_01770 119642 120892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057279.1 protein_id gnl|my_center|LOCUS_01770 121072 122574 gene locus_tag LOCUS_01780 121072 122574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 124118 122700 gene locus_tag LOCUS_01790 124118 122700 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056050.1 protein_id gnl|my_center|LOCUS_01790 124586 124903 gene locus_tag LOCUS_01800 124586 124903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 125586 125038 gene locus_tag LOCUS_01810 125586 125038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143752.1 protein_id gnl|my_center|LOCUS_01810 126243 125848 gene locus_tag LOCUS_01820 126243 125848 CDS product period-extender gene product inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057790.1 protein_id gnl|my_center|LOCUS_01820 127091 127660 gene locus_tag LOCUS_01830 127091 127660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056251.1 protein_id gnl|my_center|LOCUS_01830 127868 129151 gene locus_tag LOCUS_01840 gene serS 127868 129151 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN0 protein_id gnl|my_center|LOCUS_01840 129315 130340 gene locus_tag LOCUS_01850 129315 130340 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE8 protein_id gnl|my_center|LOCUS_01850 130645 131361 gene locus_tag LOCUS_01860 gene nth 130645 131361 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE9 protein_id gnl|my_center|LOCUS_01860 131420 131722 gene locus_tag LOCUS_01870 gene rpsN 131420 131722 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW7 protein_id gnl|my_center|LOCUS_01870 132314 131979 gene locus_tag LOCUS_01880 132314 131979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056249.1 protein_id gnl|my_center|LOCUS_01880 134112 132418 gene locus_tag LOCUS_01890 134112 132418 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057573.1 protein_id gnl|my_center|LOCUS_01890 135640 134630 gene locus_tag LOCUS_01900 135640 134630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 136457 135840 gene locus_tag LOCUS_01910 136457 135840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869506.1 protein_id gnl|my_center|LOCUS_01910 137087 136512 gene locus_tag LOCUS_01920 137087 136512 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057508.1 protein_id gnl|my_center|LOCUS_01920 137798 137253 gene locus_tag LOCUS_01930 137798 137253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143948.1 protein_id gnl|my_center|LOCUS_01930 139327 138851 gene locus_tag LOCUS_01940 139327 138851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 140603 139716 gene locus_tag LOCUS_01950 140603 139716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 141920 141198 gene locus_tag LOCUS_01960 141920 141198 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_01960 142401 143156 gene locus_tag LOCUS_01970 142401 143156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 143170 144108 gene locus_tag LOCUS_01980 gene lgtF 143170 144108 CDS product beta 1,4 glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_01980 145825 146553 gene locus_tag LOCUS_01990 145825 146553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 protein_id gnl|my_center|LOCUS_01990 146594 147223 gene locus_tag LOCUS_02000 gene nusB 146594 147223 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKZ0 protein_id gnl|my_center|LOCUS_02000 148087 149970 gene locus_tag LOCUS_02010 148087 149970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 149963 150154 gene locus_tag LOCUS_02020 149963 150154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 150821 150399 gene locus_tag LOCUS_02030 150821 150399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 152250 153182 gene locus_tag LOCUS_02040 152250 153182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 153352 155559 gene locus_tag LOCUS_02050 153352 155559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 155932 155588 gene locus_tag LOCUS_02060 155932 155588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 156840 156418 gene locus_tag LOCUS_02070 156840 156418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 157597 157343 gene locus_tag LOCUS_02080 157597 157343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 >Feature sequence003 581 2338 gene locus_tag LOCUS_02090 gene argS 581 2338 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKN4 protein_id gnl|my_center|LOCUS_02090 2773 2450 gene locus_tag LOCUS_02100 2773 2450 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_02100 3153 2785 gene locus_tag LOCUS_02110 3153 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 4053 3517 gene locus_tag LOCUS_02120 gene def2 4053 3517 CDS product peptide deformylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHZ2 protein_id gnl|my_center|LOCUS_02120 4243 5625 gene locus_tag LOCUS_02130 gene dnaA 4243 5625 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL93 protein_id gnl|my_center|LOCUS_02130 6273 7394 gene locus_tag LOCUS_02140 gene dnaN 6273 7394 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG8 protein_id gnl|my_center|LOCUS_02140 7403 7594 gene locus_tag LOCUS_02150 7403 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 11106 7591 gene locus_tag LOCUS_02160 11106 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 11618 13642 gene locus_tag LOCUS_02170 11618 13642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 15225 13678 gene locus_tag LOCUS_02180 15225 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 18340 15218 gene locus_tag LOCUS_02190 18340 15218 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120142.1 protein_id gnl|my_center|LOCUS_02190 19470 19279 gene locus_tag LOCUS_02200 19470 19279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 23958 20053 gene locus_tag LOCUS_02210 23958 20053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_02210 26228 24189 gene locus_tag LOCUS_02220 26228 24189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 29335 26486 gene locus_tag LOCUS_02230 29335 26486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 30112 30041 gene locus_tag LOCUS_t00010 30112 30041 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 30285 30584 gene locus_tag LOCUS_02240 30285 30584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143785.1 protein_id gnl|my_center|LOCUS_02240 31318 31959 gene locus_tag LOCUS_02250 31318 31959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 33136 32051 gene locus_tag LOCUS_02260 gene recA 33136 32051 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH70 protein_id gnl|my_center|LOCUS_02260 33809 35044 gene locus_tag LOCUS_02270 gene xseA 33809 35044 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW4 protein_id gnl|my_center|LOCUS_02270 36349 35069 gene locus_tag LOCUS_02280 gene argD 36349 35069 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59322 protein_id gnl|my_center|LOCUS_02280 37070 36423 gene locus_tag LOCUS_02290 37070 36423 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 protein_id gnl|my_center|LOCUS_02290 37224 37024 gene locus_tag LOCUS_02300 37224 37024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 37853 37368 gene locus_tag LOCUS_02310 37853 37368 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056015.1 protein_id gnl|my_center|LOCUS_02310 38346 38657 gene locus_tag LOCUS_02320 gene groS 38346 38657 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TV92 protein_id gnl|my_center|LOCUS_02320 38761 40392 gene locus_tag LOCUS_02330 gene groL 38761 40392 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD4 protein_id gnl|my_center|LOCUS_02330 40630 41616 gene locus_tag LOCUS_02340 40630 41616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_02340 41616 42857 gene locus_tag LOCUS_02350 gene hisZ 41616 42857 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD8 protein_id gnl|my_center|LOCUS_02350 43921 42893 gene locus_tag LOCUS_02360 gene pdhA 43921 42893 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ3 protein_id gnl|my_center|LOCUS_02360 44664 47048 gene locus_tag LOCUS_02370 44664 47048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 47824 49005 gene locus_tag LOCUS_02380 47824 49005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057902.1 protein_id gnl|my_center|LOCUS_02380 50105 51778 gene locus_tag LOCUS_02390 50105 51778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 protein_id gnl|my_center|LOCUS_02390 52037 54967 gene locus_tag LOCUS_02400 52037 54967 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144199.1 protein_id gnl|my_center|LOCUS_02400 55211 56362 gene locus_tag LOCUS_02410 gene recF 55211 56362 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHY0 protein_id gnl|my_center|LOCUS_02410 56740 57501 gene locus_tag LOCUS_02420 56740 57501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 57636 58592 gene locus_tag LOCUS_02430 57636 58592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097898.1 protein_id gnl|my_center|LOCUS_02430 59507 60832 gene locus_tag LOCUS_02440 59507 60832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 61395 62723 gene locus_tag LOCUS_02450 61395 62723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 62953 64236 gene locus_tag LOCUS_02460 62953 64236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 64860 64297 gene locus_tag LOCUS_02470 64860 64297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195773.1 protein_id gnl|my_center|LOCUS_02470 65092 66540 gene locus_tag LOCUS_02480 65092 66540 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087310.1 protein_id gnl|my_center|LOCUS_02480 66980 69028 gene locus_tag LOCUS_02490 66980 69028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 69786 69280 gene locus_tag LOCUS_02500 69786 69280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057284.1 protein_id gnl|my_center|LOCUS_02500 71097 70018 gene locus_tag LOCUS_02510 71097 70018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_02510 72196 71081 gene locus_tag LOCUS_02520 72196 71081 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_02520 72558 73106 gene locus_tag LOCUS_02530 72558 73106 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_02530 73446 73195 gene locus_tag LOCUS_02540 73446 73195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 73923 74234 gene locus_tag LOCUS_02550 73923 74234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 74367 75731 gene locus_tag LOCUS_02560 74367 75731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 75719 76651 gene locus_tag LOCUS_02570 75719 76651 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_02570 76648 77988 gene locus_tag LOCUS_02580 76648 77988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 78381 79805 gene locus_tag LOCUS_02590 78381 79805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 79943 80689 gene locus_tag LOCUS_02600 79943 80689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141492.1 protein_id gnl|my_center|LOCUS_02600 80930 81685 gene locus_tag LOCUS_02610 80930 81685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 81959 82687 gene locus_tag LOCUS_02620 81959 82687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 82836 83693 gene locus_tag LOCUS_02630 82836 83693 CDS product inward rectifier potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_02630 85678 83720 gene locus_tag LOCUS_02640 gene dnaG 85678 83720 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB0 protein_id gnl|my_center|LOCUS_02640 86447 85845 gene locus_tag LOCUS_02650 86447 85845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_02650 86673 87647 gene locus_tag LOCUS_02660 86673 87647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 88292 89602 gene locus_tag LOCUS_02670 88292 89602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 90479 90000 gene locus_tag LOCUS_02680 90479 90000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 91817 90663 gene locus_tag LOCUS_02690 91817 90663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 92768 93862 gene locus_tag LOCUS_02700 92768 93862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 95695 94169 gene locus_tag LOCUS_02710 95695 94169 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_02710 96486 95758 gene locus_tag LOCUS_02720 96486 95758 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGK9 protein_id gnl|my_center|LOCUS_02720 98914 96902 gene locus_tag LOCUS_02730 98914 96902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 99738 100145 gene locus_tag LOCUS_02740 99738 100145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 100446 101093 gene locus_tag LOCUS_02750 100446 101093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 101280 102197 gene locus_tag LOCUS_02760 101280 102197 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_02760 102591 102325 gene locus_tag LOCUS_02770 102591 102325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 103331 104434 gene locus_tag LOCUS_02780 103331 104434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 104631 106793 gene locus_tag LOCUS_02790 gene glyS 104631 106793 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGX0 protein_id gnl|my_center|LOCUS_02790 107144 107668 gene locus_tag LOCUS_02800 107144 107668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140909.1 protein_id gnl|my_center|LOCUS_02800 107824 109014 gene locus_tag LOCUS_02810 gene sbcD 107824 109014 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHI2 protein_id gnl|my_center|LOCUS_02810 109249 109022 gene locus_tag LOCUS_02820 109249 109022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 110270 109389 gene locus_tag LOCUS_02830 110270 109389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 110954 111265 gene locus_tag LOCUS_02840 110954 111265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 112161 113618 gene locus_tag LOCUS_02850 112161 113618 CDS product regulator of sigma-B activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 protein_id gnl|my_center|LOCUS_02850 113661 113912 gene locus_tag LOCUS_02860 113661 113912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 114235 115629 gene locus_tag LOCUS_02870 gene argH 114235 115629 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLW0 protein_id gnl|my_center|LOCUS_02870 116168 115962 gene locus_tag LOCUS_02880 116168 115962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057571.1 protein_id gnl|my_center|LOCUS_02880 116616 116326 gene locus_tag LOCUS_02890 116616 116326 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_02890 117085 117456 gene locus_tag LOCUS_02900 117085 117456 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057290.1 protein_id gnl|my_center|LOCUS_02900 118279 117482 gene locus_tag LOCUS_02910 gene coaX 118279 117482 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJS3 protein_id gnl|my_center|LOCUS_02910 118719 124211 gene locus_tag LOCUS_02920 118719 124211 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_02920 124516 130008 gene locus_tag LOCUS_02930 124516 130008 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_02930 130265 131983 gene locus_tag LOCUS_02940 130265 131983 CDS product diflavin flavoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141773.1 protein_id gnl|my_center|LOCUS_02940 132024 133772 gene locus_tag LOCUS_02950 132024 133772 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141774.1 protein_id gnl|my_center|LOCUS_02950 134048 135352 gene locus_tag LOCUS_02960 134048 135352 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_02960 136430 135510 gene locus_tag LOCUS_02970 136430 135510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 137259 136495 gene locus_tag LOCUS_02980 137259 136495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 137604 137398 gene locus_tag LOCUS_02990 137604 137398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 137820 138842 gene locus_tag LOCUS_03000 gene proX 137820 138842 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418240.1 protein_id gnl|my_center|LOCUS_03000 139158 140243 gene locus_tag LOCUS_03010 139158 140243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 140585 140779 gene locus_tag LOCUS_03020 140585 140779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 142105 141149 gene locus_tag LOCUS_03030 142105 141149 CDS product type II restriction endonuclease MjaIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870104.1 protein_id gnl|my_center|LOCUS_03030 143105 142218 gene locus_tag LOCUS_03040 143105 142218 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142703.1 protein_id gnl|my_center|LOCUS_03040 143554 144498 gene locus_tag LOCUS_03050 143554 144498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 144829 145230 gene locus_tag LOCUS_03060 144829 145230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 147219 145537 gene locus_tag LOCUS_03070 147219 145537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056296.1 protein_id gnl|my_center|LOCUS_03070 147412 148941 gene locus_tag LOCUS_03080 147412 148941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 149453 150748 gene locus_tag LOCUS_03090 149453 150748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 150842 154102 gene locus_tag LOCUS_03100 150842 154102 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_03100 154853 155167 gene locus_tag LOCUS_03110 154853 155167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence004 4374 5525 gene locus_tag LOCUS_03120 4374 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 7293 6016 gene locus_tag LOCUS_03130 7293 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 8068 7433 gene locus_tag LOCUS_03140 8068 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 9309 8167 gene locus_tag LOCUS_03150 9309 8167 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728241.1 protein_id gnl|my_center|LOCUS_03150 11985 9712 gene locus_tag LOCUS_03160 11985 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228654.1 protein_id gnl|my_center|LOCUS_03160 12923 12597 gene locus_tag LOCUS_03170 12923 12597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 14633 19900 gene locus_tag LOCUS_03180 14633 19900 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_03180 20001 21104 gene locus_tag LOCUS_03190 20001 21104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 21612 22823 gene locus_tag LOCUS_03200 21612 22823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 22938 23405 gene locus_tag LOCUS_03210 22938 23405 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH28 protein_id gnl|my_center|LOCUS_03210 23544 25337 gene locus_tag LOCUS_03220 23544 25337 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_03220 27685 25613 gene locus_tag LOCUS_03230 27685 25613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 28824 29078 gene locus_tag LOCUS_03240 28824 29078 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_03240 29207 29404 gene locus_tag LOCUS_03250 29207 29404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 29466 29780 gene locus_tag LOCUS_03260 29466 29780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 29996 30652 gene locus_tag LOCUS_03270 gene nblB 29996 30652 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141257.1 protein_id gnl|my_center|LOCUS_03270 31199 30852 gene locus_tag LOCUS_03280 31199 30852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 32194 31208 gene locus_tag LOCUS_03290 32194 31208 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970133.1 protein_id gnl|my_center|LOCUS_03290 33802 32279 gene locus_tag LOCUS_03300 33802 32279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 35004 34135 gene locus_tag LOCUS_03310 35004 34135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 36102 36938 gene locus_tag LOCUS_03320 36102 36938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 37311 38900 gene locus_tag LOCUS_03330 37311 38900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 39315 42404 gene locus_tag LOCUS_03340 39315 42404 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_03340 42486 43664 gene locus_tag LOCUS_03350 42486 43664 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_03350 44166 43624 gene locus_tag LOCUS_03360 44166 43624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 44724 44242 gene locus_tag LOCUS_03370 44724 44242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 45574 44882 gene locus_tag LOCUS_03380 45574 44882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 46192 47772 gene locus_tag LOCUS_03390 46192 47772 CDS product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546376.1 protein_id gnl|my_center|LOCUS_03390 48826 48002 gene locus_tag LOCUS_03400 48826 48002 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014078.1 protein_id gnl|my_center|LOCUS_03400 49408 49181 gene locus_tag LOCUS_03410 49408 49181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 49825 51099 gene locus_tag LOCUS_03420 49825 51099 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_03420 51493 52773 gene locus_tag LOCUS_03430 51493 52773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 52746 53837 gene locus_tag LOCUS_03440 52746 53837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 53844 56873 gene locus_tag LOCUS_03450 53844 56873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142223.1 protein_id gnl|my_center|LOCUS_03450 57370 57966 gene locus_tag LOCUS_03460 57370 57966 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_03460 58168 58007 gene locus_tag LOCUS_03470 58168 58007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 58964 58491 gene locus_tag LOCUS_03480 gene yafE 58964 58491 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905064.1 protein_id gnl|my_center|LOCUS_03480 59878 59009 gene locus_tag LOCUS_03490 59878 59009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_03490 60228 61463 gene locus_tag LOCUS_03500 gene dapL 60228 61463 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH57 protein_id gnl|my_center|LOCUS_03500 61743 62099 gene locus_tag LOCUS_03510 61743 62099 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935368.1 protein_id gnl|my_center|LOCUS_03510 62408 63949 gene locus_tag LOCUS_03520 gene crtH 62408 63949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 protein_id gnl|my_center|LOCUS_03520 68589 64249 gene locus_tag LOCUS_03530 68589 64249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 69370 70749 gene locus_tag LOCUS_03540 gene mnmE 69370 70749 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P1 protein_id gnl|my_center|LOCUS_03540 71007 72416 gene locus_tag LOCUS_03550 71007 72416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 72566 73585 gene locus_tag LOCUS_03560 72566 73585 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055865.1 protein_id gnl|my_center|LOCUS_03560 74241 75149 gene locus_tag LOCUS_03570 gene ycf38 74241 75149 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJA3 protein_id gnl|my_center|LOCUS_03570 78561 75331 gene locus_tag LOCUS_03580 78561 75331 CDS product tetratricopeptide repeat domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_03580 78817 79206 gene locus_tag LOCUS_03590 78817 79206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 79695 79351 gene locus_tag LOCUS_03600 79695 79351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 80198 79776 gene locus_tag LOCUS_03610 80198 79776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 80751 80188 gene locus_tag LOCUS_03620 80751 80188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 81457 81077 gene locus_tag LOCUS_03630 81457 81077 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_03630 83834 81447 gene locus_tag LOCUS_03640 83834 81447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03640 85948 83966 gene locus_tag LOCUS_03650 85948 83966 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144195.1 protein_id gnl|my_center|LOCUS_03650 86520 86086 gene locus_tag LOCUS_03660 86520 86086 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 protein_id gnl|my_center|LOCUS_03660 86790 87206 gene locus_tag LOCUS_03670 86790 87206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 protein_id gnl|my_center|LOCUS_03670 87280 88770 gene locus_tag LOCUS_03680 gene cobQ 87280 88770 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI74 protein_id gnl|my_center|LOCUS_03680 88930 89169 gene locus_tag LOCUS_03690 88930 89169 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141646.1 protein_id gnl|my_center|LOCUS_03690 90453 89371 gene locus_tag LOCUS_03700 gene mnmA 90453 89371 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM0 protein_id gnl|my_center|LOCUS_03700 90618 90986 gene locus_tag LOCUS_03710 90618 90986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 91282 91704 gene locus_tag LOCUS_03720 91282 91704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 91719 92138 gene locus_tag LOCUS_03730 gene queF 91719 92138 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA3 protein_id gnl|my_center|LOCUS_03730 93073 92306 gene locus_tag LOCUS_03740 gene tagA 93073 92306 CDS product acetyl-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 protein_id gnl|my_center|LOCUS_03740 94477 96144 gene locus_tag LOCUS_03750 94477 96144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 96493 97554 gene locus_tag LOCUS_03760 96493 97554 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140456.1 protein_id gnl|my_center|LOCUS_03760 98067 99311 gene locus_tag LOCUS_03770 98067 99311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 99387 100625 gene locus_tag LOCUS_03780 99387 100625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 100704 101687 gene locus_tag LOCUS_03790 100704 101687 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_03790 101764 104103 gene locus_tag LOCUS_03800 101764 104103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 104247 105272 gene locus_tag LOCUS_03810 104247 105272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 105296 106333 gene locus_tag LOCUS_03820 105296 106333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 107228 108241 gene locus_tag LOCUS_03830 107228 108241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 108386 109399 gene locus_tag LOCUS_03840 108386 109399 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_03840 109527 110315 gene locus_tag LOCUS_03850 109527 110315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 110699 113047 gene locus_tag LOCUS_03860 110699 113047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 114208 113576 gene locus_tag LOCUS_03870 114208 113576 CDS product dihydroxyacetone kinase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938279.1 protein_id gnl|my_center|LOCUS_03870 115360 114287 gene locus_tag LOCUS_03880 115360 114287 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938278.1 protein_id gnl|my_center|LOCUS_03880 115774 116298 gene locus_tag LOCUS_03890 115774 116298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 117636 116290 gene locus_tag LOCUS_03900 117636 116290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 117832 119472 gene locus_tag LOCUS_03910 117832 119472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 120002 119637 gene locus_tag LOCUS_03920 120002 119637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086800.1 protein_id gnl|my_center|LOCUS_03920 120675 119992 gene locus_tag LOCUS_03930 120675 119992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 121043 120816 gene locus_tag LOCUS_03940 121043 120816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 123646 121082 gene locus_tag LOCUS_03950 123646 121082 CDS product multiphosphoryl transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938280.1 protein_id gnl|my_center|LOCUS_03950 124090 124407 gene locus_tag LOCUS_03960 124090 124407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 124488 124769 gene locus_tag LOCUS_03970 124488 124769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 126103 125582 gene locus_tag LOCUS_03980 gene grpB 126103 125582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957538.1 protein_id gnl|my_center|LOCUS_03980 126321 128291 gene locus_tag LOCUS_03990 gene acsA 126321 128291 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH2 protein_id gnl|my_center|LOCUS_03990 129344 128418 gene locus_tag LOCUS_04000 129344 128418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 130850 130302 gene locus_tag LOCUS_04010 gene frr 130850 130302 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM64 protein_id gnl|my_center|LOCUS_04010 131565 130837 gene locus_tag LOCUS_04020 gene pyrH 131565 130837 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM63 protein_id gnl|my_center|LOCUS_04020 132235 131687 gene locus_tag LOCUS_04030 132235 131687 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228051.1 protein_id gnl|my_center|LOCUS_04030 132574 133518 gene locus_tag LOCUS_04040 132574 133518 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057233.1 protein_id gnl|my_center|LOCUS_04040 134431 133619 gene locus_tag LOCUS_04050 134431 133619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143821.1 protein_id gnl|my_center|LOCUS_04050 135176 139318 gene locus_tag LOCUS_04060 135176 139318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 140298 139342 gene locus_tag LOCUS_04070 140298 139342 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 protein_id gnl|my_center|LOCUS_04070 140924 140508 gene locus_tag LOCUS_04080 140924 140508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 141147 140899 gene locus_tag LOCUS_04090 141147 140899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 143020 141581 gene locus_tag LOCUS_04100 gene ffh 143020 141581 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHI6 protein_id gnl|my_center|LOCUS_04100 143245 144174 gene locus_tag LOCUS_04110 143245 144174 CDS product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_04110 144476 145537 gene locus_tag LOCUS_04120 gene hemE 144476 145537 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBL3 protein_id gnl|my_center|LOCUS_04120 145965 146960 gene locus_tag LOCUS_04130 145965 146960 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 protein_id gnl|my_center|LOCUS_04130 148077 148916 gene locus_tag LOCUS_04140 148077 148916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 150242 149460 gene locus_tag LOCUS_04150 150242 149460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 151372 150377 gene locus_tag LOCUS_04160 151372 150377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 151362 151730 gene locus_tag LOCUS_04170 151362 151730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 152690 152391 gene locus_tag LOCUS_04180 152690 152391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence005 3636 163 gene locus_tag LOCUS_04190 3636 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 4436 4642 gene locus_tag LOCUS_04200 4436 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 4728 4961 gene locus_tag LOCUS_04210 4728 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 5087 5542 gene locus_tag LOCUS_04220 5087 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 5694 6485 gene locus_tag LOCUS_04230 5694 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197081.1 protein_id gnl|my_center|LOCUS_04230 8169 6691 gene locus_tag LOCUS_04240 8169 6691 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064509.1 protein_id gnl|my_center|LOCUS_04240 9876 8557 gene locus_tag LOCUS_04250 9876 8557 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 protein_id gnl|my_center|LOCUS_04250 10217 10735 gene locus_tag LOCUS_04260 10217 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 11051 12421 gene locus_tag LOCUS_04270 11051 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 12400 17508 gene locus_tag LOCUS_04280 12400 17508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 17822 20710 gene locus_tag LOCUS_04290 17822 20710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 21613 20771 gene locus_tag LOCUS_04300 21613 20771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 21803 21991 gene locus_tag LOCUS_04310 21803 21991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 22603 22229 gene locus_tag LOCUS_04320 22603 22229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 23037 22600 gene locus_tag LOCUS_04330 23037 22600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 23669 25060 gene locus_tag LOCUS_04340 23669 25060 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083861.1 protein_id gnl|my_center|LOCUS_04340 25195 26373 gene locus_tag LOCUS_04350 25195 26373 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 protein_id gnl|my_center|LOCUS_04350 27909 26518 gene locus_tag LOCUS_04360 gene mgtE 27909 26518 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9N7 protein_id gnl|my_center|LOCUS_04360 28584 29171 gene locus_tag LOCUS_04370 28584 29171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 29168 29530 gene locus_tag LOCUS_04380 29168 29530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 30145 30924 gene locus_tag LOCUS_04390 gene rnc 30145 30924 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH89 protein_id gnl|my_center|LOCUS_04390 30921 32030 gene locus_tag LOCUS_04400 30921 32030 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_04400 33053 32058 gene locus_tag LOCUS_04410 gene xerD 33053 32058 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC9 protein_id gnl|my_center|LOCUS_04410 33924 34220 gene locus_tag LOCUS_04420 33924 34220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 34985 34545 gene locus_tag LOCUS_04430 34985 34545 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 protein_id gnl|my_center|LOCUS_04430 35427 34975 gene locus_tag LOCUS_04440 35427 34975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 35618 36481 gene locus_tag LOCUS_04450 gene folD 35618 36481 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMU0 protein_id gnl|my_center|LOCUS_04450 36847 37776 gene locus_tag LOCUS_04460 gene crtE 36847 37776 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_04460 37998 38453 gene locus_tag LOCUS_04470 37998 38453 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055874.1 protein_id gnl|my_center|LOCUS_04470 39161 38517 gene locus_tag LOCUS_04480 39161 38517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 39539 39216 gene locus_tag LOCUS_04490 gene ycf54 39539 39216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 protein_id gnl|my_center|LOCUS_04490 40284 39562 gene locus_tag LOCUS_04500 gene pdxJ 40284 39562 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPF2 protein_id gnl|my_center|LOCUS_04500 41164 40526 gene locus_tag LOCUS_04510 41164 40526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 41892 41665 gene locus_tag LOCUS_04520 41892 41665 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHG5 protein_id gnl|my_center|LOCUS_04520 43108 44637 gene locus_tag LOCUS_04530 gene rsr 43108 44637 CDS product 60 kDa SS-A/Ro ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUW8 protein_id gnl|my_center|LOCUS_04530 44948 45790 gene locus_tag LOCUS_04540 44948 45790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057453.1 protein_id gnl|my_center|LOCUS_04540 45808 47118 gene locus_tag LOCUS_04550 gene rfaL 45808 47118 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126018.1 protein_id gnl|my_center|LOCUS_04550 47339 47953 gene locus_tag LOCUS_04560 47339 47953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 48152 48424 gene locus_tag LOCUS_04570 48152 48424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 protein_id gnl|my_center|LOCUS_04570 49466 48726 gene locus_tag LOCUS_04580 gene uppS 49466 48726 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI29 protein_id gnl|my_center|LOCUS_04580 50392 49472 gene locus_tag LOCUS_04590 50392 49472 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057599.1 protein_id gnl|my_center|LOCUS_04590 51830 50565 gene locus_tag LOCUS_04600 gene lysA 51830 50565 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI31 protein_id gnl|my_center|LOCUS_04600 52045 52647 gene locus_tag LOCUS_04610 52045 52647 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL5 protein_id gnl|my_center|LOCUS_04610 52788 55256 gene locus_tag LOCUS_04620 gene clpC 52788 55256 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_04620 55429 55632 gene locus_tag LOCUS_04630 55429 55632 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124286.1 protein_id gnl|my_center|LOCUS_04630 55696 56094 gene locus_tag LOCUS_04640 gene rbfA 55696 56094 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF9 protein_id gnl|my_center|LOCUS_04640 56091 57854 gene locus_tag LOCUS_04650 56091 57854 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056886.1 protein_id gnl|my_center|LOCUS_04650 58643 58885 gene locus_tag LOCUS_04660 58643 58885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058280.1 protein_id gnl|my_center|LOCUS_04660 59650 59258 gene locus_tag LOCUS_04670 59650 59258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 59819 59574 gene locus_tag LOCUS_04680 59819 59574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 60216 59869 gene locus_tag LOCUS_04690 60216 59869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056501.1 protein_id gnl|my_center|LOCUS_04690 61022 60441 gene locus_tag LOCUS_04700 61022 60441 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 protein_id gnl|my_center|LOCUS_04700 62701 62913 gene locus_tag LOCUS_04710 62701 62913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 63105 63401 gene locus_tag LOCUS_04720 63105 63401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 65346 66059 gene locus_tag LOCUS_04730 65346 66059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 67908 66322 gene locus_tag LOCUS_04740 gene guaA 67908 66322 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA5 protein_id gnl|my_center|LOCUS_04740 69541 68396 gene locus_tag LOCUS_04750 gene cbiD 69541 68396 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT8 protein_id gnl|my_center|LOCUS_04750 70863 69958 gene locus_tag LOCUS_04760 70863 69958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 71122 72108 gene locus_tag LOCUS_04770 gene moaA 71122 72108 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCF5 protein_id gnl|my_center|LOCUS_04770 72852 72244 gene locus_tag LOCUS_04780 gene rpsD 72852 72244 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59134 protein_id gnl|my_center|LOCUS_04780 74347 73385 gene locus_tag LOCUS_04790 74347 73385 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_04790 75124 75840 gene locus_tag LOCUS_04800 75124 75840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 76407 76820 gene locus_tag LOCUS_04810 76407 76820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 80371 77375 gene locus_tag LOCUS_04820 80371 77375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 81282 81494 gene locus_tag LOCUS_04830 81282 81494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 81524 82063 gene locus_tag LOCUS_04840 81524 82063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 82191 83915 gene locus_tag LOCUS_04850 82191 83915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 84511 84017 gene locus_tag LOCUS_04860 84511 84017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 85871 84801 gene locus_tag LOCUS_04870 gene aguA 85871 84801 CDS product putative agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZK4 protein_id gnl|my_center|LOCUS_04870 86413 87330 gene locus_tag LOCUS_04880 86413 87330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 87439 88188 gene locus_tag LOCUS_04890 87439 88188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144001.1 protein_id gnl|my_center|LOCUS_04890 90051 88453 gene locus_tag LOCUS_04900 gene ndhD1 90051 88453 CDS product NAD(P)H-quinone oxidoreductase chain 4 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY0 protein_id gnl|my_center|LOCUS_04900 92222 90156 gene locus_tag LOCUS_04910 gene ndhF1 92222 90156 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056567.1 protein_id gnl|my_center|LOCUS_04910 93424 92993 gene locus_tag LOCUS_04920 93424 92993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 94188 93511 gene locus_tag LOCUS_04930 94188 93511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056001.1 protein_id gnl|my_center|LOCUS_04930 94346 95359 gene locus_tag LOCUS_04940 gene ycf30 94346 95359 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 protein_id gnl|my_center|LOCUS_04940 95929 97239 gene locus_tag LOCUS_04950 95929 97239 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058264.1 protein_id gnl|my_center|LOCUS_04950 97299 98726 gene locus_tag LOCUS_04960 97299 98726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_04960 99345 100718 gene locus_tag LOCUS_04970 99345 100718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 100986 102068 gene locus_tag LOCUS_04980 100986 102068 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057692.1 protein_id gnl|my_center|LOCUS_04980 102967 102110 gene locus_tag LOCUS_04990 gene nadC 102967 102110 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057550.1 protein_id gnl|my_center|LOCUS_04990 103806 103045 gene locus_tag LOCUS_05000 103806 103045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258578.1 protein_id gnl|my_center|LOCUS_05000 104685 103942 gene locus_tag LOCUS_05010 104685 103942 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861198.1 protein_id gnl|my_center|LOCUS_05010 105077 104742 gene locus_tag LOCUS_05020 105077 104742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 105481 105065 gene locus_tag LOCUS_05030 105481 105065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 105917 105582 gene locus_tag LOCUS_05040 105917 105582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 106866 106297 gene locus_tag LOCUS_05050 106866 106297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_05050 108736 107012 gene locus_tag LOCUS_05060 gene nadB 108736 107012 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGB1 protein_id gnl|my_center|LOCUS_05060 109857 108883 gene locus_tag LOCUS_05070 gene nadA 109857 108883 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_05070 111821 110364 gene locus_tag LOCUS_05080 111821 110364 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_05080 113659 112388 gene locus_tag LOCUS_05090 113659 112388 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837658.1 protein_id gnl|my_center|LOCUS_05090 116457 113656 gene locus_tag LOCUS_05100 116457 113656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 117035 116454 gene locus_tag LOCUS_05110 117035 116454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 118013 122092 gene locus_tag LOCUS_05120 118013 122092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 122105 122917 gene locus_tag LOCUS_05130 122105 122917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 122944 124377 gene locus_tag LOCUS_05140 122944 124377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 124752 125357 gene locus_tag LOCUS_05150 124752 125357 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141157.1 protein_id gnl|my_center|LOCUS_05150 125831 126394 gene locus_tag LOCUS_05160 125831 126394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 126732 127154 gene locus_tag LOCUS_05170 126732 127154 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546622.1 protein_id gnl|my_center|LOCUS_05170 127428 127189 gene locus_tag LOCUS_05180 127428 127189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 127887 128621 gene locus_tag LOCUS_05190 127887 128621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05190 129205 130908 gene locus_tag LOCUS_05200 129205 130908 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence006 1657 293 gene locus_tag LOCUS_05210 gene trmFO 1657 293 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59109 protein_id gnl|my_center|LOCUS_05210 3381 1885 gene locus_tag LOCUS_05220 3381 1885 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056715.1 protein_id gnl|my_center|LOCUS_05220 3432 4136 gene locus_tag LOCUS_05230 3432 4136 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056716.1 protein_id gnl|my_center|LOCUS_05230 5416 4181 gene locus_tag LOCUS_05240 gene ctpA 5416 4181 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 protein_id gnl|my_center|LOCUS_05240 5637 6305 gene locus_tag LOCUS_05250 gene petB 5637 6305 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8M7 protein_id gnl|my_center|LOCUS_05250 6405 6887 gene locus_tag LOCUS_05260 gene petD 6405 6887 CDS product cytochrome b6-f complex subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N3 protein_id gnl|my_center|LOCUS_05260 8773 7172 gene locus_tag LOCUS_05270 8773 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 9265 10410 gene locus_tag LOCUS_05280 9265 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 10528 10908 gene locus_tag LOCUS_05290 10528 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057511.1 protein_id gnl|my_center|LOCUS_05290 11213 10953 gene locus_tag LOCUS_05300 11213 10953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 11305 12537 gene locus_tag LOCUS_05310 11305 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 12929 12729 gene locus_tag LOCUS_05320 12929 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 13643 13218 gene locus_tag LOCUS_05330 13643 13218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 14136 16307 gene locus_tag LOCUS_05340 14136 16307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 16708 17226 gene locus_tag LOCUS_05350 16708 17226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 17603 18475 gene locus_tag LOCUS_05360 gene mtnP 17603 18475 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE4 protein_id gnl|my_center|LOCUS_05360 18839 19285 gene locus_tag LOCUS_05370 18839 19285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 20098 19400 gene locus_tag LOCUS_05380 20098 19400 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_05380 20210 21514 gene locus_tag LOCUS_05390 20210 21514 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_05390 21814 22902 gene locus_tag LOCUS_05400 21814 22902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 23056 24489 gene locus_tag LOCUS_05410 23056 24489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 24486 25475 gene locus_tag LOCUS_05420 24486 25475 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 protein_id gnl|my_center|LOCUS_05420 25481 28201 gene locus_tag LOCUS_05430 25481 28201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 29117 28464 gene locus_tag LOCUS_05440 29117 28464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 protein_id gnl|my_center|LOCUS_05440 29945 29154 gene locus_tag LOCUS_05450 29945 29154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_05450 30222 30866 gene locus_tag LOCUS_05460 30222 30866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140730.1 protein_id gnl|my_center|LOCUS_05460 33105 30904 gene locus_tag LOCUS_05470 33105 30904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 protein_id gnl|my_center|LOCUS_05470 34795 33851 gene locus_tag LOCUS_05480 gene fcl 34795 33851 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL64 protein_id gnl|my_center|LOCUS_05480 36051 34972 gene locus_tag LOCUS_05490 gene gmd 36051 34972 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 protein_id gnl|my_center|LOCUS_05490 37035 38465 gene locus_tag LOCUS_05500 37035 38465 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056473.1 protein_id gnl|my_center|LOCUS_05500 38687 39649 gene locus_tag LOCUS_05510 38687 39649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 40261 39884 gene locus_tag LOCUS_05520 40261 39884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 40443 41798 gene locus_tag LOCUS_05530 40443 41798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058234.1 protein_id gnl|my_center|LOCUS_05530 42083 42505 gene locus_tag LOCUS_05540 42083 42505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 42813 42643 gene locus_tag LOCUS_05550 42813 42643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057262.1 protein_id gnl|my_center|LOCUS_05550 43125 43688 gene locus_tag LOCUS_05560 43125 43688 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056635.1 protein_id gnl|my_center|LOCUS_05560 44091 43840 gene locus_tag LOCUS_05570 44091 43840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 44225 45655 gene locus_tag LOCUS_05580 44225 45655 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN18 protein_id gnl|my_center|LOCUS_05580 46276 45722 gene locus_tag LOCUS_05590 46276 45722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057944.1 protein_id gnl|my_center|LOCUS_05590 47136 46483 gene locus_tag LOCUS_05600 47136 46483 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_05600 47322 48047 gene locus_tag LOCUS_05610 47322 48047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 48680 48111 gene locus_tag LOCUS_05620 48680 48111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056693.1 protein_id gnl|my_center|LOCUS_05620 49913 49125 gene locus_tag LOCUS_05630 49913 49125 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057801.1 protein_id gnl|my_center|LOCUS_05630 50475 51341 gene locus_tag LOCUS_05640 50475 51341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 51754 51533 gene locus_tag LOCUS_05650 51754 51533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 51962 52807 gene locus_tag LOCUS_05660 gene dapF 51962 52807 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM2 protein_id gnl|my_center|LOCUS_05660 54203 52830 gene locus_tag LOCUS_05670 gene murF 54203 52830 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM9 protein_id gnl|my_center|LOCUS_05670 54536 55822 gene locus_tag LOCUS_05680 54536 55822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055996.1 protein_id gnl|my_center|LOCUS_05680 56550 55906 gene locus_tag LOCUS_05690 gene pth 56550 55906 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN75 protein_id gnl|my_center|LOCUS_05690 57000 56776 gene locus_tag LOCUS_05700 57000 56776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056228.1 protein_id gnl|my_center|LOCUS_05700 59240 57717 gene locus_tag LOCUS_05710 gene phrB 59240 57717 CDS product (6-4) photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CH39 protein_id gnl|my_center|LOCUS_05710 61106 59760 gene locus_tag LOCUS_05720 61106 59760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 61783 62406 gene locus_tag LOCUS_05730 61783 62406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 63109 63390 gene locus_tag LOCUS_05740 63109 63390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 63407 64720 gene locus_tag LOCUS_05750 63407 64720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 64901 66733 gene locus_tag LOCUS_05760 64901 66733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 67381 67938 gene locus_tag LOCUS_05770 67381 67938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 69673 68282 gene locus_tag LOCUS_05780 gene pcxA 69673 68282 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59112 protein_id gnl|my_center|LOCUS_05780 69794 72022 gene locus_tag LOCUS_05790 69794 72022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056596.1 protein_id gnl|my_center|LOCUS_05790 73329 72133 gene locus_tag LOCUS_05800 73329 72133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 74784 73666 gene locus_tag LOCUS_05810 74784 73666 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_05810 75456 78179 gene locus_tag LOCUS_05820 75456 78179 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058103.1 protein_id gnl|my_center|LOCUS_05820 79014 78217 gene locus_tag LOCUS_05830 79014 78217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 80713 80081 gene locus_tag LOCUS_05840 80713 80081 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS3 protein_id gnl|my_center|LOCUS_05840 80882 82363 gene locus_tag LOCUS_05850 80882 82363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057642.1 protein_id gnl|my_center|LOCUS_05850 82677 83777 gene locus_tag LOCUS_05860 82677 83777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141888.1 protein_id gnl|my_center|LOCUS_05860 84197 85249 gene locus_tag LOCUS_05870 84197 85249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088971.1 protein_id gnl|my_center|LOCUS_05870 86166 85423 gene locus_tag LOCUS_05880 86166 85423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141009.1 protein_id gnl|my_center|LOCUS_05880 86511 87794 gene locus_tag LOCUS_05890 86511 87794 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024498.1 protein_id gnl|my_center|LOCUS_05890 89009 88131 gene locus_tag LOCUS_05900 89009 88131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 90208 89327 gene locus_tag LOCUS_05910 90208 89327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 91221 90418 gene locus_tag LOCUS_05920 91221 90418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 91801 92199 gene locus_tag LOCUS_05930 91801 92199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 92555 92803 gene locus_tag LOCUS_05940 92555 92803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 97774 92948 gene locus_tag LOCUS_05950 97774 92948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 99558 98119 gene locus_tag LOCUS_05960 99558 98119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 100560 100111 gene locus_tag LOCUS_05970 100560 100111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144145.1 protein_id gnl|my_center|LOCUS_05970 102788 101127 gene locus_tag LOCUS_05980 102788 101127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089817.1 protein_id gnl|my_center|LOCUS_05980 103738 103076 gene locus_tag LOCUS_05990 103738 103076 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 protein_id gnl|my_center|LOCUS_05990 104409 103738 gene locus_tag LOCUS_06000 104409 103738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057650.1 protein_id gnl|my_center|LOCUS_06000 104928 104677 gene locus_tag LOCUS_06010 104928 104677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 protein_id gnl|my_center|LOCUS_06010 105314 104925 gene locus_tag LOCUS_06020 105314 104925 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057653.1 protein_id gnl|my_center|LOCUS_06020 106747 105311 gene locus_tag LOCUS_06030 gene ndhD5 106747 105311 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057654.1 protein_id gnl|my_center|LOCUS_06030 108180 106744 gene locus_tag LOCUS_06040 gene ndhD5 108180 106744 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057654.1 protein_id gnl|my_center|LOCUS_06040 108440 108177 gene locus_tag LOCUS_06050 108440 108177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 108715 109959 gene locus_tag LOCUS_06060 108715 109959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 110189 110419 gene locus_tag LOCUS_06070 110189 110419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 110416 110727 gene locus_tag LOCUS_06080 110416 110727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 111253 111543 gene locus_tag LOCUS_06090 111253 111543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 111558 111929 gene locus_tag LOCUS_06100 111558 111929 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142729.1 protein_id gnl|my_center|LOCUS_06100 114442 111986 gene locus_tag LOCUS_06110 114442 111986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 115271 115564 gene locus_tag LOCUS_06120 115271 115564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 116148 115729 gene locus_tag LOCUS_06130 116148 115729 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249647.1 protein_id gnl|my_center|LOCUS_06130 116560 116195 gene locus_tag LOCUS_06140 116560 116195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 117640 118227 gene locus_tag LOCUS_06150 117640 118227 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_06150 118625 119287 gene locus_tag LOCUS_06160 118625 119287 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969704.1 protein_id gnl|my_center|LOCUS_06160 119399 121375 gene locus_tag LOCUS_06170 119399 121375 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704555.1 protein_id gnl|my_center|LOCUS_06170 121708 122280 gene locus_tag LOCUS_06180 121708 122280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809969.1 protein_id gnl|my_center|LOCUS_06180 123498 122392 gene locus_tag LOCUS_06190 123498 122392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963741.1 protein_id gnl|my_center|LOCUS_06190 124801 123947 gene locus_tag LOCUS_06200 124801 123947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 protein_id gnl|my_center|LOCUS_06200 125858 125247 gene locus_tag LOCUS_06210 125858 125247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 128134 126410 gene locus_tag LOCUS_06220 128134 126410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 129327 128140 gene locus_tag LOCUS_06230 129327 128140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence007 2327 2133 gene locus_tag LOCUS_06240 2327 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4441 2441 gene locus_tag LOCUS_06250 gene uvrB 4441 2441 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC6 protein_id gnl|my_center|LOCUS_06250 5048 5497 gene locus_tag LOCUS_06260 5048 5497 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_06260 8009 5787 gene locus_tag LOCUS_06270 8009 5787 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_06270 8761 9129 gene locus_tag LOCUS_06280 8761 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057913.1 protein_id gnl|my_center|LOCUS_06280 10131 9130 gene locus_tag LOCUS_06290 gene fmt 10131 9130 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS1 protein_id gnl|my_center|LOCUS_06290 10934 10191 gene locus_tag LOCUS_06300 10934 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 11607 12407 gene locus_tag LOCUS_06310 11607 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056146.1 protein_id gnl|my_center|LOCUS_06310 12701 12468 gene locus_tag LOCUS_06320 12701 12468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 13342 12773 gene locus_tag LOCUS_06330 13342 12773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 14073 13543 gene locus_tag LOCUS_06340 14073 13543 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057261.1 protein_id gnl|my_center|LOCUS_06340 14750 14944 gene locus_tag LOCUS_06350 gene rpmG 14750 14944 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH99 protein_id gnl|my_center|LOCUS_06350 15087 15302 gene locus_tag LOCUS_06360 gene rpsR 15087 15302 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBX4 protein_id gnl|my_center|LOCUS_06360 15662 17719 gene locus_tag LOCUS_06370 15662 17719 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_06370 18205 19455 gene locus_tag LOCUS_06380 18205 19455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 20857 19694 gene locus_tag LOCUS_06390 20857 19694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 21347 21003 gene locus_tag LOCUS_06400 21347 21003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 21532 21930 gene locus_tag LOCUS_06410 21532 21930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 22364 22170 gene locus_tag LOCUS_06420 22364 22170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 23167 23499 gene locus_tag LOCUS_06430 23167 23499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 23746 26481 gene locus_tag LOCUS_06440 23746 26481 CDS product B12-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058092.1 protein_id gnl|my_center|LOCUS_06440 29257 26555 gene locus_tag LOCUS_06450 29257 26555 CDS product NHLP family bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_06450 29702 30832 gene locus_tag LOCUS_06460 29702 30832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 32178 31093 gene locus_tag LOCUS_06470 32178 31093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 33531 32197 gene locus_tag LOCUS_06480 33531 32197 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 protein_id gnl|my_center|LOCUS_06480 33906 34850 gene locus_tag LOCUS_06490 33906 34850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 34835 36985 gene locus_tag LOCUS_06500 34835 36985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 38264 37137 gene locus_tag LOCUS_06510 38264 37137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 38853 38599 gene locus_tag LOCUS_06520 38853 38599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 40100 39138 gene locus_tag LOCUS_06530 40100 39138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 41749 40169 gene locus_tag LOCUS_06540 41749 40169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 45171 41866 gene locus_tag LOCUS_06550 45171 41866 CDS product lanthionine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970831.1 protein_id gnl|my_center|LOCUS_06550 46034 45165 gene locus_tag LOCUS_06560 46034 45165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 46684 49323 gene locus_tag LOCUS_06570 46684 49323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 49814 52015 gene locus_tag LOCUS_06580 49814 52015 CDS product potassium efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140386.1 protein_id gnl|my_center|LOCUS_06580 52671 53306 gene locus_tag LOCUS_06590 gene rplC 52671 53306 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN1 protein_id gnl|my_center|LOCUS_06590 53453 54085 gene locus_tag LOCUS_06600 gene rplD 53453 54085 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN0 protein_id gnl|my_center|LOCUS_06600 54078 54380 gene locus_tag LOCUS_06610 gene rplW 54078 54380 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM9 protein_id gnl|my_center|LOCUS_06610 54497 55360 gene locus_tag LOCUS_06620 gene rplB 54497 55360 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM8 protein_id gnl|my_center|LOCUS_06620 55473 55748 gene locus_tag LOCUS_06630 gene rpsS 55473 55748 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9W6 protein_id gnl|my_center|LOCUS_06630 55799 56158 gene locus_tag LOCUS_06640 gene rplV 55799 56158 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM6 protein_id gnl|my_center|LOCUS_06640 56235 56960 gene locus_tag LOCUS_06650 gene rpsC 56235 56960 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59187 protein_id gnl|my_center|LOCUS_06650 57103 57465 gene locus_tag LOCUS_06660 gene rplP 57103 57465 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM5 protein_id gnl|my_center|LOCUS_06660 57469 57753 gene locus_tag LOCUS_06670 57469 57753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 57762 58010 gene locus_tag LOCUS_06680 gene rpsQ 57762 58010 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM3 protein_id gnl|my_center|LOCUS_06680 58162 58530 gene locus_tag LOCUS_06690 gene rplN 58162 58530 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM2 protein_id gnl|my_center|LOCUS_06690 58530 58892 gene locus_tag LOCUS_06700 gene rplX 58530 58892 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM1 protein_id gnl|my_center|LOCUS_06700 59002 59595 gene locus_tag LOCUS_06710 gene rplE 59002 59595 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM0 protein_id gnl|my_center|LOCUS_06710 59619 60020 gene locus_tag LOCUS_06720 gene rpsH 59619 60020 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML9 protein_id gnl|my_center|LOCUS_06720 60282 60821 gene locus_tag LOCUS_06730 gene rplF 60282 60821 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML8 protein_id gnl|my_center|LOCUS_06730 60825 61187 gene locus_tag LOCUS_06740 gene rplR 60825 61187 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML7 protein_id gnl|my_center|LOCUS_06740 61302 61823 gene locus_tag LOCUS_06750 gene rpsE 61302 61823 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59126 protein_id gnl|my_center|LOCUS_06750 61927 62376 gene locus_tag LOCUS_06760 gene rplO 61927 62376 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML6 protein_id gnl|my_center|LOCUS_06760 62421 63761 gene locus_tag LOCUS_06770 gene secY 62421 63761 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML5 protein_id gnl|my_center|LOCUS_06770 63883 64446 gene locus_tag LOCUS_06780 gene adk 63883 64446 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD15 protein_id gnl|my_center|LOCUS_06780 64783 65007 gene locus_tag LOCUS_06790 gene infA 64783 65007 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML3 protein_id gnl|my_center|LOCUS_06790 65294 65677 gene locus_tag LOCUS_06800 gene rpsM 65294 65677 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML1 protein_id gnl|my_center|LOCUS_06800 65864 66256 gene locus_tag LOCUS_06810 gene rpsK 65864 66256 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59379 protein_id gnl|my_center|LOCUS_06810 66409 67353 gene locus_tag LOCUS_06820 gene rpoA 66409 67353 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFF5 protein_id gnl|my_center|LOCUS_06820 67456 67806 gene locus_tag LOCUS_06830 gene rplQ 67456 67806 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK9 protein_id gnl|my_center|LOCUS_06830 67865 68701 gene locus_tag LOCUS_06840 gene truA 67865 68701 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM6 protein_id gnl|my_center|LOCUS_06840 68941 69390 gene locus_tag LOCUS_06850 gene rplM 68941 69390 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK8 protein_id gnl|my_center|LOCUS_06850 69396 69809 gene locus_tag LOCUS_06860 gene rpsI 69396 69809 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK7 protein_id gnl|my_center|LOCUS_06860 70204 70452 gene locus_tag LOCUS_06870 gene rpmE 70204 70452 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9Y9 protein_id gnl|my_center|LOCUS_06870 70673 71785 gene locus_tag LOCUS_06880 gene prfA 70673 71785 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMG9 protein_id gnl|my_center|LOCUS_06880 74196 72310 gene locus_tag LOCUS_06890 74196 72310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 74859 76190 gene locus_tag LOCUS_06900 74859 76190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 76850 76440 gene locus_tag LOCUS_06910 76850 76440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 77616 78407 gene locus_tag LOCUS_06920 77616 78407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140639.1 protein_id gnl|my_center|LOCUS_06920 79483 78635 gene locus_tag LOCUS_06930 79483 78635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143297.1 protein_id gnl|my_center|LOCUS_06930 79774 82947 gene locus_tag LOCUS_06940 79774 82947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 84197 83343 gene locus_tag LOCUS_06950 84197 83343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_06950 84819 84412 gene locus_tag LOCUS_06960 84819 84412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 86175 85297 gene locus_tag LOCUS_06970 86175 85297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143297.1 protein_id gnl|my_center|LOCUS_06970 89855 87228 gene locus_tag LOCUS_06980 89855 87228 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144168.1 protein_id gnl|my_center|LOCUS_06980 91411 90077 gene locus_tag LOCUS_06990 91411 90077 CDS product modulator of DNA gyrase PmbA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 protein_id gnl|my_center|LOCUS_06990 92454 91591 gene locus_tag LOCUS_07000 92454 91591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 protein_id gnl|my_center|LOCUS_07000 92810 93199 gene locus_tag LOCUS_07010 92810 93199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140146.1 protein_id gnl|my_center|LOCUS_07010 94179 93958 gene locus_tag LOCUS_07020 94179 93958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 94472 95650 gene locus_tag LOCUS_07030 94472 95650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 95767 96909 gene locus_tag LOCUS_07040 95767 96909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 97530 96973 gene locus_tag LOCUS_07050 97530 96973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057756.1 protein_id gnl|my_center|LOCUS_07050 97845 98399 gene locus_tag LOCUS_07060 gene dpsA 97845 98399 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056462.1 protein_id gnl|my_center|LOCUS_07060 98650 98566 gene locus_tag LOCUS_t00020 98650 98566 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 99650 98733 gene locus_tag LOCUS_07070 99650 98733 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125164.1 protein_id gnl|my_center|LOCUS_07070 100967 99765 gene locus_tag LOCUS_07080 100967 99765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 101780 103663 gene locus_tag LOCUS_07090 101780 103663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 104095 103769 gene locus_tag LOCUS_07100 104095 103769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 104517 104197 gene locus_tag LOCUS_07110 104517 104197 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKP7 protein_id gnl|my_center|LOCUS_07110 104716 105081 gene locus_tag LOCUS_07120 104716 105081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 105602 106996 gene locus_tag LOCUS_07130 105602 106996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 107565 107080 gene locus_tag LOCUS_07140 107565 107080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_07140 108032 107565 gene locus_tag LOCUS_07150 108032 107565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 protein_id gnl|my_center|LOCUS_07150 109453 109130 gene locus_tag LOCUS_07160 109453 109130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 110125 110340 gene locus_tag LOCUS_07170 110125 110340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 110769 113996 gene locus_tag LOCUS_07180 110769 113996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 114807 116411 gene locus_tag LOCUS_07190 114807 116411 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_07190 116584 117018 gene locus_tag LOCUS_07200 116584 117018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 117841 117608 gene locus_tag LOCUS_07210 117841 117608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07210 118021 117845 gene locus_tag LOCUS_07220 118021 117845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 118271 118011 gene locus_tag LOCUS_07230 118271 118011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07230 118739 118296 gene locus_tag LOCUS_07240 118739 118296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07240 >Feature sequence008 145 375 gene locus_tag LOCUS_07250 145 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 387 578 gene locus_tag LOCUS_07260 387 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058211.1 protein_id gnl|my_center|LOCUS_07260 1158 3038 gene locus_tag LOCUS_07270 gene ftsH 1158 3038 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG5 protein_id gnl|my_center|LOCUS_07270 3317 3664 gene locus_tag LOCUS_07280 3317 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 3674 4042 gene locus_tag LOCUS_07290 3674 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 4641 4853 gene locus_tag LOCUS_07300 4641 4853 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_07300 6184 7515 gene locus_tag LOCUS_07310 gene aroB 6184 7515 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L68 protein_id gnl|my_center|LOCUS_07310 7527 8360 gene locus_tag LOCUS_07320 7527 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 8432 9760 gene locus_tag LOCUS_07330 8432 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_07330 9999 9811 gene locus_tag LOCUS_07340 9999 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 10624 11601 gene locus_tag LOCUS_07350 10624 11601 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 protein_id gnl|my_center|LOCUS_07350 11750 13171 gene locus_tag LOCUS_07360 gene putP 11750 13171 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_07360 13208 14353 gene locus_tag LOCUS_07370 13208 14353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 15397 16395 gene locus_tag LOCUS_07380 15397 16395 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_07380 17713 16475 gene locus_tag LOCUS_07390 17713 16475 CDS product UPF0754 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM9 protein_id gnl|my_center|LOCUS_07390 18045 19139 gene locus_tag LOCUS_07400 18045 19139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142156.1 protein_id gnl|my_center|LOCUS_07400 19893 19246 gene locus_tag LOCUS_07410 19893 19246 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 protein_id gnl|my_center|LOCUS_07410 20247 19954 gene locus_tag LOCUS_07420 20247 19954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 20353 20269 gene locus_tag LOCUS_t00030 20353 20269 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21201 20332 gene locus_tag LOCUS_07430 21201 20332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 protein_id gnl|my_center|LOCUS_07430 21770 21414 gene locus_tag LOCUS_07440 gene ycf57 21770 21414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056711.1 protein_id gnl|my_center|LOCUS_07440 23129 22020 gene locus_tag LOCUS_07450 23129 22020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 24476 23637 gene locus_tag LOCUS_07460 24476 23637 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_07460 25950 24604 gene locus_tag LOCUS_07470 gene clpX 25950 24604 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDN9 protein_id gnl|my_center|LOCUS_07470 26566 25964 gene locus_tag LOCUS_07480 gene clpP1 26566 25964 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI2 protein_id gnl|my_center|LOCUS_07480 28412 26979 gene locus_tag LOCUS_07490 gene tig 28412 26979 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDP0 protein_id gnl|my_center|LOCUS_07490 29297 30349 gene locus_tag LOCUS_07500 gene asd 29297 30349 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP2 protein_id gnl|my_center|LOCUS_07500 30463 31347 gene locus_tag LOCUS_07510 gene dapA 30463 31347 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK4 protein_id gnl|my_center|LOCUS_07510 31694 33454 gene locus_tag LOCUS_07520 gene rnj 31694 33454 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK3 protein_id gnl|my_center|LOCUS_07520 34359 34736 gene locus_tag LOCUS_07530 34359 34736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 34797 35570 gene locus_tag LOCUS_07540 34797 35570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 35698 35949 gene locus_tag LOCUS_07550 35698 35949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056812.1 protein_id gnl|my_center|LOCUS_07550 35983 37179 gene locus_tag LOCUS_07560 35983 37179 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_07560 37361 37579 gene locus_tag LOCUS_07570 37361 37579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 39222 37576 gene locus_tag LOCUS_07580 39222 37576 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057298.1 protein_id gnl|my_center|LOCUS_07580 39754 40920 gene locus_tag LOCUS_07590 39754 40920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141214.1 protein_id gnl|my_center|LOCUS_07590 41196 41990 gene locus_tag LOCUS_07600 gene trmJ 41196 41990 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH44 protein_id gnl|my_center|LOCUS_07600 42751 43695 gene locus_tag LOCUS_07610 42751 43695 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057949.1 protein_id gnl|my_center|LOCUS_07610 44777 43728 gene locus_tag LOCUS_07620 gene obg 44777 43728 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG4 protein_id gnl|my_center|LOCUS_07620 45625 44924 gene locus_tag LOCUS_07630 45625 44924 CDS product nitrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057403.1 protein_id gnl|my_center|LOCUS_07630 45760 46140 gene locus_tag LOCUS_07640 45760 46140 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986781.1 protein_id gnl|my_center|LOCUS_07640 46480 47370 gene locus_tag LOCUS_07650 46480 47370 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257381.1 protein_id gnl|my_center|LOCUS_07650 48401 48802 gene locus_tag LOCUS_07660 48401 48802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 49025 49309 gene locus_tag LOCUS_07670 49025 49309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 49554 49796 gene locus_tag LOCUS_07680 49554 49796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 49957 50898 gene locus_tag LOCUS_07690 49957 50898 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730913.1 protein_id gnl|my_center|LOCUS_07690 51342 51142 gene locus_tag LOCUS_07700 51342 51142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 52340 52035 gene locus_tag LOCUS_07710 52340 52035 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_07710 54149 55111 gene locus_tag LOCUS_07720 54149 55111 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_07720 55331 56647 gene locus_tag LOCUS_07730 55331 56647 CDS product polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141791.1 protein_id gnl|my_center|LOCUS_07730 57433 58371 gene locus_tag LOCUS_07740 57433 58371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 58623 60587 gene locus_tag LOCUS_07750 58623 60587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143705.1 protein_id gnl|my_center|LOCUS_07750 60591 61997 gene locus_tag LOCUS_07760 60591 61997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 62340 62924 gene locus_tag LOCUS_07770 62340 62924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 63792 63061 gene locus_tag LOCUS_07780 63792 63061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057176.1 protein_id gnl|my_center|LOCUS_07780 64080 66683 gene locus_tag LOCUS_07790 64080 66683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 66894 68105 gene locus_tag LOCUS_07800 66894 68105 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056452.1 protein_id gnl|my_center|LOCUS_07800 69384 68173 gene locus_tag LOCUS_07810 69384 68173 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_07810 70268 70089 gene locus_tag LOCUS_07820 70268 70089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 72059 73228 gene locus_tag LOCUS_07830 72059 73228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_07830 73232 74131 gene locus_tag LOCUS_07840 73232 74131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 74382 75101 gene locus_tag LOCUS_07850 74382 75101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 75318 76703 gene locus_tag LOCUS_07860 75318 76703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 76936 79098 gene locus_tag LOCUS_07870 76936 79098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 protein_id gnl|my_center|LOCUS_07870 79292 80350 gene locus_tag LOCUS_07880 79292 80350 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141068.1 protein_id gnl|my_center|LOCUS_07880 81867 80623 gene locus_tag LOCUS_07890 gene ackA 81867 80623 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLW9 protein_id gnl|my_center|LOCUS_07890 82061 81870 gene locus_tag LOCUS_07900 82061 81870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 84546 82117 gene locus_tag LOCUS_07910 84546 82117 CDS product putative phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN6 protein_id gnl|my_center|LOCUS_07910 85871 84915 gene locus_tag LOCUS_07920 85871 84915 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUG2 protein_id gnl|my_center|LOCUS_07920 86727 86179 gene locus_tag LOCUS_07930 86727 86179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030243.1 protein_id gnl|my_center|LOCUS_07930 87055 88896 gene locus_tag LOCUS_07940 87055 88896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 88909 90732 gene locus_tag LOCUS_07950 88909 90732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 91266 91472 gene locus_tag LOCUS_07960 91266 91472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 92657 91677 gene locus_tag LOCUS_07970 92657 91677 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_07970 93026 96070 gene locus_tag LOCUS_07980 93026 96070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 96336 96887 gene locus_tag LOCUS_07990 96336 96887 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_07990 97143 100853 gene locus_tag LOCUS_08000 97143 100853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 102841 101735 gene locus_tag LOCUS_08010 102841 101735 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_08010 103791 103225 gene locus_tag LOCUS_08020 103791 103225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_08020 103891 104295 gene locus_tag LOCUS_08030 103891 104295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 104712 104230 gene locus_tag LOCUS_08040 104712 104230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 105782 105255 gene locus_tag LOCUS_08050 105782 105255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 106201 106740 gene locus_tag LOCUS_08060 106201 106740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 108302 106950 gene locus_tag LOCUS_08070 108302 106950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 110051 108492 gene locus_tag LOCUS_08080 110051 108492 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384423.1 protein_id gnl|my_center|LOCUS_08080 111904 110330 gene locus_tag LOCUS_08090 111904 110330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 114260 112026 gene locus_tag LOCUS_08100 114260 112026 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143066.1 protein_id gnl|my_center|LOCUS_08100 114661 116046 gene locus_tag LOCUS_08110 114661 116046 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence009 2156 861 gene locus_tag LOCUS_08120 2156 861 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_08120 7809 2578 gene locus_tag LOCUS_08130 7809 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 8615 8809 gene locus_tag LOCUS_08140 8615 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 10079 8760 gene locus_tag LOCUS_08150 10079 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 10510 11352 gene locus_tag LOCUS_08160 10510 11352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 11574 12845 gene locus_tag LOCUS_08170 gene ftsZ 11574 12845 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNW0 protein_id gnl|my_center|LOCUS_08170 13291 13761 gene locus_tag LOCUS_08180 13291 13761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 14813 16159 gene locus_tag LOCUS_08190 14813 16159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 17638 16385 gene locus_tag LOCUS_08200 17638 16385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 18312 19526 gene locus_tag LOCUS_08210 18312 19526 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056420.1 protein_id gnl|my_center|LOCUS_08210 19626 19991 gene locus_tag LOCUS_08220 19626 19991 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 protein_id gnl|my_center|LOCUS_08220 20021 20569 gene locus_tag LOCUS_08230 20021 20569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 20710 23769 gene locus_tag LOCUS_08240 20710 23769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 23982 27023 gene locus_tag LOCUS_08250 23982 27023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 27105 30893 gene locus_tag LOCUS_08260 27105 30893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 31233 31757 gene locus_tag LOCUS_08270 31233 31757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 32480 33229 gene locus_tag LOCUS_08280 32480 33229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_08280 33482 34753 gene locus_tag LOCUS_08290 33482 34753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 35306 34797 gene locus_tag LOCUS_08300 35306 34797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 35800 37983 gene locus_tag LOCUS_08310 35800 37983 CDS product UDP-glucose-beta-D-glucan glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057632.1 protein_id gnl|my_center|LOCUS_08310 39735 38086 gene locus_tag LOCUS_08320 39735 38086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 40818 39838 gene locus_tag LOCUS_08330 40818 39838 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_08330 42514 40829 gene locus_tag LOCUS_08340 42514 40829 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_08340 42839 43204 gene locus_tag LOCUS_08350 42839 43204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 45501 43573 gene locus_tag LOCUS_08360 gene asnB 45501 43573 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_08360 46192 45593 gene locus_tag LOCUS_08370 46192 45593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 46552 47322 gene locus_tag LOCUS_08380 46552 47322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 47924 48964 gene locus_tag LOCUS_08390 47924 48964 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_08390 49092 50264 gene locus_tag LOCUS_08400 49092 50264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_08400 50307 51524 gene locus_tag LOCUS_08410 50307 51524 CDS product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_08410 51846 52637 gene locus_tag LOCUS_08420 51846 52637 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_08420 53980 52859 gene locus_tag LOCUS_08430 gene ribD 53980 52859 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH08 protein_id gnl|my_center|LOCUS_08430 56175 54133 gene locus_tag LOCUS_08440 56175 54133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 56603 57442 gene locus_tag LOCUS_08450 56603 57442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 58009 57464 gene locus_tag LOCUS_08460 58009 57464 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056784.1 protein_id gnl|my_center|LOCUS_08460 58923 58228 gene locus_tag LOCUS_08470 58923 58228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 60100 59093 gene locus_tag LOCUS_08480 60100 59093 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056782.1 protein_id gnl|my_center|LOCUS_08480 60479 60844 gene locus_tag LOCUS_08490 gene ssb 60479 60844 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIU1 protein_id gnl|my_center|LOCUS_08490 61700 62203 gene locus_tag LOCUS_08500 61700 62203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057132.1 protein_id gnl|my_center|LOCUS_08500 63414 62452 gene locus_tag LOCUS_08510 63414 62452 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057967.1 protein_id gnl|my_center|LOCUS_08510 63541 64245 gene locus_tag LOCUS_08520 gene ispD 63541 64245 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL91 protein_id gnl|my_center|LOCUS_08520 64327 64992 gene locus_tag LOCUS_08530 gene nfi 64327 64992 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGM4 protein_id gnl|my_center|LOCUS_08530 65442 65068 gene locus_tag LOCUS_08540 65442 65068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 66044 65775 gene locus_tag LOCUS_08550 66044 65775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 67901 67335 gene locus_tag LOCUS_08560 67901 67335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056117.1 protein_id gnl|my_center|LOCUS_08560 68607 67912 gene locus_tag LOCUS_08570 68607 67912 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056116.1 protein_id gnl|my_center|LOCUS_08570 68890 70008 gene locus_tag LOCUS_08580 gene rlmN 68890 70008 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG98 protein_id gnl|my_center|LOCUS_08580 71587 72786 gene locus_tag LOCUS_08590 71587 72786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 73296 74351 gene locus_tag LOCUS_08600 73296 74351 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583760.1 protein_id gnl|my_center|LOCUS_08600 74324 74641 gene locus_tag LOCUS_08610 74324 74641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 74949 75716 gene locus_tag LOCUS_08620 74949 75716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 75937 76842 gene locus_tag LOCUS_08630 75937 76842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140468.1 protein_id gnl|my_center|LOCUS_08630 77126 78115 gene locus_tag LOCUS_08640 77126 78115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 78122 79129 gene locus_tag LOCUS_08650 78122 79129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 79140 80066 gene locus_tag LOCUS_08660 79140 80066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 82259 80628 gene locus_tag LOCUS_08670 82259 80628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 83141 82278 gene locus_tag LOCUS_08680 gene phnC 83141 82278 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92V71 protein_id gnl|my_center|LOCUS_08680 84055 83138 gene locus_tag LOCUS_08690 gene phnD 84055 83138 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_08690 84487 86835 gene locus_tag LOCUS_08700 gene ndh 84487 86835 CDS product bifunctional NADH dehydrogenase FAD-containing subunit/selenide,water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124488.1 protein_id gnl|my_center|LOCUS_08700 87079 87591 gene locus_tag LOCUS_08710 87079 87591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 87656 88387 gene locus_tag LOCUS_08720 87656 88387 CDS product bifunctional dihydropteridine reductase/dihydrofolate reductase TmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172549.1 protein_id gnl|my_center|LOCUS_08720 88375 89307 gene locus_tag LOCUS_08730 gene folP 88375 89307 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBS7 protein_id gnl|my_center|LOCUS_08730 89318 90721 gene locus_tag LOCUS_08740 89318 90721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 91922 90939 gene locus_tag LOCUS_08750 91922 90939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 92477 92046 gene locus_tag LOCUS_08760 92477 92046 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172548.1 protein_id gnl|my_center|LOCUS_08760 92955 92884 gene locus_tag LOCUS_t00040 92955 92884 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 95443 93158 gene locus_tag LOCUS_08770 95443 93158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 95836 97104 gene locus_tag LOCUS_08780 95836 97104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 97833 97519 gene locus_tag LOCUS_08790 97833 97519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08790 98870 99286 gene locus_tag LOCUS_08800 98870 99286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 100190 101101 gene locus_tag LOCUS_08810 gene axeA 100190 101101 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120225.1 protein_id gnl|my_center|LOCUS_08810 101176 102831 gene locus_tag LOCUS_08820 101176 102831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 104662 103100 gene locus_tag LOCUS_08830 104662 103100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 104720 105559 gene locus_tag LOCUS_08840 gene tyrA 104720 105559 CDS product arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058267.1 protein_id gnl|my_center|LOCUS_08840 106079 105591 gene locus_tag LOCUS_08850 106079 105591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence010 1217 477 gene locus_tag LOCUS_08860 1217 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1766 1551 gene locus_tag LOCUS_08870 1766 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2360 5950 gene locus_tag LOCUS_08880 gene metH 2360 5950 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056870.1 protein_id gnl|my_center|LOCUS_08880 7821 6973 gene locus_tag LOCUS_08890 7821 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 7846 8043 gene locus_tag LOCUS_08900 7846 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 9425 8079 gene locus_tag LOCUS_08910 gene cobL 9425 8079 CDS product precorrin-6Y C5,15-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056027.1 protein_id gnl|my_center|LOCUS_08910 10044 9418 gene locus_tag LOCUS_08920 gene cobH 10044 9418 CDS product cobalt-precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056028.1 protein_id gnl|my_center|LOCUS_08920 10893 10087 gene locus_tag LOCUS_08930 10893 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 10918 11910 gene locus_tag LOCUS_08940 10918 11910 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057413.1 protein_id gnl|my_center|LOCUS_08940 12119 13378 gene locus_tag LOCUS_08950 12119 13378 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_08950 13879 14391 gene locus_tag LOCUS_08960 13879 14391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 14704 15150 gene locus_tag LOCUS_08970 14704 15150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 15522 15953 gene locus_tag LOCUS_08980 gene ureE 15522 15953 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ62 protein_id gnl|my_center|LOCUS_08980 16409 16020 gene locus_tag LOCUS_08990 16409 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140941.1 protein_id gnl|my_center|LOCUS_08990 16944 16381 gene locus_tag LOCUS_09000 16944 16381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 17262 17714 gene locus_tag LOCUS_09010 17262 17714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 19255 17843 gene locus_tag LOCUS_09020 19255 17843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057279.1 protein_id gnl|my_center|LOCUS_09020 19802 21028 gene locus_tag LOCUS_09030 19802 21028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 21279 22415 gene locus_tag LOCUS_09040 21279 22415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 22477 23607 gene locus_tag LOCUS_09050 22477 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 23838 24293 gene locus_tag LOCUS_09060 23838 24293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 24554 25843 gene locus_tag LOCUS_09070 24554 25843 CDS product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 protein_id gnl|my_center|LOCUS_09070 26065 26262 gene locus_tag LOCUS_09080 26065 26262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 26447 26767 gene locus_tag LOCUS_09090 26447 26767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 26975 27274 gene locus_tag LOCUS_09100 26975 27274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 27586 28224 gene locus_tag LOCUS_09110 27586 28224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 28561 28229 gene locus_tag LOCUS_09120 28561 28229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 29112 28864 gene locus_tag LOCUS_09130 29112 28864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 29866 32949 gene locus_tag LOCUS_09140 29866 32949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 33557 33336 gene locus_tag LOCUS_09150 33557 33336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 33817 33557 gene locus_tag LOCUS_09160 33817 33557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 34951 34787 gene locus_tag LOCUS_09170 34951 34787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 36185 34899 gene locus_tag LOCUS_09180 36185 34899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09180 36992 36759 gene locus_tag LOCUS_09190 36992 36759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 37946 37611 gene locus_tag LOCUS_09200 37946 37611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 38552 39427 gene locus_tag LOCUS_09210 38552 39427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 39811 39626 gene locus_tag LOCUS_09220 39811 39626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 40754 41260 gene locus_tag LOCUS_09230 40754 41260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056704.1 protein_id gnl|my_center|LOCUS_09230 43596 41575 gene locus_tag LOCUS_09240 43596 41575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 44246 43662 gene locus_tag LOCUS_09250 44246 43662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 44540 45457 gene locus_tag LOCUS_09260 gene ilvE 44540 45457 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125110.1 protein_id gnl|my_center|LOCUS_09260 45532 47370 gene locus_tag LOCUS_09270 45532 47370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 47833 49011 gene locus_tag LOCUS_09280 47833 49011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 49215 50879 gene locus_tag LOCUS_09290 gene lnt 49215 50879 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIC3 protein_id gnl|my_center|LOCUS_09290 51580 50948 gene locus_tag LOCUS_09300 51580 50948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_09300 52069 51605 gene locus_tag LOCUS_09310 52069 51605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 52706 52371 gene locus_tag LOCUS_09320 52706 52371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 53320 52703 gene locus_tag LOCUS_09330 gene sigH 53320 52703 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056172.1 protein_id gnl|my_center|LOCUS_09330 53771 56002 gene locus_tag LOCUS_09340 53771 56002 CDS product protein-tyrosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389244.1 protein_id gnl|my_center|LOCUS_09340 56379 58052 gene locus_tag LOCUS_09350 56379 58052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 58607 59854 gene locus_tag LOCUS_09360 gene hfsI 58607 59854 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918387.1 protein_id gnl|my_center|LOCUS_09360 59851 60945 gene locus_tag LOCUS_09370 59851 60945 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888142.1 protein_id gnl|my_center|LOCUS_09370 61223 62119 gene locus_tag LOCUS_09380 61223 62119 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975608.1 protein_id gnl|my_center|LOCUS_09380 62463 63671 gene locus_tag LOCUS_09390 62463 63671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 64190 64354 gene locus_tag LOCUS_09400 64190 64354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 64818 65801 gene locus_tag LOCUS_09410 64818 65801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 66080 67009 gene locus_tag LOCUS_09420 66080 67009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 67340 68506 gene locus_tag LOCUS_09430 67340 68506 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMT4 protein_id gnl|my_center|LOCUS_09430 69154 68906 gene locus_tag LOCUS_09440 69154 68906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 70105 70302 gene locus_tag LOCUS_09450 70105 70302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 71582 70860 gene locus_tag LOCUS_09460 gene folE 71582 70860 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB8 protein_id gnl|my_center|LOCUS_09460 72432 71707 gene locus_tag LOCUS_09470 72432 71707 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057150.1 protein_id gnl|my_center|LOCUS_09470 72707 72432 gene locus_tag LOCUS_09480 72707 72432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 74052 73078 gene locus_tag LOCUS_09490 gene accA 74052 73078 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB6 protein_id gnl|my_center|LOCUS_09490 74915 76432 gene locus_tag LOCUS_09500 74915 76432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 77701 76778 gene locus_tag LOCUS_09510 77701 76778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 84604 77945 gene locus_tag LOCUS_09520 84604 77945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 86967 84616 gene locus_tag LOCUS_09530 86967 84616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 88250 87213 gene locus_tag LOCUS_09540 88250 87213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124527.1 protein_id gnl|my_center|LOCUS_09540 88895 90463 gene locus_tag LOCUS_09550 88895 90463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 90607 91602 gene locus_tag LOCUS_09560 gene ureD 90607 91602 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF7 protein_id gnl|my_center|LOCUS_09560 91652 91954 gene locus_tag LOCUS_09570 gene ureA 91652 91954 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK85 protein_id gnl|my_center|LOCUS_09570 92297 92010 gene locus_tag LOCUS_09580 92297 92010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 93237 93554 gene locus_tag LOCUS_09590 gene ureB 93237 93554 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLZ6 protein_id gnl|my_center|LOCUS_09590 93718 95436 gene locus_tag LOCUS_09600 gene ureC 93718 95436 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMV6 protein_id gnl|my_center|LOCUS_09600 95713 96027 gene locus_tag LOCUS_09610 95713 96027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 96368 96706 gene locus_tag LOCUS_09620 96368 96706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 96980 97591 gene locus_tag LOCUS_09630 96980 97591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 98329 97751 gene locus_tag LOCUS_09640 98329 97751 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 protein_id gnl|my_center|LOCUS_09640 98548 99156 gene locus_tag LOCUS_09650 98548 99156 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090559.1 protein_id gnl|my_center|LOCUS_09650 99221 100120 gene locus_tag LOCUS_09660 99221 100120 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122363.1 protein_id gnl|my_center|LOCUS_09660 100246 100899 gene locus_tag LOCUS_09670 100246 100899 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_09670 101069 102061 gene locus_tag LOCUS_09680 101069 102061 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142928.1 protein_id gnl|my_center|LOCUS_09680 102215 102478 gene locus_tag LOCUS_09690 102215 102478 CDS product antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z4V7 protein_id gnl|my_center|LOCUS_09690 >Feature sequence011 1108 260 gene locus_tag LOCUS_09700 1108 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_09700 4840 1292 gene locus_tag LOCUS_09710 4840 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 5091 5345 gene locus_tag LOCUS_09720 5091 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7184 5862 gene locus_tag LOCUS_09730 7184 5862 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143095.1 protein_id gnl|my_center|LOCUS_09730 8149 7874 gene locus_tag LOCUS_09740 8149 7874 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_09740 9706 8402 gene locus_tag LOCUS_09750 gene thrC 9706 8402 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056826.1 protein_id gnl|my_center|LOCUS_09750 10191 10487 gene locus_tag LOCUS_09760 10191 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 10582 11817 gene locus_tag LOCUS_09770 10582 11817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 11826 12182 gene locus_tag LOCUS_09780 11826 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 12155 12334 gene locus_tag LOCUS_09790 12155 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 12469 13257 gene locus_tag LOCUS_09800 12469 13257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 13250 14332 gene locus_tag LOCUS_09810 13250 14332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 14842 14534 gene locus_tag LOCUS_09820 14842 14534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 15357 15596 gene locus_tag LOCUS_09830 15357 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 15593 15856 gene locus_tag LOCUS_09840 15593 15856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 19833 16048 gene locus_tag LOCUS_09850 19833 16048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 19961 20416 gene locus_tag LOCUS_09860 19961 20416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 24822 20659 gene locus_tag LOCUS_09870 24822 20659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140727.1 protein_id gnl|my_center|LOCUS_09870 24931 25386 gene locus_tag LOCUS_09880 24931 25386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 25794 27227 gene locus_tag LOCUS_09890 25794 27227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 30864 27379 gene locus_tag LOCUS_09900 30864 27379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_09900 31805 32341 gene locus_tag LOCUS_09910 31805 32341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 32535 33011 gene locus_tag LOCUS_09920 32535 33011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 33089 34027 gene locus_tag LOCUS_09930 33089 34027 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122378.1 protein_id gnl|my_center|LOCUS_09930 34299 35057 gene locus_tag LOCUS_09940 34299 35057 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122379.1 protein_id gnl|my_center|LOCUS_09940 35150 35764 gene locus_tag LOCUS_09950 35150 35764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 35899 36666 gene locus_tag LOCUS_09960 35899 36666 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480002.1 protein_id gnl|my_center|LOCUS_09960 37031 36801 gene locus_tag LOCUS_09970 37031 36801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 37309 38466 gene locus_tag LOCUS_09980 gene gcvT 37309 38466 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFJ5 protein_id gnl|my_center|LOCUS_09980 38957 38565 gene locus_tag LOCUS_09990 38957 38565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144373.1 protein_id gnl|my_center|LOCUS_09990 39472 39086 gene locus_tag LOCUS_10000 39472 39086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057308.1 protein_id gnl|my_center|LOCUS_10000 40081 41607 gene locus_tag LOCUS_10010 40081 41607 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 protein_id gnl|my_center|LOCUS_10010 41678 43030 gene locus_tag LOCUS_10020 41678 43030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143184.1 protein_id gnl|my_center|LOCUS_10020 43211 43846 gene locus_tag LOCUS_10030 43211 43846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143183.1 protein_id gnl|my_center|LOCUS_10030 44589 44020 gene locus_tag LOCUS_10040 44589 44020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10040 46667 44751 gene locus_tag LOCUS_10050 gene glmS 46667 44751 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJI6 protein_id gnl|my_center|LOCUS_10050 47052 46807 gene locus_tag LOCUS_10060 gene psaC 47052 46807 CDS product photosystem I iron-sulfur center inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9R1 protein_id gnl|my_center|LOCUS_10060 48839 47334 gene locus_tag LOCUS_10070 48839 47334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 49872 49537 gene locus_tag LOCUS_10080 49872 49537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 50305 50027 gene locus_tag LOCUS_10090 50305 50027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 52107 50629 gene locus_tag LOCUS_10100 52107 50629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 54184 52370 gene locus_tag LOCUS_10110 54184 52370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 55023 54268 gene locus_tag LOCUS_10120 55023 54268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 56082 55549 gene locus_tag LOCUS_10130 56082 55549 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 protein_id gnl|my_center|LOCUS_10130 56282 57982 gene locus_tag LOCUS_10140 56282 57982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 58507 58244 gene locus_tag LOCUS_10150 58507 58244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 58658 60745 gene locus_tag LOCUS_10160 58658 60745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056981.1 protein_id gnl|my_center|LOCUS_10160 60818 61837 gene locus_tag LOCUS_10170 60818 61837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 62440 62793 gene locus_tag LOCUS_10180 62440 62793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 62870 63619 gene locus_tag LOCUS_10190 gene atpB 62870 63619 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP8 protein_id gnl|my_center|LOCUS_10190 63752 63997 gene locus_tag LOCUS_10200 gene atpE 63752 63997 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP7 protein_id gnl|my_center|LOCUS_10200 64099 64530 gene locus_tag LOCUS_10210 gene atpG 64099 64530 CDS product ATP synthase subunit b' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP6 protein_id gnl|my_center|LOCUS_10210 64764 65300 gene locus_tag LOCUS_10220 gene atpF 64764 65300 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP5 protein_id gnl|my_center|LOCUS_10220 65297 65851 gene locus_tag LOCUS_10230 gene atpH 65297 65851 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP4 protein_id gnl|my_center|LOCUS_10230 66026 67543 gene locus_tag LOCUS_10240 gene atpA 66026 67543 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP3 protein_id gnl|my_center|LOCUS_10240 67767 68717 gene locus_tag LOCUS_10250 gene atpG 67767 68717 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLU1 protein_id gnl|my_center|LOCUS_10250 68867 70018 gene locus_tag LOCUS_10260 68867 70018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 70367 71623 gene locus_tag LOCUS_10270 70367 71623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 71939 72865 gene locus_tag LOCUS_10280 71939 72865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 74171 73284 gene locus_tag LOCUS_10290 74171 73284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143303.1 protein_id gnl|my_center|LOCUS_10290 75142 74324 gene locus_tag LOCUS_10300 75142 74324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_10300 75341 76318 gene locus_tag LOCUS_10310 75341 76318 CDS product manganese ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143301.1 protein_id gnl|my_center|LOCUS_10310 77143 76376 gene locus_tag LOCUS_10320 77143 76376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 78865 77624 gene locus_tag LOCUS_10330 78865 77624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 78962 80581 gene locus_tag LOCUS_10340 78962 80581 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056013.1 protein_id gnl|my_center|LOCUS_10340 80791 81900 gene locus_tag LOCUS_10350 80791 81900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 84371 82080 gene locus_tag LOCUS_10360 84371 82080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 85831 84596 gene locus_tag LOCUS_10370 85831 84596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 86673 87494 gene locus_tag LOCUS_10380 86673 87494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 87961 87653 gene locus_tag LOCUS_10390 gene fer4 87961 87653 CDS product ferredoxin IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883007.1 protein_id gnl|my_center|LOCUS_10390 89227 88001 gene locus_tag LOCUS_10400 89227 88001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 91331 89646 gene locus_tag LOCUS_10410 91331 89646 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142825.1 protein_id gnl|my_center|LOCUS_10410 91842 91558 gene locus_tag LOCUS_10420 91842 91558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 96611 91860 gene locus_tag LOCUS_10430 96611 91860 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141955.1 protein_id gnl|my_center|LOCUS_10430 98542 96803 gene locus_tag LOCUS_10440 98542 96803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 99979 98618 gene locus_tag LOCUS_10450 99979 98618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119646.1 protein_id gnl|my_center|LOCUS_10450 101989 100145 gene locus_tag LOCUS_10460 101989 100145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence012 3158 2535 gene locus_tag LOCUS_10470 3158 2535 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056062.1 protein_id gnl|my_center|LOCUS_10470 3702 3926 gene locus_tag LOCUS_10480 3702 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4463 4654 gene locus_tag LOCUS_10490 4463 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 4959 6626 gene locus_tag LOCUS_10500 gene pyrG 4959 6626 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT7 protein_id gnl|my_center|LOCUS_10500 7508 7927 gene locus_tag LOCUS_10510 7508 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 9197 8373 gene locus_tag LOCUS_10520 9197 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143597.1 protein_id gnl|my_center|LOCUS_10520 11532 9586 gene locus_tag LOCUS_10530 11532 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 12568 11879 gene locus_tag LOCUS_10540 12568 11879 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_10540 13165 14364 gene locus_tag LOCUS_10550 13165 14364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 14575 16251 gene locus_tag LOCUS_10560 14575 16251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 16446 17192 gene locus_tag LOCUS_10570 16446 17192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 17275 18186 gene locus_tag LOCUS_10580 17275 18186 CDS product heterodisulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056823.1 protein_id gnl|my_center|LOCUS_10580 18775 18503 gene locus_tag LOCUS_10590 gene rpmA 18775 18503 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NME2 protein_id gnl|my_center|LOCUS_10590 19289 18852 gene locus_tag LOCUS_10600 gene rplU 19289 18852 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMF1 protein_id gnl|my_center|LOCUS_10600 19501 21054 gene locus_tag LOCUS_10610 19501 21054 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883980.1 protein_id gnl|my_center|LOCUS_10610 21102 21536 gene locus_tag LOCUS_10620 21102 21536 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_10620 21650 22462 gene locus_tag LOCUS_10630 21650 22462 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_10630 23613 22549 gene locus_tag LOCUS_10640 gene ccmA 23613 22549 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_10640 24071 24271 gene locus_tag LOCUS_10650 24071 24271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 24885 24376 gene locus_tag LOCUS_10660 24885 24376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 25190 24921 gene locus_tag LOCUS_10670 gene rpsO 25190 24921 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJL5 protein_id gnl|my_center|LOCUS_10670 25706 25251 gene locus_tag LOCUS_10680 25706 25251 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI8 protein_id gnl|my_center|LOCUS_10680 27072 25816 gene locus_tag LOCUS_10690 27072 25816 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056850.1 protein_id gnl|my_center|LOCUS_10690 27869 27567 gene locus_tag LOCUS_10700 27869 27567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 28127 30421 gene locus_tag LOCUS_10710 28127 30421 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056974.1 protein_id gnl|my_center|LOCUS_10710 32602 30551 gene locus_tag LOCUS_10720 32602 30551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 33139 33963 gene locus_tag LOCUS_10730 33139 33963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 34785 34243 gene locus_tag LOCUS_10740 34785 34243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 35134 35640 gene locus_tag LOCUS_10750 35134 35640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 36365 35667 gene locus_tag LOCUS_10760 36365 35667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 37440 36367 gene locus_tag LOCUS_10770 37440 36367 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_10770 38172 37441 gene locus_tag LOCUS_10780 38172 37441 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804111.1 protein_id gnl|my_center|LOCUS_10780 39725 38232 gene locus_tag LOCUS_10790 39725 38232 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726801.1 protein_id gnl|my_center|LOCUS_10790 41018 40485 gene locus_tag LOCUS_10800 41018 40485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 41283 43952 gene locus_tag LOCUS_10810 41283 43952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 44401 44072 gene locus_tag LOCUS_10820 gene rpsF 44401 44072 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNH7 protein_id gnl|my_center|LOCUS_10820 44928 45728 gene locus_tag LOCUS_10830 44928 45728 CDS product 5-oxo-1,2,5-tricarboxylic-3-penten acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057118.1 protein_id gnl|my_center|LOCUS_10830 46201 45725 gene locus_tag LOCUS_10840 gene ycf60 46201 45725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056916.1 protein_id gnl|my_center|LOCUS_10840 46540 46343 gene locus_tag LOCUS_10850 46540 46343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 47992 46736 gene locus_tag LOCUS_10860 47992 46736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 48860 50143 gene locus_tag LOCUS_10870 gene glyA 48860 50143 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH33 protein_id gnl|my_center|LOCUS_10870 50569 51819 gene locus_tag LOCUS_10880 50569 51819 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH31 protein_id gnl|my_center|LOCUS_10880 52412 51876 gene locus_tag LOCUS_10890 52412 51876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 53085 52441 gene locus_tag LOCUS_10900 53085 52441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 protein_id gnl|my_center|LOCUS_10900 53875 53147 gene locus_tag LOCUS_10910 53875 53147 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058197.1 protein_id gnl|my_center|LOCUS_10910 54080 55678 gene locus_tag LOCUS_10920 gene radA 54080 55678 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX9 protein_id gnl|my_center|LOCUS_10920 56545 55760 gene locus_tag LOCUS_10930 56545 55760 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 protein_id gnl|my_center|LOCUS_10930 57099 57845 gene locus_tag LOCUS_10940 57099 57845 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056437.1 protein_id gnl|my_center|LOCUS_10940 58269 59480 gene locus_tag LOCUS_10950 58269 59480 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_10950 59497 60804 gene locus_tag LOCUS_10960 59497 60804 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056769.1 protein_id gnl|my_center|LOCUS_10960 61401 62063 gene locus_tag LOCUS_10970 61401 62063 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM85 protein_id gnl|my_center|LOCUS_10970 62579 64252 gene locus_tag LOCUS_10980 62579 64252 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_10980 64638 66311 gene locus_tag LOCUS_10990 64638 66311 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_10990 66583 67173 gene locus_tag LOCUS_11000 66583 67173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 67429 67223 gene locus_tag LOCUS_11010 67429 67223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 67754 72562 gene locus_tag LOCUS_11020 67754 72562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 72574 72960 gene locus_tag LOCUS_11030 72574 72960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 72957 74345 gene locus_tag LOCUS_11040 72957 74345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 74716 74408 gene locus_tag LOCUS_11050 74716 74408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 74880 75806 gene locus_tag LOCUS_11060 74880 75806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 76938 75952 gene locus_tag LOCUS_11070 76938 75952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_11070 78296 77307 gene locus_tag LOCUS_11080 78296 77307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_11080 79799 78546 gene locus_tag LOCUS_11090 79799 78546 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082727.1 protein_id gnl|my_center|LOCUS_11090 80338 79967 gene locus_tag LOCUS_11100 80338 79967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 80887 80615 gene locus_tag LOCUS_11110 80887 80615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 81629 81333 gene locus_tag LOCUS_11120 81629 81333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 81985 81626 gene locus_tag LOCUS_11130 81985 81626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 84555 82486 gene locus_tag LOCUS_11140 84555 82486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551773.1 protein_id gnl|my_center|LOCUS_11140 86277 84616 gene locus_tag LOCUS_11150 86277 84616 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839957.1 protein_id gnl|my_center|LOCUS_11150 87294 86422 gene locus_tag LOCUS_11160 87294 86422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 88005 87460 gene locus_tag LOCUS_11170 88005 87460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 88815 89300 gene locus_tag LOCUS_11180 88815 89300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 89395 90414 gene locus_tag LOCUS_11190 89395 90414 CDS product hydroxyneurosporene-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726885.1 protein_id gnl|my_center|LOCUS_11190 91821 90535 gene locus_tag LOCUS_11200 gene gdhA 91821 90535 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P03 protein_id gnl|my_center|LOCUS_11200 91965 92555 gene locus_tag LOCUS_11210 91965 92555 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056727.1 protein_id gnl|my_center|LOCUS_11210 92924 92700 gene locus_tag LOCUS_11220 92924 92700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_11220 94407 93055 gene locus_tag LOCUS_11230 94407 93055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 95575 94544 gene locus_tag LOCUS_11240 95575 94544 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056913.1 protein_id gnl|my_center|LOCUS_11240 96025 96222 gene locus_tag LOCUS_11250 96025 96222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 96586 96960 gene locus_tag LOCUS_11260 96586 96960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 97057 97890 gene locus_tag LOCUS_11270 97057 97890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 98155 98649 gene locus_tag LOCUS_11280 98155 98649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_11280 99889 98726 gene locus_tag LOCUS_11290 gene hemH 99889 98726 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGU6 protein_id gnl|my_center|LOCUS_11290 99997 100623 gene locus_tag LOCUS_11300 99997 100623 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057443.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence013 1468 215 gene locus_tag LOCUS_11310 1468 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2281 1502 gene locus_tag LOCUS_11320 2281 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2939 3142 gene locus_tag LOCUS_11330 2939 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 3163 3501 gene locus_tag LOCUS_11340 3163 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4023 5168 gene locus_tag LOCUS_11350 4023 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 6866 5262 gene locus_tag LOCUS_11360 6866 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141449.1 protein_id gnl|my_center|LOCUS_11360 7392 8324 gene locus_tag LOCUS_11370 7392 8324 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_11370 8699 9817 gene locus_tag LOCUS_11380 8699 9817 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 protein_id gnl|my_center|LOCUS_11380 11809 9866 gene locus_tag LOCUS_11390 11809 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 12213 11953 gene locus_tag LOCUS_11400 12213 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 12436 13875 gene locus_tag LOCUS_11410 12436 13875 CDS product nucleoside:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_11410 13974 14600 gene locus_tag LOCUS_11420 13974 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 15459 16646 gene locus_tag LOCUS_11430 15459 16646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 16780 17922 gene locus_tag LOCUS_11440 gene b3791 16780 17922 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176203.1 protein_id gnl|my_center|LOCUS_11440 18546 19574 gene locus_tag LOCUS_11450 18546 19574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 21516 19792 gene locus_tag LOCUS_11460 21516 19792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 21884 23611 gene locus_tag LOCUS_11470 21884 23611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 23786 24829 gene locus_tag LOCUS_11480 23786 24829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 25244 26467 gene locus_tag LOCUS_11490 25244 26467 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061719.1 protein_id gnl|my_center|LOCUS_11490 27088 29280 gene locus_tag LOCUS_11500 27088 29280 CDS product succinoglycan transporter ExoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057604.1 protein_id gnl|my_center|LOCUS_11500 29746 31011 gene locus_tag LOCUS_11510 29746 31011 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_11510 31243 32103 gene locus_tag LOCUS_11520 31243 32103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 32246 33604 gene locus_tag LOCUS_11530 32246 33604 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 protein_id gnl|my_center|LOCUS_11530 33767 34564 gene locus_tag LOCUS_11540 33767 34564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 34798 36213 gene locus_tag LOCUS_11550 34798 36213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 36396 37406 gene locus_tag LOCUS_11560 36396 37406 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_11560 37719 38306 gene locus_tag LOCUS_11570 37719 38306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 38419 38940 gene locus_tag LOCUS_11580 38419 38940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 39924 41399 gene locus_tag LOCUS_11590 39924 41399 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_11590 41442 42635 gene locus_tag LOCUS_11600 41442 42635 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837503.1 protein_id gnl|my_center|LOCUS_11600 42676 43113 gene locus_tag LOCUS_11610 42676 43113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 44699 46156 gene locus_tag LOCUS_11620 44699 46156 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_11620 46549 47007 gene locus_tag LOCUS_11630 46549 47007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 48005 47022 gene locus_tag LOCUS_11640 48005 47022 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705561.1 protein_id gnl|my_center|LOCUS_11640 49380 48172 gene locus_tag LOCUS_11650 49380 48172 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143013.1 protein_id gnl|my_center|LOCUS_11650 49887 49417 gene locus_tag LOCUS_11660 49887 49417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 51540 52673 gene locus_tag LOCUS_11670 gene cofH 51540 52673 CDS product FO synthase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DII8 protein_id gnl|my_center|LOCUS_11670 52849 54564 gene locus_tag LOCUS_11680 52849 54564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057437.1 protein_id gnl|my_center|LOCUS_11680 55966 54704 gene locus_tag LOCUS_11690 gene metK 55966 54704 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK88 protein_id gnl|my_center|LOCUS_11690 57574 56420 gene locus_tag LOCUS_11700 57574 56420 CDS product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125189.1 protein_id gnl|my_center|LOCUS_11700 58530 59843 gene locus_tag LOCUS_11710 gene thrA 58530 59843 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM46 protein_id gnl|my_center|LOCUS_11710 60061 61251 gene locus_tag LOCUS_11720 60061 61251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 62255 64402 gene locus_tag LOCUS_11730 62255 64402 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412557.1 protein_id gnl|my_center|LOCUS_11730 64641 66134 gene locus_tag LOCUS_11740 64641 66134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900521.1 protein_id gnl|my_center|LOCUS_11740 67606 66635 gene locus_tag LOCUS_11750 gene sds 67606 66635 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_11750 71102 69096 gene locus_tag LOCUS_11760 71102 69096 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS5 protein_id gnl|my_center|LOCUS_11760 72739 71486 gene locus_tag LOCUS_11770 72739 71486 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS4 protein_id gnl|my_center|LOCUS_11770 73063 72800 gene locus_tag LOCUS_11780 gene acpP 73063 72800 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS3 protein_id gnl|my_center|LOCUS_11780 74477 75142 gene locus_tag LOCUS_11790 74477 75142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 77316 75535 gene locus_tag LOCUS_11800 77316 75535 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP1 protein_id gnl|my_center|LOCUS_11800 79147 77771 gene locus_tag LOCUS_11810 79147 77771 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_11810 79500 79646 gene locus_tag LOCUS_11820 gene hli4 79500 79646 CDS product high light inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 protein_id gnl|my_center|LOCUS_11820 80884 80066 gene locus_tag LOCUS_11830 80884 80066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 81133 80975 gene locus_tag LOCUS_11840 81133 80975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 82895 81354 gene locus_tag LOCUS_11850 gene purH 82895 81354 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN5 protein_id gnl|my_center|LOCUS_11850 83915 83421 gene locus_tag LOCUS_11860 gene psaF 83915 83421 CDS product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A401 protein_id gnl|my_center|LOCUS_11860 84067 85113 gene locus_tag LOCUS_11870 gene tsaD 84067 85113 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI9 protein_id gnl|my_center|LOCUS_11870 85328 85253 gene locus_tag LOCUS_t00050 85328 85253 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 85459 86328 gene locus_tag LOCUS_11880 gene lipA1 85459 86328 CDS product lipoyl synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL83 protein_id gnl|my_center|LOCUS_11880 86377 87288 gene locus_tag LOCUS_11890 gene gpsA 86377 87288 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF59 protein_id gnl|my_center|LOCUS_11890 88232 89482 gene locus_tag LOCUS_11900 88232 89482 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEW6 protein_id gnl|my_center|LOCUS_11900 90899 89709 gene locus_tag LOCUS_11910 90899 89709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 91083 91961 gene locus_tag LOCUS_11920 91083 91961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 92187 92011 gene locus_tag LOCUS_11930 92187 92011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 92855 92388 gene locus_tag LOCUS_11940 92855 92388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 94645 93131 gene locus_tag LOCUS_11950 gene ycf46 94645 93131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_11950 95411 94896 gene locus_tag LOCUS_11960 95411 94896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055932.1 protein_id gnl|my_center|LOCUS_11960 96090 95596 gene locus_tag LOCUS_11970 96090 95596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056447.1 protein_id gnl|my_center|LOCUS_11970 97266 96097 gene locus_tag LOCUS_11980 gene yidC 97266 96097 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL96 protein_id gnl|my_center|LOCUS_11980 97870 97475 gene locus_tag LOCUS_11990 97870 97475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11990 98267 97860 gene locus_tag LOCUS_12000 98267 97860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence014 579 349 gene locus_tag LOCUS_12010 579 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1087 2583 gene locus_tag LOCUS_12020 1087 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143058.1 protein_id gnl|my_center|LOCUS_12020 4688 3048 gene locus_tag LOCUS_12030 4688 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_12030 8159 4998 gene locus_tag LOCUS_12040 8159 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 8352 10148 gene locus_tag LOCUS_12050 8352 10148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 10771 11757 gene locus_tag LOCUS_12060 gene thrB 10771 11757 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI27 protein_id gnl|my_center|LOCUS_12060 12012 13625 gene locus_tag LOCUS_12070 gene ndhD2 12012 13625 CDS product NAD(P)H-quinone oxidoreductase chain 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHX4 protein_id gnl|my_center|LOCUS_12070 14669 13902 gene locus_tag LOCUS_12080 14669 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 14805 15107 gene locus_tag LOCUS_12090 14805 15107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 15275 16081 gene locus_tag LOCUS_12100 15275 16081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 16301 17485 gene locus_tag LOCUS_12110 16301 17485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 17757 18431 gene locus_tag LOCUS_12120 17757 18431 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FV9 protein_id gnl|my_center|LOCUS_12120 18631 19137 gene locus_tag LOCUS_12130 18631 19137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 19600 19232 gene locus_tag LOCUS_12140 19600 19232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 21489 19744 gene locus_tag LOCUS_12150 21489 19744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 21834 22007 gene locus_tag LOCUS_12160 21834 22007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 22452 23864 gene locus_tag LOCUS_12170 22452 23864 CDS product reverse transcriptase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_12170 24718 24005 gene locus_tag LOCUS_12180 24718 24005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 25603 24923 gene locus_tag LOCUS_12190 25603 24923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 26685 26005 gene locus_tag LOCUS_12200 26685 26005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 27876 27013 gene locus_tag LOCUS_12210 27876 27013 CDS product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_12210 28110 29378 gene locus_tag LOCUS_12220 28110 29378 CDS product Na+-transporting ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056159.1 protein_id gnl|my_center|LOCUS_12220 29504 30199 gene locus_tag LOCUS_12230 29504 30199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056267.1 protein_id gnl|my_center|LOCUS_12230 31587 30196 gene locus_tag LOCUS_12240 31587 30196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 31687 33039 gene locus_tag LOCUS_12250 31687 33039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143055.1 protein_id gnl|my_center|LOCUS_12250 35153 33195 gene locus_tag LOCUS_12260 35153 33195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 36145 35207 gene locus_tag LOCUS_12270 36145 35207 CDS product alkylphosphonate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477713.1 protein_id gnl|my_center|LOCUS_12270 37583 39382 gene locus_tag LOCUS_12280 37583 39382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 41087 39864 gene locus_tag LOCUS_12290 41087 39864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 41998 41558 gene locus_tag LOCUS_12300 41998 41558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125638.1 protein_id gnl|my_center|LOCUS_12300 42060 42302 gene locus_tag LOCUS_12310 42060 42302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 42550 43383 gene locus_tag LOCUS_12320 42550 43383 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528424.1 protein_id gnl|my_center|LOCUS_12320 45049 43868 gene locus_tag LOCUS_12330 45049 43868 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021990.1 protein_id gnl|my_center|LOCUS_12330 45675 46067 gene locus_tag LOCUS_12340 45675 46067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 49904 46134 gene locus_tag LOCUS_12350 gene oplaH 49904 46134 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_12350 50467 50147 gene locus_tag LOCUS_12360 50467 50147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 50967 50545 gene locus_tag LOCUS_12370 50967 50545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 51274 50948 gene locus_tag LOCUS_12380 51274 50948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 51895 52260 gene locus_tag LOCUS_12390 51895 52260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 52402 54903 gene locus_tag LOCUS_12400 52402 54903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 55795 54929 gene locus_tag LOCUS_12410 55795 54929 CDS product S-adenosyl-L-methionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQ31 protein_id gnl|my_center|LOCUS_12410 56547 55825 gene locus_tag LOCUS_12420 56547 55825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 56882 57481 gene locus_tag LOCUS_12430 56882 57481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 57645 58292 gene locus_tag LOCUS_12440 gene msrA 57645 58292 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_12440 58451 60127 gene locus_tag LOCUS_12450 58451 60127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142737.1 protein_id gnl|my_center|LOCUS_12450 60648 60160 gene locus_tag LOCUS_12460 60648 60160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 62083 60743 gene locus_tag LOCUS_12470 62083 60743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 64461 63145 gene locus_tag LOCUS_12480 64461 63145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 67395 65761 gene locus_tag LOCUS_12490 67395 65761 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_12490 69560 67842 gene locus_tag LOCUS_12500 gene lysS 69560 67842 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA9 protein_id gnl|my_center|LOCUS_12500 70073 71395 gene locus_tag LOCUS_12510 70073 71395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140919.1 protein_id gnl|my_center|LOCUS_12510 71532 72380 gene locus_tag LOCUS_12520 gene minC 71532 72380 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ40 protein_id gnl|my_center|LOCUS_12520 72377 73171 gene locus_tag LOCUS_12530 gene minD 72377 73171 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE2 protein_id gnl|my_center|LOCUS_12530 73247 73600 gene locus_tag LOCUS_12540 73247 73600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 73920 75368 gene locus_tag LOCUS_12550 gene atpD 73920 75368 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG8 protein_id gnl|my_center|LOCUS_12550 75697 76107 gene locus_tag LOCUS_12560 gene atpC 75697 76107 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG7 protein_id gnl|my_center|LOCUS_12560 76680 76381 gene locus_tag LOCUS_12570 76680 76381 CDS product putative 30S ribosomal protein PSRP-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59327 protein_id gnl|my_center|LOCUS_12570 76852 77673 gene locus_tag LOCUS_12580 76852 77673 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056155.1 protein_id gnl|my_center|LOCUS_12580 78677 77850 gene locus_tag LOCUS_12590 gene ugpE 78677 77850 CDS product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92WV5 protein_id gnl|my_center|LOCUS_12590 79648 78692 gene locus_tag LOCUS_12600 79648 78692 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_12600 80815 79652 gene locus_tag LOCUS_12610 80815 79652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 82598 83650 gene locus_tag LOCUS_12620 82598 83650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 84610 83789 gene locus_tag LOCUS_12630 84610 83789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 protein_id gnl|my_center|LOCUS_12630 85779 84688 gene locus_tag LOCUS_12640 gene ruvB 85779 84688 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGP9 protein_id gnl|my_center|LOCUS_12640 85821 86591 gene locus_tag LOCUS_12650 gene hisF 85821 86591 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN7 protein_id gnl|my_center|LOCUS_12650 86718 86930 gene locus_tag LOCUS_12660 86718 86930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 87008 87080 gene locus_tag LOCUS_t00060 87008 87080 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 88786 87986 gene locus_tag LOCUS_12670 88786 87986 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_12670 89408 90520 gene locus_tag LOCUS_12680 89408 90520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 91086 90580 gene locus_tag LOCUS_12690 91086 90580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 91695 91150 gene locus_tag LOCUS_12700 91695 91150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 92620 92441 gene locus_tag LOCUS_12710 92620 92441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 93241 94653 gene locus_tag LOCUS_12720 93241 94653 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528760.1 protein_id gnl|my_center|LOCUS_12720 95888 94893 gene locus_tag LOCUS_12730 gene ilvC 95888 94893 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR0 protein_id gnl|my_center|LOCUS_12730 96476 96769 gene locus_tag LOCUS_12740 gene petF 96476 96769 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143612.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence015 1877 489 gene locus_tag LOCUS_12750 1877 489 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H18 protein_id gnl|my_center|LOCUS_12750 4597 2942 gene locus_tag LOCUS_12760 gene ppx 4597 2942 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057517.1 protein_id gnl|my_center|LOCUS_12760 4775 5656 gene locus_tag LOCUS_12770 gene ubiA 4775 5656 CDS product 4-hydroxybenzoate solanesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFU6 protein_id gnl|my_center|LOCUS_12770 6120 6551 gene locus_tag LOCUS_12780 6120 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 7130 6783 gene locus_tag LOCUS_12790 gene rbcS 7130 6783 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057344.1 protein_id gnl|my_center|LOCUS_12790 7604 7215 gene locus_tag LOCUS_12800 gene rbcX 7604 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142154.1 protein_id gnl|my_center|LOCUS_12800 9456 8026 gene locus_tag LOCUS_12810 gene cbbL 9456 8026 CDS product ribulose bisphosphate carboxylase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS5 protein_id gnl|my_center|LOCUS_12810 10271 11194 gene locus_tag LOCUS_12820 10271 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 12135 11410 gene locus_tag LOCUS_12830 12135 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 12244 12849 gene locus_tag LOCUS_12840 gene cobU 12244 12849 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 protein_id gnl|my_center|LOCUS_12840 12963 13385 gene locus_tag LOCUS_12850 12963 13385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057567.1 protein_id gnl|my_center|LOCUS_12850 15042 13594 gene locus_tag LOCUS_12860 15042 13594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 15546 15118 gene locus_tag LOCUS_12870 15546 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 17093 15621 gene locus_tag LOCUS_12880 17093 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 18796 17372 gene locus_tag LOCUS_12890 18796 17372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 19707 20516 gene locus_tag LOCUS_12900 gene dltE 19707 20516 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_12900 20691 21983 gene locus_tag LOCUS_12910 20691 21983 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226936.1 protein_id gnl|my_center|LOCUS_12910 22302 24059 gene locus_tag LOCUS_12920 22302 24059 CDS product putative peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704637.1 protein_id gnl|my_center|LOCUS_12920 24900 24202 gene locus_tag LOCUS_12930 24900 24202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 25379 24921 gene locus_tag LOCUS_12940 25379 24921 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125731.1 protein_id gnl|my_center|LOCUS_12940 25665 26285 gene locus_tag LOCUS_12950 25665 26285 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144323.1 protein_id gnl|my_center|LOCUS_12950 26348 27313 gene locus_tag LOCUS_12960 26348 27313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 27551 27796 gene locus_tag LOCUS_12970 27551 27796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 28579 27899 gene locus_tag LOCUS_12980 28579 27899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 28880 28671 gene locus_tag LOCUS_12990 28880 28671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 30613 29408 gene locus_tag LOCUS_13000 30613 29408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057682.1 protein_id gnl|my_center|LOCUS_13000 31981 31058 gene locus_tag LOCUS_13010 31981 31058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 34013 33054 gene locus_tag LOCUS_13020 34013 33054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056713.1 protein_id gnl|my_center|LOCUS_13020 34880 35218 gene locus_tag LOCUS_13030 34880 35218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 36125 35610 gene locus_tag LOCUS_13040 36125 35610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140118.1 protein_id gnl|my_center|LOCUS_13040 38650 36422 gene locus_tag LOCUS_13050 38650 36422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 38822 39025 gene locus_tag LOCUS_13060 38822 39025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 39128 40345 gene locus_tag LOCUS_13070 gene ispG 39128 40345 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK70 protein_id gnl|my_center|LOCUS_13070 41329 40526 gene locus_tag LOCUS_13080 41329 40526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_13080 42324 41512 gene locus_tag LOCUS_13090 42324 41512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 42543 45785 gene locus_tag LOCUS_13100 gene pyrA 42543 45785 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI5 protein_id gnl|my_center|LOCUS_13100 46479 46021 gene locus_tag LOCUS_13110 46479 46021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141996.1 protein_id gnl|my_center|LOCUS_13110 46955 46755 gene locus_tag LOCUS_13120 46955 46755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 47200 47595 gene locus_tag LOCUS_13130 47200 47595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 48062 47865 gene locus_tag LOCUS_13140 48062 47865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 48559 53913 gene locus_tag LOCUS_13150 48559 53913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 53943 54287 gene locus_tag LOCUS_13160 53943 54287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 54379 56067 gene locus_tag LOCUS_13170 54379 56067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 57188 56097 gene locus_tag LOCUS_13180 gene hrcA 57188 56097 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU4 protein_id gnl|my_center|LOCUS_13180 57909 57550 gene locus_tag LOCUS_13190 57909 57550 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055899.1 protein_id gnl|my_center|LOCUS_13190 58445 58912 gene locus_tag LOCUS_13200 58445 58912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 58969 59733 gene locus_tag LOCUS_13210 gene cysE 58969 59733 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK8 protein_id gnl|my_center|LOCUS_13210 60421 59816 gene locus_tag LOCUS_13220 60421 59816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 60618 60836 gene locus_tag LOCUS_13230 60618 60836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144012.1 protein_id gnl|my_center|LOCUS_13230 61160 61441 gene locus_tag LOCUS_13240 61160 61441 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_13240 62682 61600 gene locus_tag LOCUS_13250 gene pfkA 62682 61600 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ7 protein_id gnl|my_center|LOCUS_13250 62927 64006 gene locus_tag LOCUS_13260 gene fbp 62927 64006 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF2 protein_id gnl|my_center|LOCUS_13260 64132 65286 gene locus_tag LOCUS_13270 gene tal 64132 65286 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFZ7 protein_id gnl|my_center|LOCUS_13270 65487 67016 gene locus_tag LOCUS_13280 gene zwf 65487 67016 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF3 protein_id gnl|my_center|LOCUS_13280 67084 68439 gene locus_tag LOCUS_13290 gene opcA 67084 68439 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 protein_id gnl|my_center|LOCUS_13290 68583 69992 gene locus_tag LOCUS_13300 gene cobB 68583 69992 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057685.1 protein_id gnl|my_center|LOCUS_13300 71599 70004 gene locus_tag LOCUS_13310 71599 70004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 71762 73069 gene locus_tag LOCUS_13320 gene glcE 71762 73069 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143064.1 protein_id gnl|my_center|LOCUS_13320 73342 74682 gene locus_tag LOCUS_13330 gene glcF 73342 74682 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCA7 protein_id gnl|my_center|LOCUS_13330 75150 74707 gene locus_tag LOCUS_13340 75150 74707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 75232 75519 gene locus_tag LOCUS_13350 75232 75519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 75974 75528 gene locus_tag LOCUS_13360 75974 75528 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142402.1 protein_id gnl|my_center|LOCUS_13360 77956 76568 gene locus_tag LOCUS_13370 77956 76568 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKB7 protein_id gnl|my_center|LOCUS_13370 78421 78915 gene locus_tag LOCUS_13380 gene apcD 78421 78915 CDS product allophycocyanin-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057391.1 protein_id gnl|my_center|LOCUS_13380 79323 79745 gene locus_tag LOCUS_13390 79323 79745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 80815 80015 gene locus_tag LOCUS_13400 80815 80015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058196.1 protein_id gnl|my_center|LOCUS_13400 83798 80859 gene locus_tag LOCUS_13410 83798 80859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 84000 84596 gene locus_tag LOCUS_13420 gene recR 84000 84596 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGV8 protein_id gnl|my_center|LOCUS_13420 85513 84962 gene locus_tag LOCUS_13430 85513 84962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 86723 85971 gene locus_tag LOCUS_13440 86723 85971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_13440 86960 90178 gene locus_tag LOCUS_13450 gene ppc 86960 90178 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X5 protein_id gnl|my_center|LOCUS_13450 91394 90294 gene locus_tag LOCUS_13460 91394 90294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 91554 92333 gene locus_tag LOCUS_13470 gene ycf23 91554 92333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence016 1559 147 gene locus_tag LOCUS_13480 1559 147 CDS product 2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097917.1 protein_id gnl|my_center|LOCUS_13480 2520 1618 gene locus_tag LOCUS_13490 2520 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 3565 2765 gene locus_tag LOCUS_13500 gene pstB 3565 2765 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E68 protein_id gnl|my_center|LOCUS_13500 4521 3559 gene locus_tag LOCUS_13510 4521 3559 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPP5 protein_id gnl|my_center|LOCUS_13510 5858 4929 gene locus_tag LOCUS_13520 gene pstC 5858 4929 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E66 protein_id gnl|my_center|LOCUS_13520 7201 6248 gene locus_tag LOCUS_13530 7201 6248 CDS product protein sphX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_13530 7722 8858 gene locus_tag LOCUS_13540 7722 8858 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_13540 9132 10004 gene locus_tag LOCUS_13550 9132 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 10079 10960 gene locus_tag LOCUS_13560 10079 10960 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058143.1 protein_id gnl|my_center|LOCUS_13560 10980 11303 gene locus_tag LOCUS_13570 10980 11303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 11816 12361 gene locus_tag LOCUS_13580 11816 12361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 12998 12561 gene locus_tag LOCUS_13590 12998 12561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143940.1 protein_id gnl|my_center|LOCUS_13590 13458 13652 gene locus_tag LOCUS_13600 13458 13652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 14011 15030 gene locus_tag LOCUS_13610 14011 15030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 15229 15993 gene locus_tag LOCUS_13620 15229 15993 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_13620 16388 17566 gene locus_tag LOCUS_13630 16388 17566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 17886 18737 gene locus_tag LOCUS_13640 17886 18737 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_13640 20334 19093 gene locus_tag LOCUS_13650 gene argJ 20334 19093 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN4 protein_id gnl|my_center|LOCUS_13650 22129 20642 gene locus_tag LOCUS_13660 gene gatB 22129 20642 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC4 protein_id gnl|my_center|LOCUS_13660 22848 23063 gene locus_tag LOCUS_13670 22848 23063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 24410 23187 gene locus_tag LOCUS_13680 24410 23187 CDS product succinyldiaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143457.1 protein_id gnl|my_center|LOCUS_13680 24832 24503 gene locus_tag LOCUS_13690 gene trx 24832 24503 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEH0 protein_id gnl|my_center|LOCUS_13690 25551 25198 gene locus_tag LOCUS_13700 25551 25198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057714.1 protein_id gnl|my_center|LOCUS_13700 27233 25707 gene locus_tag LOCUS_13710 27233 25707 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057713.1 protein_id gnl|my_center|LOCUS_13710 27698 27351 gene locus_tag LOCUS_13720 27698 27351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057712.1 protein_id gnl|my_center|LOCUS_13720 29107 28373 gene locus_tag LOCUS_13730 29107 28373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058104.1 protein_id gnl|my_center|LOCUS_13730 29255 30010 gene locus_tag LOCUS_13740 29255 30010 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL42 protein_id gnl|my_center|LOCUS_13740 30042 30830 gene locus_tag LOCUS_13750 30042 30830 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_13750 32864 31356 gene locus_tag LOCUS_13760 32864 31356 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ1 protein_id gnl|my_center|LOCUS_13760 35480 33123 gene locus_tag LOCUS_13770 35480 33123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 36128 36457 gene locus_tag LOCUS_13780 36128 36457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 36509 37087 gene locus_tag LOCUS_13790 36509 37087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 38071 37262 gene locus_tag LOCUS_13800 38071 37262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 39126 38326 gene locus_tag LOCUS_13810 39126 38326 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392510.1 protein_id gnl|my_center|LOCUS_13810 40074 39241 gene locus_tag LOCUS_13820 40074 39241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 41128 42018 gene locus_tag LOCUS_13830 gene lgt 41128 42018 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH03 protein_id gnl|my_center|LOCUS_13830 44420 42402 gene locus_tag LOCUS_13840 44420 42402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 45838 44612 gene locus_tag LOCUS_13850 45838 44612 CDS product glycine/betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356523.1 protein_id gnl|my_center|LOCUS_13850 46644 45949 gene locus_tag LOCUS_13860 46644 45949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_13860 49212 47266 gene locus_tag LOCUS_13870 49212 47266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 50273 49254 gene locus_tag LOCUS_13880 50273 49254 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG6 protein_id gnl|my_center|LOCUS_13880 50486 51028 gene locus_tag LOCUS_13890 50486 51028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 52249 51236 gene locus_tag LOCUS_13900 52249 51236 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG6 protein_id gnl|my_center|LOCUS_13900 52545 52724 gene locus_tag LOCUS_13910 52545 52724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 53282 53716 gene locus_tag LOCUS_13920 53282 53716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 54310 54987 gene locus_tag LOCUS_13930 54310 54987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 55704 56678 gene locus_tag LOCUS_13940 55704 56678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 58022 56943 gene locus_tag LOCUS_13950 58022 56943 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140208.1 protein_id gnl|my_center|LOCUS_13950 58199 59266 gene locus_tag LOCUS_13960 58199 59266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057303.1 protein_id gnl|my_center|LOCUS_13960 59472 60158 gene locus_tag LOCUS_13970 59472 60158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 60251 60697 gene locus_tag LOCUS_13980 60251 60697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 60819 61529 gene locus_tag LOCUS_13990 60819 61529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 61691 63019 gene locus_tag LOCUS_14000 61691 63019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994245.1 protein_id gnl|my_center|LOCUS_14000 63022 63648 gene locus_tag LOCUS_14010 63022 63648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_14010 63845 64267 gene locus_tag LOCUS_14020 63845 64267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 64495 65202 gene locus_tag LOCUS_14030 64495 65202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 65698 65357 gene locus_tag LOCUS_14040 65698 65357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14040 66376 65882 gene locus_tag LOCUS_14050 66376 65882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 67395 66382 gene locus_tag LOCUS_14060 67395 66382 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5M7 protein_id gnl|my_center|LOCUS_14060 72288 67579 gene locus_tag LOCUS_14070 72288 67579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 73634 72285 gene locus_tag LOCUS_14080 73634 72285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 74221 74508 gene locus_tag LOCUS_14090 74221 74508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 75074 75490 gene locus_tag LOCUS_14100 75074 75490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 75987 75634 gene locus_tag LOCUS_14110 75987 75634 CDS product phenylpyruvate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125356.1 protein_id gnl|my_center|LOCUS_14110 76821 76336 gene locus_tag LOCUS_14120 76821 76336 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125105.1 protein_id gnl|my_center|LOCUS_14120 77370 76927 gene locus_tag LOCUS_14130 77370 76927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143557.1 protein_id gnl|my_center|LOCUS_14130 78191 77394 gene locus_tag LOCUS_14140 gene cobM 78191 77394 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141377.1 protein_id gnl|my_center|LOCUS_14140 78725 78369 gene locus_tag LOCUS_14150 78725 78369 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057146.1 protein_id gnl|my_center|LOCUS_14150 79844 78753 gene locus_tag LOCUS_14160 gene ychF 79844 78753 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ8 protein_id gnl|my_center|LOCUS_14160 80289 80801 gene locus_tag LOCUS_14170 gene ycf51 80289 80801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056935.1 protein_id gnl|my_center|LOCUS_14170 81662 80880 gene locus_tag LOCUS_14180 81662 80880 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_14180 81979 81707 gene locus_tag LOCUS_14190 81979 81707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 82468 83595 gene locus_tag LOCUS_14200 gene wecE 82468 83595 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124471.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence017 1075 203 gene locus_tag LOCUS_14210 1075 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3605 1164 gene locus_tag LOCUS_14220 3605 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056175.1 protein_id gnl|my_center|LOCUS_14220 4387 4022 gene locus_tag LOCUS_14230 4387 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_14230 4708 4926 gene locus_tag LOCUS_14240 4708 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 4919 6298 gene locus_tag LOCUS_14250 4919 6298 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_14250 6723 7553 gene locus_tag LOCUS_14260 6723 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_14260 7557 7922 gene locus_tag LOCUS_14270 7557 7922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 7940 8887 gene locus_tag LOCUS_14280 7940 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 9019 9327 gene locus_tag LOCUS_14290 9019 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 10715 9534 gene locus_tag LOCUS_14300 10715 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258404.1 protein_id gnl|my_center|LOCUS_14300 10886 12508 gene locus_tag LOCUS_14310 10886 12508 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG7 protein_id gnl|my_center|LOCUS_14310 13839 12622 gene locus_tag LOCUS_14320 13839 12622 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268208.1 protein_id gnl|my_center|LOCUS_14320 15342 13942 gene locus_tag LOCUS_14330 15342 13942 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 protein_id gnl|my_center|LOCUS_14330 17324 15702 gene locus_tag LOCUS_14340 17324 15702 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057178.1 protein_id gnl|my_center|LOCUS_14340 18105 18767 gene locus_tag LOCUS_14350 18105 18767 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143281.1 protein_id gnl|my_center|LOCUS_14350 19348 18887 gene locus_tag LOCUS_14360 19348 18887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 19571 19870 gene locus_tag LOCUS_14370 19571 19870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 19936 20178 gene locus_tag LOCUS_14380 19936 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 21723 20260 gene locus_tag LOCUS_14390 gene glcD 21723 20260 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_14390 22115 22774 gene locus_tag LOCUS_14400 22115 22774 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057925.1 protein_id gnl|my_center|LOCUS_14400 23336 23917 gene locus_tag LOCUS_14410 23336 23917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 24462 25370 gene locus_tag LOCUS_14420 24462 25370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 25904 25566 gene locus_tag LOCUS_14430 25904 25566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 protein_id gnl|my_center|LOCUS_14430 26399 26052 gene locus_tag LOCUS_14440 26399 26052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057537.1 protein_id gnl|my_center|LOCUS_14440 26861 28678 gene locus_tag LOCUS_14450 gene thrS 26861 28678 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW0 protein_id gnl|my_center|LOCUS_14450 29633 34426 gene locus_tag LOCUS_14460 29633 34426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 34759 34541 gene locus_tag LOCUS_14470 34759 34541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 36770 36201 gene locus_tag LOCUS_14480 36770 36201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_14480 37455 36886 gene locus_tag LOCUS_14490 37455 36886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_14490 37978 37640 gene locus_tag LOCUS_14500 37978 37640 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 protein_id gnl|my_center|LOCUS_14500 38389 40056 gene locus_tag LOCUS_14510 38389 40056 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056694.1 protein_id gnl|my_center|LOCUS_14510 40556 40092 gene locus_tag LOCUS_14520 40556 40092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 40890 41216 gene locus_tag LOCUS_14530 40890 41216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 42075 41392 gene locus_tag LOCUS_14540 42075 41392 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_14540 43392 42238 gene locus_tag LOCUS_14550 43392 42238 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056491.1 protein_id gnl|my_center|LOCUS_14550 44738 43425 gene locus_tag LOCUS_14560 44738 43425 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 protein_id gnl|my_center|LOCUS_14560 45656 45054 gene locus_tag LOCUS_14570 45656 45054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 48352 45734 gene locus_tag LOCUS_14580 48352 45734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 51105 48415 gene locus_tag LOCUS_14590 51105 48415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 52317 51157 gene locus_tag LOCUS_14600 52317 51157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 protein_id gnl|my_center|LOCUS_14600 53594 52524 gene locus_tag LOCUS_14610 gene hioM 53594 52524 CDS product hydroxyindole O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118446.1 protein_id gnl|my_center|LOCUS_14610 54064 53591 gene locus_tag LOCUS_14620 54064 53591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 59369 54165 gene locus_tag LOCUS_14630 59369 54165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 60843 59443 gene locus_tag LOCUS_14640 60843 59443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 61286 60969 gene locus_tag LOCUS_14650 61286 60969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 63147 61390 gene locus_tag LOCUS_14660 63147 61390 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_14660 67810 63188 gene locus_tag LOCUS_14670 67810 63188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 69685 67853 gene locus_tag LOCUS_14680 69685 67853 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_14680 72850 71546 gene locus_tag LOCUS_14690 72850 71546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 73819 74139 gene locus_tag LOCUS_14700 73819 74139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 74319 76271 gene locus_tag LOCUS_14710 74319 76271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 76513 77796 gene locus_tag LOCUS_14720 76513 77796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056681.1 protein_id gnl|my_center|LOCUS_14720 77890 78828 gene locus_tag LOCUS_14730 77890 78828 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_14730 79352 79080 gene locus_tag LOCUS_14740 79352 79080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 80202 81233 gene locus_tag LOCUS_14750 80202 81233 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence018 311 238 gene locus_tag LOCUS_t00070 311 238 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 551 1384 gene locus_tag LOCUS_14760 551 1384 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I583 protein_id gnl|my_center|LOCUS_14760 2245 1583 gene locus_tag LOCUS_14770 2245 1583 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_14770 2496 3851 gene locus_tag LOCUS_14780 2496 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4729 3959 gene locus_tag LOCUS_14790 4729 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 5004 6242 gene locus_tag LOCUS_14800 5004 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 7537 9144 gene locus_tag LOCUS_14810 7537 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 10649 15691 gene locus_tag LOCUS_14820 10649 15691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 19786 15950 gene locus_tag LOCUS_14830 19786 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 21182 21991 gene locus_tag LOCUS_14840 gene pstS 21182 21991 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_14840 22065 22826 gene locus_tag LOCUS_14850 gene pstC 22065 22826 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9I6 protein_id gnl|my_center|LOCUS_14850 22886 23824 gene locus_tag LOCUS_14860 22886 23824 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KN93 protein_id gnl|my_center|LOCUS_14860 23847 24671 gene locus_tag LOCUS_14870 23847 24671 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_14870 24851 25534 gene locus_tag LOCUS_14880 24851 25534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 25869 26654 gene locus_tag LOCUS_14890 25869 26654 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_14890 26975 27388 gene locus_tag LOCUS_14900 26975 27388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 27487 27882 gene locus_tag LOCUS_14910 27487 27882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 27920 28513 gene locus_tag LOCUS_14920 27920 28513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 28689 31475 gene locus_tag LOCUS_14930 28689 31475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 31743 32009 gene locus_tag LOCUS_14940 31743 32009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 32520 33194 gene locus_tag LOCUS_14950 32520 33194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 33236 34189 gene locus_tag LOCUS_14960 33236 34189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 34327 34869 gene locus_tag LOCUS_14970 34327 34869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 34893 35558 gene locus_tag LOCUS_14980 34893 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 37572 35575 gene locus_tag LOCUS_14990 37572 35575 CDS product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142261.1 protein_id gnl|my_center|LOCUS_14990 38580 37630 gene locus_tag LOCUS_15000 38580 37630 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759755.1 protein_id gnl|my_center|LOCUS_15000 39258 40337 gene locus_tag LOCUS_15010 gene ssuD 39258 40337 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HHJ0 protein_id gnl|my_center|LOCUS_15010 40535 41644 gene locus_tag LOCUS_15020 40535 41644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 41804 43159 gene locus_tag LOCUS_15030 gene dltB 41804 43159 CDS product membrane-bound O-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898728.1 protein_id gnl|my_center|LOCUS_15030 44448 43156 gene locus_tag LOCUS_15040 44448 43156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 45719 44490 gene locus_tag LOCUS_15050 45719 44490 CDS product BEC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088825.1 protein_id gnl|my_center|LOCUS_15050 49705 45902 gene locus_tag LOCUS_15060 49705 45902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 50371 50192 gene locus_tag LOCUS_15070 50371 50192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 51567 55277 gene locus_tag LOCUS_15080 51567 55277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 55655 56806 gene locus_tag LOCUS_15090 55655 56806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 57111 56866 gene locus_tag LOCUS_15100 57111 56866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 57379 57104 gene locus_tag LOCUS_15110 57379 57104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 58717 57752 gene locus_tag LOCUS_15120 58717 57752 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_15120 61572 59224 gene locus_tag LOCUS_15130 61572 59224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 62824 61841 gene locus_tag LOCUS_15140 62824 61841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 63545 62907 gene locus_tag LOCUS_15150 63545 62907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 64286 65797 gene locus_tag LOCUS_15160 gene pds 64286 65797 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057401.1 protein_id gnl|my_center|LOCUS_15160 66008 67147 gene locus_tag LOCUS_15170 gene nptA 66008 67147 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_15170 67690 67848 gene locus_tag LOCUS_15180 67690 67848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 68034 69191 gene locus_tag LOCUS_15190 68034 69191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 69311 70312 gene locus_tag LOCUS_15200 69311 70312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 70881 70447 gene locus_tag LOCUS_15210 70881 70447 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290819.1 protein_id gnl|my_center|LOCUS_15210 71976 71122 gene locus_tag LOCUS_15220 71976 71122 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_15220 72005 72415 gene locus_tag LOCUS_15230 72005 72415 CDS product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLK3 protein_id gnl|my_center|LOCUS_15230 74077 72638 gene locus_tag LOCUS_15240 74077 72638 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249070.1 protein_id gnl|my_center|LOCUS_15240 74754 74557 gene locus_tag LOCUS_15250 74754 74557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 74884 76173 gene locus_tag LOCUS_15260 74884 76173 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 protein_id gnl|my_center|LOCUS_15260 76793 76377 gene locus_tag LOCUS_15270 76793 76377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 77259 76843 gene locus_tag LOCUS_15280 77259 76843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 77907 77419 gene locus_tag LOCUS_15290 77907 77419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 80103 78178 gene locus_tag LOCUS_15300 80103 78178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence019 324 1526 gene locus_tag LOCUS_15310 324 1526 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056455.1 protein_id gnl|my_center|LOCUS_15310 2095 1547 gene locus_tag LOCUS_15320 gene aroK 2095 1547 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH7 protein_id gnl|my_center|LOCUS_15320 2841 3041 gene locus_tag LOCUS_15330 2841 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3858 3151 gene locus_tag LOCUS_15340 3858 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4657 4013 gene locus_tag LOCUS_15350 gene ubiX 4657 4013 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK39 protein_id gnl|my_center|LOCUS_15350 7152 4900 gene locus_tag LOCUS_15360 gene zam 7152 4900 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057710.1 protein_id gnl|my_center|LOCUS_15360 7369 7196 gene locus_tag LOCUS_15370 7369 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 8316 9125 gene locus_tag LOCUS_15380 8316 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 9674 9946 gene locus_tag LOCUS_15390 9674 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 12257 10290 gene locus_tag LOCUS_15400 12257 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 13547 12846 gene locus_tag LOCUS_15410 13547 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15410 14229 15050 gene locus_tag LOCUS_15420 14229 15050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057926.1 protein_id gnl|my_center|LOCUS_15420 15597 15196 gene locus_tag LOCUS_15430 15597 15196 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390954.1 protein_id gnl|my_center|LOCUS_15430 16274 18805 gene locus_tag LOCUS_15440 gene gyrA 16274 18805 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIY2 protein_id gnl|my_center|LOCUS_15440 19466 18774 gene locus_tag LOCUS_15450 19466 18774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 19688 21028 gene locus_tag LOCUS_15460 gene purA 19688 21028 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG2 protein_id gnl|my_center|LOCUS_15460 21176 21775 gene locus_tag LOCUS_15470 gene rplY 21176 21775 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNL2 protein_id gnl|my_center|LOCUS_15470 22083 23102 gene locus_tag LOCUS_15480 gene rbsK 22083 23102 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683574.1 protein_id gnl|my_center|LOCUS_15480 23246 24778 gene locus_tag LOCUS_15490 23246 24778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056133.1 protein_id gnl|my_center|LOCUS_15490 25084 24839 gene locus_tag LOCUS_15500 25084 24839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 25699 25400 gene locus_tag LOCUS_15510 25699 25400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 26406 27344 gene locus_tag LOCUS_15520 26406 27344 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_15520 27658 28380 gene locus_tag LOCUS_15530 27658 28380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 28377 28970 gene locus_tag LOCUS_15540 28377 28970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 29649 30167 gene locus_tag LOCUS_15550 29649 30167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 30626 30276 gene locus_tag LOCUS_15560 gene psb28 30626 30276 CDS product photosystem II reaction center Psb28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ8 protein_id gnl|my_center|LOCUS_15560 30835 31845 gene locus_tag LOCUS_15570 gene trpS 30835 31845 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHG3 protein_id gnl|my_center|LOCUS_15570 31875 32810 gene locus_tag LOCUS_15580 31875 32810 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI21 protein_id gnl|my_center|LOCUS_15580 34477 33065 gene locus_tag LOCUS_15590 34477 33065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 35328 35993 gene locus_tag LOCUS_15600 35328 35993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 36547 37176 gene locus_tag LOCUS_15610 36547 37176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 38081 37659 gene locus_tag LOCUS_15620 38081 37659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 38962 40614 gene locus_tag LOCUS_15630 38962 40614 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 protein_id gnl|my_center|LOCUS_15630 44857 40904 gene locus_tag LOCUS_15640 gene rpoC2 44857 40904 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL57 protein_id gnl|my_center|LOCUS_15640 47284 45407 gene locus_tag LOCUS_15650 gene rpoC1 47284 45407 CDS product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL56 protein_id gnl|my_center|LOCUS_15650 50735 47331 gene locus_tag LOCUS_15660 gene rpoB 50735 47331 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIA0 protein_id gnl|my_center|LOCUS_15660 52270 51458 gene locus_tag LOCUS_15670 gene tatD 52270 51458 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN5 protein_id gnl|my_center|LOCUS_15670 52700 52377 gene locus_tag LOCUS_15680 gene rpsT 52700 52377 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN4 protein_id gnl|my_center|LOCUS_15680 52974 54302 gene locus_tag LOCUS_15690 gene hisD 52974 54302 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR2 protein_id gnl|my_center|LOCUS_15690 55690 54422 gene locus_tag LOCUS_15700 55690 54422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_15700 57019 57243 gene locus_tag LOCUS_15710 gene cp12 57019 57243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057657.1 protein_id gnl|my_center|LOCUS_15710 57506 58099 gene locus_tag LOCUS_15720 57506 58099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057787.1 protein_id gnl|my_center|LOCUS_15720 58187 58507 gene locus_tag LOCUS_15730 58187 58507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 58890 60362 gene locus_tag LOCUS_15740 gene glmM 58890 60362 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI20 protein_id gnl|my_center|LOCUS_15740 61045 61557 gene locus_tag LOCUS_15750 61045 61557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 61639 63402 gene locus_tag LOCUS_15760 61639 63402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 63537 64550 gene locus_tag LOCUS_15770 63537 64550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 64568 65740 gene locus_tag LOCUS_15780 64568 65740 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_15780 67273 65867 gene locus_tag LOCUS_15790 67273 65867 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 protein_id gnl|my_center|LOCUS_15790 69292 67514 gene locus_tag LOCUS_15800 69292 67514 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_15800 70288 69512 gene locus_tag LOCUS_15810 70288 69512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 71798 70290 gene locus_tag LOCUS_15820 71798 70290 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_15820 72905 72135 gene locus_tag LOCUS_15830 72905 72135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141101.1 protein_id gnl|my_center|LOCUS_15830 74987 73167 gene locus_tag LOCUS_15840 74987 73167 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_15840 75418 77133 gene locus_tag LOCUS_15850 75418 77133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 77233 77394 gene locus_tag LOCUS_15860 77233 77394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 77645 79186 gene locus_tag LOCUS_15870 77645 79186 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence020 3406 23 gene locus_tag LOCUS_15880 3406 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 5999 8116 gene locus_tag LOCUS_15890 5999 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 9232 10464 gene locus_tag LOCUS_15900 9232 10464 CDS product devB secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_15900 10667 11839 gene locus_tag LOCUS_15910 10667 11839 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_15910 11912 12652 gene locus_tag LOCUS_15920 11912 12652 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_15920 12766 13047 gene locus_tag LOCUS_15930 12766 13047 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141953.1 protein_id gnl|my_center|LOCUS_15930 13103 17032 gene locus_tag LOCUS_15940 13103 17032 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142823.1 protein_id gnl|my_center|LOCUS_15940 17301 18422 gene locus_tag LOCUS_15950 gene pks11 17301 18422 CDS product alpha-pyrone synthesis polyketide synthase-like Pks11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPF3 protein_id gnl|my_center|LOCUS_15950 18433 19029 gene locus_tag LOCUS_15960 18433 19029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405935.1 protein_id gnl|my_center|LOCUS_15960 19026 20063 gene locus_tag LOCUS_15970 19026 20063 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_15970 20279 21292 gene locus_tag LOCUS_15980 gene stf3 20279 21292 CDS product PAPS-dependent sulfotransferase Stf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLG1 protein_id gnl|my_center|LOCUS_15980 21405 22364 gene locus_tag LOCUS_15990 21405 22364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 24357 23029 gene locus_tag LOCUS_16000 gene yojK 24357 23029 CDS product putative UDP-glucosyltransferase YojK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31853 protein_id gnl|my_center|LOCUS_16000 24982 24791 gene locus_tag LOCUS_16010 24982 24791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 25682 25533 gene locus_tag LOCUS_16020 25682 25533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 25650 26720 gene locus_tag LOCUS_16030 25650 26720 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056420.1 protein_id gnl|my_center|LOCUS_16030 26940 27473 gene locus_tag LOCUS_16040 26940 27473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056418.1 protein_id gnl|my_center|LOCUS_16040 27627 31034 gene locus_tag LOCUS_16050 27627 31034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 31092 34214 gene locus_tag LOCUS_16060 31092 34214 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056416.1 protein_id gnl|my_center|LOCUS_16060 34896 34477 gene locus_tag LOCUS_16070 34896 34477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 37295 35919 gene locus_tag LOCUS_16080 37295 35919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 38674 40191 gene locus_tag LOCUS_16090 38674 40191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 41619 40351 gene locus_tag LOCUS_16100 41619 40351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 42340 41783 gene locus_tag LOCUS_16110 42340 41783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 42523 42711 gene locus_tag LOCUS_16120 42523 42711 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143465.1 protein_id gnl|my_center|LOCUS_16120 42857 45754 gene locus_tag LOCUS_16130 42857 45754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 46268 45732 gene locus_tag LOCUS_16140 46268 45732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 46745 47125 gene locus_tag LOCUS_16150 46745 47125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 48582 47242 gene locus_tag LOCUS_16160 48582 47242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 49278 51500 gene locus_tag LOCUS_16170 gene psaA 49278 51500 CDS product photosystem I P700 chlorophyll a apoprotein A1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A405 protein_id gnl|my_center|LOCUS_16170 51675 53891 gene locus_tag LOCUS_16180 gene psaB 51675 53891 CDS product photosystem I P700 chlorophyll a apoprotein A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A407 protein_id gnl|my_center|LOCUS_16180 54455 56884 gene locus_tag LOCUS_16190 54455 56884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 57022 58182 gene locus_tag LOCUS_16200 gene corA 57022 58182 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 protein_id gnl|my_center|LOCUS_16200 59250 58348 gene locus_tag LOCUS_16210 59250 58348 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_16210 59605 59243 gene locus_tag LOCUS_16220 59605 59243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 60285 59986 gene locus_tag LOCUS_16230 60285 59986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 63164 61389 gene locus_tag LOCUS_16240 63164 61389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 64279 63179 gene locus_tag LOCUS_16250 64279 63179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 65671 64382 gene locus_tag LOCUS_16260 65671 64382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 68182 66260 gene locus_tag LOCUS_16270 68182 66260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 68343 68522 gene locus_tag LOCUS_16280 68343 68522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 70428 69475 gene locus_tag LOCUS_16290 70428 69475 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021382.1 protein_id gnl|my_center|LOCUS_16290 70863 72932 gene locus_tag LOCUS_16300 gene fus 70863 72932 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058192.1 protein_id gnl|my_center|LOCUS_16300 73303 73064 gene locus_tag LOCUS_16310 73303 73064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 74993 75643 gene locus_tag LOCUS_16320 74993 75643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 75771 76964 gene locus_tag LOCUS_16330 75771 76964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 77543 78589 gene locus_tag LOCUS_16340 77543 78589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence021 545 1795 gene locus_tag LOCUS_16350 545 1795 CDS product UPF0284 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGL0 protein_id gnl|my_center|LOCUS_16350 2302 1922 gene locus_tag LOCUS_16360 2302 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055984.1 protein_id gnl|my_center|LOCUS_16360 3255 4445 gene locus_tag LOCUS_16370 3255 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056563.1 protein_id gnl|my_center|LOCUS_16370 5030 4458 gene locus_tag LOCUS_16380 5030 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 6319 5189 gene locus_tag LOCUS_16390 6319 5189 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 protein_id gnl|my_center|LOCUS_16390 7264 6614 gene locus_tag LOCUS_16400 7264 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 7426 8130 gene locus_tag LOCUS_16410 gene ribC 7426 8130 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057523.1 protein_id gnl|my_center|LOCUS_16410 9496 8279 gene locus_tag LOCUS_16420 9496 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 11234 9552 gene locus_tag LOCUS_16430 11234 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 11611 12864 gene locus_tag LOCUS_16440 11611 12864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 12918 13367 gene locus_tag LOCUS_16450 12918 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16450 13727 13554 gene locus_tag LOCUS_16460 13727 13554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16460 14193 13681 gene locus_tag LOCUS_16470 14193 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16470 15567 14368 gene locus_tag LOCUS_16480 15567 14368 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056224.1 protein_id gnl|my_center|LOCUS_16480 17133 16054 gene locus_tag LOCUS_16490 gene ycf81 17133 16054 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055863.1 protein_id gnl|my_center|LOCUS_16490 17697 18806 gene locus_tag LOCUS_16500 gene hemN2 17697 18806 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057034.1 protein_id gnl|my_center|LOCUS_16500 18868 19719 gene locus_tag LOCUS_16510 gene rsmI 18868 19719 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR7 protein_id gnl|my_center|LOCUS_16510 20028 20534 gene locus_tag LOCUS_16520 20028 20534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124316.1 protein_id gnl|my_center|LOCUS_16520 20826 20527 gene locus_tag LOCUS_16530 20826 20527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943940.1 protein_id gnl|my_center|LOCUS_16530 21114 23537 gene locus_tag LOCUS_16540 21114 23537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 23618 24163 gene locus_tag LOCUS_16550 23618 24163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16550 24164 24385 gene locus_tag LOCUS_16560 24164 24385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16560 24778 25107 gene locus_tag LOCUS_16570 24778 25107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 28345 25343 gene locus_tag LOCUS_16580 28345 25343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 29898 28534 gene locus_tag LOCUS_16590 29898 28534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 30766 31677 gene locus_tag LOCUS_16600 30766 31677 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085765.1 protein_id gnl|my_center|LOCUS_16600 31829 32833 gene locus_tag LOCUS_16610 31829 32833 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_16610 33049 32968 gene locus_tag LOCUS_t00080 33049 32968 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33430 33146 gene locus_tag LOCUS_16620 33430 33146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141965.1 protein_id gnl|my_center|LOCUS_16620 33868 35040 gene locus_tag LOCUS_16630 33868 35040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 35600 36676 gene locus_tag LOCUS_16640 35600 36676 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 protein_id gnl|my_center|LOCUS_16640 36763 38874 gene locus_tag LOCUS_16650 36763 38874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 38883 39344 gene locus_tag LOCUS_16660 38883 39344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866321.1 protein_id gnl|my_center|LOCUS_16660 39497 41113 gene locus_tag LOCUS_16670 39497 41113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 41323 42501 gene locus_tag LOCUS_16680 41323 42501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 43029 42556 gene locus_tag LOCUS_16690 43029 42556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 43687 43127 gene locus_tag LOCUS_16700 43687 43127 CDS product KHG-KDPG bifunctional aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144255.1 protein_id gnl|my_center|LOCUS_16700 44016 43943 gene locus_tag LOCUS_t00090 44016 43943 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 44297 44213 gene locus_tag LOCUS_t00100 44297 44213 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 44708 45694 gene locus_tag LOCUS_16710 44708 45694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 47044 45959 gene locus_tag LOCUS_16720 47044 45959 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057568.1 protein_id gnl|my_center|LOCUS_16720 47336 48049 gene locus_tag LOCUS_16730 gene queC 47336 48049 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI59 protein_id gnl|my_center|LOCUS_16730 49103 48132 gene locus_tag LOCUS_16740 49103 48132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 50582 51907 gene locus_tag LOCUS_16750 50582 51907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 52158 53390 gene locus_tag LOCUS_16760 gene rfaG 52158 53390 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125976.1 protein_id gnl|my_center|LOCUS_16760 54288 54037 gene locus_tag LOCUS_16770 54288 54037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 54712 55449 gene locus_tag LOCUS_16780 54712 55449 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 protein_id gnl|my_center|LOCUS_16780 55840 55658 gene locus_tag LOCUS_16790 55840 55658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 56409 57254 gene locus_tag LOCUS_16800 56409 57254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 58448 57348 gene locus_tag LOCUS_16810 58448 57348 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_16810 59318 58536 gene locus_tag LOCUS_16820 59318 58536 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392686.1 protein_id gnl|my_center|LOCUS_16820 59995 59396 gene locus_tag LOCUS_16830 59995 59396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 protein_id gnl|my_center|LOCUS_16830 61072 60233 gene locus_tag LOCUS_16840 61072 60233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_16840 61559 61404 gene locus_tag LOCUS_16850 61559 61404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 62236 66051 gene locus_tag LOCUS_16860 62236 66051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 67485 66634 gene locus_tag LOCUS_16870 67485 66634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_16870 67824 67603 gene locus_tag LOCUS_16880 67824 67603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 68303 68755 gene locus_tag LOCUS_16890 68303 68755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 70657 69215 gene locus_tag LOCUS_16900 70657 69215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 71500 73557 gene locus_tag LOCUS_16910 71500 73557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 75065 73671 gene locus_tag LOCUS_16920 gene xylE 75065 73671 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036933.1 protein_id gnl|my_center|LOCUS_16920 75430 75750 gene locus_tag LOCUS_16930 75430 75750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence022 1128 184 gene locus_tag LOCUS_16940 1128 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3452 1143 gene locus_tag LOCUS_16950 3452 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 5423 3549 gene locus_tag LOCUS_16960 5423 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 7431 5413 gene locus_tag LOCUS_16970 7431 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 8052 7696 gene locus_tag LOCUS_16980 8052 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 8800 9495 gene locus_tag LOCUS_16990 8800 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 10666 9578 gene locus_tag LOCUS_17000 10666 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 12361 10958 gene locus_tag LOCUS_17010 gene chlN 12361 10958 CDS product light-independent protochlorophyllide reductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH2 protein_id gnl|my_center|LOCUS_17010 13283 12420 gene locus_tag LOCUS_17020 gene chlL 13283 12420 CDS product light-independent protochlorophyllide reductase iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH0 protein_id gnl|my_center|LOCUS_17020 15654 14128 gene locus_tag LOCUS_17030 gene chlB 15654 14128 CDS product light-independent protochlorophyllide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC6 protein_id gnl|my_center|LOCUS_17030 16266 16901 gene locus_tag LOCUS_17040 16266 16901 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056907.1 protein_id gnl|my_center|LOCUS_17040 17441 18727 gene locus_tag LOCUS_17050 17441 18727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 18866 19339 gene locus_tag LOCUS_17060 18866 19339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 19594 19343 gene locus_tag LOCUS_17070 19594 19343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 21811 19928 gene locus_tag LOCUS_17080 21811 19928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140887.1 protein_id gnl|my_center|LOCUS_17080 23019 22297 gene locus_tag LOCUS_17090 23019 22297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 25451 23886 gene locus_tag LOCUS_17100 25451 23886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056025.1 protein_id gnl|my_center|LOCUS_17100 26007 26546 gene locus_tag LOCUS_17110 26007 26546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056026.1 protein_id gnl|my_center|LOCUS_17110 26572 27918 gene locus_tag LOCUS_17120 26572 27918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_17120 28348 29259 gene locus_tag LOCUS_17130 gene axeA 28348 29259 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120225.1 protein_id gnl|my_center|LOCUS_17130 30131 30886 gene locus_tag LOCUS_17140 30131 30886 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141932.1 protein_id gnl|my_center|LOCUS_17140 32199 30976 gene locus_tag LOCUS_17150 gene lysA 32199 30976 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL42 protein_id gnl|my_center|LOCUS_17150 33130 32402 gene locus_tag LOCUS_17160 33130 32402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 33996 33415 gene locus_tag LOCUS_17170 33996 33415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 35344 34220 gene locus_tag LOCUS_17180 gene dapL 35344 34220 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GT3 protein_id gnl|my_center|LOCUS_17180 35445 36377 gene locus_tag LOCUS_17190 35445 36377 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_17190 37174 36389 gene locus_tag LOCUS_17200 37174 36389 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 protein_id gnl|my_center|LOCUS_17200 39090 37312 gene locus_tag LOCUS_17210 39090 37312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 39543 39836 gene locus_tag LOCUS_17220 39543 39836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 40083 41495 gene locus_tag LOCUS_17230 40083 41495 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 protein_id gnl|my_center|LOCUS_17230 42453 41752 gene locus_tag LOCUS_17240 gene trmD 42453 41752 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM2 protein_id gnl|my_center|LOCUS_17240 42650 43519 gene locus_tag LOCUS_17250 gene cphB 42650 43519 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P3 protein_id gnl|my_center|LOCUS_17250 43963 46641 gene locus_tag LOCUS_17260 43963 46641 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058004.1 protein_id gnl|my_center|LOCUS_17260 47852 48490 gene locus_tag LOCUS_17270 47852 48490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 48829 50724 gene locus_tag LOCUS_17280 48829 50724 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057278.1 protein_id gnl|my_center|LOCUS_17280 51475 51014 gene locus_tag LOCUS_17290 51475 51014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140553.1 protein_id gnl|my_center|LOCUS_17290 51895 51509 gene locus_tag LOCUS_17300 51895 51509 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017671.1 protein_id gnl|my_center|LOCUS_17300 52082 53551 gene locus_tag LOCUS_17310 gene tldD 52082 53551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056379.1 protein_id gnl|my_center|LOCUS_17310 53743 55083 gene locus_tag LOCUS_17320 53743 55083 CDS product modulator of DNA gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056923.1 protein_id gnl|my_center|LOCUS_17320 55824 55201 gene locus_tag LOCUS_17330 55824 55201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 56269 56496 gene locus_tag LOCUS_17340 56269 56496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 57367 56672 gene locus_tag LOCUS_17350 57367 56672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142612.1 protein_id gnl|my_center|LOCUS_17350 58302 57520 gene locus_tag LOCUS_17360 58302 57520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 58678 59385 gene locus_tag LOCUS_17370 58678 59385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143841.1 protein_id gnl|my_center|LOCUS_17370 59592 59410 gene locus_tag LOCUS_17380 gene tatA 59592 59410 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMQ4 protein_id gnl|my_center|LOCUS_17380 60227 60967 gene locus_tag LOCUS_17390 gene pcyA 60227 60967 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59288 protein_id gnl|my_center|LOCUS_17390 61639 61022 gene locus_tag LOCUS_17400 61639 61022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 63010 61949 gene locus_tag LOCUS_17410 gene mtnA 63010 61949 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK09 protein_id gnl|my_center|LOCUS_17410 65009 63102 gene locus_tag LOCUS_17420 gene dxs 65009 63102 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL74 protein_id gnl|my_center|LOCUS_17420 65099 66694 gene locus_tag LOCUS_17430 65099 66694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 66694 68253 gene locus_tag LOCUS_17440 66694 68253 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7B2 protein_id gnl|my_center|LOCUS_17440 68360 69970 gene locus_tag LOCUS_17450 68360 69970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 70134 71765 gene locus_tag LOCUS_17460 70134 71765 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_17460 72159 71947 gene locus_tag LOCUS_17470 72159 71947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_17470 72428 72216 gene locus_tag LOCUS_17480 72428 72216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 72680 73291 gene locus_tag LOCUS_17490 72680 73291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 74698 73484 gene locus_tag LOCUS_17500 74698 73484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 75140 74721 gene locus_tag LOCUS_17510 75140 74721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence023 821 291 gene locus_tag LOCUS_17520 821 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1642 1223 gene locus_tag LOCUS_17530 1642 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2031 3104 gene locus_tag LOCUS_17540 2031 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 3448 4098 gene locus_tag LOCUS_17550 3448 4098 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140352.1 protein_id gnl|my_center|LOCUS_17550 4204 4401 gene locus_tag LOCUS_17560 4204 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 5032 5880 gene locus_tag LOCUS_17570 5032 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 5957 7975 gene locus_tag LOCUS_17580 5957 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 8272 11019 gene locus_tag LOCUS_17590 8272 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 12677 11127 gene locus_tag LOCUS_17600 12677 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 14077 12866 gene locus_tag LOCUS_17610 14077 12866 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_17610 15299 14256 gene locus_tag LOCUS_17620 15299 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974307.1 protein_id gnl|my_center|LOCUS_17620 15916 15299 gene locus_tag LOCUS_17630 15916 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 16764 16192 gene locus_tag LOCUS_17640 16764 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 19654 17069 gene locus_tag LOCUS_17650 gene priA 19654 17069 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLR3 protein_id gnl|my_center|LOCUS_17650 20158 21246 gene locus_tag LOCUS_17660 20158 21246 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEW6 protein_id gnl|my_center|LOCUS_17660 21491 21994 gene locus_tag LOCUS_17670 21491 21994 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_17670 22115 22321 gene locus_tag LOCUS_17680 22115 22321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057172.1 protein_id gnl|my_center|LOCUS_17680 23606 22542 gene locus_tag LOCUS_17690 23606 22542 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140935.1 protein_id gnl|my_center|LOCUS_17690 24890 24336 gene locus_tag LOCUS_17700 gene ruvC 24890 24336 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJT5 protein_id gnl|my_center|LOCUS_17700 25509 26876 gene locus_tag LOCUS_17710 25509 26876 CDS product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHJ8 protein_id gnl|my_center|LOCUS_17710 26973 27467 gene locus_tag LOCUS_17720 26973 27467 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142985.1 protein_id gnl|my_center|LOCUS_17720 28919 27564 gene locus_tag LOCUS_17730 28919 27564 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL33 protein_id gnl|my_center|LOCUS_17730 29249 29875 gene locus_tag LOCUS_17740 29249 29875 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHX1 protein_id gnl|my_center|LOCUS_17740 31186 29888 gene locus_tag LOCUS_17750 gene pyrC 31186 29888 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057373.1 protein_id gnl|my_center|LOCUS_17750 31510 31758 gene locus_tag LOCUS_17760 31510 31758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 31773 32249 gene locus_tag LOCUS_17770 31773 32249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 33941 33021 gene locus_tag LOCUS_17780 33941 33021 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227777.1 protein_id gnl|my_center|LOCUS_17780 34077 34457 gene locus_tag LOCUS_17790 34077 34457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057769.1 protein_id gnl|my_center|LOCUS_17790 37564 34619 gene locus_tag LOCUS_17800 37564 34619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 38226 38023 gene locus_tag LOCUS_17810 38226 38023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 38676 38338 gene locus_tag LOCUS_17820 38676 38338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 39718 38864 gene locus_tag LOCUS_17830 39718 38864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 41298 39769 gene locus_tag LOCUS_17840 41298 39769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 42865 41582 gene locus_tag LOCUS_17850 gene hisS 42865 41582 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHP7 protein_id gnl|my_center|LOCUS_17850 43162 42884 gene locus_tag LOCUS_17860 43162 42884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057701.1 protein_id gnl|my_center|LOCUS_17860 43741 43355 gene locus_tag LOCUS_17870 43741 43355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 43701 44156 gene locus_tag LOCUS_17880 43701 44156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 45400 44624 gene locus_tag LOCUS_17890 gene sigF 45400 44624 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_17890 46782 45952 gene locus_tag LOCUS_17900 gene psbO 46782 45952 CDS product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A431 protein_id gnl|my_center|LOCUS_17900 47094 47423 gene locus_tag LOCUS_17910 47094 47423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 47780 49222 gene locus_tag LOCUS_17920 47780 49222 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140391.1 protein_id gnl|my_center|LOCUS_17920 49486 50010 gene locus_tag LOCUS_17930 49486 50010 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHZ6 protein_id gnl|my_center|LOCUS_17930 50438 50100 gene locus_tag LOCUS_17940 gene glnB 50438 50100 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 protein_id gnl|my_center|LOCUS_17940 51518 54850 gene locus_tag LOCUS_17950 51518 54850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 54873 55337 gene locus_tag LOCUS_17960 54873 55337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 56172 55504 gene locus_tag LOCUS_17970 56172 55504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143006.1 protein_id gnl|my_center|LOCUS_17970 56432 56241 gene locus_tag LOCUS_17980 56432 56241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 57783 56515 gene locus_tag LOCUS_17990 57783 56515 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057422.1 protein_id gnl|my_center|LOCUS_17990 59043 57979 gene locus_tag LOCUS_18000 59043 57979 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA4 protein_id gnl|my_center|LOCUS_18000 59968 60657 gene locus_tag LOCUS_18010 59968 60657 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533464.1 protein_id gnl|my_center|LOCUS_18010 60870 61940 gene locus_tag LOCUS_18020 60870 61940 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533458.1 protein_id gnl|my_center|LOCUS_18020 62006 63319 gene locus_tag LOCUS_18030 62006 63319 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533465.1 protein_id gnl|my_center|LOCUS_18030 63433 64317 gene locus_tag LOCUS_18040 63433 64317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 64325 65425 gene locus_tag LOCUS_18050 64325 65425 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533459.1 protein_id gnl|my_center|LOCUS_18050 65460 66206 gene locus_tag LOCUS_18060 65460 66206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 66449 68875 gene locus_tag LOCUS_18070 66449 68875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 68883 69323 gene locus_tag LOCUS_18080 68883 69323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 69345 70286 gene locus_tag LOCUS_18090 69345 70286 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533468.1 protein_id gnl|my_center|LOCUS_18090 70427 70606 gene locus_tag LOCUS_18100 70427 70606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18100 70742 72142 gene locus_tag LOCUS_18110 70742 72142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence024 5677 20 gene locus_tag LOCUS_18120 5677 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 6104 7393 gene locus_tag LOCUS_18130 gene glgC 6104 7393 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057127.1 protein_id gnl|my_center|LOCUS_18130 7718 8743 gene locus_tag LOCUS_18140 gene dnaJ 7718 8743 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_18140 9533 8991 gene locus_tag LOCUS_18150 9533 8991 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057129.1 protein_id gnl|my_center|LOCUS_18150 10693 9686 gene locus_tag LOCUS_18160 10693 9686 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103232.1 protein_id gnl|my_center|LOCUS_18160 11775 10831 gene locus_tag LOCUS_18170 11775 10831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 12781 11807 gene locus_tag LOCUS_18180 12781 11807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 13806 12772 gene locus_tag LOCUS_18190 13806 12772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 14540 13803 gene locus_tag LOCUS_18200 14540 13803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 16180 14537 gene locus_tag LOCUS_18210 16180 14537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 18178 16394 gene locus_tag LOCUS_18220 18178 16394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530674.1 protein_id gnl|my_center|LOCUS_18220 19248 18292 gene locus_tag LOCUS_18230 19248 18292 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_18230 20604 19420 gene locus_tag LOCUS_18240 20604 19420 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141789.1 protein_id gnl|my_center|LOCUS_18240 22295 20844 gene locus_tag LOCUS_18250 22295 20844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142196.1 protein_id gnl|my_center|LOCUS_18250 24489 22282 gene locus_tag LOCUS_18260 24489 22282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142199.1 protein_id gnl|my_center|LOCUS_18260 25685 24513 gene locus_tag LOCUS_18270 25685 24513 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_18270 27017 25818 gene locus_tag LOCUS_18280 27017 25818 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142192.1 protein_id gnl|my_center|LOCUS_18280 29102 30421 gene locus_tag LOCUS_18290 29102 30421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 30704 31387 gene locus_tag LOCUS_18300 gene tmk 30704 31387 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHA4 protein_id gnl|my_center|LOCUS_18300 31357 32316 gene locus_tag LOCUS_18310 gene dnaX 31357 32316 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056369.1 protein_id gnl|my_center|LOCUS_18310 32784 33386 gene locus_tag LOCUS_18320 gene tpx 32784 33386 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 protein_id gnl|my_center|LOCUS_18320 33889 34653 gene locus_tag LOCUS_18330 33889 34653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 35889 34774 gene locus_tag LOCUS_18340 35889 34774 CDS product geranylgeranyl bacteriochlorophyll reductase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058112.1 protein_id gnl|my_center|LOCUS_18340 36827 37096 gene locus_tag LOCUS_18350 36827 37096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057448.1 protein_id gnl|my_center|LOCUS_18350 37715 38302 gene locus_tag LOCUS_18360 gene sepF 37715 38302 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK7 protein_id gnl|my_center|LOCUS_18360 38371 39195 gene locus_tag LOCUS_18370 gene proC 38371 39195 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMR1 protein_id gnl|my_center|LOCUS_18370 39714 41168 gene locus_tag LOCUS_18380 39714 41168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 41306 42649 gene locus_tag LOCUS_18390 gene mviN 41306 42649 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ED5 protein_id gnl|my_center|LOCUS_18390 42668 43612 gene locus_tag LOCUS_18400 42668 43612 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_18400 43708 43869 gene locus_tag LOCUS_18410 43708 43869 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZC7 protein_id gnl|my_center|LOCUS_18410 45449 43974 gene locus_tag LOCUS_18420 45449 43974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 46606 45611 gene locus_tag LOCUS_18430 46606 45611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 47280 46720 gene locus_tag LOCUS_18440 47280 46720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 48467 47343 gene locus_tag LOCUS_18450 48467 47343 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 protein_id gnl|my_center|LOCUS_18450 49156 49770 gene locus_tag LOCUS_18460 49156 49770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 50503 52041 gene locus_tag LOCUS_18470 50503 52041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 protein_id gnl|my_center|LOCUS_18470 52381 52034 gene locus_tag LOCUS_18480 52381 52034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 53082 53906 gene locus_tag LOCUS_18490 53082 53906 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_18490 55524 54235 gene locus_tag LOCUS_18500 55524 54235 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142380.1 protein_id gnl|my_center|LOCUS_18500 57390 55684 gene locus_tag LOCUS_18510 57390 55684 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034322.1 protein_id gnl|my_center|LOCUS_18510 57630 57899 gene locus_tag LOCUS_18520 57630 57899 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057702.1 protein_id gnl|my_center|LOCUS_18520 58670 58353 gene locus_tag LOCUS_18530 58670 58353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 58823 60103 gene locus_tag LOCUS_18540 gene trpB 58823 60103 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG49 protein_id gnl|my_center|LOCUS_18540 60593 61243 gene locus_tag LOCUS_18550 60593 61243 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 protein_id gnl|my_center|LOCUS_18550 61315 64671 gene locus_tag LOCUS_18560 61315 64671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 65379 65125 gene locus_tag LOCUS_18570 65379 65125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 65817 66641 gene locus_tag LOCUS_18580 65817 66641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 66743 68884 gene locus_tag LOCUS_18590 66743 68884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence025 615 307 gene locus_tag LOCUS_18600 615 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1034 612 gene locus_tag LOCUS_18610 1034 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2051 3253 gene locus_tag LOCUS_18620 2051 3253 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195315.1 protein_id gnl|my_center|LOCUS_18620 3525 4976 gene locus_tag LOCUS_18630 3525 4976 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674454.1 protein_id gnl|my_center|LOCUS_18630 5490 5906 gene locus_tag LOCUS_18640 5490 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 6019 6732 gene locus_tag LOCUS_18650 6019 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 8697 6853 gene locus_tag LOCUS_18660 8697 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_18660 9637 8735 gene locus_tag LOCUS_18670 9637 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 11355 10387 gene locus_tag LOCUS_18680 11355 10387 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228588.1 protein_id gnl|my_center|LOCUS_18680 11823 11587 gene locus_tag LOCUS_18690 11823 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058260.1 protein_id gnl|my_center|LOCUS_18690 12959 11901 gene locus_tag LOCUS_18700 12959 11901 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057238.1 protein_id gnl|my_center|LOCUS_18700 13213 13842 gene locus_tag LOCUS_18710 13213 13842 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057508.1 protein_id gnl|my_center|LOCUS_18710 14013 14648 gene locus_tag LOCUS_18720 14013 14648 CDS product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 protein_id gnl|my_center|LOCUS_18720 14747 15355 gene locus_tag LOCUS_18730 14747 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_18730 17460 15463 gene locus_tag LOCUS_18740 17460 15463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 17857 18939 gene locus_tag LOCUS_18750 gene thiE 17857 18939 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHK2 protein_id gnl|my_center|LOCUS_18750 19026 19250 gene locus_tag LOCUS_18760 gene ycf40 19026 19250 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056654.1 protein_id gnl|my_center|LOCUS_18760 20533 19346 gene locus_tag LOCUS_18770 20533 19346 CDS product NDP-hexose methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975523.1 protein_id gnl|my_center|LOCUS_18770 21865 20657 gene locus_tag LOCUS_18780 21865 20657 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_18780 23184 22306 gene locus_tag LOCUS_18790 23184 22306 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142189.1 protein_id gnl|my_center|LOCUS_18790 24557 23328 gene locus_tag LOCUS_18800 24557 23328 CDS product NDP-hexose methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975523.1 protein_id gnl|my_center|LOCUS_18800 26250 25033 gene locus_tag LOCUS_18810 26250 25033 CDS product NDP-hexose 3-C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_18810 27532 26468 gene locus_tag LOCUS_18820 27532 26468 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435695.1 protein_id gnl|my_center|LOCUS_18820 28307 27456 gene locus_tag LOCUS_18830 gene gcd1 28307 27456 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 protein_id gnl|my_center|LOCUS_18830 29139 29285 gene locus_tag LOCUS_18840 29139 29285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 29623 30714 gene locus_tag LOCUS_18850 29623 30714 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_18850 32294 31203 gene locus_tag LOCUS_18860 gene mtnW 32294 31203 CDS product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31666 protein_id gnl|my_center|LOCUS_18860 32880 32323 gene locus_tag LOCUS_18870 gene mtnD 32880 32323 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXC0 protein_id gnl|my_center|LOCUS_18870 33122 34963 gene locus_tag LOCUS_18880 gene ftsH 33122 34963 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI5 protein_id gnl|my_center|LOCUS_18880 35314 36687 gene locus_tag LOCUS_18890 gene thiC 35314 36687 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLZ2 protein_id gnl|my_center|LOCUS_18890 37128 37910 gene locus_tag LOCUS_18900 37128 37910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 38143 38958 gene locus_tag LOCUS_18910 gene cysE 38143 38958 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHM1 protein_id gnl|my_center|LOCUS_18910 38962 39396 gene locus_tag LOCUS_18920 38962 39396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 39878 40465 gene locus_tag LOCUS_18930 39878 40465 CDS product IS607 family transposase ISTko1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_18930 40449 41540 gene locus_tag LOCUS_18940 40449 41540 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 protein_id gnl|my_center|LOCUS_18940 41559 42659 gene locus_tag LOCUS_18950 41559 42659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 44864 43026 gene locus_tag LOCUS_18960 44864 43026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 45256 44861 gene locus_tag LOCUS_18970 45256 44861 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655500.1 protein_id gnl|my_center|LOCUS_18970 47271 45781 gene locus_tag LOCUS_18980 47271 45781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 50853 47581 gene locus_tag LOCUS_18990 50853 47581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 53959 51395 gene locus_tag LOCUS_19000 53959 51395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 54827 53967 gene locus_tag LOCUS_19010 54827 53967 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_19010 57708 55372 gene locus_tag LOCUS_19020 57708 55372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 60441 58213 gene locus_tag LOCUS_19030 60441 58213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 62613 60568 gene locus_tag LOCUS_19040 62613 60568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 64397 63918 gene locus_tag LOCUS_19050 64397 63918 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057304.1 protein_id gnl|my_center|LOCUS_19050 64596 65918 gene locus_tag LOCUS_19060 64596 65918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence026 2888 705 gene locus_tag LOCUS_19070 2888 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159898.1 protein_id gnl|my_center|LOCUS_19070 3448 3990 gene locus_tag LOCUS_19080 3448 3990 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844912.1 protein_id gnl|my_center|LOCUS_19080 4132 4416 gene locus_tag LOCUS_19090 4132 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 4667 4996 gene locus_tag LOCUS_19100 4667 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227643.1 protein_id gnl|my_center|LOCUS_19100 5010 9062 gene locus_tag LOCUS_19110 5010 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 9602 10216 gene locus_tag LOCUS_19120 9602 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 12193 10448 gene locus_tag LOCUS_19130 12193 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_19130 13235 14185 gene locus_tag LOCUS_19140 13235 14185 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709054.1 protein_id gnl|my_center|LOCUS_19140 14312 15253 gene locus_tag LOCUS_19150 14312 15253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 17562 15382 gene locus_tag LOCUS_19160 17562 15382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 18114 18413 gene locus_tag LOCUS_19170 18114 18413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 18695 19687 gene locus_tag LOCUS_19180 18695 19687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 19665 20264 gene locus_tag LOCUS_19190 19665 20264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039060.1 protein_id gnl|my_center|LOCUS_19190 20513 21520 gene locus_tag LOCUS_19200 20513 21520 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104356.1 protein_id gnl|my_center|LOCUS_19200 21788 22078 gene locus_tag LOCUS_19210 21788 22078 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118393.1 protein_id gnl|my_center|LOCUS_19210 22547 22149 gene locus_tag LOCUS_19220 22547 22149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 23167 23634 gene locus_tag LOCUS_19230 gene msrA 23167 23634 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066219.1 protein_id gnl|my_center|LOCUS_19230 24283 23819 gene locus_tag LOCUS_19240 24283 23819 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143783.1 protein_id gnl|my_center|LOCUS_19240 24399 26561 gene locus_tag LOCUS_19250 24399 26561 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144130.1 protein_id gnl|my_center|LOCUS_19250 26639 27196 gene locus_tag LOCUS_19260 26639 27196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 28324 29754 gene locus_tag LOCUS_19270 28324 29754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 32944 30347 gene locus_tag LOCUS_19280 gene leuS 32944 30347 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH61 protein_id gnl|my_center|LOCUS_19280 33351 34022 gene locus_tag LOCUS_19290 33351 34022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 34855 34031 gene locus_tag LOCUS_19300 34855 34031 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_19300 36194 35223 gene locus_tag LOCUS_19310 gene por 36194 35223 CDS product protochlorophyllide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 protein_id gnl|my_center|LOCUS_19310 37313 36507 gene locus_tag LOCUS_19320 gene cobA 37313 36507 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055999.1 protein_id gnl|my_center|LOCUS_19320 38071 37316 gene locus_tag LOCUS_19330 38071 37316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057734.1 protein_id gnl|my_center|LOCUS_19330 39158 38550 gene locus_tag LOCUS_19340 39158 38550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 40839 39358 gene locus_tag LOCUS_19350 40839 39358 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_19350 41319 42593 gene locus_tag LOCUS_19360 41319 42593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 protein_id gnl|my_center|LOCUS_19360 42751 43557 gene locus_tag LOCUS_19370 42751 43557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 44117 43836 gene locus_tag LOCUS_19380 44117 43836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 44729 44178 gene locus_tag LOCUS_19390 44729 44178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144066.1 protein_id gnl|my_center|LOCUS_19390 45196 44861 gene locus_tag LOCUS_19400 45196 44861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 46308 45661 gene locus_tag LOCUS_19410 46308 45661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141284.1 protein_id gnl|my_center|LOCUS_19410 46978 46352 gene locus_tag LOCUS_19420 46978 46352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_19420 48059 47121 gene locus_tag LOCUS_19430 48059 47121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 48363 48172 gene locus_tag LOCUS_19440 48363 48172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 49180 48845 gene locus_tag LOCUS_19450 49180 48845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 49584 49168 gene locus_tag LOCUS_19460 49584 49168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 51297 49762 gene locus_tag LOCUS_19470 51297 49762 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948836.1 protein_id gnl|my_center|LOCUS_19470 52355 51594 gene locus_tag LOCUS_19480 52355 51594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 52816 52262 gene locus_tag LOCUS_19490 gene coaD 52816 52262 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ7 protein_id gnl|my_center|LOCUS_19490 53328 57071 gene locus_tag LOCUS_19500 gene smc 53328 57071 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAK1 protein_id gnl|my_center|LOCUS_19500 57372 58370 gene locus_tag LOCUS_19510 57372 58370 CDS product photosystem reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056697.1 protein_id gnl|my_center|LOCUS_19510 59554 58970 gene locus_tag LOCUS_19520 59554 58970 CDS product fibrillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 protein_id gnl|my_center|LOCUS_19520 59628 59849 gene locus_tag LOCUS_19530 59628 59849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142940.1 protein_id gnl|my_center|LOCUS_19530 60315 61658 gene locus_tag LOCUS_19540 gene lpxB 60315 61658 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056176.1 protein_id gnl|my_center|LOCUS_19540 62301 61720 gene locus_tag LOCUS_19550 62301 61720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_19550 62598 62353 gene locus_tag LOCUS_19560 62598 62353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 62706 62960 gene locus_tag LOCUS_19570 62706 62960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 63064 63459 gene locus_tag LOCUS_19580 63064 63459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 64741 63584 gene locus_tag LOCUS_19590 64741 63584 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140086.1 protein_id gnl|my_center|LOCUS_19590 66201 64762 gene locus_tag LOCUS_19600 66201 64762 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058069.1 protein_id gnl|my_center|LOCUS_19600 67203 66268 gene locus_tag LOCUS_19610 gene recO 67203 66268 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPH1 protein_id gnl|my_center|LOCUS_19610 68040 67360 gene locus_tag LOCUS_19620 gene deoC 68040 67360 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJZ1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence027 399 2732 gene locus_tag LOCUS_19630 399 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 3022 5280 gene locus_tag LOCUS_19640 3022 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_19640 5633 7000 gene locus_tag LOCUS_19650 5633 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 7109 7621 gene locus_tag LOCUS_19660 7109 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 8252 9424 gene locus_tag LOCUS_19670 8252 9424 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_19670 9508 10023 gene locus_tag LOCUS_19680 9508 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 13303 10334 gene locus_tag LOCUS_19690 gene gcvP 13303 10334 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 protein_id gnl|my_center|LOCUS_19690 14022 13618 gene locus_tag LOCUS_19700 gene gcvH 14022 13618 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIB2 protein_id gnl|my_center|LOCUS_19700 14556 14353 gene locus_tag LOCUS_19710 14556 14353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056763.1 protein_id gnl|my_center|LOCUS_19710 18258 14974 gene locus_tag LOCUS_19720 gene infB 18258 14974 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK04 protein_id gnl|my_center|LOCUS_19720 19045 18677 gene locus_tag LOCUS_19730 19045 18677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 20739 19450 gene locus_tag LOCUS_19740 gene nusA 20739 19450 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHL2 protein_id gnl|my_center|LOCUS_19740 21374 20913 gene locus_tag LOCUS_19750 gene rimP 21374 20913 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFN6 protein_id gnl|my_center|LOCUS_19750 24345 22840 gene locus_tag LOCUS_19760 24345 22840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057693.1 protein_id gnl|my_center|LOCUS_19760 26153 24807 gene locus_tag LOCUS_19770 26153 24807 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 protein_id gnl|my_center|LOCUS_19770 27025 26492 gene locus_tag LOCUS_19780 27025 26492 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709012.1 protein_id gnl|my_center|LOCUS_19780 27485 27156 gene locus_tag LOCUS_19790 27485 27156 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLS3 protein_id gnl|my_center|LOCUS_19790 28962 27571 gene locus_tag LOCUS_19800 28962 27571 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 protein_id gnl|my_center|LOCUS_19800 31905 29104 gene locus_tag LOCUS_19810 31905 29104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 33157 31895 gene locus_tag LOCUS_19820 33157 31895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 34501 34232 gene locus_tag LOCUS_19830 34501 34232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 38274 35746 gene locus_tag LOCUS_19840 38274 35746 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU0 protein_id gnl|my_center|LOCUS_19840 41007 40468 gene locus_tag LOCUS_19850 41007 40468 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE5 protein_id gnl|my_center|LOCUS_19850 45425 41427 gene locus_tag LOCUS_19860 45425 41427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 52177 46139 gene locus_tag LOCUS_19870 52177 46139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 54099 52420 gene locus_tag LOCUS_19880 54099 52420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 55468 54533 gene locus_tag LOCUS_19890 gene APA2 55468 54533 CDS product ATP adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125113.1 protein_id gnl|my_center|LOCUS_19890 55911 56558 gene locus_tag LOCUS_19900 55911 56558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140697.1 protein_id gnl|my_center|LOCUS_19900 56723 56974 gene locus_tag LOCUS_19910 56723 56974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 57514 57194 gene locus_tag LOCUS_19920 gene cutA 57514 57194 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7SIA8 protein_id gnl|my_center|LOCUS_19920 57778 58278 gene locus_tag LOCUS_19930 57778 58278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 58462 59421 gene locus_tag LOCUS_19940 58462 59421 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_19940 59881 59666 gene locus_tag LOCUS_19950 59881 59666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 60942 60619 gene locus_tag LOCUS_19960 60942 60619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 61557 61189 gene locus_tag LOCUS_19970 61557 61189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence028 1801 1139 gene locus_tag LOCUS_19980 1801 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3363 4904 gene locus_tag LOCUS_19990 3363 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 5191 6882 gene locus_tag LOCUS_20000 5191 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 9150 7429 gene locus_tag LOCUS_20010 9150 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_20010 10010 9228 gene locus_tag LOCUS_20020 gene cysE 10010 9228 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK8 protein_id gnl|my_center|LOCUS_20020 10737 10156 gene locus_tag LOCUS_20030 10737 10156 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223840.1 protein_id gnl|my_center|LOCUS_20030 12616 11123 gene locus_tag LOCUS_20040 12616 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 14556 12832 gene locus_tag LOCUS_20050 14556 12832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 15107 15319 gene locus_tag LOCUS_20060 15107 15319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 16727 16131 gene locus_tag LOCUS_20070 16727 16131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 17293 17997 gene locus_tag LOCUS_20080 17293 17997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 17994 18908 gene locus_tag LOCUS_20090 17994 18908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 19179 21494 gene locus_tag LOCUS_20100 19179 21494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 21662 22798 gene locus_tag LOCUS_20110 21662 22798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057832.1 protein_id gnl|my_center|LOCUS_20110 22976 23635 gene locus_tag LOCUS_20120 22976 23635 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_20120 23907 24584 gene locus_tag LOCUS_20130 23907 24584 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105364.1 protein_id gnl|my_center|LOCUS_20130 24832 25524 gene locus_tag LOCUS_20140 24832 25524 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_20140 25541 26389 gene locus_tag LOCUS_20150 25541 26389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 27094 27600 gene locus_tag LOCUS_20160 27094 27600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 28217 27696 gene locus_tag LOCUS_20170 28217 27696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_20170 28787 28984 gene locus_tag LOCUS_20180 28787 28984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 31199 29070 gene locus_tag LOCUS_20190 gene recQ 31199 29070 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142623.1 protein_id gnl|my_center|LOCUS_20190 34603 31280 gene locus_tag LOCUS_20200 34603 31280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 35029 35286 gene locus_tag LOCUS_20210 35029 35286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 35759 35547 gene locus_tag LOCUS_20220 35759 35547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 35815 36231 gene locus_tag LOCUS_20230 35815 36231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 36296 36817 gene locus_tag LOCUS_20240 36296 36817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 37182 37388 gene locus_tag LOCUS_20250 37182 37388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 37441 38289 gene locus_tag LOCUS_20260 37441 38289 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886674.1 protein_id gnl|my_center|LOCUS_20260 38927 38490 gene locus_tag LOCUS_20270 38927 38490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 39547 41202 gene locus_tag LOCUS_20280 39547 41202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 41613 41365 gene locus_tag LOCUS_20290 41613 41365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 41823 43298 gene locus_tag LOCUS_20300 41823 43298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055916.1 protein_id gnl|my_center|LOCUS_20300 44399 43617 gene locus_tag LOCUS_20310 gene sigF 44399 43617 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_20310 45035 45763 gene locus_tag LOCUS_20320 45035 45763 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056315.1 protein_id gnl|my_center|LOCUS_20320 50488 47156 gene locus_tag LOCUS_20330 50488 47156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 51871 50567 gene locus_tag LOCUS_20340 gene hemA 51871 50567 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI53 protein_id gnl|my_center|LOCUS_20340 53478 52441 gene locus_tag LOCUS_20350 53478 52441 CDS product D-fructose 1,6-bisphosphatase class 2/sedoheptulose 1,7-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE9 protein_id gnl|my_center|LOCUS_20350 54424 54212 gene locus_tag LOCUS_20360 54424 54212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 54711 58649 gene locus_tag LOCUS_20370 54711 58649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 59838 60725 gene locus_tag LOCUS_20380 59838 60725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 60841 61110 gene locus_tag LOCUS_20390 60841 61110 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence029 1981 476 gene locus_tag LOCUS_20400 gene spoIID 1981 476 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125969.1 protein_id gnl|my_center|LOCUS_20400 5697 2380 gene locus_tag LOCUS_20410 5697 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 6665 5910 gene locus_tag LOCUS_20420 6665 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 protein_id gnl|my_center|LOCUS_20420 7968 6805 gene locus_tag LOCUS_20430 gene nifS 7968 6805 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056757.1 protein_id gnl|my_center|LOCUS_20430 8509 8129 gene locus_tag LOCUS_20440 8509 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057706.1 protein_id gnl|my_center|LOCUS_20440 8775 10178 gene locus_tag LOCUS_20450 8775 10178 CDS product competence protein ComE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058172.1 protein_id gnl|my_center|LOCUS_20450 10522 11664 gene locus_tag LOCUS_20460 gene pyrB 10522 11664 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM4 protein_id gnl|my_center|LOCUS_20460 12533 11712 gene locus_tag LOCUS_20470 12533 11712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 14794 12704 gene locus_tag LOCUS_20480 14794 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 15553 15152 gene locus_tag LOCUS_20490 15553 15152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 16344 15739 gene locus_tag LOCUS_20500 16344 15739 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC5 protein_id gnl|my_center|LOCUS_20500 17238 16684 gene locus_tag LOCUS_20510 gene psbP 17238 16684 CDS product photosystem II oxygen-evolving complex 23K protein PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 protein_id gnl|my_center|LOCUS_20510 17431 18435 gene locus_tag LOCUS_20520 17431 18435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 18672 18493 gene locus_tag LOCUS_20530 18672 18493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055918.1 protein_id gnl|my_center|LOCUS_20530 21098 19050 gene locus_tag LOCUS_20540 21098 19050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 21822 21370 gene locus_tag LOCUS_20550 21822 21370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 23089 23958 gene locus_tag LOCUS_20560 23089 23958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 24542 24691 gene locus_tag LOCUS_20570 24542 24691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 24791 25006 gene locus_tag LOCUS_20580 24791 25006 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_20580 25003 25227 gene locus_tag LOCUS_20590 25003 25227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020810.1 protein_id gnl|my_center|LOCUS_20590 25361 25600 gene locus_tag LOCUS_20600 25361 25600 CDS product addiction module toxin, HicA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_20600 25600 25809 gene locus_tag LOCUS_20610 25600 25809 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_20610 26036 26425 gene locus_tag LOCUS_20620 26036 26425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 26762 26538 gene locus_tag LOCUS_20630 26762 26538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 26941 26780 gene locus_tag LOCUS_20640 26941 26780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 28009 27299 gene locus_tag LOCUS_20650 28009 27299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 30280 28031 gene locus_tag LOCUS_20660 30280 28031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 31653 30277 gene locus_tag LOCUS_20670 31653 30277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 32194 32493 gene locus_tag LOCUS_20680 32194 32493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 33273 32818 gene locus_tag LOCUS_20690 33273 32818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 34039 33530 gene locus_tag LOCUS_20700 34039 33530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 35318 34080 gene locus_tag LOCUS_20710 35318 34080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 37104 36205 gene locus_tag LOCUS_20720 37104 36205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 37997 37515 gene locus_tag LOCUS_20730 37997 37515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057249.1 protein_id gnl|my_center|LOCUS_20730 38323 39270 gene locus_tag LOCUS_20740 gene hemF 38323 39270 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL15 protein_id gnl|my_center|LOCUS_20740 39741 40109 gene locus_tag LOCUS_20750 39741 40109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 40242 41024 gene locus_tag LOCUS_20760 gene thf1 40242 41024 CDS product protein Thf1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJT8 protein_id gnl|my_center|LOCUS_20760 41424 41107 gene locus_tag LOCUS_20770 gene trxM1 41424 41107 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGN0 protein_id gnl|my_center|LOCUS_20770 41577 42353 gene locus_tag LOCUS_20780 gene fabG 41577 42353 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_20780 42444 44135 gene locus_tag LOCUS_20790 gene groL2 42444 44135 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7MBB4 protein_id gnl|my_center|LOCUS_20790 44374 44988 gene locus_tag LOCUS_20800 44374 44988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 46131 45019 gene locus_tag LOCUS_20810 46131 45019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_20810 48343 46274 gene locus_tag LOCUS_20820 48343 46274 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_20820 48799 49704 gene locus_tag LOCUS_20830 48799 49704 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728191.1 protein_id gnl|my_center|LOCUS_20830 50000 50605 gene locus_tag LOCUS_20840 50000 50605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_20840 50794 51012 gene locus_tag LOCUS_20850 50794 51012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 50999 51217 gene locus_tag LOCUS_20860 50999 51217 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_20860 51582 51238 gene locus_tag LOCUS_20870 51582 51238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 51997 51695 gene locus_tag LOCUS_20880 51997 51695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 52477 52037 gene locus_tag LOCUS_20890 52477 52037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 52779 52513 gene locus_tag LOCUS_20900 52779 52513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 53131 52907 gene locus_tag LOCUS_20910 53131 52907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 55050 53395 gene locus_tag LOCUS_20920 55050 53395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 55235 56011 gene locus_tag LOCUS_20930 55235 56011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 56188 57810 gene locus_tag LOCUS_20940 56188 57810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 57885 58928 gene locus_tag LOCUS_20950 57885 58928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 58964 59374 gene locus_tag LOCUS_20960 58964 59374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 59609 59773 gene locus_tag LOCUS_20970 59609 59773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 60260 59901 gene locus_tag LOCUS_20980 60260 59901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 60326 60736 gene locus_tag LOCUS_20990 60326 60736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence030 82 333 gene locus_tag LOCUS_21000 82 333 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_21000 2465 579 gene locus_tag LOCUS_21010 2465 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 3501 2689 gene locus_tag LOCUS_21020 3501 2689 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031846.1 protein_id gnl|my_center|LOCUS_21020 4040 3786 gene locus_tag LOCUS_21030 4040 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 4783 4277 gene locus_tag LOCUS_21040 4783 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 5122 4820 gene locus_tag LOCUS_21050 5122 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 6309 5590 gene locus_tag LOCUS_21060 6309 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 7405 6779 gene locus_tag LOCUS_21070 7405 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 8566 9300 gene locus_tag LOCUS_21080 8566 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 10184 9414 gene locus_tag LOCUS_21090 10184 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 12201 10525 gene locus_tag LOCUS_21100 gene ccmM 12201 10525 CDS product carbon dioxide concentrating mechanism protein CcmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142091.1 protein_id gnl|my_center|LOCUS_21100 12805 12506 gene locus_tag LOCUS_21110 gene ccmL 12805 12506 CDS product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_21110 13315 12974 gene locus_tag LOCUS_21120 gene ccmK1 13315 12974 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_21120 13809 13498 gene locus_tag LOCUS_21130 gene ccmK2 13809 13498 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056791.1 protein_id gnl|my_center|LOCUS_21130 14857 16749 gene locus_tag LOCUS_21140 gene ndhF4 14857 16749 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057958.1 protein_id gnl|my_center|LOCUS_21140 16926 18422 gene locus_tag LOCUS_21150 gene ndhD 16926 18422 CDS product NAD(P)H-quinone oxidoreductase subunit D4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142080.1 protein_id gnl|my_center|LOCUS_21150 18615 19760 gene locus_tag LOCUS_21160 18615 19760 CDS product carbon dioxide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057960.1 protein_id gnl|my_center|LOCUS_21160 20980 19757 gene locus_tag LOCUS_21170 gene proA 20980 19757 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEF6 protein_id gnl|my_center|LOCUS_21170 21439 21032 gene locus_tag LOCUS_21180 21439 21032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057546.1 protein_id gnl|my_center|LOCUS_21180 21741 21670 gene locus_tag LOCUS_t00110 21741 21670 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22441 21854 gene locus_tag LOCUS_21190 gene ribH 22441 21854 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP4 protein_id gnl|my_center|LOCUS_21190 22775 22503 gene locus_tag LOCUS_21200 22775 22503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 23100 26042 gene locus_tag LOCUS_21210 23100 26042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 26087 27244 gene locus_tag LOCUS_21220 gene hisC 26087 27244 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM42 protein_id gnl|my_center|LOCUS_21220 28597 27386 gene locus_tag LOCUS_21230 28597 27386 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057144.1 protein_id gnl|my_center|LOCUS_21230 29037 28666 gene locus_tag LOCUS_21240 29037 28666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 29393 29842 gene locus_tag LOCUS_21250 29393 29842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 30910 30134 gene locus_tag LOCUS_21260 30910 30134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 32005 31256 gene locus_tag LOCUS_21270 32005 31256 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971501.1 protein_id gnl|my_center|LOCUS_21270 32665 32075 gene locus_tag LOCUS_21280 32665 32075 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463775.1 protein_id gnl|my_center|LOCUS_21280 33170 33451 gene locus_tag LOCUS_21290 33170 33451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090339.1 protein_id gnl|my_center|LOCUS_21290 34107 33688 gene locus_tag LOCUS_21300 34107 33688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 34916 34659 gene locus_tag LOCUS_21310 34916 34659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 35417 38536 gene locus_tag LOCUS_21320 35417 38536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 39289 38846 gene locus_tag LOCUS_21330 39289 38846 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142874.1 protein_id gnl|my_center|LOCUS_21330 39675 39289 gene locus_tag LOCUS_21340 gene ycf35 39675 39289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_21340 39924 39715 gene locus_tag LOCUS_21350 39924 39715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 40280 41320 gene locus_tag LOCUS_21360 40280 41320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140531.1 protein_id gnl|my_center|LOCUS_21360 42181 41534 gene locus_tag LOCUS_21370 42181 41534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056349.1 protein_id gnl|my_center|LOCUS_21370 43403 42186 gene locus_tag LOCUS_21380 gene pilC 43403 42186 CDS product pilus biosynthesis protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_21380 44584 43466 gene locus_tag LOCUS_21390 gene pilT 44584 43466 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_21390 46668 44662 gene locus_tag LOCUS_21400 gene pilB 46668 44662 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 protein_id gnl|my_center|LOCUS_21400 46912 47145 gene locus_tag LOCUS_21410 46912 47145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 47284 48081 gene locus_tag LOCUS_21420 gene grpE 47284 48081 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB3 protein_id gnl|my_center|LOCUS_21420 48229 50241 gene locus_tag LOCUS_21430 gene dnaK1 48229 50241 CDS product chaperone protein dnaK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR6 protein_id gnl|my_center|LOCUS_21430 50440 51567 gene locus_tag LOCUS_21440 gene dnaJ 50440 51567 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR7 protein_id gnl|my_center|LOCUS_21440 51564 51839 gene locus_tag LOCUS_21450 51564 51839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056832.1 protein_id gnl|my_center|LOCUS_21450 51832 52956 gene locus_tag LOCUS_21460 gene rsgA 51832 52956 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK79 protein_id gnl|my_center|LOCUS_21460 55457 53013 gene locus_tag LOCUS_21470 gene pheT 55457 53013 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL37 protein_id gnl|my_center|LOCUS_21470 56119 57486 gene locus_tag LOCUS_21480 56119 57486 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 protein_id gnl|my_center|LOCUS_21480 59097 57598 gene locus_tag LOCUS_21490 59097 57598 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948684.1 protein_id gnl|my_center|LOCUS_21490 60480 59272 gene locus_tag LOCUS_21500 60480 59272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence031 1917 640 gene locus_tag LOCUS_21510 1917 640 CDS product carbon dioxide concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_21510 3145 2153 gene locus_tag LOCUS_21520 3145 2153 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056436.1 protein_id gnl|my_center|LOCUS_21520 4168 3392 gene locus_tag LOCUS_21530 gene btpA 4168 3392 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 protein_id gnl|my_center|LOCUS_21530 5188 6510 gene locus_tag LOCUS_21540 gene rimO 5188 6510 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL8 protein_id gnl|my_center|LOCUS_21540 7331 8740 gene locus_tag LOCUS_21550 gene cshA 7331 8740 CDS product DEAD-box ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHF7 protein_id gnl|my_center|LOCUS_21550 8930 10060 gene locus_tag LOCUS_21560 gene thrC 8930 10060 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJJ6 protein_id gnl|my_center|LOCUS_21560 11212 10400 gene locus_tag LOCUS_21570 11212 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 17140 11375 gene locus_tag LOCUS_21580 17140 11375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 18087 17299 gene locus_tag LOCUS_21590 18087 17299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 18969 18517 gene locus_tag LOCUS_21600 18969 18517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 21151 19592 gene locus_tag LOCUS_21610 21151 19592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 21513 21713 gene locus_tag LOCUS_21620 21513 21713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 22403 23485 gene locus_tag LOCUS_21630 22403 23485 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5M7 protein_id gnl|my_center|LOCUS_21630 24065 26356 gene locus_tag LOCUS_21640 24065 26356 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_21640 26310 26756 gene locus_tag LOCUS_21650 26310 26756 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_21650 26864 28042 gene locus_tag LOCUS_21660 26864 28042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 28319 28152 gene locus_tag LOCUS_21670 28319 28152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 29305 28319 gene locus_tag LOCUS_21680 29305 28319 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709054.1 protein_id gnl|my_center|LOCUS_21680 32059 30308 gene locus_tag LOCUS_21690 32059 30308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056794.1 protein_id gnl|my_center|LOCUS_21690 33567 32599 gene locus_tag LOCUS_21700 gene kch 33567 32599 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842311.1 protein_id gnl|my_center|LOCUS_21700 33921 36905 gene locus_tag LOCUS_21710 gene uvrA 33921 36905 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD5 protein_id gnl|my_center|LOCUS_21710 37038 37376 gene locus_tag LOCUS_21720 37038 37376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 37504 38796 gene locus_tag LOCUS_21730 37504 38796 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057131.1 protein_id gnl|my_center|LOCUS_21730 39193 38924 gene locus_tag LOCUS_21740 gene psaK 39193 38924 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125081.1 protein_id gnl|my_center|LOCUS_21740 39605 41149 gene locus_tag LOCUS_21750 39605 41149 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124464.1 protein_id gnl|my_center|LOCUS_21750 42901 41663 gene locus_tag LOCUS_21760 42901 41663 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 protein_id gnl|my_center|LOCUS_21760 43307 43382 gene locus_tag LOCUS_t00120 43307 43382 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 43513 44961 gene locus_tag LOCUS_21770 gene gltX 43513 44961 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI5 protein_id gnl|my_center|LOCUS_21770 45895 45116 gene locus_tag LOCUS_21780 gene dltE 45895 45116 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_21780 46849 46034 gene locus_tag LOCUS_21790 gene ydfG 46849 46034 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588802.1 protein_id gnl|my_center|LOCUS_21790 48816 47284 gene locus_tag LOCUS_21800 48816 47284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_21800 50626 49133 gene locus_tag LOCUS_21810 gene gbcB 50626 49133 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096769.1 protein_id gnl|my_center|LOCUS_21810 51668 52222 gene locus_tag LOCUS_21820 51668 52222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 53892 55451 gene locus_tag LOCUS_21830 53892 55451 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_21830 56263 55628 gene locus_tag LOCUS_21840 56263 55628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 57113 56268 gene locus_tag LOCUS_21850 57113 56268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 58146 57499 gene locus_tag LOCUS_21860 58146 57499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_21860 59669 58236 gene locus_tag LOCUS_21870 59669 58236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 59986 59914 gene locus_tag LOCUS_t00130 59986 59914 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence032 439 173 gene locus_tag LOCUS_21880 439 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 930 2639 gene locus_tag LOCUS_21890 930 2639 CDS product dynamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_21890 3029 3202 gene locus_tag LOCUS_21900 3029 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 3748 3314 gene locus_tag LOCUS_21910 3748 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 3899 4183 gene locus_tag LOCUS_21920 3899 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 4484 4750 gene locus_tag LOCUS_21930 4484 4750 CDS product UPF0296 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ID1 protein_id gnl|my_center|LOCUS_21930 4775 5329 gene locus_tag LOCUS_21940 gene gmk 4775 5329 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ7 protein_id gnl|my_center|LOCUS_21940 5546 5872 gene locus_tag LOCUS_21950 5546 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 6525 6037 gene locus_tag LOCUS_21960 6525 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 7397 6597 gene locus_tag LOCUS_21970 7397 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21970 8969 7467 gene locus_tag LOCUS_21980 8969 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 10571 8991 gene locus_tag LOCUS_21990 10571 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887878.1 protein_id gnl|my_center|LOCUS_21990 10878 11705 gene locus_tag LOCUS_22000 10878 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 11868 13010 gene locus_tag LOCUS_22010 11868 13010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 13264 13334 gene locus_tag LOCUS_t00140 13264 13334 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 15996 13393 gene locus_tag LOCUS_22020 15996 13393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 17476 16265 gene locus_tag LOCUS_22030 17476 16265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 18166 19134 gene locus_tag LOCUS_22040 18166 19134 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709054.1 protein_id gnl|my_center|LOCUS_22040 20245 19268 gene locus_tag LOCUS_22050 gene glk 20245 19268 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLF5 protein_id gnl|my_center|LOCUS_22050 21366 20317 gene locus_tag LOCUS_22060 21366 20317 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056814.1 protein_id gnl|my_center|LOCUS_22060 22186 21515 gene locus_tag LOCUS_22070 gene yniC 22186 21515 CDS product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070789.1 protein_id gnl|my_center|LOCUS_22070 23175 22198 gene locus_tag LOCUS_22080 23175 22198 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083017.1 protein_id gnl|my_center|LOCUS_22080 24695 23175 gene locus_tag LOCUS_22090 24695 23175 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867786.1 protein_id gnl|my_center|LOCUS_22090 25690 27033 gene locus_tag LOCUS_22100 25690 27033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 27375 27584 gene locus_tag LOCUS_22110 27375 27584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 28935 30674 gene locus_tag LOCUS_22120 28935 30674 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_22120 30718 31680 gene locus_tag LOCUS_22130 30718 31680 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141945.1 protein_id gnl|my_center|LOCUS_22130 31742 32068 gene locus_tag LOCUS_22140 31742 32068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 32193 33104 gene locus_tag LOCUS_22150 32193 33104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 33138 36572 gene locus_tag LOCUS_22160 33138 36572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 36598 36855 gene locus_tag LOCUS_22170 gene acpK 36598 36855 CDS product polyketide biosynthesis acyl-carrier-protein AcpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7PC63 protein_id gnl|my_center|LOCUS_22170 36932 38155 gene locus_tag LOCUS_22180 gene pksF 36932 38155 CDS product polyketide biosynthesis malonyl-ACP decarboxylase PksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40804 protein_id gnl|my_center|LOCUS_22180 38136 39395 gene locus_tag LOCUS_22190 gene pksG 38136 39395 CDS product polyketide biosynthesis 3-hydroxy-3-methylglutaryl-ACP synthase PksG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40830 protein_id gnl|my_center|LOCUS_22190 39386 40162 gene locus_tag LOCUS_22200 gene pksH 39386 40162 CDS product putative polyketide biosynthesis enoyl-CoA hydratase PksH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40805 protein_id gnl|my_center|LOCUS_22200 40150 51510 gene locus_tag LOCUS_22210 40150 51510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 51510 58856 gene locus_tag LOCUS_22220 51510 58856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence033 12910 5966 gene locus_tag LOCUS_22230 12910 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 13557 13285 gene locus_tag LOCUS_22240 13557 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22240 14568 15185 gene locus_tag LOCUS_22250 14568 15185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 15227 15517 gene locus_tag LOCUS_22260 15227 15517 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125708.1 protein_id gnl|my_center|LOCUS_22260 16064 15636 gene locus_tag LOCUS_22270 16064 15636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 16297 17157 gene locus_tag LOCUS_22280 16297 17157 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_22280 18280 17384 gene locus_tag LOCUS_22290 18280 17384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057104.1 protein_id gnl|my_center|LOCUS_22290 19390 18341 gene locus_tag LOCUS_22300 19390 18341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143786.1 protein_id gnl|my_center|LOCUS_22300 20346 19477 gene locus_tag LOCUS_22310 20346 19477 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_22310 20683 20360 gene locus_tag LOCUS_22320 20683 20360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 20984 21057 gene locus_tag LOCUS_t00150 20984 21057 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 21690 21394 gene locus_tag LOCUS_22330 21690 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056708.1 protein_id gnl|my_center|LOCUS_22330 22640 23278 gene locus_tag LOCUS_22340 22640 23278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 23294 23887 gene locus_tag LOCUS_22350 23294 23887 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055910.1 protein_id gnl|my_center|LOCUS_22350 26173 24338 gene locus_tag LOCUS_22360 26173 24338 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057670.1 protein_id gnl|my_center|LOCUS_22360 27093 26521 gene locus_tag LOCUS_22370 27093 26521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_22370 27667 28497 gene locus_tag LOCUS_22380 27667 28497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144107.1 protein_id gnl|my_center|LOCUS_22380 28733 29434 gene locus_tag LOCUS_22390 28733 29434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143627.1 protein_id gnl|my_center|LOCUS_22390 30888 29482 gene locus_tag LOCUS_22400 30888 29482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 33682 30977 gene locus_tag LOCUS_22410 33682 30977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 36007 33749 gene locus_tag LOCUS_22420 36007 33749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 36968 36057 gene locus_tag LOCUS_22430 36968 36057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 37285 36965 gene locus_tag LOCUS_22440 37285 36965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 38973 38719 gene locus_tag LOCUS_22450 38973 38719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 43623 39631 gene locus_tag LOCUS_22460 gene chlH 43623 39631 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056126.1 protein_id gnl|my_center|LOCUS_22460 44374 46143 gene locus_tag LOCUS_22470 44374 46143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 46361 46852 gene locus_tag LOCUS_22480 46361 46852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 47240 46911 gene locus_tag LOCUS_22490 47240 46911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 48643 47549 gene locus_tag LOCUS_22500 48643 47549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 49111 49344 gene locus_tag LOCUS_22510 49111 49344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 50001 51680 gene locus_tag LOCUS_22520 50001 51680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 51683 52942 gene locus_tag LOCUS_22530 51683 52942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 53231 54553 gene locus_tag LOCUS_22540 53231 54553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 54798 55997 gene locus_tag LOCUS_22550 54798 55997 CDS product L-gulono-1,4-lactone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIT3 protein_id gnl|my_center|LOCUS_22550 >Feature sequence034 1284 1087 gene locus_tag LOCUS_22560 1284 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1526 2536 gene locus_tag LOCUS_22570 1526 2536 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_22570 2652 3785 gene locus_tag LOCUS_22580 2652 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 4822 4166 gene locus_tag LOCUS_22590 4822 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 5632 9084 gene locus_tag LOCUS_22600 5632 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 9308 12853 gene locus_tag LOCUS_22610 9308 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_22610 12983 13957 gene locus_tag LOCUS_22620 12983 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_22620 14506 14105 gene locus_tag LOCUS_22630 14506 14105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 15648 15253 gene locus_tag LOCUS_22640 15648 15253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 16924 16106 gene locus_tag LOCUS_22650 16924 16106 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057297.1 protein_id gnl|my_center|LOCUS_22650 17911 17555 gene locus_tag LOCUS_22660 17911 17555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 19448 17934 gene locus_tag LOCUS_22670 19448 17934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 20659 19436 gene locus_tag LOCUS_22680 20659 19436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 21732 20884 gene locus_tag LOCUS_22690 21732 20884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 26085 21775 gene locus_tag LOCUS_22700 26085 21775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 28183 26078 gene locus_tag LOCUS_22710 28183 26078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 30384 28180 gene locus_tag LOCUS_22720 30384 28180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 32071 30377 gene locus_tag LOCUS_22730 32071 30377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 33525 32146 gene locus_tag LOCUS_22740 33525 32146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 35507 34554 gene locus_tag LOCUS_22750 35507 34554 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056905.1 protein_id gnl|my_center|LOCUS_22750 36059 35553 gene locus_tag LOCUS_22760 gene ycf36 36059 35553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056906.1 protein_id gnl|my_center|LOCUS_22760 36492 36085 gene locus_tag LOCUS_22770 gene rsfS 36492 36085 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK1 protein_id gnl|my_center|LOCUS_22770 37275 36661 gene locus_tag LOCUS_22780 37275 36661 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057165.1 protein_id gnl|my_center|LOCUS_22780 38805 37714 gene locus_tag LOCUS_22790 38805 37714 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEB1 protein_id gnl|my_center|LOCUS_22790 38909 39079 gene locus_tag LOCUS_22800 38909 39079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057753.1 protein_id gnl|my_center|LOCUS_22800 39915 40226 gene locus_tag LOCUS_22810 39915 40226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057054.1 protein_id gnl|my_center|LOCUS_22810 40300 40758 gene locus_tag LOCUS_22820 40300 40758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 40782 41858 gene locus_tag LOCUS_22830 40782 41858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 42153 42569 gene locus_tag LOCUS_22840 42153 42569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 43013 42750 gene locus_tag LOCUS_22850 43013 42750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 43625 45088 gene locus_tag LOCUS_22860 43625 45088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_22860 45560 46789 gene locus_tag LOCUS_22870 45560 46789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144202.1 protein_id gnl|my_center|LOCUS_22870 47208 46828 gene locus_tag LOCUS_22880 47208 46828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 52000 47222 gene locus_tag LOCUS_22890 52000 47222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 53528 52218 gene locus_tag LOCUS_22900 53528 52218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence035 969 271 gene locus_tag LOCUS_22910 969 271 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056208.1 protein_id gnl|my_center|LOCUS_22910 2349 1348 gene locus_tag LOCUS_22920 2349 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_22920 2615 3988 gene locus_tag LOCUS_22930 2615 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 4379 6295 gene locus_tag LOCUS_22940 4379 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 6493 6723 gene locus_tag LOCUS_22950 6493 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 7373 7119 gene locus_tag LOCUS_22960 7373 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 8146 10179 gene locus_tag LOCUS_22970 8146 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 10185 10853 gene locus_tag LOCUS_22980 10185 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 10876 13710 gene locus_tag LOCUS_22990 10876 13710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 13978 15171 gene locus_tag LOCUS_23000 13978 15171 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_23000 16490 15168 gene locus_tag LOCUS_23010 16490 15168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393799.1 protein_id gnl|my_center|LOCUS_23010 18975 17119 gene locus_tag LOCUS_23020 gene dnaK2 18975 17119 CDS product chaperone protein dnaK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI58 protein_id gnl|my_center|LOCUS_23020 20054 21088 gene locus_tag LOCUS_23030 20054 21088 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK75 protein_id gnl|my_center|LOCUS_23030 21258 21437 gene locus_tag LOCUS_23040 21258 21437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 23721 21637 gene locus_tag LOCUS_23050 gene ligA 23721 21637 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK2 protein_id gnl|my_center|LOCUS_23050 23917 24363 gene locus_tag LOCUS_23060 23917 24363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071088.1 protein_id gnl|my_center|LOCUS_23060 26047 27846 gene locus_tag LOCUS_23070 26047 27846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 28554 28366 gene locus_tag LOCUS_23080 28554 28366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 29552 28551 gene locus_tag LOCUS_23090 29552 28551 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI38 protein_id gnl|my_center|LOCUS_23090 29961 30344 gene locus_tag LOCUS_23100 29961 30344 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056992.1 protein_id gnl|my_center|LOCUS_23100 31514 32248 gene locus_tag LOCUS_23110 31514 32248 CDS product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141847.1 protein_id gnl|my_center|LOCUS_23110 33626 33381 gene locus_tag LOCUS_23120 gene psbE 33626 33381 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP0 protein_id gnl|my_center|LOCUS_23120 34752 33760 gene locus_tag LOCUS_23130 34752 33760 CDS product Ycf48-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI95 protein_id gnl|my_center|LOCUS_23130 35248 34901 gene locus_tag LOCUS_23140 35248 34901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 35571 35933 gene locus_tag LOCUS_23150 gene ndhC 35571 35933 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ02 protein_id gnl|my_center|LOCUS_23150 35930 36676 gene locus_tag LOCUS_23160 gene ndhK 35930 36676 CDS product NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ4 protein_id gnl|my_center|LOCUS_23160 36669 37199 gene locus_tag LOCUS_23170 gene ndhJ 36669 37199 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ01 protein_id gnl|my_center|LOCUS_23170 38528 37272 gene locus_tag LOCUS_23180 38528 37272 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057839.1 protein_id gnl|my_center|LOCUS_23180 40754 39636 gene locus_tag LOCUS_23190 40754 39636 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974018.1 protein_id gnl|my_center|LOCUS_23190 41167 42420 gene locus_tag LOCUS_23200 gene dxr 41167 42420 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK30 protein_id gnl|my_center|LOCUS_23200 42573 44159 gene locus_tag LOCUS_23210 gene pgi 42573 44159 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY2 protein_id gnl|my_center|LOCUS_23210 44409 46073 gene locus_tag LOCUS_23220 44409 46073 CDS product preprotein translocase subunit Tim44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_23220 46307 47002 gene locus_tag LOCUS_23230 46307 47002 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058278.1 protein_id gnl|my_center|LOCUS_23230 47496 47071 gene locus_tag LOCUS_23240 47496 47071 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_23240 47734 49125 gene locus_tag LOCUS_23250 47734 49125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 49591 49238 gene locus_tag LOCUS_23260 49591 49238 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKX6 protein_id gnl|my_center|LOCUS_23260 51022 50036 gene locus_tag LOCUS_23270 gene murB 51022 50036 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV6 protein_id gnl|my_center|LOCUS_23270 52771 51248 gene locus_tag LOCUS_23280 gene murC 52771 51248 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV5 protein_id gnl|my_center|LOCUS_23280 53388 54401 gene locus_tag LOCUS_23290 53388 54401 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIW5 protein_id gnl|my_center|LOCUS_23290 54792 54619 gene locus_tag LOCUS_23300 54792 54619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence036 1598 276 gene locus_tag LOCUS_23310 1598 276 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058123.1 protein_id gnl|my_center|LOCUS_23310 1929 2489 gene locus_tag LOCUS_23320 1929 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 8134 2807 gene locus_tag LOCUS_23330 8134 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057482.1 protein_id gnl|my_center|LOCUS_23330 9078 9707 gene locus_tag LOCUS_23340 9078 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869506.1 protein_id gnl|my_center|LOCUS_23340 9740 10819 gene locus_tag LOCUS_23350 9740 10819 CDS product IS element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_454711.1 protein_id gnl|my_center|LOCUS_23350 14199 10843 gene locus_tag LOCUS_23360 14199 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 16236 14575 gene locus_tag LOCUS_23370 16236 14575 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 protein_id gnl|my_center|LOCUS_23370 19023 17101 gene locus_tag LOCUS_23380 gene uvrC 19023 17101 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI39 protein_id gnl|my_center|LOCUS_23380 19674 19297 gene locus_tag LOCUS_23390 19674 19297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 19830 20612 gene locus_tag LOCUS_23400 19830 20612 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143437.1 protein_id gnl|my_center|LOCUS_23400 22367 20940 gene locus_tag LOCUS_23410 22367 20940 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLC0 protein_id gnl|my_center|LOCUS_23410 22506 23432 gene locus_tag LOCUS_23420 22506 23432 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385089.1 protein_id gnl|my_center|LOCUS_23420 23742 24767 gene locus_tag LOCUS_23430 23742 24767 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 protein_id gnl|my_center|LOCUS_23430 24926 25648 gene locus_tag LOCUS_23440 24926 25648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 25977 28799 gene locus_tag LOCUS_23450 gene ileS 25977 28799 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI7 protein_id gnl|my_center|LOCUS_23450 29809 28907 gene locus_tag LOCUS_23460 29809 28907 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 protein_id gnl|my_center|LOCUS_23460 32580 31090 gene locus_tag LOCUS_23470 gene gbcB 32580 31090 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096769.1 protein_id gnl|my_center|LOCUS_23470 34910 33153 gene locus_tag LOCUS_23480 34910 33153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 36901 36425 gene locus_tag LOCUS_23490 36901 36425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 37142 37564 gene locus_tag LOCUS_23500 37142 37564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140769.1 protein_id gnl|my_center|LOCUS_23500 37744 38502 gene locus_tag LOCUS_23510 37744 38502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 38811 39254 gene locus_tag LOCUS_23520 38811 39254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 39716 40147 gene locus_tag LOCUS_23530 39716 40147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 40409 40777 gene locus_tag LOCUS_23540 40409 40777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 41248 41964 gene locus_tag LOCUS_23550 41248 41964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 42574 43176 gene locus_tag LOCUS_23560 42574 43176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141514.1 protein_id gnl|my_center|LOCUS_23560 43388 44257 gene locus_tag LOCUS_23570 43388 44257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141513.1 protein_id gnl|my_center|LOCUS_23570 44454 44383 gene locus_tag LOCUS_t00160 44454 44383 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 46591 44648 gene locus_tag LOCUS_23580 gene ycf45 46591 44648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 protein_id gnl|my_center|LOCUS_23580 47855 46746 gene locus_tag LOCUS_23590 47855 46746 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056586.1 protein_id gnl|my_center|LOCUS_23590 48907 48287 gene locus_tag LOCUS_23600 48907 48287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 49696 49244 gene locus_tag LOCUS_23610 49696 49244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 50423 49818 gene locus_tag LOCUS_23620 50423 49818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 51216 50722 gene locus_tag LOCUS_23630 gene ndhN 51216 50722 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJU2 protein_id gnl|my_center|LOCUS_23630 51593 52957 gene locus_tag LOCUS_23640 51593 52957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057293.1 protein_id gnl|my_center|LOCUS_23640 54107 53046 gene locus_tag LOCUS_23650 54107 53046 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence037 <1 4361 gene locus_tag LOCUS_23660 <1 4361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141952.1:polyketide synthase 5290 6621 gene locus_tag LOCUS_23670 5290 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 6961 7866 gene locus_tag LOCUS_23680 6961 7866 CDS product 2-hydroxy-6-oxohepta-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 protein_id gnl|my_center|LOCUS_23680 8736 8005 gene locus_tag LOCUS_23690 8736 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 10855 8741 gene locus_tag LOCUS_23700 10855 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 11976 11122 gene locus_tag LOCUS_23710 11976 11122 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975514.1 protein_id gnl|my_center|LOCUS_23710 14246 12162 gene locus_tag LOCUS_23720 14246 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 18702 14434 gene locus_tag LOCUS_23730 18702 14434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 18893 19345 gene locus_tag LOCUS_23740 18893 19345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 21673 19391 gene locus_tag LOCUS_23750 21673 19391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 22742 21681 gene locus_tag LOCUS_23760 22742 21681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 23102 24481 gene locus_tag LOCUS_23770 23102 24481 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_23770 25630 24800 gene locus_tag LOCUS_23780 25630 24800 CDS product TIGR00268 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057083.1 protein_id gnl|my_center|LOCUS_23780 26823 25816 gene locus_tag LOCUS_23790 26823 25816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 28394 27621 gene locus_tag LOCUS_23800 28394 27621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_23800 29531 28863 gene locus_tag LOCUS_23810 29531 28863 CDS product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056065.1 protein_id gnl|my_center|LOCUS_23810 30020 29739 gene locus_tag LOCUS_23820 gene clpS 30020 29739 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056066.1 protein_id gnl|my_center|LOCUS_23820 30145 31047 gene locus_tag LOCUS_23830 30145 31047 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_23830 31318 32274 gene locus_tag LOCUS_23840 31318 32274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 34248 32941 gene locus_tag LOCUS_23850 34248 32941 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC8 protein_id gnl|my_center|LOCUS_23850 35000 35743 gene locus_tag LOCUS_23860 35000 35743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 35900 36382 gene locus_tag LOCUS_23870 35900 36382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 37088 36531 gene locus_tag LOCUS_23880 37088 36531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141484.1 protein_id gnl|my_center|LOCUS_23880 39106 37127 gene locus_tag LOCUS_23890 39106 37127 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 protein_id gnl|my_center|LOCUS_23890 39901 40869 gene locus_tag LOCUS_23900 39901 40869 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_23900 41225 42220 gene locus_tag LOCUS_23910 41225 42220 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272452.1 protein_id gnl|my_center|LOCUS_23910 42300 42605 gene locus_tag LOCUS_23920 42300 42605 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122598.1 protein_id gnl|my_center|LOCUS_23920 42784 43605 gene locus_tag LOCUS_23930 42784 43605 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232471.2 protein_id gnl|my_center|LOCUS_23930 43737 44594 gene locus_tag LOCUS_23940 gene pstC 43737 44594 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9I6 protein_id gnl|my_center|LOCUS_23940 44587 45525 gene locus_tag LOCUS_23950 44587 45525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 45601 46446 gene locus_tag LOCUS_23960 45601 46446 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_23960 47704 46499 gene locus_tag LOCUS_23970 47704 46499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 49224 48046 gene locus_tag LOCUS_23980 49224 48046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 50748 51278 gene locus_tag LOCUS_23990 50748 51278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 51526 52071 gene locus_tag LOCUS_24000 51526 52071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 52931 53659 gene locus_tag LOCUS_24010 52931 53659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence038 3617 723 gene locus_tag LOCUS_24020 3617 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 4354 4608 gene locus_tag LOCUS_24030 4354 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 5603 5037 gene locus_tag LOCUS_24040 5603 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_24040 9081 5584 gene locus_tag LOCUS_24050 9081 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_24050 9958 9086 gene locus_tag LOCUS_24060 9958 9086 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257980.1 protein_id gnl|my_center|LOCUS_24060 10228 11997 gene locus_tag LOCUS_24070 gene mutL 10228 11997 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL47 protein_id gnl|my_center|LOCUS_24070 12698 19948 gene locus_tag LOCUS_24080 12698 19948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 20005 28698 gene locus_tag LOCUS_24090 20005 28698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 28926 29882 gene locus_tag LOCUS_24100 28926 29882 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057245.1 protein_id gnl|my_center|LOCUS_24100 30505 30185 gene locus_tag LOCUS_24110 30505 30185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 31956 30562 gene locus_tag LOCUS_24120 gene fum 31956 30562 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRE5 protein_id gnl|my_center|LOCUS_24120 32477 32872 gene locus_tag LOCUS_24130 32477 32872 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSF7 protein_id gnl|my_center|LOCUS_24130 33785 33093 gene locus_tag LOCUS_24140 33785 33093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 35649 33886 gene locus_tag LOCUS_24150 35649 33886 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118712.1 protein_id gnl|my_center|LOCUS_24150 36859 36140 gene locus_tag LOCUS_24160 gene yfcG 36859 36140 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071741.1 protein_id gnl|my_center|LOCUS_24160 37516 36899 gene locus_tag LOCUS_24170 37516 36899 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789166.1 protein_id gnl|my_center|LOCUS_24170 37646 38074 gene locus_tag LOCUS_24180 37646 38074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 38426 39655 gene locus_tag LOCUS_24190 38426 39655 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 protein_id gnl|my_center|LOCUS_24190 40249 39662 gene locus_tag LOCUS_24200 40249 39662 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_24200 40748 45694 gene locus_tag LOCUS_24210 40748 45694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 46672 45833 gene locus_tag LOCUS_24220 46672 45833 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528620.1 protein_id gnl|my_center|LOCUS_24220 47713 48267 gene locus_tag LOCUS_24230 47713 48267 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_24230 49747 48815 gene locus_tag LOCUS_24240 49747 48815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 51480 50443 gene locus_tag LOCUS_24250 51480 50443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 52120 51524 gene locus_tag LOCUS_24260 52120 51524 CDS product IS607 family transposase ISTko1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence039 1178 324 gene locus_tag LOCUS_24270 1178 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2008 1301 gene locus_tag LOCUS_24280 2008 1301 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057970.1 protein_id gnl|my_center|LOCUS_24280 2368 3648 gene locus_tag LOCUS_24290 2368 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 4674 5369 gene locus_tag LOCUS_24300 4674 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 6179 5791 gene locus_tag LOCUS_tm00010 6179 5791 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 7503 6340 gene locus_tag LOCUS_24310 7503 6340 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_24310 8642 7773 gene locus_tag LOCUS_24320 8642 7773 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057495.1 protein_id gnl|my_center|LOCUS_24320 9886 9671 gene locus_tag LOCUS_24330 9886 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 10355 10999 gene locus_tag LOCUS_24340 gene pdxH 10355 10999 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WN7 protein_id gnl|my_center|LOCUS_24340 13243 11171 gene locus_tag LOCUS_24350 13243 11171 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 protein_id gnl|my_center|LOCUS_24350 14221 13442 gene locus_tag LOCUS_24360 14221 13442 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_24360 14972 14466 gene locus_tag LOCUS_24370 14972 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058114.1 protein_id gnl|my_center|LOCUS_24370 15335 16915 gene locus_tag LOCUS_24380 gene serA 15335 16915 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM01 protein_id gnl|my_center|LOCUS_24380 17096 17989 gene locus_tag LOCUS_24390 gene prmA 17096 17989 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM00 protein_id gnl|my_center|LOCUS_24390 18712 18074 gene locus_tag LOCUS_24400 gene cpcF 18712 18074 CDS product phycocyanobilin lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50038 protein_id gnl|my_center|LOCUS_24400 19869 19033 gene locus_tag LOCUS_24410 gene cpcE 19869 19033 CDS product phycocyanobilin lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50037 protein_id gnl|my_center|LOCUS_24410 20605 20117 gene locus_tag LOCUS_24420 gene cpcA 20605 20117 CDS product C-phycocyanin alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50032 protein_id gnl|my_center|LOCUS_24420 21213 20695 gene locus_tag LOCUS_24430 gene cpcB 21213 20695 CDS product C-phycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50033 protein_id gnl|my_center|LOCUS_24430 22485 21757 gene locus_tag LOCUS_24440 gene cpcG2 22485 21757 CDS product phycobilisome rod-core linker polypeptide CpcG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50040 protein_id gnl|my_center|LOCUS_24440 23817 23071 gene locus_tag LOCUS_24450 gene pebB 23817 23071 CDS product phycoerythrobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL65 protein_id gnl|my_center|LOCUS_24450 24551 23814 gene locus_tag LOCUS_24460 gene pebA 24551 23814 CDS product 15,16-dihydrobiliverdin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL66 protein_id gnl|my_center|LOCUS_24460 25052 26332 gene locus_tag LOCUS_24470 25052 26332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 27053 26397 gene locus_tag LOCUS_24480 gene nblB 27053 26397 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141257.1 protein_id gnl|my_center|LOCUS_24480 27790 29136 gene locus_tag LOCUS_24490 27790 29136 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_24490 29481 30053 gene locus_tag LOCUS_24500 29481 30053 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141254.1 protein_id gnl|my_center|LOCUS_24500 30152 30703 gene locus_tag LOCUS_24510 gene cpcS 30152 30703 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU5 protein_id gnl|my_center|LOCUS_24510 31103 31639 gene locus_tag LOCUS_24520 gene cpeS 31103 31639 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD4 protein_id gnl|my_center|LOCUS_24520 31725 32336 gene locus_tag LOCUS_24530 gene cpcT3 31725 32336 CDS product chromophore lyase CpcT/CpeT 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD3 protein_id gnl|my_center|LOCUS_24530 33560 34093 gene locus_tag LOCUS_24540 gene cpeB 33560 34093 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141190.1 protein_id gnl|my_center|LOCUS_24540 34198 34692 gene locus_tag LOCUS_24550 gene cpeA 34198 34692 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141189.1 protein_id gnl|my_center|LOCUS_24550 34899 36179 gene locus_tag LOCUS_24560 gene cpeY 34899 36179 CDS product phycocyanin operon protein Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141188.1 protein_id gnl|my_center|LOCUS_24560 36425 36958 gene locus_tag LOCUS_24570 gene cpeB 36425 36958 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141190.1 protein_id gnl|my_center|LOCUS_24570 37034 37522 gene locus_tag LOCUS_24580 gene cpeA 37034 37522 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141189.1 protein_id gnl|my_center|LOCUS_24580 37908 38531 gene locus_tag LOCUS_24590 gene cpeZ 37908 38531 CDS product phycocyanin operon protein Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141187.1 protein_id gnl|my_center|LOCUS_24590 39647 38643 gene locus_tag LOCUS_24600 39647 38643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 41690 39864 gene locus_tag LOCUS_24610 41690 39864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 43066 42305 gene locus_tag LOCUS_24620 gene cpeE 43066 42305 CDS product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141265.1 protein_id gnl|my_center|LOCUS_24620 44027 43233 gene locus_tag LOCUS_24630 gene cpeE 44027 43233 CDS product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141265.1 protein_id gnl|my_center|LOCUS_24630 44864 44073 gene locus_tag LOCUS_24640 gene cpeD 44864 44073 CDS product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141264.1 protein_id gnl|my_center|LOCUS_24640 45924 45055 gene locus_tag LOCUS_24650 gene cpeC 45924 45055 CDS product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141263.1 protein_id gnl|my_center|LOCUS_24650 47321 46455 gene locus_tag LOCUS_24660 47321 46455 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141255.1 protein_id gnl|my_center|LOCUS_24660 47582 47376 gene locus_tag LOCUS_24670 47582 47376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 48725 47862 gene locus_tag LOCUS_24680 48725 47862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141258.1 protein_id gnl|my_center|LOCUS_24680 48859 49452 gene locus_tag LOCUS_24690 gene cpcS 48859 49452 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL67 protein_id gnl|my_center|LOCUS_24690 >Feature sequence040 1705 1493 gene locus_tag LOCUS_24700 1705 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 2377 1802 gene locus_tag LOCUS_24710 2377 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_24710 3480 2593 gene locus_tag LOCUS_24720 3480 2593 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058188.1 protein_id gnl|my_center|LOCUS_24720 4441 3557 gene locus_tag LOCUS_24730 4441 3557 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056948.1 protein_id gnl|my_center|LOCUS_24730 5948 4557 gene locus_tag LOCUS_24740 5948 4557 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM2 protein_id gnl|my_center|LOCUS_24740 7296 6112 gene locus_tag LOCUS_24750 7296 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 7918 9747 gene locus_tag LOCUS_24760 7918 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 10912 9800 gene locus_tag LOCUS_24770 10912 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057388.1 protein_id gnl|my_center|LOCUS_24770 11221 11862 gene locus_tag LOCUS_24780 gene trmB 11221 11862 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH6 protein_id gnl|my_center|LOCUS_24780 11989 13281 gene locus_tag LOCUS_24790 11989 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 13348 13545 gene locus_tag LOCUS_24800 gene rpmI 13348 13545 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH01 protein_id gnl|my_center|LOCUS_24800 13607 13960 gene locus_tag LOCUS_24810 gene rplT 13607 13960 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH02 protein_id gnl|my_center|LOCUS_24810 14354 15115 gene locus_tag LOCUS_24820 14354 15115 CDS product glutamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142777.1 protein_id gnl|my_center|LOCUS_24820 15108 15635 gene locus_tag LOCUS_24830 15108 15635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 16356 15658 gene locus_tag LOCUS_24840 16356 15658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144133.1 protein_id gnl|my_center|LOCUS_24840 16338 16502 gene locus_tag LOCUS_24850 16338 16502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 16518 17429 gene locus_tag LOCUS_24860 16518 17429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_24860 18552 17500 gene locus_tag LOCUS_24870 18552 17500 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258617.1 protein_id gnl|my_center|LOCUS_24870 19764 18577 gene locus_tag LOCUS_24880 19764 18577 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_24880 20017 19781 gene locus_tag LOCUS_24890 20017 19781 CDS product hydrogenase assembly protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_24890 22366 20024 gene locus_tag LOCUS_24900 gene hypF 22366 20024 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66902 protein_id gnl|my_center|LOCUS_24900 25418 22701 gene locus_tag LOCUS_24910 25418 22701 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141077.1 protein_id gnl|my_center|LOCUS_24910 26448 25687 gene locus_tag LOCUS_24920 gene hypB 26448 25687 CDS product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_24920 26792 26451 gene locus_tag LOCUS_24930 gene hypA 26792 26451 CDS product putative hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G73 protein_id gnl|my_center|LOCUS_24930 27468 27010 gene locus_tag LOCUS_24940 27468 27010 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257075.1 protein_id gnl|my_center|LOCUS_24940 29205 27781 gene locus_tag LOCUS_24950 29205 27781 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_24950 30039 29425 gene locus_tag LOCUS_24960 30039 29425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 30914 30366 gene locus_tag LOCUS_24970 30914 30366 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_24970 31320 30937 gene locus_tag LOCUS_24980 31320 30937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 32113 31397 gene locus_tag LOCUS_24990 32113 31397 CDS product hydrogenase HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_24990 34069 32420 gene locus_tag LOCUS_25000 gene hcp 34069 32420 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHX5 protein_id gnl|my_center|LOCUS_25000 35185 34160 gene locus_tag LOCUS_25010 35185 34160 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_25010 39011 35412 gene locus_tag LOCUS_25020 gene nifJ 39011 35412 CDS product pyruvate-flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC02 protein_id gnl|my_center|LOCUS_25020 40609 39026 gene locus_tag LOCUS_25030 40609 39026 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_25030 41439 40906 gene locus_tag LOCUS_25040 41439 40906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 45748 41918 gene locus_tag LOCUS_25050 45748 41918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 46552 46046 gene locus_tag LOCUS_25060 46552 46046 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_25060 47691 46909 gene locus_tag LOCUS_25070 47691 46909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058247.1 protein_id gnl|my_center|LOCUS_25070 48495 48250 gene locus_tag LOCUS_25080 48495 48250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 48876 48577 gene locus_tag LOCUS_25090 48876 48577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 49343 49044 gene locus_tag LOCUS_25100 49343 49044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 49758 49414 gene locus_tag LOCUS_25110 49758 49414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 51627 50278 gene locus_tag LOCUS_25120 51627 50278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence041 1828 1019 gene locus_tag LOCUS_25130 1828 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2830 3348 gene locus_tag LOCUS_25140 gene cpcB 2830 3348 CDS product C-phycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50033 protein_id gnl|my_center|LOCUS_25140 3450 3938 gene locus_tag LOCUS_25150 gene cpcA 3450 3938 CDS product C-phycocyanin alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50032 protein_id gnl|my_center|LOCUS_25150 4043 4861 gene locus_tag LOCUS_25160 gene cpcC 4043 4861 CDS product phycobilisome 32.1 kDa linker polypeptide, phycocyanin-associated, rod inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50034 protein_id gnl|my_center|LOCUS_25160 4916 5734 gene locus_tag LOCUS_25170 gene cpcC 4916 5734 CDS product phycobilisome 32.1 kDa linker polypeptide, phycocyanin-associated, rod inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50034 protein_id gnl|my_center|LOCUS_25170 5780 6640 gene locus_tag LOCUS_25180 gene cpcC 5780 6640 CDS product phycobilisome 32.1 kDa linker polypeptide, phycocyanin-associated, rod inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50034 protein_id gnl|my_center|LOCUS_25180 6714 6953 gene locus_tag LOCUS_25190 gene cpcD 6714 6953 CDS product phycobilisome 8.9 kDa linker polypeptide, phycocyanin-associated, rod inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50035 protein_id gnl|my_center|LOCUS_25190 7197 7934 gene locus_tag LOCUS_25200 gene pcyA 7197 7934 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59288 protein_id gnl|my_center|LOCUS_25200 8069 10237 gene locus_tag LOCUS_25210 8069 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25210 10227 10607 gene locus_tag LOCUS_25220 10227 10607 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_25220 10640 11680 gene locus_tag LOCUS_25230 10640 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 12363 11956 gene locus_tag LOCUS_25240 12363 11956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 15141 13006 gene locus_tag LOCUS_25250 15141 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 16210 15128 gene locus_tag LOCUS_25260 16210 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 19190 16413 gene locus_tag LOCUS_25270 19190 16413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 19284 19688 gene locus_tag LOCUS_25280 19284 19688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 20016 20972 gene locus_tag LOCUS_25290 20016 20972 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057997.1 protein_id gnl|my_center|LOCUS_25290 21249 21470 gene locus_tag LOCUS_25300 21249 21470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 21460 21672 gene locus_tag LOCUS_25310 21460 21672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020810.1 protein_id gnl|my_center|LOCUS_25310 21935 21786 gene locus_tag LOCUS_25320 21935 21786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 23773 21896 gene locus_tag LOCUS_25330 23773 21896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 24161 24231 gene locus_tag LOCUS_t00170 24161 24231 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 24981 25829 gene locus_tag LOCUS_25340 24981 25829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 26120 25995 gene locus_tag LOCUS_25350 26120 25995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 26965 26186 gene locus_tag LOCUS_25360 26965 26186 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946403.1 protein_id gnl|my_center|LOCUS_25360 27798 26956 gene locus_tag LOCUS_25370 27798 26956 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_25370 28356 28036 gene locus_tag LOCUS_25380 28356 28036 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947375.1 protein_id gnl|my_center|LOCUS_25380 28948 31182 gene locus_tag LOCUS_25390 28948 31182 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058113.1 protein_id gnl|my_center|LOCUS_25390 31519 32385 gene locus_tag LOCUS_25400 31519 32385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 34110 32761 gene locus_tag LOCUS_25410 34110 32761 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056941.1 protein_id gnl|my_center|LOCUS_25410 35457 37049 gene locus_tag LOCUS_25420 35457 37049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 37050 37316 gene locus_tag LOCUS_25430 37050 37316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 38109 37483 gene locus_tag LOCUS_25440 38109 37483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 39753 38242 gene locus_tag LOCUS_25450 39753 38242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 40098 40973 gene locus_tag LOCUS_25460 40098 40973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_25460 40989 41462 gene locus_tag LOCUS_25470 40989 41462 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL3 protein_id gnl|my_center|LOCUS_25470 41633 42013 gene locus_tag LOCUS_25480 41633 42013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057859.1 protein_id gnl|my_center|LOCUS_25480 42974 42351 gene locus_tag LOCUS_25490 42974 42351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057912.1 protein_id gnl|my_center|LOCUS_25490 43865 43053 gene locus_tag LOCUS_25500 43865 43053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 45807 44530 gene locus_tag LOCUS_25510 gene ahcY 45807 44530 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC8 protein_id gnl|my_center|LOCUS_25510 46143 46409 gene locus_tag LOCUS_25520 46143 46409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 47876 46530 gene locus_tag LOCUS_25530 47876 46530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 48472 48116 gene locus_tag LOCUS_25540 gene ccmK 48472 48116 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_25540 48890 48579 gene locus_tag LOCUS_25550 gene ccmK 48890 48579 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_25550 50038 49016 gene locus_tag LOCUS_25560 50038 49016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 51446 50820 gene locus_tag LOCUS_25570 51446 50820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_25570 >Feature sequence042 1637 528 gene locus_tag LOCUS_25580 1637 528 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057982.1 protein_id gnl|my_center|LOCUS_25580 1979 3715 gene locus_tag LOCUS_25590 1979 3715 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_25590 3927 4754 gene locus_tag LOCUS_25600 3927 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 5057 4815 gene locus_tag LOCUS_25610 5057 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 5106 5666 gene locus_tag LOCUS_25620 5106 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_25620 7172 5955 gene locus_tag LOCUS_25630 7172 5955 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 protein_id gnl|my_center|LOCUS_25630 8080 7664 gene locus_tag LOCUS_25640 8080 7664 CDS product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_25640 9769 8084 gene locus_tag LOCUS_25650 9769 8084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 9867 11459 gene locus_tag LOCUS_25660 9867 11459 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_25660 11615 11947 gene locus_tag LOCUS_25670 11615 11947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 12943 12779 gene locus_tag LOCUS_25680 12943 12779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 13242 13314 gene locus_tag LOCUS_t00180 13242 13314 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14091 13492 gene locus_tag LOCUS_25690 14091 13492 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140132.1 protein_id gnl|my_center|LOCUS_25690 14638 14177 gene locus_tag LOCUS_25700 14638 14177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 18133 15986 gene locus_tag LOCUS_25710 18133 15986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 19747 20508 gene locus_tag LOCUS_25720 19747 20508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 21845 20505 gene locus_tag LOCUS_25730 21845 20505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 22207 22512 gene locus_tag LOCUS_25740 22207 22512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 23440 22526 gene locus_tag LOCUS_25750 gene rsmH 23440 22526 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH87 protein_id gnl|my_center|LOCUS_25750 23779 24099 gene locus_tag LOCUS_25760 23779 24099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 24375 26450 gene locus_tag LOCUS_25770 24375 26450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 26740 28818 gene locus_tag LOCUS_25780 26740 28818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 29174 29527 gene locus_tag LOCUS_25790 29174 29527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 29697 29996 gene locus_tag LOCUS_25800 29697 29996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 30185 30457 gene locus_tag LOCUS_25810 30185 30457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 30467 30835 gene locus_tag LOCUS_25820 30467 30835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 31615 30845 gene locus_tag LOCUS_25830 31615 30845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140178.1 protein_id gnl|my_center|LOCUS_25830 32868 32029 gene locus_tag LOCUS_25840 32868 32029 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140177.1 protein_id gnl|my_center|LOCUS_25840 33962 32892 gene locus_tag LOCUS_25850 33962 32892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140179.1 protein_id gnl|my_center|LOCUS_25850 35127 36686 gene locus_tag LOCUS_25860 35127 36686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 38808 37021 gene locus_tag LOCUS_25870 gene ftsH 38808 37021 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW7 protein_id gnl|my_center|LOCUS_25870 39192 39413 gene locus_tag LOCUS_25880 39192 39413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 40096 39506 gene locus_tag LOCUS_25890 40096 39506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 42300 41116 gene locus_tag LOCUS_25900 gene petH 42300 41116 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93RE3 protein_id gnl|my_center|LOCUS_25900 42977 43879 gene locus_tag LOCUS_25910 gene prk 42977 43879 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN2 protein_id gnl|my_center|LOCUS_25910 44006 44332 gene locus_tag LOCUS_25920 44006 44332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 45098 44511 gene locus_tag LOCUS_25930 45098 44511 CDS product TIGR04376 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140547.1 protein_id gnl|my_center|LOCUS_25930 46560 45406 gene locus_tag LOCUS_25940 46560 45406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 48555 46645 gene locus_tag LOCUS_25950 gene mnmG 48555 46645 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF8 protein_id gnl|my_center|LOCUS_25950 49001 48711 gene locus_tag LOCUS_25960 gene gatC 49001 48711 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG91 protein_id gnl|my_center|LOCUS_25960 49644 49123 gene locus_tag LOCUS_25970 gene ycf3 49644 49123 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ6 protein_id gnl|my_center|LOCUS_25970 50593 50775 gene locus_tag LOCUS_25980 50593 50775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence043 258 1070 gene locus_tag LOCUS_25990 258 1070 CDS product short-chain dehydrogenase/reductase SDR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974406.1 protein_id gnl|my_center|LOCUS_25990 2139 1201 gene locus_tag LOCUS_26000 2139 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 2792 3052 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccattgtttcactggcaagatgcc 4099 3539 gene locus_tag LOCUS_26010 4099 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_26010 4362 4826 gene locus_tag LOCUS_26020 4362 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_26020 5333 5500 gene locus_tag LOCUS_26030 5333 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 5989 7131 gene locus_tag LOCUS_26040 5989 7131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 7323 7898 gene locus_tag LOCUS_26050 7323 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141116.1 protein_id gnl|my_center|LOCUS_26050 7924 8373 gene locus_tag LOCUS_26060 7924 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 8610 9269 gene locus_tag LOCUS_26070 8610 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142612.1 protein_id gnl|my_center|LOCUS_26070 10171 9266 gene locus_tag LOCUS_26080 10171 9266 CDS product putative aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72208 protein_id gnl|my_center|LOCUS_26080 10401 10970 gene locus_tag LOCUS_26090 10401 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904062.1 protein_id gnl|my_center|LOCUS_26090 11321 11133 gene locus_tag LOCUS_26100 11321 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 11560 13983 gene locus_tag LOCUS_26110 gene purL 11560 13983 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA7 protein_id gnl|my_center|LOCUS_26110 14259 15167 gene locus_tag LOCUS_26120 14259 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_26120 15405 15881 gene locus_tag LOCUS_26130 15405 15881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 17025 16486 gene locus_tag LOCUS_26140 17025 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 18477 17350 gene locus_tag LOCUS_26150 18477 17350 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701641.1 protein_id gnl|my_center|LOCUS_26150 19844 18609 gene locus_tag LOCUS_26160 19844 18609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 21749 20139 gene locus_tag LOCUS_26170 21749 20139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 22657 21746 gene locus_tag LOCUS_26180 22657 21746 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140660.1 protein_id gnl|my_center|LOCUS_26180 24174 23155 gene locus_tag LOCUS_26190 24174 23155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 24532 24858 gene locus_tag LOCUS_26200 24532 24858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 26122 25781 gene locus_tag LOCUS_26210 gene petJ 26122 25781 CDS product cytochrome c6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X9 protein_id gnl|my_center|LOCUS_26210 26370 28022 gene locus_tag LOCUS_26220 26370 28022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142479.1 protein_id gnl|my_center|LOCUS_26220 29063 29293 gene locus_tag LOCUS_26230 29063 29293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 29271 29531 gene locus_tag LOCUS_26240 29271 29531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_26240 29647 30165 gene locus_tag LOCUS_26250 29647 30165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 30310 32073 gene locus_tag LOCUS_26260 30310 32073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 32566 32117 gene locus_tag LOCUS_26270 32566 32117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 32886 32572 gene locus_tag LOCUS_26280 32886 32572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 33074 33292 gene locus_tag LOCUS_26290 33074 33292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 33514 33317 gene locus_tag LOCUS_26300 33514 33317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 33727 33521 gene locus_tag LOCUS_26310 33727 33521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 34048 33827 gene locus_tag LOCUS_26320 34048 33827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 34762 34157 gene locus_tag LOCUS_26330 34762 34157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 34977 34759 gene locus_tag LOCUS_26340 34977 34759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 35431 35162 gene locus_tag LOCUS_26350 35431 35162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 35430 35648 gene locus_tag LOCUS_26360 35430 35648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 35651 35857 gene locus_tag LOCUS_26370 35651 35857 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_26370 36701 36141 gene locus_tag LOCUS_26380 36701 36141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_26380 37470 37751 gene locus_tag LOCUS_26390 37470 37751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 37854 38768 gene locus_tag LOCUS_26400 37854 38768 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_26400 40255 38858 gene locus_tag LOCUS_26410 gene murA 40255 38858 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGP3 protein_id gnl|my_center|LOCUS_26410 40575 40658 gene locus_tag LOCUS_t00190 40575 40658 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 40676 41455 gene locus_tag LOCUS_26420 40676 41455 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140557.1 protein_id gnl|my_center|LOCUS_26420 41695 42954 gene locus_tag LOCUS_26430 41695 42954 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 protein_id gnl|my_center|LOCUS_26430 43098 44528 gene locus_tag LOCUS_26440 43098 44528 CDS product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056712.1 protein_id gnl|my_center|LOCUS_26440 44636 45523 gene locus_tag LOCUS_26450 gene trpC 44636 45523 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL01 protein_id gnl|my_center|LOCUS_26450 45590 45874 gene locus_tag LOCUS_26460 45590 45874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058031.1 protein_id gnl|my_center|LOCUS_26460 46276 47430 gene locus_tag LOCUS_26470 46276 47430 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057305.1 protein_id gnl|my_center|LOCUS_26470 48469 48314 gene locus_tag LOCUS_26480 48469 48314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 48485 49270 gene locus_tag LOCUS_26490 48485 49270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 49529 50785 gene locus_tag LOCUS_26500 49529 50785 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence044 957 85 gene locus_tag LOCUS_26510 957 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_26510 2195 1134 gene locus_tag LOCUS_26520 gene thiL 2195 1134 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGF1 protein_id gnl|my_center|LOCUS_26520 3500 2424 gene locus_tag LOCUS_26530 3500 2424 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 protein_id gnl|my_center|LOCUS_26530 3837 4394 gene locus_tag LOCUS_26540 gene efp 3837 4394 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD3 protein_id gnl|my_center|LOCUS_26540 4539 5021 gene locus_tag LOCUS_26550 gene accB 4539 5021 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057135.1 protein_id gnl|my_center|LOCUS_26550 5845 5207 gene locus_tag LOCUS_26560 5845 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 6768 5992 gene locus_tag LOCUS_26570 6768 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141748.1 protein_id gnl|my_center|LOCUS_26570 7993 7352 gene locus_tag LOCUS_26580 gene lrtA 7993 7352 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_26580 8185 8844 gene locus_tag LOCUS_26590 gene lipB 8185 8844 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKM7 protein_id gnl|my_center|LOCUS_26590 10935 9148 gene locus_tag LOCUS_26600 10935 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057893.1 protein_id gnl|my_center|LOCUS_26600 11479 11763 gene locus_tag LOCUS_26610 11479 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 12610 13263 gene locus_tag LOCUS_26620 12610 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 13444 14796 gene locus_tag LOCUS_26630 gene dnaE 13444 14796 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057904.1 protein_id gnl|my_center|LOCUS_26630 16157 14922 gene locus_tag LOCUS_26640 16157 14922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 16751 16443 gene locus_tag LOCUS_26650 16751 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144013.1 protein_id gnl|my_center|LOCUS_26650 17113 16823 gene locus_tag LOCUS_26660 gene ycf49 17113 16823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 protein_id gnl|my_center|LOCUS_26660 17459 18487 gene locus_tag LOCUS_26670 17459 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 20060 18693 gene locus_tag LOCUS_26680 20060 18693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 21025 21246 gene locus_tag LOCUS_26690 21025 21246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 21225 22721 gene locus_tag LOCUS_26700 21225 22721 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887933.1 protein_id gnl|my_center|LOCUS_26700 23107 24543 gene locus_tag LOCUS_26710 23107 24543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 24750 25916 gene locus_tag LOCUS_26720 24750 25916 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338580.1 protein_id gnl|my_center|LOCUS_26720 28106 26010 gene locus_tag LOCUS_26730 28106 26010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 29541 28111 gene locus_tag LOCUS_26740 29541 28111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 30955 30566 gene locus_tag LOCUS_26750 30955 30566 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_26750 31308 32642 gene locus_tag LOCUS_26760 31308 32642 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674116.1 protein_id gnl|my_center|LOCUS_26760 34775 32787 gene locus_tag LOCUS_26770 34775 32787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 35029 36159 gene locus_tag LOCUS_26780 35029 36159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 36658 37833 gene locus_tag LOCUS_26790 gene anmK 36658 37833 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC2 protein_id gnl|my_center|LOCUS_26790 38240 38686 gene locus_tag LOCUS_26800 38240 38686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057015.1 protein_id gnl|my_center|LOCUS_26800 38921 40453 gene locus_tag LOCUS_26810 38921 40453 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056298.1 protein_id gnl|my_center|LOCUS_26810 41356 40538 gene locus_tag LOCUS_26820 41356 40538 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_26820 43061 41598 gene locus_tag LOCUS_26830 gene pntB 43061 41598 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ6 protein_id gnl|my_center|LOCUS_26830 43077 43352 gene locus_tag LOCUS_26840 43077 43352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 45329 43704 gene locus_tag LOCUS_26850 gene pntA 45329 43704 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z6X5 protein_id gnl|my_center|LOCUS_26850 47432 47965 gene locus_tag LOCUS_26860 47432 47965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 protein_id gnl|my_center|LOCUS_26860 49252 49854 gene locus_tag LOCUS_26870 49252 49854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 50033 50299 gene locus_tag LOCUS_26880 50033 50299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence045 589 2040 gene locus_tag LOCUS_26890 589 2040 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141482.1 protein_id gnl|my_center|LOCUS_26890 3877 2225 gene locus_tag LOCUS_26900 3877 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 6007 4649 gene locus_tag LOCUS_26910 gene gltA 6007 4649 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R417 protein_id gnl|my_center|LOCUS_26910 6292 7617 gene locus_tag LOCUS_26920 6292 7617 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 protein_id gnl|my_center|LOCUS_26920 7853 8434 gene locus_tag LOCUS_26930 7853 8434 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_26930 8662 9444 gene locus_tag LOCUS_26940 8662 9444 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104931.1 protein_id gnl|my_center|LOCUS_26940 9868 10122 gene locus_tag LOCUS_26950 9868 10122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 12185 10548 gene locus_tag LOCUS_26960 12185 10548 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_26960 14082 13705 gene locus_tag LOCUS_26970 14082 13705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 14839 14447 gene locus_tag LOCUS_26980 14839 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_26980 16441 15200 gene locus_tag LOCUS_26990 16441 15200 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW51 protein_id gnl|my_center|LOCUS_26990 16614 16766 gene locus_tag LOCUS_27000 16614 16766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 16705 17067 gene locus_tag LOCUS_27010 16705 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 18249 17320 gene locus_tag LOCUS_27020 gene truB 18249 17320 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7MBB8 protein_id gnl|my_center|LOCUS_27020 19342 18512 gene locus_tag LOCUS_27030 19342 18512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057850.1 protein_id gnl|my_center|LOCUS_27030 19673 20737 gene locus_tag LOCUS_27040 gene murG 19673 20737 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY4 protein_id gnl|my_center|LOCUS_27040 20853 21578 gene locus_tag LOCUS_27050 20853 21578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 protein_id gnl|my_center|LOCUS_27050 22668 22165 gene locus_tag LOCUS_27060 22668 22165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119100.1 protein_id gnl|my_center|LOCUS_27060 23040 22795 gene locus_tag LOCUS_27070 23040 22795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27070 23706 24173 gene locus_tag LOCUS_27080 23706 24173 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057639.1 protein_id gnl|my_center|LOCUS_27080 24266 24928 gene locus_tag LOCUS_27090 24266 24928 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056611.1 protein_id gnl|my_center|LOCUS_27090 25760 25002 gene locus_tag LOCUS_27100 25760 25002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 protein_id gnl|my_center|LOCUS_27100 26303 25806 gene locus_tag LOCUS_27110 26303 25806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 26511 26308 gene locus_tag LOCUS_27120 26511 26308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 27375 28190 gene locus_tag LOCUS_27130 27375 28190 CDS product S-adenosyl-L-methionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAU5 protein_id gnl|my_center|LOCUS_27130 29178 28318 gene locus_tag LOCUS_27140 29178 28318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 30185 29463 gene locus_tag LOCUS_27150 30185 29463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 31356 31862 gene locus_tag LOCUS_27160 31356 31862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 32295 33410 gene locus_tag LOCUS_27170 32295 33410 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098268.1 protein_id gnl|my_center|LOCUS_27170 33582 33929 gene locus_tag LOCUS_27180 33582 33929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 36115 34220 gene locus_tag LOCUS_27190 36115 34220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 38003 36393 gene locus_tag LOCUS_27200 gene putP 38003 36393 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125785.1 protein_id gnl|my_center|LOCUS_27200 38370 40019 gene locus_tag LOCUS_27210 38370 40019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 40083 40919 gene locus_tag LOCUS_27220 gene nrtB 40083 40919 CDS product nitrate ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088477.1 protein_id gnl|my_center|LOCUS_27220 41171 42442 gene locus_tag LOCUS_27230 41171 42442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 42614 43498 gene locus_tag LOCUS_27240 gene nrtD 42614 43498 CDS product bacitracin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057194.1 protein_id gnl|my_center|LOCUS_27240 43559 44002 gene locus_tag LOCUS_27250 gene cynS 43559 44002 CDS product cyanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IA8 protein_id gnl|my_center|LOCUS_27250 44184 45242 gene locus_tag LOCUS_27260 44184 45242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 45248 45505 gene locus_tag LOCUS_27270 45248 45505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 45521 46492 gene locus_tag LOCUS_27280 45521 46492 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537568.1 protein_id gnl|my_center|LOCUS_27280 46830 47264 gene locus_tag LOCUS_27290 46830 47264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103775.1 protein_id gnl|my_center|LOCUS_27290 47743 47408 gene locus_tag LOCUS_27300 47743 47408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 48147 47818 gene locus_tag LOCUS_27310 48147 47818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 49330 48437 gene locus_tag LOCUS_27320 49330 48437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence046 1814 3115 gene locus_tag LOCUS_27330 1814 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258026.1 protein_id gnl|my_center|LOCUS_27330 3606 3409 gene locus_tag LOCUS_27340 3606 3409 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546765.1 protein_id gnl|my_center|LOCUS_27340 3911 3720 gene locus_tag LOCUS_27350 3911 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 3917 4204 gene locus_tag LOCUS_27360 3917 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 4149 4376 gene locus_tag LOCUS_27370 4149 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 4364 4705 gene locus_tag LOCUS_27380 4364 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 6423 4837 gene locus_tag LOCUS_27390 6423 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 8450 6453 gene locus_tag LOCUS_27400 8450 6453 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_27400 9009 8755 gene locus_tag LOCUS_27410 9009 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 9517 9771 gene locus_tag LOCUS_27420 9517 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 10232 12025 gene locus_tag LOCUS_27430 10232 12025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 12476 13162 gene locus_tag LOCUS_27440 12476 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_27440 13230 13520 gene locus_tag LOCUS_27450 13230 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_27450 13526 14665 gene locus_tag LOCUS_27460 13526 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258033.1 protein_id gnl|my_center|LOCUS_27460 14662 15507 gene locus_tag LOCUS_27470 14662 15507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 15507 15830 gene locus_tag LOCUS_27480 15507 15830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258035.1 protein_id gnl|my_center|LOCUS_27480 18161 16638 gene locus_tag LOCUS_27490 18161 16638 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085184.1 protein_id gnl|my_center|LOCUS_27490 18721 18218 gene locus_tag LOCUS_27500 18721 18218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 19347 20084 gene locus_tag LOCUS_27510 19347 20084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 20449 20658 gene locus_tag LOCUS_27520 20449 20658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 20990 21346 gene locus_tag LOCUS_27530 20990 21346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_27530 21346 23820 gene locus_tag LOCUS_27540 21346 23820 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258037.1 protein_id gnl|my_center|LOCUS_27540 24297 27926 gene locus_tag LOCUS_27550 24297 27926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 28887 28081 gene locus_tag LOCUS_27560 28887 28081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141414.1 protein_id gnl|my_center|LOCUS_27560 30767 29298 gene locus_tag LOCUS_27570 30767 29298 CDS product thermolabile hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746867.1 protein_id gnl|my_center|LOCUS_27570 31001 31435 gene locus_tag LOCUS_27580 31001 31435 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405595.1 protein_id gnl|my_center|LOCUS_27580 32630 33256 gene locus_tag LOCUS_27590 32630 33256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 33344 35938 gene locus_tag LOCUS_27600 33344 35938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 35896 39393 gene locus_tag LOCUS_27610 35896 39393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 39362 40552 gene locus_tag LOCUS_27620 39362 40552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 40765 41013 gene locus_tag LOCUS_27630 40765 41013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 41383 42330 gene locus_tag LOCUS_27640 41383 42330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 42452 43726 gene locus_tag LOCUS_27650 42452 43726 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123037.1 protein_id gnl|my_center|LOCUS_27650 44433 44098 gene locus_tag LOCUS_27660 44433 44098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 44662 45015 gene locus_tag LOCUS_27670 44662 45015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 45015 45377 gene locus_tag LOCUS_27680 45015 45377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 45513 46028 gene locus_tag LOCUS_27690 45513 46028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 47219 49474 gene locus_tag LOCUS_27700 47219 49474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence047 505 1221 gene locus_tag LOCUS_27710 gene ho1 505 1221 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056220.1 protein_id gnl|my_center|LOCUS_27710 3133 1865 gene locus_tag LOCUS_27720 3133 1865 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_27720 3684 3328 gene locus_tag LOCUS_27730 3684 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 8404 4850 gene locus_tag LOCUS_27740 gene mfd 8404 4850 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA7 protein_id gnl|my_center|LOCUS_27740 8788 9744 gene locus_tag LOCUS_27750 8788 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 11618 9759 gene locus_tag LOCUS_27760 gene menD 11618 9759 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI6 protein_id gnl|my_center|LOCUS_27760 12462 11749 gene locus_tag LOCUS_27770 gene menH 12462 11749 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBE3 protein_id gnl|my_center|LOCUS_27770 14207 12759 gene locus_tag LOCUS_27780 14207 12759 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_27780 14491 14691 gene locus_tag LOCUS_27790 14491 14691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 15351 16193 gene locus_tag LOCUS_27800 gene menA 15351 16193 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW6 protein_id gnl|my_center|LOCUS_27800 16211 16909 gene locus_tag LOCUS_27810 gene menG 16211 16909 CDS product 2-phytyl-1,4-naphtoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPC8 protein_id gnl|my_center|LOCUS_27810 16985 17977 gene locus_tag LOCUS_27820 gene menC 16985 17977 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP8 protein_id gnl|my_center|LOCUS_27820 18188 19459 gene locus_tag LOCUS_27830 18188 19459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 19605 21155 gene locus_tag LOCUS_27840 gene menE 19605 21155 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057063.1 protein_id gnl|my_center|LOCUS_27840 21700 22722 gene locus_tag LOCUS_27850 gene dusA 21700 22722 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD0 protein_id gnl|my_center|LOCUS_27850 22928 23857 gene locus_tag LOCUS_27860 22928 23857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 protein_id gnl|my_center|LOCUS_27860 24648 23878 gene locus_tag LOCUS_27870 24648 23878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 26934 25723 gene locus_tag LOCUS_27880 26934 25723 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_27880 27993 28142 gene locus_tag LOCUS_27890 27993 28142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 29136 29414 gene locus_tag LOCUS_27900 29136 29414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 29540 30832 gene locus_tag LOCUS_27910 gene hemN 29540 30832 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_27910 30932 33052 gene locus_tag LOCUS_27920 30932 33052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 33409 34134 gene locus_tag LOCUS_27930 33409 34134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 34152 34742 gene locus_tag LOCUS_27940 34152 34742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140946.1 protein_id gnl|my_center|LOCUS_27940 34946 36019 gene locus_tag LOCUS_27950 34946 36019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 36284 39229 gene locus_tag LOCUS_27960 36284 39229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 39262 40602 gene locus_tag LOCUS_27970 39262 40602 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084306.1 protein_id gnl|my_center|LOCUS_27970 41266 43044 gene locus_tag LOCUS_27980 41266 43044 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108982.1 protein_id gnl|my_center|LOCUS_27980 43489 45288 gene locus_tag LOCUS_27990 gene ilvG 43489 45288 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD1 protein_id gnl|my_center|LOCUS_27990 45332 46192 gene locus_tag LOCUS_28000 45332 46192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 46247 47611 gene locus_tag LOCUS_28010 46247 47611 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205874.1 protein_id gnl|my_center|LOCUS_28010 47699 48580 gene locus_tag LOCUS_28020 47699 48580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 49124 48894 gene locus_tag LOCUS_28030 49124 48894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence048 1696 2049 gene locus_tag LOCUS_28040 1696 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2024 2401 gene locus_tag LOCUS_28050 2024 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 3147 2521 gene locus_tag LOCUS_28060 3147 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_28060 9544 3506 gene locus_tag LOCUS_28070 9544 3506 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_28070 9871 10113 gene locus_tag LOCUS_28080 9871 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 10276 11415 gene locus_tag LOCUS_28090 10276 11415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 11760 12782 gene locus_tag LOCUS_28100 gene wcaA 11760 12782 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_28100 13435 14058 gene locus_tag LOCUS_28110 13435 14058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 14299 14898 gene locus_tag LOCUS_28120 14299 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 14910 16667 gene locus_tag LOCUS_28130 gene glpA 14910 16667 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_28130 16750 17595 gene locus_tag LOCUS_28140 16750 17595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 17626 18354 gene locus_tag LOCUS_28150 17626 18354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 18447 19433 gene locus_tag LOCUS_28160 18447 19433 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783220.1 protein_id gnl|my_center|LOCUS_28160 19499 20155 gene locus_tag LOCUS_28170 19499 20155 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966689.1 protein_id gnl|my_center|LOCUS_28170 20215 20952 gene locus_tag LOCUS_28180 20215 20952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 21196 22881 gene locus_tag LOCUS_28190 gene glpA 21196 22881 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_28190 22944 23972 gene locus_tag LOCUS_28200 22944 23972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088167.1 protein_id gnl|my_center|LOCUS_28200 24186 25640 gene locus_tag LOCUS_28210 gene yesX 24186 25640 CDS product rhamnogalacturonan exolyase YesX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31527 protein_id gnl|my_center|LOCUS_28210 25652 26617 gene locus_tag LOCUS_28220 25652 26617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088167.1 protein_id gnl|my_center|LOCUS_28220 26774 27343 gene locus_tag LOCUS_28230 26774 27343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 27583 29154 gene locus_tag LOCUS_28240 27583 29154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 29182 30696 gene locus_tag LOCUS_28250 29182 30696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 31491 30979 gene locus_tag LOCUS_28260 31491 30979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 31702 32181 gene locus_tag LOCUS_28270 gene ispF 31702 32181 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC4 protein_id gnl|my_center|LOCUS_28270 32245 33285 gene locus_tag LOCUS_28280 gene trpD 32245 33285 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI76 protein_id gnl|my_center|LOCUS_28280 33820 33404 gene locus_tag LOCUS_28290 33820 33404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140148.1 protein_id gnl|my_center|LOCUS_28290 34809 34123 gene locus_tag LOCUS_28300 34809 34123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 36328 34862 gene locus_tag LOCUS_28310 36328 34862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_28310 37360 36686 gene locus_tag LOCUS_28320 37360 36686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055926.1 protein_id gnl|my_center|LOCUS_28320 37575 37647 gene locus_tag LOCUS_t00200 37575 37647 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 38168 37701 gene locus_tag LOCUS_28330 38168 37701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 38444 39055 gene locus_tag LOCUS_28340 gene pyrE 38444 39055 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW5 protein_id gnl|my_center|LOCUS_28340 39158 39086 gene locus_tag LOCUS_t00210 39158 39086 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 42081 39712 gene locus_tag LOCUS_28350 42081 39712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 43947 43486 gene locus_tag LOCUS_28360 43947 43486 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM1 protein_id gnl|my_center|LOCUS_28360 45922 44801 gene locus_tag LOCUS_28370 45922 44801 CDS product putative glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_28370 46937 46086 gene locus_tag LOCUS_28380 46937 46086 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_28380 47083 47607 gene locus_tag LOCUS_28390 47083 47607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 47907 48857 gene locus_tag LOCUS_28400 47907 48857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 >Feature sequence049 668 1120 gene locus_tag LOCUS_28410 668 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1442 2806 gene locus_tag LOCUS_28420 1442 2806 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_28420 2836 4581 gene locus_tag LOCUS_28430 2836 4581 CDS product putative peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702957.1 protein_id gnl|my_center|LOCUS_28430 5683 4508 gene locus_tag LOCUS_28440 gene bioF 5683 4508 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNL4 protein_id gnl|my_center|LOCUS_28440 6052 5732 gene locus_tag LOCUS_28450 6052 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 6767 7642 gene locus_tag LOCUS_28460 6767 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057555.1 protein_id gnl|my_center|LOCUS_28460 8815 7748 gene locus_tag LOCUS_28470 8815 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057667.1 protein_id gnl|my_center|LOCUS_28470 10524 8965 gene locus_tag LOCUS_28480 gene kaiC 10524 8965 CDS product circadian clock protein kinase KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V60 protein_id gnl|my_center|LOCUS_28480 10941 10627 gene locus_tag LOCUS_28490 gene kaiB 10941 10627 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V61 protein_id gnl|my_center|LOCUS_28490 11989 11069 gene locus_tag LOCUS_28500 gene kaiA 11989 11069 CDS product circadian clock protein KaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V62 protein_id gnl|my_center|LOCUS_28500 12520 15972 gene locus_tag LOCUS_28510 12520 15972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 16630 17676 gene locus_tag LOCUS_28520 16630 17676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_28520 19714 17894 gene locus_tag LOCUS_28530 19714 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143571.1 protein_id gnl|my_center|LOCUS_28530 19933 20283 gene locus_tag LOCUS_28540 gene ycf20 19933 20283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 protein_id gnl|my_center|LOCUS_28540 20362 21447 gene locus_tag LOCUS_28550 20362 21447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 21532 21461 gene locus_tag LOCUS_t00220 21532 21461 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21963 22838 gene locus_tag LOCUS_28560 21963 22838 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085765.1 protein_id gnl|my_center|LOCUS_28560 23177 24247 gene locus_tag LOCUS_28570 23177 24247 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056993.1 protein_id gnl|my_center|LOCUS_28570 24389 25513 gene locus_tag LOCUS_28580 24389 25513 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531761.1 protein_id gnl|my_center|LOCUS_28580 25914 27719 gene locus_tag LOCUS_28590 25914 27719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027306.1 protein_id gnl|my_center|LOCUS_28590 28557 27838 gene locus_tag LOCUS_28600 28557 27838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_28600 30339 28720 gene locus_tag LOCUS_28610 30339 28720 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_28610 33842 30762 gene locus_tag LOCUS_28620 33842 30762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 34947 34333 gene locus_tag LOCUS_28630 34947 34333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 35832 35098 gene locus_tag LOCUS_28640 35832 35098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 36324 36587 gene locus_tag LOCUS_28650 36324 36587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 37107 38294 gene locus_tag LOCUS_28660 37107 38294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 38501 39625 gene locus_tag LOCUS_28670 38501 39625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 39622 40662 gene locus_tag LOCUS_28680 39622 40662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 40679 41437 gene locus_tag LOCUS_28690 40679 41437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 41962 41741 gene locus_tag LOCUS_28700 41962 41741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 43395 44096 gene locus_tag LOCUS_28710 43395 44096 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801900.1 protein_id gnl|my_center|LOCUS_28710 44116 44958 gene locus_tag LOCUS_28720 44116 44958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 45153 45362 gene locus_tag LOCUS_28730 45153 45362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 45907 45611 gene locus_tag LOCUS_28740 45907 45611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 >Feature sequence050 1000 653 gene locus_tag LOCUS_28750 1000 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 1322 2497 gene locus_tag LOCUS_28760 1322 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 2577 3644 gene locus_tag LOCUS_28770 2577 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 4583 5581 gene locus_tag LOCUS_28780 4583 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 5678 6823 gene locus_tag LOCUS_28790 5678 6823 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_28790 7389 9650 gene locus_tag LOCUS_28800 7389 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_28800 10192 10620 gene locus_tag LOCUS_28810 10192 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 10747 11820 gene locus_tag LOCUS_28820 gene gmd 10747 11820 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 protein_id gnl|my_center|LOCUS_28820 12161 12340 gene locus_tag LOCUS_28830 12161 12340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 12843 14324 gene locus_tag LOCUS_28840 12843 14324 CDS product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142193.1 protein_id gnl|my_center|LOCUS_28840 14406 15320 gene locus_tag LOCUS_28850 14406 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 15360 16388 gene locus_tag LOCUS_28860 15360 16388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 16516 17496 gene locus_tag LOCUS_28870 16516 17496 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476417.1 protein_id gnl|my_center|LOCUS_28870 17584 18705 gene locus_tag LOCUS_28880 17584 18705 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552050.1 protein_id gnl|my_center|LOCUS_28880 19089 20114 gene locus_tag LOCUS_28890 19089 20114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 20338 21270 gene locus_tag LOCUS_28900 20338 21270 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552051.1 protein_id gnl|my_center|LOCUS_28900 21619 23088 gene locus_tag LOCUS_28910 21619 23088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540305.1 protein_id gnl|my_center|LOCUS_28910 23211 24275 gene locus_tag LOCUS_28920 23211 24275 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140478.1 protein_id gnl|my_center|LOCUS_28920 24350 26542 gene locus_tag LOCUS_28930 24350 26542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205662.1 protein_id gnl|my_center|LOCUS_28930 26828 27943 gene locus_tag LOCUS_28940 26828 27943 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544567.1 protein_id gnl|my_center|LOCUS_28940 28280 29476 gene locus_tag LOCUS_28950 28280 29476 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_28950 29647 30795 gene locus_tag LOCUS_28960 29647 30795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 31137 33860 gene locus_tag LOCUS_28970 31137 33860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 35260 34214 gene locus_tag LOCUS_28980 35260 34214 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_28980 36236 37765 gene locus_tag LOCUS_28990 36236 37765 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_28990 37828 38871 gene locus_tag LOCUS_29000 37828 38871 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140747.1 protein_id gnl|my_center|LOCUS_29000 39884 39132 gene locus_tag LOCUS_29010 39884 39132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141414.1 protein_id gnl|my_center|LOCUS_29010 41507 40239 gene locus_tag LOCUS_29020 41507 40239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 41739 41515 gene locus_tag LOCUS_29030 41739 41515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 42306 41899 gene locus_tag LOCUS_29040 42306 41899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29040 43022 42330 gene locus_tag LOCUS_29050 43022 42330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29050 43743 43117 gene locus_tag LOCUS_29060 43743 43117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 45697 44942 gene locus_tag LOCUS_29070 45697 44942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence051 1036 2157 gene locus_tag LOCUS_29080 1036 2157 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 protein_id gnl|my_center|LOCUS_29080 2225 7303 gene locus_tag LOCUS_29090 2225 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 7642 8322 gene locus_tag LOCUS_29100 7642 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 8452 9495 gene locus_tag LOCUS_29110 8452 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 9768 10322 gene locus_tag LOCUS_29120 9768 10322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 10383 11015 gene locus_tag LOCUS_29130 10383 11015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 13424 11136 gene locus_tag LOCUS_29140 gene glgB 13424 11136 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB8 protein_id gnl|my_center|LOCUS_29140 13754 13455 gene locus_tag LOCUS_29150 13754 13455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 15094 13865 gene locus_tag LOCUS_29160 15094 13865 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 protein_id gnl|my_center|LOCUS_29160 16299 15661 gene locus_tag LOCUS_29170 16299 15661 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_29170 16742 17194 gene locus_tag LOCUS_29180 16742 17194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 17674 17318 gene locus_tag LOCUS_29190 17674 17318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 21014 17970 gene locus_tag LOCUS_29200 21014 17970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 21642 21247 gene locus_tag LOCUS_29210 21642 21247 CDS product IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057219.1 protein_id gnl|my_center|LOCUS_29210 21829 22959 gene locus_tag LOCUS_29220 21829 22959 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056956.1 protein_id gnl|my_center|LOCUS_29220 23053 24246 gene locus_tag LOCUS_29230 23053 24246 CDS product arsenical pump membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPC8 protein_id gnl|my_center|LOCUS_29230 25132 24284 gene locus_tag LOCUS_29240 25132 24284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29240 25283 25146 gene locus_tag LOCUS_29250 25283 25146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 25777 25944 gene locus_tag LOCUS_29260 25777 25944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 27308 27096 gene locus_tag LOCUS_29270 27308 27096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 27949 27560 gene locus_tag LOCUS_29280 27949 27560 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_29280 28175 27951 gene locus_tag LOCUS_29290 28175 27951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 28922 30034 gene locus_tag LOCUS_29300 28922 30034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 31262 29976 gene locus_tag LOCUS_29310 31262 29976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 33999 31267 gene locus_tag LOCUS_29320 33999 31267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 35189 34530 gene locus_tag LOCUS_29330 35189 34530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 38172 35479 gene locus_tag LOCUS_29340 38172 35479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 40628 38883 gene locus_tag LOCUS_29350 40628 38883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056502.1 protein_id gnl|my_center|LOCUS_29350 41312 40869 gene locus_tag LOCUS_29360 41312 40869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 42013 42390 gene locus_tag LOCUS_29370 42013 42390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 42862 43251 gene locus_tag LOCUS_29380 42862 43251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 43522 44652 gene locus_tag LOCUS_29390 43522 44652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 44753 45484 gene locus_tag LOCUS_29400 gene wcaJ 44753 45484 CDS product galactosyl-1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125542.1 protein_id gnl|my_center|LOCUS_29400 >Feature sequence052 335 3148 gene locus_tag LOCUS_29410 335 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 3945 6092 gene locus_tag LOCUS_29420 3945 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 7178 6600 gene locus_tag LOCUS_29430 7178 6600 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR9 protein_id gnl|my_center|LOCUS_29430 8582 7548 gene locus_tag LOCUS_29440 8582 7548 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RH17 protein_id gnl|my_center|LOCUS_29440 11131 8870 gene locus_tag LOCUS_29450 11131 8870 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RH18 protein_id gnl|my_center|LOCUS_29450 11583 11966 gene locus_tag LOCUS_29460 gene folP 11583 11966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124278.1 protein_id gnl|my_center|LOCUS_29460 12704 12174 gene locus_tag LOCUS_29470 12704 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29470 12954 12631 gene locus_tag LOCUS_29480 12954 12631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 14181 13306 gene locus_tag LOCUS_29490 14181 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29490 16484 15027 gene locus_tag LOCUS_29500 16484 15027 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403771.1 protein_id gnl|my_center|LOCUS_29500 17679 17368 gene locus_tag LOCUS_29510 17679 17368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 18204 18938 gene locus_tag LOCUS_29520 18204 18938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 19769 19221 gene locus_tag LOCUS_29530 19769 19221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 20056 19775 gene locus_tag LOCUS_29540 20056 19775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 20537 20860 gene locus_tag LOCUS_29550 20537 20860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057879.1 protein_id gnl|my_center|LOCUS_29550 22849 20981 gene locus_tag LOCUS_29560 22849 20981 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055904.1 protein_id gnl|my_center|LOCUS_29560 23468 24700 gene locus_tag LOCUS_29570 gene tyrS 23468 24700 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR1 protein_id gnl|my_center|LOCUS_29570 24772 25494 gene locus_tag LOCUS_29580 gene pyrF 24772 25494 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLT3 protein_id gnl|my_center|LOCUS_29580 25487 26230 gene locus_tag LOCUS_29590 25487 26230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 26718 26506 gene locus_tag LOCUS_29600 26718 26506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 27015 28733 gene locus_tag LOCUS_29610 27015 28733 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084171.1 protein_id gnl|my_center|LOCUS_29610 29116 30078 gene locus_tag LOCUS_29620 29116 30078 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256681.1 protein_id gnl|my_center|LOCUS_29620 30095 30985 gene locus_tag LOCUS_29630 30095 30985 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 protein_id gnl|my_center|LOCUS_29630 32733 31180 gene locus_tag LOCUS_29640 32733 31180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 33922 33638 gene locus_tag LOCUS_29650 33922 33638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 35322 34288 gene locus_tag LOCUS_29660 gene cobW 35322 34288 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057463.1 protein_id gnl|my_center|LOCUS_29660 35932 35342 gene locus_tag LOCUS_29670 35932 35342 CDS product iron hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706448.1 protein_id gnl|my_center|LOCUS_29670 37630 36629 gene locus_tag LOCUS_29680 37630 36629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 38180 39340 gene locus_tag LOCUS_29690 gene cfa1 38180 39340 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640436.1 protein_id gnl|my_center|LOCUS_29690 39492 41519 gene locus_tag LOCUS_29700 gene chlD 39492 41519 CDS product Mg-protoporphyrin IX chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ18 protein_id gnl|my_center|LOCUS_29700 42146 43339 gene locus_tag LOCUS_29710 42146 43339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 43752 44858 gene locus_tag LOCUS_29720 43752 44858 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence053 959 210 gene locus_tag LOCUS_29730 959 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 1452 1967 gene locus_tag LOCUS_29740 1452 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 2844 3305 gene locus_tag LOCUS_29750 2844 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 3306 4130 gene locus_tag LOCUS_29760 3306 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 4217 5500 gene locus_tag LOCUS_29770 4217 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 5730 6047 gene locus_tag LOCUS_29780 5730 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227643.1 protein_id gnl|my_center|LOCUS_29780 6063 8897 gene locus_tag LOCUS_29790 6063 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 8940 9887 gene locus_tag LOCUS_29800 8940 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 9966 10973 gene locus_tag LOCUS_29810 9966 10973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_29810 11607 10996 gene locus_tag LOCUS_29820 11607 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 13768 11978 gene locus_tag LOCUS_29830 13768 11978 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_29830 14358 16604 gene locus_tag LOCUS_29840 14358 16604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143158.1 protein_id gnl|my_center|LOCUS_29840 17201 19621 gene locus_tag LOCUS_29850 17201 19621 CDS product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056890.1 protein_id gnl|my_center|LOCUS_29850 20574 23555 gene locus_tag LOCUS_29860 20574 23555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 24857 23781 gene locus_tag LOCUS_29870 24857 23781 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_29870 24928 25317 gene locus_tag LOCUS_29880 24928 25317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 26505 25471 gene locus_tag LOCUS_29890 26505 25471 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_29890 27535 26846 gene locus_tag LOCUS_29900 27535 26846 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056348.1 protein_id gnl|my_center|LOCUS_29900 28796 28587 gene locus_tag LOCUS_29910 28796 28587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 29188 29871 gene locus_tag LOCUS_29920 gene surE 29188 29871 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_29920 30058 30996 gene locus_tag LOCUS_29930 gene wcaG 30058 30996 CDS product mRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 protein_id gnl|my_center|LOCUS_29930 31493 30942 gene locus_tag LOCUS_29940 31493 30942 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 protein_id gnl|my_center|LOCUS_29940 32702 31725 gene locus_tag LOCUS_29950 32702 31725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 34179 35348 gene locus_tag LOCUS_29960 34179 35348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 37050 35773 gene locus_tag LOCUS_29970 37050 35773 CDS product serine protease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_29970 38768 38166 gene locus_tag LOCUS_29980 38768 38166 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_29980 39138 39707 gene locus_tag LOCUS_29990 39138 39707 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706359.1 protein_id gnl|my_center|LOCUS_29990 40573 39710 gene locus_tag LOCUS_30000 40573 39710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 protein_id gnl|my_center|LOCUS_30000 41439 40858 gene locus_tag LOCUS_30010 41439 40858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 41832 42053 gene locus_tag LOCUS_30020 41832 42053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 42389 42607 gene locus_tag LOCUS_30030 42389 42607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 >Feature sequence054 582 2084 gene locus_tag LOCUS_30040 582 2084 CDS product lignostilbene alpha-beta-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055870.1 protein_id gnl|my_center|LOCUS_30040 2402 3367 gene locus_tag LOCUS_30050 2402 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 4377 3610 gene locus_tag LOCUS_30060 gene pspA 4377 3610 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_30060 5618 4929 gene locus_tag LOCUS_30070 gene pspA 5618 4929 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_30070 7131 5704 gene locus_tag LOCUS_30080 7131 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 7406 8029 gene locus_tag LOCUS_30090 7406 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056696.1 protein_id gnl|my_center|LOCUS_30090 8592 8930 gene locus_tag LOCUS_30100 8592 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 10233 11042 gene locus_tag LOCUS_30110 10233 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 11922 11077 gene locus_tag LOCUS_30120 gene menB 11922 11077 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG66 protein_id gnl|my_center|LOCUS_30120 12120 12953 gene locus_tag LOCUS_30130 12120 12953 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_30130 13548 13171 gene locus_tag LOCUS_30140 13548 13171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144314.1 protein_id gnl|my_center|LOCUS_30140 13904 13548 gene locus_tag LOCUS_30150 13904 13548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 15032 14340 gene locus_tag LOCUS_30160 gene chlM 15032 14340 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056304.1 protein_id gnl|my_center|LOCUS_30160 15057 16454 gene locus_tag LOCUS_30170 gene folC 15057 16454 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056045.1 protein_id gnl|my_center|LOCUS_30170 16657 17760 gene locus_tag LOCUS_30180 gene pilM 16657 17760 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058174.1 protein_id gnl|my_center|LOCUS_30180 17765 18565 gene locus_tag LOCUS_30190 17765 18565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058175.1 protein_id gnl|my_center|LOCUS_30190 18562 19311 gene locus_tag LOCUS_30200 18562 19311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 19600 22026 gene locus_tag LOCUS_30210 19600 22026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 22568 22852 gene locus_tag LOCUS_30220 22568 22852 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058100.1 protein_id gnl|my_center|LOCUS_30220 22873 24015 gene locus_tag LOCUS_30230 22873 24015 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058099.1 protein_id gnl|my_center|LOCUS_30230 24045 25553 gene locus_tag LOCUS_30240 24045 25553 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_30240 25726 27234 gene locus_tag LOCUS_30250 25726 27234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 27702 27520 gene locus_tag LOCUS_30260 27702 27520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 27641 28174 gene locus_tag LOCUS_30270 27641 28174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 28371 29084 gene locus_tag LOCUS_30280 gene rph 28371 29084 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA4 protein_id gnl|my_center|LOCUS_30280 30111 29308 gene locus_tag LOCUS_30290 30111 29308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056104.1 protein_id gnl|my_center|LOCUS_30290 30641 31363 gene locus_tag LOCUS_30300 30641 31363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142166.1 protein_id gnl|my_center|LOCUS_30300 32808 31552 gene locus_tag LOCUS_30310 32808 31552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 33224 33039 gene locus_tag LOCUS_30320 33224 33039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 37261 33542 gene locus_tag LOCUS_30330 37261 33542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_30330 38254 37676 gene locus_tag LOCUS_30340 38254 37676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_30340 40870 38282 gene locus_tag LOCUS_30350 40870 38282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 43377 40870 gene locus_tag LOCUS_30360 43377 40870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 >Feature sequence055 449 90 gene locus_tag LOCUS_30370 449 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 1079 480 gene locus_tag LOCUS_30380 1079 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 2185 1097 gene locus_tag LOCUS_30390 2185 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_30390 2349 2510 gene locus_tag LOCUS_30400 2349 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 2560 2784 gene locus_tag LOCUS_30410 2560 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30410 5528 2940 gene locus_tag LOCUS_30420 5528 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 5912 6862 gene locus_tag LOCUS_30430 5912 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 8697 6910 gene locus_tag LOCUS_30440 gene aspS 8697 6910 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJS8 protein_id gnl|my_center|LOCUS_30440 8994 8764 gene locus_tag LOCUS_30450 8994 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 9129 9539 gene locus_tag LOCUS_30460 9129 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057825.1 protein_id gnl|my_center|LOCUS_30460 10061 10921 gene locus_tag LOCUS_30470 10061 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057827.1 protein_id gnl|my_center|LOCUS_30470 11063 11620 gene locus_tag LOCUS_30480 11063 11620 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057826.1 protein_id gnl|my_center|LOCUS_30480 12205 14697 gene locus_tag LOCUS_30490 12205 14697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 16097 16855 gene locus_tag LOCUS_30500 16097 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057827.1 protein_id gnl|my_center|LOCUS_30500 17608 18453 gene locus_tag LOCUS_30510 17608 18453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 19350 18706 gene locus_tag LOCUS_30520 19350 18706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 19720 20916 gene locus_tag LOCUS_30530 gene ndbB 19720 20916 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056978.1 protein_id gnl|my_center|LOCUS_30530 20988 21641 gene locus_tag LOCUS_30540 20988 21641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056977.1 protein_id gnl|my_center|LOCUS_30540 22361 21762 gene locus_tag LOCUS_30550 22361 21762 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_30550 22941 23687 gene locus_tag LOCUS_30560 22941 23687 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_30560 24657 23749 gene locus_tag LOCUS_30570 24657 23749 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058143.1 protein_id gnl|my_center|LOCUS_30570 25098 25619 gene locus_tag LOCUS_30580 25098 25619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056576.1 protein_id gnl|my_center|LOCUS_30580 27032 25743 gene locus_tag LOCUS_30590 27032 25743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 27769 27332 gene locus_tag LOCUS_30600 27769 27332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 27898 28566 gene locus_tag LOCUS_30610 27898 28566 CDS product chitooligosaccharide deacetylase NodB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144237.1 protein_id gnl|my_center|LOCUS_30610 29482 30603 gene locus_tag LOCUS_30620 gene sigA 29482 30603 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL79 protein_id gnl|my_center|LOCUS_30620 31179 31027 gene locus_tag LOCUS_30630 31179 31027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141443.1 protein_id gnl|my_center|LOCUS_30630 31349 31936 gene locus_tag LOCUS_30640 31349 31936 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 protein_id gnl|my_center|LOCUS_30640 32853 32068 gene locus_tag LOCUS_30650 32853 32068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 34464 33421 gene locus_tag LOCUS_30660 gene lpxD3 34464 33421 CDS product UDP-3-O-acylglucosamine N-acyltransferase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH24 protein_id gnl|my_center|LOCUS_30660 36079 36681 gene locus_tag LOCUS_30670 gene clpP1 36079 36681 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI2 protein_id gnl|my_center|LOCUS_30670 37213 36857 gene locus_tag LOCUS_30680 37213 36857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 37434 37246 gene locus_tag LOCUS_30690 37434 37246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 38006 38803 gene locus_tag LOCUS_30700 38006 38803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 38775 41432 gene locus_tag LOCUS_30710 38775 41432 CDS product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_30710 41505 43052 gene locus_tag LOCUS_30720 gene aprE 41505 43052 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887168.1 protein_id gnl|my_center|LOCUS_30720 43336 44091 gene locus_tag LOCUS_30730 43336 44091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence056 316 1812 gene locus_tag LOCUS_30740 gene gatA 316 1812 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK65 protein_id gnl|my_center|LOCUS_30740 1832 2680 gene locus_tag LOCUS_30750 1832 2680 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143200.1 protein_id gnl|my_center|LOCUS_30750 3427 2720 gene locus_tag LOCUS_30760 3427 2720 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_30760 4395 3538 gene locus_tag LOCUS_30770 gene rps1 4395 3538 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140989.1 protein_id gnl|my_center|LOCUS_30770 5264 4521 gene locus_tag LOCUS_30780 5264 4521 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_30780 5890 6876 gene locus_tag LOCUS_30790 5890 6876 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057951.1 protein_id gnl|my_center|LOCUS_30790 8700 7468 gene locus_tag LOCUS_30800 8700 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 8996 10207 gene locus_tag LOCUS_30810 gene pilT 8996 10207 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056402.1 protein_id gnl|my_center|LOCUS_30810 12175 10373 gene locus_tag LOCUS_30820 12175 10373 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_30820 14216 12483 gene locus_tag LOCUS_30830 14216 12483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 15805 17013 gene locus_tag LOCUS_30840 15805 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 17363 17839 gene locus_tag LOCUS_30850 17363 17839 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_30850 17836 18765 gene locus_tag LOCUS_30860 gene rimK 17836 18765 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ2 protein_id gnl|my_center|LOCUS_30860 18981 19985 gene locus_tag LOCUS_30870 18981 19985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 20239 20619 gene locus_tag LOCUS_30880 20239 20619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 21107 22354 gene locus_tag LOCUS_30890 21107 22354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 22401 22640 gene locus_tag LOCUS_30900 22401 22640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 22795 23061 gene locus_tag LOCUS_30910 22795 23061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 23253 23900 gene locus_tag LOCUS_30920 23253 23900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 25579 24026 gene locus_tag LOCUS_30930 25579 24026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057554.1 protein_id gnl|my_center|LOCUS_30930 26219 27139 gene locus_tag LOCUS_30940 gene argF 26219 27139 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJW4 protein_id gnl|my_center|LOCUS_30940 27547 28179 gene locus_tag LOCUS_30950 gene lexA 27547 28179 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VAW7 protein_id gnl|my_center|LOCUS_30950 29303 28356 gene locus_tag LOCUS_30960 29303 28356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 29883 31088 gene locus_tag LOCUS_30970 29883 31088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 31504 31307 gene locus_tag LOCUS_30980 31504 31307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 31952 33244 gene locus_tag LOCUS_30990 31952 33244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 33488 36184 gene locus_tag LOCUS_31000 33488 36184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_31000 36563 36279 gene locus_tag LOCUS_31010 36563 36279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 36780 37016 gene locus_tag LOCUS_31020 36780 37016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 37292 37525 gene locus_tag LOCUS_31030 37292 37525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 38126 39460 gene locus_tag LOCUS_31040 38126 39460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 39665 43039 gene locus_tag LOCUS_31050 39665 43039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_31050 >Feature sequence057 191 2683 gene locus_tag LOCUS_31060 191 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 2990 3748 gene locus_tag LOCUS_31070 2990 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 4205 4002 gene locus_tag LOCUS_31080 4205 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 4871 4671 gene locus_tag LOCUS_31090 4871 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 5895 5302 gene locus_tag LOCUS_31100 5895 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 9938 6219 gene locus_tag LOCUS_31110 9938 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_31110 11235 9898 gene locus_tag LOCUS_31120 11235 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 12143 13429 gene locus_tag LOCUS_31130 12143 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 13532 14902 gene locus_tag LOCUS_31140 13532 14902 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_31140 15886 15098 gene locus_tag LOCUS_31150 15886 15098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_31150 16884 18221 gene locus_tag LOCUS_31160 16884 18221 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865056.1 protein_id gnl|my_center|LOCUS_31160 18821 20374 gene locus_tag LOCUS_31170 18821 20374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 20550 22109 gene locus_tag LOCUS_31180 20550 22109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 22240 23766 gene locus_tag LOCUS_31190 22240 23766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 23955 24659 gene locus_tag LOCUS_31200 23955 24659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877403.1 protein_id gnl|my_center|LOCUS_31200 24681 25484 gene locus_tag LOCUS_31210 24681 25484 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_31210 25568 26305 gene locus_tag LOCUS_31220 25568 26305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 32043 26401 gene locus_tag LOCUS_31230 32043 26401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 33242 33063 gene locus_tag LOCUS_31240 33242 33063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 33563 34903 gene locus_tag LOCUS_31250 33563 34903 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_31250 35046 34971 gene locus_tag LOCUS_t00230 35046 34971 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 35282 35785 gene locus_tag LOCUS_31260 35282 35785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142895.1 protein_id gnl|my_center|LOCUS_31260 35829 36239 gene locus_tag LOCUS_31270 35829 36239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056937.1 protein_id gnl|my_center|LOCUS_31270 36480 36971 gene locus_tag LOCUS_31280 36480 36971 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR4 protein_id gnl|my_center|LOCUS_31280 38402 37095 gene locus_tag LOCUS_31290 gene hemL 38402 37095 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLK8 protein_id gnl|my_center|LOCUS_31290 38706 39356 gene locus_tag LOCUS_31300 gene hisI 38706 39356 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM88 protein_id gnl|my_center|LOCUS_31300 39503 40408 gene locus_tag LOCUS_31310 39503 40408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_31310 41125 40610 gene locus_tag LOCUS_31320 41125 40610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 42161 41181 gene locus_tag LOCUS_31330 42161 41181 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142351.1 protein_id gnl|my_center|LOCUS_31330 42335 42586 gene locus_tag LOCUS_31340 42335 42586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence058 1589 210 gene locus_tag LOCUS_31350 1589 210 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884020.1 protein_id gnl|my_center|LOCUS_31350 2897 1878 gene locus_tag LOCUS_31360 2897 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_31360 4279 3116 gene locus_tag LOCUS_31370 4279 3116 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC5 protein_id gnl|my_center|LOCUS_31370 4987 4490 gene locus_tag LOCUS_31380 4987 4490 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057106.1 protein_id gnl|my_center|LOCUS_31380 6320 5070 gene locus_tag LOCUS_31390 6320 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057105.1 protein_id gnl|my_center|LOCUS_31390 6931 6434 gene locus_tag LOCUS_31400 6931 6434 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_31400 8655 7102 gene locus_tag LOCUS_31410 8655 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 12884 9291 gene locus_tag LOCUS_31420 12884 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 15948 15025 gene locus_tag LOCUS_31430 15948 15025 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M8 protein_id gnl|my_center|LOCUS_31430 17390 16095 gene locus_tag LOCUS_31440 17390 16095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 18027 19475 gene locus_tag LOCUS_31450 18027 19475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 19564 20850 gene locus_tag LOCUS_31460 19564 20850 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_31460 21112 22386 gene locus_tag LOCUS_31470 21112 22386 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_31470 22520 23329 gene locus_tag LOCUS_31480 22520 23329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 24189 23530 gene locus_tag LOCUS_31490 24189 23530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 24745 28215 gene locus_tag LOCUS_31500 24745 28215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 29449 28379 gene locus_tag LOCUS_31510 29449 28379 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X28 protein_id gnl|my_center|LOCUS_31510 31972 29561 gene locus_tag LOCUS_31520 31972 29561 CDS product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056890.1 protein_id gnl|my_center|LOCUS_31520 33675 32134 gene locus_tag LOCUS_31530 33675 32134 CDS product carboxypeptidase Taq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_31530 35317 34598 gene locus_tag LOCUS_31540 35317 34598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058125.1 protein_id gnl|my_center|LOCUS_31540 35724 35494 gene locus_tag LOCUS_31550 gene secG 35724 35494 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 protein_id gnl|my_center|LOCUS_31550 37400 35802 gene locus_tag LOCUS_31560 gene gpmI 37400 35802 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59177 protein_id gnl|my_center|LOCUS_31560 38055 38600 gene locus_tag LOCUS_31570 gene purN 38055 38600 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ1 protein_id gnl|my_center|LOCUS_31570 39333 38740 gene locus_tag LOCUS_31580 39333 38740 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056337.1 protein_id gnl|my_center|LOCUS_31580 40439 39333 gene locus_tag LOCUS_31590 40439 39333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056519.1 protein_id gnl|my_center|LOCUS_31590 40621 40436 gene locus_tag LOCUS_31600 40621 40436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 41052 40729 gene locus_tag LOCUS_31610 41052 40729 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_31610 41495 42301 gene locus_tag LOCUS_31620 41495 42301 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400429.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence059 1568 2470 gene locus_tag LOCUS_31630 1568 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 2727 2942 gene locus_tag LOCUS_31640 2727 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 3409 5943 gene locus_tag LOCUS_31650 3409 5943 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968158.1 protein_id gnl|my_center|LOCUS_31650 6040 6204 gene locus_tag LOCUS_31660 6040 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 9006 6376 gene locus_tag LOCUS_31670 gene alaS 9006 6376 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH56 protein_id gnl|my_center|LOCUS_31670 10433 10630 gene locus_tag LOCUS_31680 10433 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 11995 13041 gene locus_tag LOCUS_31690 11995 13041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 13722 13045 gene locus_tag LOCUS_31700 gene ntcA 13722 13045 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057487.1 protein_id gnl|my_center|LOCUS_31700 14632 15408 gene locus_tag LOCUS_31710 14632 15408 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI97 protein_id gnl|my_center|LOCUS_31710 15573 16235 gene locus_tag LOCUS_31720 gene hisB 15573 16235 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI3 protein_id gnl|my_center|LOCUS_31720 17205 16924 gene locus_tag LOCUS_31730 17205 16924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 17859 18323 gene locus_tag LOCUS_31740 17859 18323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056684.1 protein_id gnl|my_center|LOCUS_31740 21070 18485 gene locus_tag LOCUS_31750 21070 18485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 23245 21389 gene locus_tag LOCUS_31760 gene recN 23245 21389 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNY7 protein_id gnl|my_center|LOCUS_31760 23546 25591 gene locus_tag LOCUS_31770 23546 25591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056794.1 protein_id gnl|my_center|LOCUS_31770 25796 26680 gene locus_tag LOCUS_31780 25796 26680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 27580 26831 gene locus_tag LOCUS_31790 27580 26831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887691.1 protein_id gnl|my_center|LOCUS_31790 28437 27637 gene locus_tag LOCUS_31800 28437 27637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 29181 30878 gene locus_tag LOCUS_31810 29181 30878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 30993 33806 gene locus_tag LOCUS_31820 30993 33806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 34204 34863 gene locus_tag LOCUS_31830 34204 34863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 35592 35359 gene locus_tag LOCUS_31840 35592 35359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 36301 38139 gene locus_tag LOCUS_31850 36301 38139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 protein_id gnl|my_center|LOCUS_31850 41304 38389 gene locus_tag LOCUS_31860 41304 38389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 41246 41488 gene locus_tag LOCUS_31870 41246 41488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 42057 41863 gene locus_tag LOCUS_31880 42057 41863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence060 2304 3035 gene locus_tag LOCUS_31890 2304 3035 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI83 protein_id gnl|my_center|LOCUS_31890 3302 3700 gene locus_tag LOCUS_31900 gene msrB 3302 3700 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK9 protein_id gnl|my_center|LOCUS_31900 4619 3735 gene locus_tag LOCUS_31910 gene gtaB 4619 3735 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6J3 protein_id gnl|my_center|LOCUS_31910 5658 4606 gene locus_tag LOCUS_31920 5658 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 6172 6672 gene locus_tag LOCUS_31930 6172 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 7314 7778 gene locus_tag LOCUS_31940 7314 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057333.1 protein_id gnl|my_center|LOCUS_31940 8666 7956 gene locus_tag LOCUS_31950 8666 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 9086 9745 gene locus_tag LOCUS_31960 gene ycf39 9086 9745 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056872.1 protein_id gnl|my_center|LOCUS_31960 10071 10571 gene locus_tag LOCUS_31970 10071 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 11120 13507 gene locus_tag LOCUS_31980 11120 13507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 14885 13647 gene locus_tag LOCUS_31990 14885 13647 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_31990 16008 16781 gene locus_tag LOCUS_32000 gene gloB 16008 16781 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF1 protein_id gnl|my_center|LOCUS_32000 16906 17451 gene locus_tag LOCUS_32010 16906 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 17631 18089 gene locus_tag LOCUS_32020 gene rplI 17631 18089 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A499 protein_id gnl|my_center|LOCUS_32020 18316 19662 gene locus_tag LOCUS_32030 gene dnaB 18316 19662 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA9 protein_id gnl|my_center|LOCUS_32030 20276 19782 gene locus_tag LOCUS_32040 gene yqjY 20276 19782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54562 protein_id gnl|my_center|LOCUS_32040 20993 20436 gene locus_tag LOCUS_32050 20993 20436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 21339 21016 gene locus_tag LOCUS_32060 21339 21016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056944.1 protein_id gnl|my_center|LOCUS_32060 22689 21556 gene locus_tag LOCUS_32070 22689 21556 CDS product protoporphyrin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP87 protein_id gnl|my_center|LOCUS_32070 23399 24730 gene locus_tag LOCUS_32080 23399 24730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 24892 25629 gene locus_tag LOCUS_32090 24892 25629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057310.1 protein_id gnl|my_center|LOCUS_32090 26810 25674 gene locus_tag LOCUS_32100 26810 25674 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249584.1 protein_id gnl|my_center|LOCUS_32100 29615 26892 gene locus_tag LOCUS_32110 29615 26892 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_32110 32029 30140 gene locus_tag LOCUS_32120 32029 30140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 32449 32258 gene locus_tag LOCUS_32130 32449 32258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 32826 34007 gene locus_tag LOCUS_32140 32826 34007 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056420.1 protein_id gnl|my_center|LOCUS_32140 35153 34086 gene locus_tag LOCUS_32150 35153 34086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 36911 35331 gene locus_tag LOCUS_32160 36911 35331 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256736.1 protein_id gnl|my_center|LOCUS_32160 38755 37277 gene locus_tag LOCUS_32170 38755 37277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 39151 40452 gene locus_tag LOCUS_32180 gene purB 39151 40452 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW4 protein_id gnl|my_center|LOCUS_32180 40750 41616 gene locus_tag LOCUS_32190 40750 41616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143123.1 protein_id gnl|my_center|LOCUS_32190 >Feature sequence061 2076 94 gene locus_tag LOCUS_32200 2076 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 2989 2102 gene locus_tag LOCUS_32210 2989 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 3789 4688 gene locus_tag LOCUS_32220 3789 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_32220 5581 6261 gene locus_tag LOCUS_32230 5581 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 6254 7258 gene locus_tag LOCUS_32240 6254 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 7792 7418 gene locus_tag LOCUS_32250 7792 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 8726 7884 gene locus_tag LOCUS_32260 8726 7884 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 protein_id gnl|my_center|LOCUS_32260 9502 9023 gene locus_tag LOCUS_32270 9502 9023 CDS product thermonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082676.1 protein_id gnl|my_center|LOCUS_32270 9947 9579 gene locus_tag LOCUS_32280 9947 9579 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 protein_id gnl|my_center|LOCUS_32280 10031 10119 gene locus_tag LOCUS_t00240 10031 10119 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10469 11155 gene locus_tag LOCUS_32290 10469 11155 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZR1 protein_id gnl|my_center|LOCUS_32290 11773 12192 gene locus_tag LOCUS_32300 11773 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 15408 12388 gene locus_tag LOCUS_32310 15408 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058009.1 protein_id gnl|my_center|LOCUS_32310 15929 16528 gene locus_tag LOCUS_32320 15929 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 18394 16655 gene locus_tag LOCUS_32330 gene ycf55 18394 16655 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058156.1 protein_id gnl|my_center|LOCUS_32330 19208 18663 gene locus_tag LOCUS_32340 19208 18663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 19634 19789 gene locus_tag LOCUS_32350 19634 19789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 20438 19944 gene locus_tag LOCUS_32360 20438 19944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 21276 20431 gene locus_tag LOCUS_32370 21276 20431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 22540 21695 gene locus_tag LOCUS_32380 gene fabD 22540 21695 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMS0 protein_id gnl|my_center|LOCUS_32380 24697 23060 gene locus_tag LOCUS_32390 24697 23060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143446.1 protein_id gnl|my_center|LOCUS_32390 25059 25694 gene locus_tag LOCUS_32400 gene upp 25059 25694 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTB9 protein_id gnl|my_center|LOCUS_32400 25907 28441 gene locus_tag LOCUS_32410 25907 28441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 28662 31172 gene locus_tag LOCUS_32420 28662 31172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 31441 33945 gene locus_tag LOCUS_32430 31441 33945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 34031 36601 gene locus_tag LOCUS_32440 34031 36601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 36927 38069 gene locus_tag LOCUS_32450 36927 38069 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_32450 38426 38659 gene locus_tag LOCUS_32460 38426 38659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 39330 38737 gene locus_tag LOCUS_32470 39330 38737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 40013 39648 gene locus_tag LOCUS_32480 40013 39648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 41568 40573 gene locus_tag LOCUS_32490 gene cysM 41568 40573 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058144.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence062 1981 884 gene locus_tag LOCUS_32500 gene ccsA 1981 884 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIH3 protein_id gnl|my_center|LOCUS_32500 3536 2562 gene locus_tag LOCUS_32510 gene psbA3 3536 2562 CDS product photosystem II protein D1 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIV4 protein_id gnl|my_center|LOCUS_32510 5442 3904 gene locus_tag LOCUS_32520 5442 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 8845 5726 gene locus_tag LOCUS_32530 8845 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 9057 8845 gene locus_tag LOCUS_32540 9057 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 9210 9446 gene locus_tag LOCUS_32550 9210 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 10604 9474 gene locus_tag LOCUS_32560 10604 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 11947 10925 gene locus_tag LOCUS_32570 gene hemB 11947 10925 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_32570 12422 13315 gene locus_tag LOCUS_32580 12422 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 14069 13338 gene locus_tag LOCUS_32590 14069 13338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 15772 14120 gene locus_tag LOCUS_32600 15772 14120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 17540 15744 gene locus_tag LOCUS_32610 17540 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 18490 17537 gene locus_tag LOCUS_32620 18490 17537 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719803.1 protein_id gnl|my_center|LOCUS_32620 19503 18475 gene locus_tag LOCUS_32630 19503 18475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 22685 19650 gene locus_tag LOCUS_32640 22685 19650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 23633 22782 gene locus_tag LOCUS_32650 23633 22782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 25702 23897 gene locus_tag LOCUS_32660 25702 23897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 26286 26047 gene locus_tag LOCUS_32670 26286 26047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 27984 26800 gene locus_tag LOCUS_32680 27984 26800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 31255 29375 gene locus_tag LOCUS_32690 gene nadE 31255 29375 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_32690 31715 31897 gene locus_tag LOCUS_32700 31715 31897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 32524 32159 gene locus_tag LOCUS_32710 32524 32159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 33395 32640 gene locus_tag LOCUS_32720 33395 32640 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32720 33958 33392 gene locus_tag LOCUS_32730 gene nadD 33958 33392 CDS product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 protein_id gnl|my_center|LOCUS_32730 35536 34700 gene locus_tag LOCUS_32740 35536 34700 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966986.1 protein_id gnl|my_center|LOCUS_32740 35585 35824 gene locus_tag LOCUS_32750 35585 35824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 37214 36993 gene locus_tag LOCUS_32760 37214 36993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 38931 37579 gene locus_tag LOCUS_32770 38931 37579 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP5 protein_id gnl|my_center|LOCUS_32770 39300 39449 gene locus_tag LOCUS_32780 39300 39449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 40337 39687 gene locus_tag LOCUS_32790 40337 39687 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141890.1 protein_id gnl|my_center|LOCUS_32790 41193 40738 gene locus_tag LOCUS_32800 41193 40738 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021182.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence063 378 746 gene locus_tag LOCUS_32810 378 746 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKV4 protein_id gnl|my_center|LOCUS_32810 784 1749 gene locus_tag LOCUS_32820 784 1749 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 protein_id gnl|my_center|LOCUS_32820 1984 2832 gene locus_tag LOCUS_32830 gene rsmA 1984 2832 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59157 protein_id gnl|my_center|LOCUS_32830 2801 3751 gene locus_tag LOCUS_32840 gene ispE 2801 3751 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ1 protein_id gnl|my_center|LOCUS_32840 5591 3813 gene locus_tag LOCUS_32850 5591 3813 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057025.1 protein_id gnl|my_center|LOCUS_32850 6130 7272 gene locus_tag LOCUS_32860 gene potA 6130 7272 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBU2 protein_id gnl|my_center|LOCUS_32860 7475 8599 gene locus_tag LOCUS_32870 gene potD 7475 8599 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_32870 8881 9795 gene locus_tag LOCUS_32880 gene potB 8881 9795 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_32880 10124 10972 gene locus_tag LOCUS_32890 10124 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 12016 11075 gene locus_tag LOCUS_32900 12016 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 12683 12069 gene locus_tag LOCUS_32910 12683 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 14104 13043 gene locus_tag LOCUS_32920 14104 13043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 14814 16151 gene locus_tag LOCUS_32930 14814 16151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 16144 17478 gene locus_tag LOCUS_32940 16144 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 17684 20158 gene locus_tag LOCUS_32950 17684 20158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 20233 20445 gene locus_tag LOCUS_32960 20233 20445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 20897 21469 gene locus_tag LOCUS_32970 20897 21469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 22626 21679 gene locus_tag LOCUS_32980 22626 21679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 26097 22783 gene locus_tag LOCUS_32990 26097 22783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 28095 27886 gene locus_tag LOCUS_33000 28095 27886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 28825 28106 gene locus_tag LOCUS_33010 28825 28106 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140299.1 protein_id gnl|my_center|LOCUS_33010 28921 29754 gene locus_tag LOCUS_33020 28921 29754 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9Y9 protein_id gnl|my_center|LOCUS_33020 30007 30429 gene locus_tag LOCUS_33030 30007 30429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 32005 30533 gene locus_tag LOCUS_33040 32005 30533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 32552 32710 gene locus_tag LOCUS_33050 32552 32710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 33854 33117 gene locus_tag LOCUS_33060 33854 33117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057763.1 protein_id gnl|my_center|LOCUS_33060 34723 34208 gene locus_tag LOCUS_33070 gene ppiB 34723 34208 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F376 protein_id gnl|my_center|LOCUS_33070 36163 34808 gene locus_tag LOCUS_33080 36163 34808 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 protein_id gnl|my_center|LOCUS_33080 36994 36665 gene locus_tag LOCUS_33090 36994 36665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141253.1 protein_id gnl|my_center|LOCUS_33090 38312 37350 gene locus_tag LOCUS_33100 38312 37350 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_33100 40190 38739 gene locus_tag LOCUS_33110 40190 38739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 40177 40383 gene locus_tag LOCUS_33120 40177 40383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence064 652 359 gene locus_tag LOCUS_33130 652 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057100.1 protein_id gnl|my_center|LOCUS_33130 977 657 gene locus_tag LOCUS_33140 gene clpS 977 657 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJY3 protein_id gnl|my_center|LOCUS_33140 1331 2458 gene locus_tag LOCUS_33150 1331 2458 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_33150 2533 4437 gene locus_tag LOCUS_33160 2533 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143667.1 protein_id gnl|my_center|LOCUS_33160 4465 4785 gene locus_tag LOCUS_33170 4465 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 5031 5387 gene locus_tag LOCUS_33180 5031 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 5645 5406 gene locus_tag LOCUS_33190 5645 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 5826 7958 gene locus_tag LOCUS_33200 5826 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 8526 10532 gene locus_tag LOCUS_33210 8526 10532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 11099 10908 gene locus_tag LOCUS_33220 11099 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 13122 11719 gene locus_tag LOCUS_33230 13122 11719 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056017.1 protein_id gnl|my_center|LOCUS_33230 13681 13148 gene locus_tag LOCUS_33240 13681 13148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 14353 15054 gene locus_tag LOCUS_33250 gene cobO 14353 15054 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056120.1 protein_id gnl|my_center|LOCUS_33250 16411 17403 gene locus_tag LOCUS_33260 gene sigB 16411 17403 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056675.1 protein_id gnl|my_center|LOCUS_33260 18020 18625 gene locus_tag LOCUS_33270 18020 18625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 19604 18789 gene locus_tag LOCUS_33280 19604 18789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 20057 19842 gene locus_tag LOCUS_33290 20057 19842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 21394 20402 gene locus_tag LOCUS_33300 21394 20402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 21512 21676 gene locus_tag LOCUS_33310 21512 21676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 22706 22026 gene locus_tag LOCUS_33320 22706 22026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140697.1 protein_id gnl|my_center|LOCUS_33320 23541 22810 gene locus_tag LOCUS_33330 23541 22810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143111.1 protein_id gnl|my_center|LOCUS_33330 24151 23630 gene locus_tag LOCUS_33340 24151 23630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 25170 24559 gene locus_tag LOCUS_33350 25170 24559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_33350 25651 26259 gene locus_tag LOCUS_33360 25651 26259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 26443 28887 gene locus_tag LOCUS_33370 gene recJ 26443 28887 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056029.1 protein_id gnl|my_center|LOCUS_33370 29363 29911 gene locus_tag LOCUS_33380 29363 29911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 30258 32210 gene locus_tag LOCUS_33390 gene sir 30258 32210 CDS product sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056194.1 protein_id gnl|my_center|LOCUS_33390 32954 32352 gene locus_tag LOCUS_33400 gene coaE 32954 32352 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKG1 protein_id gnl|my_center|LOCUS_33400 33253 33714 gene locus_tag LOCUS_33410 33253 33714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 36020 34104 gene locus_tag LOCUS_33420 36020 34104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 36234 37154 gene locus_tag LOCUS_33430 gene nadK2 36234 37154 CDS product NAD kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RR32 protein_id gnl|my_center|LOCUS_33430 37948 38883 gene locus_tag LOCUS_33440 37948 38883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 >Feature sequence065 930 2957 gene locus_tag LOCUS_33450 930 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 3964 3161 gene locus_tag LOCUS_33460 3964 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 4425 5027 gene locus_tag LOCUS_33470 4425 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 5862 7031 gene locus_tag LOCUS_33480 gene nifS 5862 7031 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055970.1 protein_id gnl|my_center|LOCUS_33480 9157 11118 gene locus_tag LOCUS_33490 gene rne 9157 11118 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056445.1 protein_id gnl|my_center|LOCUS_33490 11115 11744 gene locus_tag LOCUS_33500 11115 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 12429 11755 gene locus_tag LOCUS_33510 12429 11755 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_33510 13333 13992 gene locus_tag LOCUS_33520 gene hisG 13333 13992 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD9 protein_id gnl|my_center|LOCUS_33520 14424 14864 gene locus_tag LOCUS_33530 14424 14864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 14968 15741 gene locus_tag LOCUS_33540 14968 15741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058307.1 protein_id gnl|my_center|LOCUS_33540 18497 16002 gene locus_tag LOCUS_33550 18497 16002 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057047.1 protein_id gnl|my_center|LOCUS_33550 18725 18967 gene locus_tag LOCUS_33560 18725 18967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 19807 19142 gene locus_tag LOCUS_33570 19807 19142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 21305 21060 gene locus_tag LOCUS_33580 21305 21060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 24591 22144 gene locus_tag LOCUS_33590 24591 22144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056048.1 protein_id gnl|my_center|LOCUS_33590 26556 24607 gene locus_tag LOCUS_33600 26556 24607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 27943 26786 gene locus_tag LOCUS_33610 27943 26786 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768296.1 protein_id gnl|my_center|LOCUS_33610 29694 28663 gene locus_tag LOCUS_33620 29694 28663 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142814.1 protein_id gnl|my_center|LOCUS_33620 30670 31884 gene locus_tag LOCUS_33630 30670 31884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_33630 32304 34358 gene locus_tag LOCUS_33640 32304 34358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 34872 35084 gene locus_tag LOCUS_33650 34872 35084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 36984 35299 gene locus_tag LOCUS_33660 gene ilvD 36984 35299 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK13 protein_id gnl|my_center|LOCUS_33660 37340 38179 gene locus_tag LOCUS_33670 37340 38179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 38459 39244 gene locus_tag LOCUS_33680 38459 39244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142774.1 protein_id gnl|my_center|LOCUS_33680 >Feature sequence066 887 669 gene locus_tag LOCUS_33690 887 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 2889 1780 gene locus_tag LOCUS_33700 gene mraY 2889 1780 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK95 protein_id gnl|my_center|LOCUS_33700 4186 3290 gene locus_tag LOCUS_33710 4186 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141312.1 protein_id gnl|my_center|LOCUS_33710 5397 4210 gene locus_tag LOCUS_33720 5397 4210 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089037.1 protein_id gnl|my_center|LOCUS_33720 6876 5632 gene locus_tag LOCUS_33730 6876 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 7768 6950 gene locus_tag LOCUS_33740 7768 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 8229 8408 gene locus_tag LOCUS_33750 8229 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 9434 8415 gene locus_tag LOCUS_33760 9434 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 10792 9455 gene locus_tag LOCUS_33770 10792 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 12113 10863 gene locus_tag LOCUS_33780 12113 10863 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_33780 12958 12110 gene locus_tag LOCUS_33790 12958 12110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 14080 13139 gene locus_tag LOCUS_33800 14080 13139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 14983 14087 gene locus_tag LOCUS_33810 14983 14087 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_33810 16245 15034 gene locus_tag LOCUS_33820 16245 15034 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767225.1 protein_id gnl|my_center|LOCUS_33820 17762 16533 gene locus_tag LOCUS_33830 17762 16533 CDS product glycosyl transferase group 1/2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546575.1 protein_id gnl|my_center|LOCUS_33830 19026 17734 gene locus_tag LOCUS_33840 19026 17734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 19674 19168 gene locus_tag LOCUS_33850 19674 19168 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224883.1 protein_id gnl|my_center|LOCUS_33850 20525 19695 gene locus_tag LOCUS_33860 gene kdsA 20525 19695 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61655 protein_id gnl|my_center|LOCUS_33860 21460 20687 gene locus_tag LOCUS_33870 21460 20687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 22360 21635 gene locus_tag LOCUS_33880 gene kdsB 22360 21635 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY2 protein_id gnl|my_center|LOCUS_33880 23351 22488 gene locus_tag LOCUS_33890 23351 22488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 24272 23631 gene locus_tag LOCUS_33900 24272 23631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 24471 24247 gene locus_tag LOCUS_33910 24471 24247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 25807 24530 gene locus_tag LOCUS_33920 gene abcT4 25807 24530 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880682.1 protein_id gnl|my_center|LOCUS_33920 26589 25810 gene locus_tag LOCUS_33930 26589 25810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 28875 27082 gene locus_tag LOCUS_33940 28875 27082 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903944.1 protein_id gnl|my_center|LOCUS_33940 30501 29491 gene locus_tag LOCUS_33950 30501 29491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058025.1 protein_id gnl|my_center|LOCUS_33950 31135 32061 gene locus_tag LOCUS_33960 31135 32061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 protein_id gnl|my_center|LOCUS_33960 33885 32158 gene locus_tag LOCUS_33970 gene sdhA 33885 32158 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057217.1 protein_id gnl|my_center|LOCUS_33970 34361 34050 gene locus_tag LOCUS_33980 34361 34050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 34646 34573 gene locus_tag LOCUS_t00250 34646 34573 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35287 35946 gene locus_tag LOCUS_33990 35287 35946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 36040 37074 gene locus_tag LOCUS_34000 36040 37074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 37071 38090 gene locus_tag LOCUS_34010 37071 38090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 39227 38298 gene locus_tag LOCUS_34020 gene draG 39227 38298 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_34020 >Feature sequence067 3456 205 gene locus_tag LOCUS_34030 gene apcE 3456 205 CDS product photosystem I reaction center subunit X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058198.1 protein_id gnl|my_center|LOCUS_34030 3845 5059 gene locus_tag LOCUS_34040 3845 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 protein_id gnl|my_center|LOCUS_34040 5373 6338 gene locus_tag LOCUS_34050 gene rfbQ 5373 6338 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403761.1 protein_id gnl|my_center|LOCUS_34050 6477 7208 gene locus_tag LOCUS_34060 gene ycf29 6477 7208 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 protein_id gnl|my_center|LOCUS_34060 8273 9295 gene locus_tag LOCUS_34070 8273 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058193.1 protein_id gnl|my_center|LOCUS_34070 9677 9198 gene locus_tag LOCUS_34080 9677 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 10052 14401 gene locus_tag LOCUS_34090 10052 14401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 14724 17558 gene locus_tag LOCUS_34100 14724 17558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 18661 17858 gene locus_tag LOCUS_34110 18661 17858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 21503 19191 gene locus_tag LOCUS_34120 21503 19191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 22656 21565 gene locus_tag LOCUS_34130 22656 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 24410 23136 gene locus_tag LOCUS_34140 24410 23136 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_34140 25146 24499 gene locus_tag LOCUS_34150 25146 24499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 26261 25212 gene locus_tag LOCUS_34160 26261 25212 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141174.1 protein_id gnl|my_center|LOCUS_34160 26822 26505 gene locus_tag LOCUS_34170 26822 26505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 29780 27099 gene locus_tag LOCUS_34180 29780 27099 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_34180 31459 30185 gene locus_tag LOCUS_34190 31459 30185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 33997 32588 gene locus_tag LOCUS_34200 33997 32588 CDS product alkaline invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 protein_id gnl|my_center|LOCUS_34200 34504 34316 gene locus_tag LOCUS_34210 34504 34316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 34758 35945 gene locus_tag LOCUS_34220 34758 35945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 36169 37557 gene locus_tag LOCUS_34230 36169 37557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 >Feature sequence068 1056 472 gene locus_tag LOCUS_34240 1056 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 1264 2307 gene locus_tag LOCUS_34250 gene oruR 1264 2307 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 protein_id gnl|my_center|LOCUS_34250 2492 3460 gene locus_tag LOCUS_34260 2492 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 3523 3732 gene locus_tag LOCUS_34270 3523 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 3818 3746 gene locus_tag LOCUS_t00260 3818 3746 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4620 3895 gene locus_tag LOCUS_34280 4620 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 protein_id gnl|my_center|LOCUS_34280 5078 4797 gene locus_tag LOCUS_34290 5078 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34290 5279 5094 gene locus_tag LOCUS_34300 5279 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34300 6072 5743 gene locus_tag LOCUS_34310 6072 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 6407 6153 gene locus_tag LOCUS_34320 6407 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 6738 8150 gene locus_tag LOCUS_34330 6738 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 8452 9126 gene locus_tag LOCUS_34340 gene ykoG 8452 9126 CDS product putative transcriptional regulatory protein YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34903 protein_id gnl|my_center|LOCUS_34340 9621 9298 gene locus_tag LOCUS_34350 9621 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 9888 12083 gene locus_tag LOCUS_34360 9888 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 12213 12683 gene locus_tag LOCUS_34370 12213 12683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 14019 12955 gene locus_tag LOCUS_34380 14019 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 14686 14012 gene locus_tag LOCUS_34390 14686 14012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 16455 16054 gene locus_tag LOCUS_34400 gene rplL 16455 16054 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM25 protein_id gnl|my_center|LOCUS_34400 17111 16545 gene locus_tag LOCUS_34410 gene rplJ 17111 16545 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM26 protein_id gnl|my_center|LOCUS_34410 18705 17989 gene locus_tag LOCUS_34420 gene rplA 18705 17989 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM27 protein_id gnl|my_center|LOCUS_34420 19277 18852 gene locus_tag LOCUS_34430 gene rplK 19277 18852 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM28 protein_id gnl|my_center|LOCUS_34430 19908 19288 gene locus_tag LOCUS_34440 gene nusG 19908 19288 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM29 protein_id gnl|my_center|LOCUS_34440 20135 19908 gene locus_tag LOCUS_34450 gene secE 20135 19908 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM30 protein_id gnl|my_center|LOCUS_34450 20595 20522 gene locus_tag LOCUS_t00270 20595 20522 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 21052 20690 gene locus_tag LOCUS_34460 gene rplS 21052 20690 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC4 protein_id gnl|my_center|LOCUS_34460 22435 21206 gene locus_tag LOCUS_34470 22435 21206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 24349 22724 gene locus_tag LOCUS_34480 24349 22724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 25710 25955 gene locus_tag LOCUS_34490 25710 25955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 27053 26607 gene locus_tag LOCUS_34500 27053 26607 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064118.1 protein_id gnl|my_center|LOCUS_34500 28708 27089 gene locus_tag LOCUS_34510 28708 27089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 29482 28817 gene locus_tag LOCUS_34520 29482 28817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 30197 30931 gene locus_tag LOCUS_34530 30197 30931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 31662 32357 gene locus_tag LOCUS_34540 31662 32357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 36171 33085 gene locus_tag LOCUS_34550 gene putA 36171 33085 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746X3 protein_id gnl|my_center|LOCUS_34550 36958 36482 gene locus_tag LOCUS_34560 36958 36482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 >Feature sequence069 2011 1175 gene locus_tag LOCUS_34570 gene map 2011 1175 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ4 protein_id gnl|my_center|LOCUS_34570 2264 2716 gene locus_tag LOCUS_34580 2264 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 3382 2735 gene locus_tag LOCUS_34590 3382 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 3576 4802 gene locus_tag LOCUS_34600 3576 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 5059 5499 gene locus_tag LOCUS_34610 5059 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056602.1 protein_id gnl|my_center|LOCUS_34610 5904 5656 gene locus_tag LOCUS_34620 gene ycf19 5904 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143529.1 protein_id gnl|my_center|LOCUS_34620 6368 6033 gene locus_tag LOCUS_34630 6368 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 7314 6664 gene locus_tag LOCUS_34640 7314 6664 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI28 protein_id gnl|my_center|LOCUS_34640 8003 9553 gene locus_tag LOCUS_34650 8003 9553 CDS product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124737.1 protein_id gnl|my_center|LOCUS_34650 9938 12361 gene locus_tag LOCUS_34660 9938 12361 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057093.1 protein_id gnl|my_center|LOCUS_34660 13411 12575 gene locus_tag LOCUS_34670 13411 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 14323 14081 gene locus_tag LOCUS_34680 14323 14081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 15384 14320 gene locus_tag LOCUS_34690 15384 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 15703 15957 gene locus_tag LOCUS_34700 15703 15957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 16348 16608 gene locus_tag LOCUS_34710 16348 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 17640 16819 gene locus_tag LOCUS_34720 17640 16819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 protein_id gnl|my_center|LOCUS_34720 17835 18047 gene locus_tag LOCUS_34730 17835 18047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 18040 18606 gene locus_tag LOCUS_34740 18040 18606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 19493 18702 gene locus_tag LOCUS_34750 19493 18702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_34750 20196 19609 gene locus_tag LOCUS_34760 20196 19609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_34760 21194 20448 gene locus_tag LOCUS_34770 gene rsmG 21194 20448 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMQ7 protein_id gnl|my_center|LOCUS_34770 22133 21471 gene locus_tag LOCUS_34780 22133 21471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056125.1 protein_id gnl|my_center|LOCUS_34780 22878 24350 gene locus_tag LOCUS_34790 22878 24350 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600173.1 protein_id gnl|my_center|LOCUS_34790 24433 25452 gene locus_tag LOCUS_34800 24433 25452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 25869 26195 gene locus_tag LOCUS_34810 25869 26195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140556.1 protein_id gnl|my_center|LOCUS_34810 26249 26791 gene locus_tag LOCUS_34820 26249 26791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057421.1 protein_id gnl|my_center|LOCUS_34820 26788 27954 gene locus_tag LOCUS_34830 gene carA 26788 27954 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU5 protein_id gnl|my_center|LOCUS_34830 28377 28778 gene locus_tag LOCUS_34840 28377 28778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 28960 29448 gene locus_tag LOCUS_34850 28960 29448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 29463 30512 gene locus_tag LOCUS_34860 29463 30512 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056885.1 protein_id gnl|my_center|LOCUS_34860 30581 30865 gene locus_tag LOCUS_34870 30581 30865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 31539 30973 gene locus_tag LOCUS_34880 31539 30973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_34880 33295 31817 gene locus_tag LOCUS_34890 33295 31817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 33647 33288 gene locus_tag LOCUS_34900 33647 33288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 35386 33659 gene locus_tag LOCUS_34910 35386 33659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 36931 35408 gene locus_tag LOCUS_34920 36931 35408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34920 >Feature sequence070 1683 1426 gene locus_tag LOCUS_34930 1683 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 2671 2006 gene locus_tag LOCUS_34940 2671 2006 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056342.1 protein_id gnl|my_center|LOCUS_34940 3063 4502 gene locus_tag LOCUS_34950 gene ycf24 3063 4502 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_34950 4636 5424 gene locus_tag LOCUS_34960 4636 5424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_34960 5424 6773 gene locus_tag LOCUS_34970 5424 6773 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 protein_id gnl|my_center|LOCUS_34970 6775 8037 gene locus_tag LOCUS_34980 gene nifS 6775 8037 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH91 protein_id gnl|my_center|LOCUS_34980 8314 9264 gene locus_tag LOCUS_34990 8314 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_34990 9804 10865 gene locus_tag LOCUS_35000 gene proX 9804 10865 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477761.1 protein_id gnl|my_center|LOCUS_35000 10911 11984 gene locus_tag LOCUS_35010 10911 11984 CDS product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886804.1 protein_id gnl|my_center|LOCUS_35010 11986 13038 gene locus_tag LOCUS_35020 11986 13038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 13048 14322 gene locus_tag LOCUS_35030 13048 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 15654 14458 gene locus_tag LOCUS_35040 gene solA 15654 14458 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58526 protein_id gnl|my_center|LOCUS_35040 17673 16699 gene locus_tag LOCUS_35050 17673 16699 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260111.1 protein_id gnl|my_center|LOCUS_35050 19698 19228 gene locus_tag LOCUS_35060 19698 19228 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_35060 21448 20996 gene locus_tag LOCUS_35070 21448 20996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 22356 23327 gene locus_tag LOCUS_35080 22356 23327 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140505.1 protein_id gnl|my_center|LOCUS_35080 27399 23317 gene locus_tag LOCUS_35090 27399 23317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 28200 27985 gene locus_tag LOCUS_35100 28200 27985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 28980 28780 gene locus_tag LOCUS_35110 28980 28780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 33334 29135 gene locus_tag LOCUS_35120 33334 29135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 33925 36615 gene locus_tag LOCUS_35130 33925 36615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 >Feature sequence071 314 1375 gene locus_tag LOCUS_35140 314 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 protein_id gnl|my_center|LOCUS_35140 2449 1670 gene locus_tag LOCUS_35150 2449 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 3977 2511 gene locus_tag LOCUS_35160 3977 2511 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729271.1 protein_id gnl|my_center|LOCUS_35160 5307 4099 gene locus_tag LOCUS_35170 5307 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 6769 5687 gene locus_tag LOCUS_35180 6769 5687 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865294.1 protein_id gnl|my_center|LOCUS_35180 7676 6798 gene locus_tag LOCUS_35190 7676 6798 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_35190 8557 7676 gene locus_tag LOCUS_35200 8557 7676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_35200 9798 8554 gene locus_tag LOCUS_35210 9798 8554 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061333.1 protein_id gnl|my_center|LOCUS_35210 10424 11206 gene locus_tag LOCUS_35220 10424 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 12665 11757 gene locus_tag LOCUS_35230 12665 11757 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_35230 13199 14314 gene locus_tag LOCUS_35240 gene proB 13199 14314 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH42 protein_id gnl|my_center|LOCUS_35240 16828 14597 gene locus_tag LOCUS_35250 16828 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 17197 17451 gene locus_tag LOCUS_35260 17197 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 24933 18409 gene locus_tag LOCUS_35270 24933 18409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 25355 26002 gene locus_tag LOCUS_35280 25355 26002 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 protein_id gnl|my_center|LOCUS_35280 26169 26381 gene locus_tag LOCUS_35290 26169 26381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 27108 26329 gene locus_tag LOCUS_35300 gene queE 27108 26329 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKG4 protein_id gnl|my_center|LOCUS_35300 27226 28218 gene locus_tag LOCUS_35310 27226 28218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 28696 29130 gene locus_tag LOCUS_35320 28696 29130 CDS product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_35320 30014 29127 gene locus_tag LOCUS_35330 30014 29127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056085.1 protein_id gnl|my_center|LOCUS_35330 30764 30255 gene locus_tag LOCUS_35340 30764 30255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056084.1 protein_id gnl|my_center|LOCUS_35340 32002 33198 gene locus_tag LOCUS_35350 32002 33198 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_35350 34191 33655 gene locus_tag LOCUS_35360 34191 33655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 34532 36229 gene locus_tag LOCUS_35370 34532 36229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 36800 36381 gene locus_tag LOCUS_35380 36800 36381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 >Feature sequence072 151 1248 gene locus_tag LOCUS_35390 gene ccmA 151 1248 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_35390 1349 1933 gene locus_tag LOCUS_35400 1349 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 1994 3217 gene locus_tag LOCUS_35410 1994 3217 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027711.1 protein_id gnl|my_center|LOCUS_35410 3359 4747 gene locus_tag LOCUS_35420 3359 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 4898 5062 gene locus_tag LOCUS_35430 4898 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 5823 6629 gene locus_tag LOCUS_35440 5823 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 7278 6721 gene locus_tag LOCUS_35450 7278 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_35450 7973 7590 gene locus_tag LOCUS_35460 7973 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249265.1 protein_id gnl|my_center|LOCUS_35460 8256 7963 gene locus_tag LOCUS_35470 8256 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 9453 8338 gene locus_tag LOCUS_35480 9453 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 9785 11152 gene locus_tag LOCUS_35490 9785 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 11372 12406 gene locus_tag LOCUS_35500 11372 12406 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_35500 13109 12546 gene locus_tag LOCUS_35510 13109 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_35510 14293 13109 gene locus_tag LOCUS_35520 14293 13109 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_35520 14677 15879 gene locus_tag LOCUS_35530 14677 15879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 18324 16069 gene locus_tag LOCUS_35540 18324 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 19260 18640 gene locus_tag LOCUS_35550 19260 18640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 21352 22503 gene locus_tag LOCUS_35560 21352 22503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530607.1 protein_id gnl|my_center|LOCUS_35560 24185 22827 gene locus_tag LOCUS_35570 gene aroA 24185 22827 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY3 protein_id gnl|my_center|LOCUS_35570 24750 24361 gene locus_tag LOCUS_35580 24750 24361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 protein_id gnl|my_center|LOCUS_35580 24890 26080 gene locus_tag LOCUS_35590 gene queA 24890 26080 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKD7 protein_id gnl|my_center|LOCUS_35590 26297 27019 gene locus_tag LOCUS_35600 26297 27019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_35600 30446 27219 gene locus_tag LOCUS_35610 30446 27219 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974031.1 protein_id gnl|my_center|LOCUS_35610 32096 30501 gene locus_tag LOCUS_35620 32096 30501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 33335 32586 gene locus_tag LOCUS_35630 33335 32586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 34971 35312 gene locus_tag LOCUS_35640 34971 35312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 35774 35953 gene locus_tag LOCUS_35650 35774 35953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 >Feature sequence073 1490 543 gene locus_tag LOCUS_35660 1490 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 3499 2852 gene locus_tag LOCUS_35670 3499 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 4426 3890 gene locus_tag LOCUS_35680 4426 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 4919 4713 gene locus_tag LOCUS_35690 4919 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 5384 5995 gene locus_tag LOCUS_35700 5384 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 8021 6423 gene locus_tag LOCUS_35710 8021 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_35710 9550 8237 gene locus_tag LOCUS_35720 9550 8237 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_35720 11161 9602 gene locus_tag LOCUS_35730 11161 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 13297 11381 gene locus_tag LOCUS_35740 13297 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 14083 13298 gene locus_tag LOCUS_35750 14083 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057312.1 protein_id gnl|my_center|LOCUS_35750 14725 14108 gene locus_tag LOCUS_35760 gene trpG 14725 14108 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 protein_id gnl|my_center|LOCUS_35760 15418 14774 gene locus_tag LOCUS_35770 15418 14774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 15888 16544 gene locus_tag LOCUS_35780 15888 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 17594 16674 gene locus_tag LOCUS_35790 17594 16674 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389749.1 protein_id gnl|my_center|LOCUS_35790 19505 18021 gene locus_tag LOCUS_35800 19505 18021 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 protein_id gnl|my_center|LOCUS_35800 20638 19859 gene locus_tag LOCUS_35810 20638 19859 CDS product fuculose phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_35810 21637 21179 gene locus_tag LOCUS_35820 21637 21179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 22555 21830 gene locus_tag LOCUS_35830 22555 21830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 24012 22741 gene locus_tag LOCUS_35840 24012 22741 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141685.1 protein_id gnl|my_center|LOCUS_35840 24848 24171 gene locus_tag LOCUS_35850 24848 24171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 25336 25854 gene locus_tag LOCUS_35860 25336 25854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 26241 30146 gene locus_tag LOCUS_35870 gene bchH 26241 30146 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388379.1 protein_id gnl|my_center|LOCUS_35870 30471 30322 gene locus_tag LOCUS_35880 30471 30322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 30797 31273 gene locus_tag LOCUS_35890 30797 31273 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_35890 32321 31335 gene locus_tag LOCUS_35900 32321 31335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_35900 33629 32700 gene locus_tag LOCUS_35910 33629 32700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 35161 35526 gene locus_tag LOCUS_35920 35161 35526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056554.1 protein_id gnl|my_center|LOCUS_35920 35541 36338 gene locus_tag LOCUS_35930 gene trpA 35541 36338 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLN9 protein_id gnl|my_center|LOCUS_35930 >Feature sequence074 433 645 gene locus_tag LOCUS_35940 433 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058299.1 protein_id gnl|my_center|LOCUS_35940 642 1886 gene locus_tag LOCUS_35950 642 1886 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058298.1 protein_id gnl|my_center|LOCUS_35950 2326 1931 gene locus_tag LOCUS_35960 2326 1931 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140008.1 protein_id gnl|my_center|LOCUS_35960 3096 2380 gene locus_tag LOCUS_35970 3096 2380 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140007.1 protein_id gnl|my_center|LOCUS_35970 3569 3114 gene locus_tag LOCUS_35980 3569 3114 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271013.1 protein_id gnl|my_center|LOCUS_35980 4106 3780 gene locus_tag LOCUS_35990 4106 3780 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140011.1 protein_id gnl|my_center|LOCUS_35990 4423 4121 gene locus_tag LOCUS_36000 4423 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 protein_id gnl|my_center|LOCUS_36000 5439 4744 gene locus_tag LOCUS_36010 gene purQ 5439 4744 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL01 protein_id gnl|my_center|LOCUS_36010 5717 5436 gene locus_tag LOCUS_36020 gene purS 5717 5436 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG9 protein_id gnl|my_center|LOCUS_36020 5988 6398 gene locus_tag LOCUS_36030 5988 6398 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_36030 6647 6859 gene locus_tag LOCUS_36040 6647 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 8039 7041 gene locus_tag LOCUS_36050 8039 7041 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058018.1 protein_id gnl|my_center|LOCUS_36050 8692 8348 gene locus_tag LOCUS_36060 8692 8348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 8640 8792 gene locus_tag LOCUS_36070 8640 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 9010 11004 gene locus_tag LOCUS_36080 9010 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056767.1 protein_id gnl|my_center|LOCUS_36080 11242 11469 gene locus_tag LOCUS_36090 gene ftrV 11242 11469 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057357.1 protein_id gnl|my_center|LOCUS_36090 13132 11621 gene locus_tag LOCUS_36100 13132 11621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 13649 13368 gene locus_tag LOCUS_36110 13649 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 14397 13636 gene locus_tag LOCUS_36120 14397 13636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 protein_id gnl|my_center|LOCUS_36120 14919 14602 gene locus_tag LOCUS_36130 14919 14602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 16504 15086 gene locus_tag LOCUS_36140 16504 15086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229352.1 protein_id gnl|my_center|LOCUS_36140 17221 17700 gene locus_tag LOCUS_36150 17221 17700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 19357 17756 gene locus_tag LOCUS_36160 19357 17756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 19807 21357 gene locus_tag LOCUS_36170 19807 21357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701838.1 protein_id gnl|my_center|LOCUS_36170 21379 21966 gene locus_tag LOCUS_36180 21379 21966 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 protein_id gnl|my_center|LOCUS_36180 22202 24202 gene locus_tag LOCUS_36190 22202 24202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701839.1 protein_id gnl|my_center|LOCUS_36190 24725 24192 gene locus_tag LOCUS_36200 24725 24192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 24914 25309 gene locus_tag LOCUS_36210 24914 25309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701840.1 protein_id gnl|my_center|LOCUS_36210 25823 25332 gene locus_tag LOCUS_36220 25823 25332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055993.1 protein_id gnl|my_center|LOCUS_36220 26729 26121 gene locus_tag LOCUS_36230 gene trxA 26729 26121 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056210.1 protein_id gnl|my_center|LOCUS_36230 26998 27402 gene locus_tag LOCUS_36240 26998 27402 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 protein_id gnl|my_center|LOCUS_36240 27497 28624 gene locus_tag LOCUS_36250 27497 28624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 29809 30300 gene locus_tag LOCUS_36260 gene psaL 29809 30300 CDS product photosystem I reaction center subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87787 protein_id gnl|my_center|LOCUS_36260 31201 30458 gene locus_tag LOCUS_36270 31201 30458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 31855 31250 gene locus_tag LOCUS_36280 31855 31250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 33003 32158 gene locus_tag LOCUS_36290 33003 32158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 33591 33833 gene locus_tag LOCUS_36300 33591 33833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 35444 33912 gene locus_tag LOCUS_36310 gene trpE 35444 33912 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057509.1 protein_id gnl|my_center|LOCUS_36310 35967 35539 gene locus_tag LOCUS_36320 gene psaD 35967 35539 CDS product photosystem I protein PsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125882.1 protein_id gnl|my_center|LOCUS_36320 >Feature sequence075 187 618 gene locus_tag LOCUS_36330 187 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 1953 1693 gene locus_tag LOCUS_36340 1953 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 2662 2429 gene locus_tag LOCUS_36350 2662 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 2996 3232 gene locus_tag LOCUS_36360 2996 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 6284 3348 gene locus_tag LOCUS_36370 gene polA 6284 3348 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057179.1 protein_id gnl|my_center|LOCUS_36370 6969 7145 gene locus_tag LOCUS_36380 6969 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 7497 8375 gene locus_tag LOCUS_36390 7497 8375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057174.1 protein_id gnl|my_center|LOCUS_36390 8559 9800 gene locus_tag LOCUS_36400 8559 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 11031 10045 gene locus_tag LOCUS_36410 11031 10045 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143025.1 protein_id gnl|my_center|LOCUS_36410 13668 11443 gene locus_tag LOCUS_36420 13668 11443 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_36420 15423 13810 gene locus_tag LOCUS_36430 15423 13810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 15830 16651 gene locus_tag LOCUS_36440 15830 16651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_36440 17179 16715 gene locus_tag LOCUS_36450 17179 16715 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140032.1 protein_id gnl|my_center|LOCUS_36450 18154 19764 gene locus_tag LOCUS_36460 18154 19764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056580.1 protein_id gnl|my_center|LOCUS_36460 21553 20048 gene locus_tag LOCUS_36470 21553 20048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_36470 21777 22052 gene locus_tag LOCUS_36480 21777 22052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 22187 23491 gene locus_tag LOCUS_36490 22187 23491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 23437 28497 gene locus_tag LOCUS_36500 23437 28497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 28782 28498 gene locus_tag LOCUS_36510 28782 28498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 29747 29595 gene locus_tag LOCUS_36520 29747 29595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 30122 30385 gene locus_tag LOCUS_36530 30122 30385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 31245 30637 gene locus_tag LOCUS_36540 31245 30637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 32475 31282 gene locus_tag LOCUS_36550 32475 31282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057505.1 protein_id gnl|my_center|LOCUS_36550 32764 34290 gene locus_tag LOCUS_36560 32764 34290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence076 711 286 gene locus_tag LOCUS_36570 711 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142480.1 protein_id gnl|my_center|LOCUS_36570 1533 757 gene locus_tag LOCUS_36580 1533 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 1925 1764 gene locus_tag LOCUS_36590 1925 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 1876 3489 gene locus_tag LOCUS_36600 1876 3489 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056162.1 protein_id gnl|my_center|LOCUS_36600 3660 4433 gene locus_tag LOCUS_36610 gene hisA 3660 4433 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA5 protein_id gnl|my_center|LOCUS_36610 4980 7292 gene locus_tag LOCUS_36620 4980 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_36620 7631 7383 gene locus_tag LOCUS_36630 7631 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 10540 8825 gene locus_tag LOCUS_36640 10540 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 10763 12418 gene locus_tag LOCUS_36650 10763 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 14091 12487 gene locus_tag LOCUS_36660 14091 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 14530 14865 gene locus_tag LOCUS_36670 14530 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 14961 16961 gene locus_tag LOCUS_36680 14961 16961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142700.1 protein_id gnl|my_center|LOCUS_36680 18369 17587 gene locus_tag LOCUS_36690 gene tatC 18369 17587 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA6 protein_id gnl|my_center|LOCUS_36690 20031 18442 gene locus_tag LOCUS_36700 20031 18442 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_36700 20277 21476 gene locus_tag LOCUS_36710 gene sasA 20277 21476 CDS product adaptive-response sensory-kinase SasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMT2 protein_id gnl|my_center|LOCUS_36710 22025 22222 gene locus_tag LOCUS_36720 22025 22222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 23896 22844 gene locus_tag LOCUS_36730 23896 22844 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_36730 24366 24019 gene locus_tag LOCUS_36740 24366 24019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056921.1 protein_id gnl|my_center|LOCUS_36740 25558 24599 gene locus_tag LOCUS_36750 gene sigD 25558 24599 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056119.1 protein_id gnl|my_center|LOCUS_36750 25718 26356 gene locus_tag LOCUS_36760 25718 26356 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404693.1 protein_id gnl|my_center|LOCUS_36760 27148 29331 gene locus_tag LOCUS_36770 27148 29331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 29331 31070 gene locus_tag LOCUS_36780 29331 31070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 31095 32210 gene locus_tag LOCUS_36790 31095 32210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 32379 33146 gene locus_tag LOCUS_36800 32379 33146 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DME3 protein_id gnl|my_center|LOCUS_36800 33184 34143 gene locus_tag LOCUS_36810 33184 34143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 >Feature sequence077 4789 527 gene locus_tag LOCUS_36820 4789 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 5692 6660 gene locus_tag LOCUS_36830 gene hemC 5692 6660 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE4 protein_id gnl|my_center|LOCUS_36830 6985 8412 gene locus_tag LOCUS_36840 gene glgA 6985 8412 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU2 protein_id gnl|my_center|LOCUS_36840 8631 12875 gene locus_tag LOCUS_36850 8631 12875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 13055 14368 gene locus_tag LOCUS_36860 13055 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 14661 15005 gene locus_tag LOCUS_36870 14661 15005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144163.1 protein_id gnl|my_center|LOCUS_36870 15124 16878 gene locus_tag LOCUS_36880 15124 16878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058075.1 protein_id gnl|my_center|LOCUS_36880 17101 17847 gene locus_tag LOCUS_36890 17101 17847 CDS product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_36890 17915 18868 gene locus_tag LOCUS_36900 gene queG 17915 18868 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA9 protein_id gnl|my_center|LOCUS_36900 18943 19614 gene locus_tag LOCUS_36910 gene gph 18943 19614 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181645.1 protein_id gnl|my_center|LOCUS_36910 20158 20478 gene locus_tag LOCUS_36920 20158 20478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055877.1 protein_id gnl|my_center|LOCUS_36920 21319 22851 gene locus_tag LOCUS_36930 gene psbB 21319 22851 CDS product photosystem II CP47 reaction center protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ1 protein_id gnl|my_center|LOCUS_36930 23433 23825 gene locus_tag LOCUS_36940 23433 23825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 24181 26148 gene locus_tag LOCUS_36950 gene ftsH 24181 26148 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW7 protein_id gnl|my_center|LOCUS_36950 26855 26244 gene locus_tag LOCUS_36960 26855 26244 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057675.1 protein_id gnl|my_center|LOCUS_36960 27313 27690 gene locus_tag LOCUS_36970 27313 27690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 28769 27813 gene locus_tag LOCUS_36980 28769 27813 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529106.1 protein_id gnl|my_center|LOCUS_36980 31144 29015 gene locus_tag LOCUS_36990 31144 29015 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_36990 32318 31389 gene locus_tag LOCUS_37000 32318 31389 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809044.1 protein_id gnl|my_center|LOCUS_37000 32916 32323 gene locus_tag LOCUS_37010 32916 32323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_37010 33308 33502 gene locus_tag LOCUS_37020 33308 33502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 33633 33863 gene locus_tag LOCUS_37030 33633 33863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 33856 34215 gene locus_tag LOCUS_37040 33856 34215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 >Feature sequence078 4291 1799 gene locus_tag LOCUS_37050 4291 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 5482 4919 gene locus_tag LOCUS_37060 5482 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 8462 5898 gene locus_tag LOCUS_37070 8462 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 10099 11835 gene locus_tag LOCUS_37080 10099 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 12432 12190 gene locus_tag LOCUS_37090 12432 12190 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057133.1 protein_id gnl|my_center|LOCUS_37090 12860 13606 gene locus_tag LOCUS_37100 gene comB 12860 13606 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS5 protein_id gnl|my_center|LOCUS_37100 13695 13910 gene locus_tag LOCUS_37110 13695 13910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 14986 13985 gene locus_tag LOCUS_37120 gene pheS 14986 13985 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL09 protein_id gnl|my_center|LOCUS_37120 15157 15969 gene locus_tag LOCUS_37130 gene surE 15157 15969 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI06 protein_id gnl|my_center|LOCUS_37130 16806 16306 gene locus_tag LOCUS_37140 16806 16306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 18818 17160 gene locus_tag LOCUS_37150 gene hflX 18818 17160 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDU0 protein_id gnl|my_center|LOCUS_37150 20523 19189 gene locus_tag LOCUS_37160 20523 19189 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_37160 20780 22147 gene locus_tag LOCUS_37170 20780 22147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_37170 22250 23098 gene locus_tag LOCUS_37180 22250 23098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143123.1 protein_id gnl|my_center|LOCUS_37180 23115 24284 gene locus_tag LOCUS_37190 23115 24284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057921.1 protein_id gnl|my_center|LOCUS_37190 24524 24889 gene locus_tag LOCUS_37200 gene ftrC 24524 24889 CDS product ferredoxin-thioredoxin reductase, catalytic chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK3 protein_id gnl|my_center|LOCUS_37200 24886 25317 gene locus_tag LOCUS_37210 24886 25317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 25515 25997 gene locus_tag LOCUS_37220 25515 25997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057412.1 protein_id gnl|my_center|LOCUS_37220 26186 26914 gene locus_tag LOCUS_37230 26186 26914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057411.1 protein_id gnl|my_center|LOCUS_37230 27592 28503 gene locus_tag LOCUS_37240 27592 28503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 28618 29784 gene locus_tag LOCUS_37250 gene ycf84 28618 29784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 protein_id gnl|my_center|LOCUS_37250 29999 29808 gene locus_tag LOCUS_37260 29999 29808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37260 30376 30194 gene locus_tag LOCUS_37270 30376 30194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 30667 30437 gene locus_tag LOCUS_37280 30667 30437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 30993 30748 gene locus_tag LOCUS_37290 30993 30748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 31801 31094 gene locus_tag LOCUS_37300 31801 31094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 32621 32971 gene locus_tag LOCUS_37310 32621 32971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 32929 33306 gene locus_tag LOCUS_37320 32929 33306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37320 >Feature sequence079 329 1039 gene locus_tag LOCUS_37330 329 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 1366 1142 gene locus_tag LOCUS_37340 1366 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 2769 1345 gene locus_tag LOCUS_37350 2769 1345 CDS product dolichyl-phosphate-mannose-protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 protein_id gnl|my_center|LOCUS_37350 3633 4160 gene locus_tag LOCUS_37360 3633 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 4352 5245 gene locus_tag LOCUS_37370 4352 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 5991 6722 gene locus_tag LOCUS_37380 5991 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 7186 10164 gene locus_tag LOCUS_37390 7186 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 10570 12204 gene locus_tag LOCUS_37400 10570 12204 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218333.1 protein_id gnl|my_center|LOCUS_37400 12495 14882 gene locus_tag LOCUS_37410 12495 14882 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_37410 15044 16168 gene locus_tag LOCUS_37420 gene aroB 15044 16168 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS3 protein_id gnl|my_center|LOCUS_37420 16829 17485 gene locus_tag LOCUS_37430 16829 17485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 17775 17497 gene locus_tag LOCUS_37440 17775 17497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 17927 18505 gene locus_tag LOCUS_37450 17927 18505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144203.1 protein_id gnl|my_center|LOCUS_37450 19203 18820 gene locus_tag LOCUS_37460 19203 18820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 19529 19774 gene locus_tag LOCUS_37470 19529 19774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 21240 20878 gene locus_tag LOCUS_37480 21240 20878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 21530 21243 gene locus_tag LOCUS_37490 21530 21243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 22334 22516 gene locus_tag LOCUS_37500 22334 22516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 23809 25116 gene locus_tag LOCUS_37510 23809 25116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 25660 26211 gene locus_tag LOCUS_37520 25660 26211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057906.1 protein_id gnl|my_center|LOCUS_37520 26575 28509 gene locus_tag LOCUS_37530 26575 28509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 28787 29056 gene locus_tag LOCUS_37540 28787 29056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 29072 30226 gene locus_tag LOCUS_37550 29072 30226 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889545.1 protein_id gnl|my_center|LOCUS_37550 31904 30807 gene locus_tag LOCUS_37560 31904 30807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143082.1 protein_id gnl|my_center|LOCUS_37560 32113 32991 gene locus_tag LOCUS_37570 32113 32991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057461.1 protein_id gnl|my_center|LOCUS_37570 >Feature sequence080 678 965 gene locus_tag LOCUS_37580 678 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_37580 1268 1014 gene locus_tag LOCUS_37590 1268 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678786.1 protein_id gnl|my_center|LOCUS_37590 1527 1243 gene locus_tag LOCUS_37600 1527 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_37600 2377 1676 gene locus_tag LOCUS_37610 2377 1676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_37610 3820 2684 gene locus_tag LOCUS_37620 3820 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 5384 4218 gene locus_tag LOCUS_37630 5384 4218 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_37630 6885 5716 gene locus_tag LOCUS_37640 6885 5716 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056963.1 protein_id gnl|my_center|LOCUS_37640 8368 7073 gene locus_tag LOCUS_37650 8368 7073 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_37650 8860 10575 gene locus_tag LOCUS_37660 8860 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 10862 12436 gene locus_tag LOCUS_37670 10862 12436 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 protein_id gnl|my_center|LOCUS_37670 12809 13096 gene locus_tag LOCUS_37680 12809 13096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 14939 13518 gene locus_tag LOCUS_37690 14939 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_37690 15188 16198 gene locus_tag LOCUS_37700 15188 16198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 16748 16329 gene locus_tag LOCUS_37710 16748 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 17264 17177 gene locus_tag LOCUS_t00280 17264 17177 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17343 17269 gene locus_tag LOCUS_t00290 17343 17269 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 17868 17413 gene locus_tag LOCUS_37720 17868 17413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058296.1 protein_id gnl|my_center|LOCUS_37720 18130 18056 gene locus_tag LOCUS_t00300 18130 18056 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 18820 18185 gene locus_tag LOCUS_37730 18820 18185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 19337 19265 gene locus_tag LOCUS_t00310 19337 19265 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19413 19340 gene locus_tag LOCUS_t00320 19413 19340 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19578 19500 gene locus_tag LOCUS_t00330 19578 19500 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19656 19581 gene locus_tag LOCUS_t00340 19656 19581 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19733 19659 gene locus_tag LOCUS_t00350 19733 19659 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19811 19737 gene locus_tag LOCUS_t00360 19811 19737 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19990 19915 gene locus_tag LOCUS_t00370 19990 19915 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20283 20208 gene locus_tag LOCUS_t00380 20283 20208 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20473 20398 gene locus_tag LOCUS_t00390 20473 20398 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20575 20499 gene locus_tag LOCUS_t00400 20575 20499 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 20678 20606 gene locus_tag LOCUS_t00410 20678 20606 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 20757 20683 gene locus_tag LOCUS_t00420 20757 20683 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20837 20765 gene locus_tag LOCUS_t00430 20837 20765 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 20915 20841 gene locus_tag LOCUS_t00440 20915 20841 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21059 20985 gene locus_tag LOCUS_t00450 21059 20985 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 21566 22363 gene locus_tag LOCUS_37740 gene ureF 21566 22363 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ63 protein_id gnl|my_center|LOCUS_37740 23175 24425 gene locus_tag LOCUS_37750 23175 24425 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056868.1 protein_id gnl|my_center|LOCUS_37750 24686 25057 gene locus_tag LOCUS_37760 24686 25057 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_37760 25075 25620 gene locus_tag LOCUS_37770 25075 25620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 25850 30952 gene locus_tag LOCUS_37780 25850 30952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 >Feature sequence081 4 894 gene locus_tag LOCUS_37790 4 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 2128 1112 gene locus_tag LOCUS_37800 gene gap1 2128 1112 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG48 protein_id gnl|my_center|LOCUS_37800 2789 3787 gene locus_tag LOCUS_37810 gene hslI 2789 3787 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210998.1 protein_id gnl|my_center|LOCUS_37810 4979 3921 gene locus_tag LOCUS_37820 4979 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 5852 5160 gene locus_tag LOCUS_37830 5852 5160 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140704.1 protein_id gnl|my_center|LOCUS_37830 8272 5876 gene locus_tag LOCUS_37840 8272 5876 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057047.1 protein_id gnl|my_center|LOCUS_37840 10363 9311 gene locus_tag LOCUS_37850 gene tgt 10363 9311 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM7 protein_id gnl|my_center|LOCUS_37850 11012 10638 gene locus_tag LOCUS_37860 11012 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140803.1 protein_id gnl|my_center|LOCUS_37860 11832 12626 gene locus_tag LOCUS_37870 gene cobS 11832 12626 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ91 protein_id gnl|my_center|LOCUS_37870 13148 12699 gene locus_tag LOCUS_37880 13148 12699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 13590 14039 gene locus_tag LOCUS_37890 13590 14039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 16799 13962 gene locus_tag LOCUS_37900 16799 13962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 17386 17207 gene locus_tag LOCUS_37910 17386 17207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 18302 17505 gene locus_tag LOCUS_37920 18302 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 19116 18358 gene locus_tag LOCUS_37930 19116 18358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 19889 19158 gene locus_tag LOCUS_37940 19889 19158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 20436 20257 gene locus_tag LOCUS_37950 20436 20257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 20639 20938 gene locus_tag LOCUS_37960 20639 20938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 21291 21542 gene locus_tag LOCUS_37970 21291 21542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 21989 23200 gene locus_tag LOCUS_37980 21989 23200 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_37980 25974 23212 gene locus_tag LOCUS_37990 25974 23212 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142589.1 protein_id gnl|my_center|LOCUS_37990 28298 26232 gene locus_tag LOCUS_38000 28298 26232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 >Feature sequence082 392 658 gene locus_tag LOCUS_38010 392 658 CDS product UPF0367 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKQ5 protein_id gnl|my_center|LOCUS_38010 791 1354 gene locus_tag LOCUS_38020 791 1354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056429.1 protein_id gnl|my_center|LOCUS_38020 1606 2154 gene locus_tag LOCUS_38030 1606 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_38030 2237 2309 gene locus_tag LOCUS_t00460 2237 2309 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4067 2388 gene locus_tag LOCUS_38040 4067 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058118.1 protein_id gnl|my_center|LOCUS_38040 6172 4214 gene locus_tag LOCUS_38050 6172 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 7853 6915 gene locus_tag LOCUS_38060 7853 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 8539 8877 gene locus_tag LOCUS_38070 gene ndhM 8539 8877 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKF6 protein_id gnl|my_center|LOCUS_38070 9679 12042 gene locus_tag LOCUS_38080 9679 12042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 12250 13884 gene locus_tag LOCUS_38090 12250 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 14188 14850 gene locus_tag LOCUS_38100 14188 14850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 16153 15248 gene locus_tag LOCUS_38110 gene cdsA 16153 15248 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 protein_id gnl|my_center|LOCUS_38110 16847 16245 gene locus_tag LOCUS_38120 gene cobL 16847 16245 CDS product precorrin-6B methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 protein_id gnl|my_center|LOCUS_38120 18765 17293 gene locus_tag LOCUS_38130 gene speA 18765 17293 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 protein_id gnl|my_center|LOCUS_38130 20163 19159 gene locus_tag LOCUS_38140 20163 19159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 21853 20246 gene locus_tag LOCUS_38150 21853 20246 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228174.1 protein_id gnl|my_center|LOCUS_38150 22025 23881 gene locus_tag LOCUS_38160 22025 23881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 23951 25492 gene locus_tag LOCUS_38170 23951 25492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 25646 28024 gene locus_tag LOCUS_38180 25646 28024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 28550 29497 gene locus_tag LOCUS_38190 28550 29497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 32486 29619 gene locus_tag LOCUS_38200 32486 29619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 >Feature sequence083 802 413 gene locus_tag LOCUS_38210 802 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 3344 1455 gene locus_tag LOCUS_38220 3344 1455 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_38220 4816 5151 gene locus_tag LOCUS_38230 4816 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 5484 6776 gene locus_tag LOCUS_38240 5484 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 6773 10726 gene locus_tag LOCUS_38250 6773 10726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 10767 11051 gene locus_tag LOCUS_38260 10767 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 12123 11506 gene locus_tag LOCUS_38270 12123 11506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 13693 12494 gene locus_tag LOCUS_38280 13693 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 14238 14681 gene locus_tag LOCUS_38290 14238 14681 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141571.1 protein_id gnl|my_center|LOCUS_38290 14827 15471 gene locus_tag LOCUS_38300 14827 15471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 15468 16310 gene locus_tag LOCUS_38310 15468 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 16482 17126 gene locus_tag LOCUS_38320 16482 17126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_38320 17376 17987 gene locus_tag LOCUS_38330 17376 17987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 18410 18883 gene locus_tag LOCUS_38340 18410 18883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 19488 19024 gene locus_tag LOCUS_38350 19488 19024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 19980 21764 gene locus_tag LOCUS_38360 19980 21764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 21826 23550 gene locus_tag LOCUS_38370 21826 23550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 23929 24378 gene locus_tag LOCUS_38380 23929 24378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 24400 24591 gene locus_tag LOCUS_38390 24400 24591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 26397 24541 gene locus_tag LOCUS_38400 26397 24541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_38400 27045 27713 gene locus_tag LOCUS_38410 gene rimM 27045 27713 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK05 protein_id gnl|my_center|LOCUS_38410 27863 27693 gene locus_tag LOCUS_38420 27863 27693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 28293 29099 gene locus_tag LOCUS_38430 28293 29099 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 protein_id gnl|my_center|LOCUS_38430 29878 30450 gene locus_tag LOCUS_38440 29878 30450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 30435 31217 gene locus_tag LOCUS_38450 30435 31217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056183.1 protein_id gnl|my_center|LOCUS_38450 31334 31513 gene locus_tag LOCUS_38460 31334 31513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 31827 32363 gene locus_tag LOCUS_38470 31827 32363 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 protein_id gnl|my_center|LOCUS_38470 >Feature sequence084 126 1310 gene locus_tag LOCUS_38480 126 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38480 2407 1787 gene locus_tag LOCUS_38490 2407 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063692.1 protein_id gnl|my_center|LOCUS_38490 2991 2446 gene locus_tag LOCUS_38500 2991 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 3085 3456 gene locus_tag LOCUS_38510 3085 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 5856 3922 gene locus_tag LOCUS_38520 5856 3922 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056292.1 protein_id gnl|my_center|LOCUS_38520 7575 6277 gene locus_tag LOCUS_38530 7575 6277 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141544.1 protein_id gnl|my_center|LOCUS_38530 7879 9291 gene locus_tag LOCUS_38540 7879 9291 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089836.1 protein_id gnl|my_center|LOCUS_38540 9297 11933 gene locus_tag LOCUS_38550 9297 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 12398 13606 gene locus_tag LOCUS_38560 gene aroB 12398 13606 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986649.1 protein_id gnl|my_center|LOCUS_38560 13767 17960 gene locus_tag LOCUS_38570 13767 17960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 19493 18288 gene locus_tag LOCUS_38580 gene pgk 19493 18288 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP7 protein_id gnl|my_center|LOCUS_38580 19684 20100 gene locus_tag LOCUS_38590 19684 20100 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 protein_id gnl|my_center|LOCUS_38590 20221 21102 gene locus_tag LOCUS_38600 20221 21102 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS4 protein_id gnl|my_center|LOCUS_38600 22339 21830 gene locus_tag LOCUS_38610 22339 21830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 22401 23057 gene locus_tag LOCUS_38620 gene hisH 22401 23057 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP5 protein_id gnl|my_center|LOCUS_38620 23131 23670 gene locus_tag LOCUS_38630 23131 23670 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 protein_id gnl|my_center|LOCUS_38630 24289 24663 gene locus_tag LOCUS_38640 24289 24663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 26416 24995 gene locus_tag LOCUS_38650 26416 24995 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932892.1 protein_id gnl|my_center|LOCUS_38650 29009 26643 gene locus_tag LOCUS_38660 29009 26643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932893.1 protein_id gnl|my_center|LOCUS_38660 30004 29294 gene locus_tag LOCUS_38670 30004 29294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932633.1 protein_id gnl|my_center|LOCUS_38670 31755 30331 gene locus_tag LOCUS_38680 31755 30331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056806.1 protein_id gnl|my_center|LOCUS_38680 >Feature sequence085 1618 308 gene locus_tag LOCUS_38690 gene ccsB 1618 308 CDS product cytochrome c biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL16 protein_id gnl|my_center|LOCUS_38690 1560 1766 gene locus_tag LOCUS_38700 1560 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 2781 2041 gene locus_tag LOCUS_38710 gene ccdA 2781 2041 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055907.1 protein_id gnl|my_center|LOCUS_38710 3113 3640 gene locus_tag LOCUS_38720 gene yetL 3113 3640 CDS product putative HTH-type transcriptional regulator YetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31541 protein_id gnl|my_center|LOCUS_38720 3787 5106 gene locus_tag LOCUS_38730 3787 5106 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 protein_id gnl|my_center|LOCUS_38730 5189 6337 gene locus_tag LOCUS_38740 5189 6337 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_38740 6389 7084 gene locus_tag LOCUS_38750 6389 7084 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_38750 7716 7081 gene locus_tag LOCUS_38760 7716 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056016.1 protein_id gnl|my_center|LOCUS_38760 8767 7880 gene locus_tag LOCUS_38770 8767 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142031.1 protein_id gnl|my_center|LOCUS_38770 9281 8784 gene locus_tag LOCUS_38780 9281 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 12595 9425 gene locus_tag LOCUS_38790 12595 9425 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142029.1 protein_id gnl|my_center|LOCUS_38790 14283 12622 gene locus_tag LOCUS_38800 14283 12622 CDS product cation efflux system protein CzcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144157.1 protein_id gnl|my_center|LOCUS_38800 14704 15402 gene locus_tag LOCUS_38810 14704 15402 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_38810 15399 16793 gene locus_tag LOCUS_38820 15399 16793 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141685.1 protein_id gnl|my_center|LOCUS_38820 17542 17063 gene locus_tag LOCUS_38830 17542 17063 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_38830 17943 17680 gene locus_tag LOCUS_38840 17943 17680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056018.1 protein_id gnl|my_center|LOCUS_38840 18127 19167 gene locus_tag LOCUS_38850 gene speB 18127 19167 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_38850 20299 19190 gene locus_tag LOCUS_38860 20299 19190 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_38860 22578 20464 gene locus_tag LOCUS_38870 gene speA 22578 20464 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY6 protein_id gnl|my_center|LOCUS_38870 22664 23251 gene locus_tag LOCUS_38880 22664 23251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 25858 23327 gene locus_tag LOCUS_38890 25858 23327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 28073 26877 gene locus_tag LOCUS_38900 28073 26877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 28723 28499 gene locus_tag LOCUS_38910 28723 28499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 30489 28720 gene locus_tag LOCUS_38920 30489 28720 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141553.1 protein_id gnl|my_center|LOCUS_38920 31657 30716 gene locus_tag LOCUS_38930 31657 30716 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533468.1 protein_id gnl|my_center|LOCUS_38930 >Feature sequence086 2376 142 gene locus_tag LOCUS_38940 2376 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 3429 2443 gene locus_tag LOCUS_38950 3429 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 4301 3426 gene locus_tag LOCUS_38960 4301 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 5201 5563 gene locus_tag LOCUS_38970 5201 5563 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_38970 6975 5614 gene locus_tag LOCUS_38980 6975 5614 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056200.1 protein_id gnl|my_center|LOCUS_38980 8115 7039 gene locus_tag LOCUS_38990 8115 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 8553 9407 gene locus_tag LOCUS_39000 8553 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 9647 10324 gene locus_tag LOCUS_39010 9647 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 10290 11687 gene locus_tag LOCUS_39020 10290 11687 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057746.1 protein_id gnl|my_center|LOCUS_39020 12104 12388 gene locus_tag LOCUS_39030 12104 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 12491 13642 gene locus_tag LOCUS_39040 12491 13642 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_39040 13626 15323 gene locus_tag LOCUS_39050 13626 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 15787 18891 gene locus_tag LOCUS_39060 15787 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 19050 22733 gene locus_tag LOCUS_39070 19050 22733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 22983 23531 gene locus_tag LOCUS_39080 22983 23531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 23972 23553 gene locus_tag LOCUS_39090 23972 23553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_39090 24366 24905 gene locus_tag LOCUS_39100 24366 24905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_39100 25321 25509 gene locus_tag LOCUS_39110 25321 25509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 25475 27994 gene locus_tag LOCUS_39120 25475 27994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 27996 28997 gene locus_tag LOCUS_39130 27996 28997 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976356.1 protein_id gnl|my_center|LOCUS_39130 28994 31540 gene locus_tag LOCUS_39140 28994 31540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 >Feature sequence087 686 165 gene locus_tag LOCUS_39150 gene cpcS 686 165 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI91 protein_id gnl|my_center|LOCUS_39150 1479 808 gene locus_tag LOCUS_39160 1479 808 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 protein_id gnl|my_center|LOCUS_39160 1833 4217 gene locus_tag LOCUS_39170 1833 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 5503 5706 gene locus_tag LOCUS_39180 gene psbH 5503 5706 CDS product photosystem II reaction center protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ43 protein_id gnl|my_center|LOCUS_39180 5982 6284 gene locus_tag LOCUS_39190 5982 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 7286 6558 gene locus_tag LOCUS_39200 7286 6558 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 protein_id gnl|my_center|LOCUS_39200 7826 8449 gene locus_tag LOCUS_39210 7826 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 protein_id gnl|my_center|LOCUS_39210 9690 8992 gene locus_tag LOCUS_39220 9690 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 11519 10104 gene locus_tag LOCUS_39230 11519 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 12035 13540 gene locus_tag LOCUS_39240 12035 13540 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058059.1 protein_id gnl|my_center|LOCUS_39240 14410 14171 gene locus_tag LOCUS_39250 14410 14171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 16923 14608 gene locus_tag LOCUS_39260 16923 14608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889282.1 protein_id gnl|my_center|LOCUS_39260 19206 17356 gene locus_tag LOCUS_39270 19206 17356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 20141 19209 gene locus_tag LOCUS_39280 20141 19209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022224.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39280 21020 20220 gene locus_tag LOCUS_39290 21020 20220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 23670 21361 gene locus_tag LOCUS_39300 23670 21361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 24581 23706 gene locus_tag LOCUS_39310 24581 23706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 25171 24605 gene locus_tag LOCUS_39320 25171 24605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 25862 25206 gene locus_tag LOCUS_39330 25862 25206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 26053 26238 gene locus_tag LOCUS_39340 26053 26238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 26494 27486 gene locus_tag LOCUS_39350 26494 27486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 27536 27868 gene locus_tag LOCUS_39360 27536 27868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39360 27881 28093 gene locus_tag LOCUS_39370 27881 28093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39370 29384 28254 gene locus_tag LOCUS_39380 29384 28254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 30585 29437 gene locus_tag LOCUS_39390 30585 29437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 31099 30854 gene locus_tag LOCUS_39400 31099 30854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 >Feature sequence088 1697 2053 gene locus_tag LOCUS_39410 1697 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 2046 3530 gene locus_tag LOCUS_39420 2046 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 3910 6537 gene locus_tag LOCUS_39430 3910 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 6687 8558 gene locus_tag LOCUS_39440 6687 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 8778 9425 gene locus_tag LOCUS_39450 8778 9425 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140746.1 protein_id gnl|my_center|LOCUS_39450 9786 11690 gene locus_tag LOCUS_39460 9786 11690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 11848 12642 gene locus_tag LOCUS_39470 11848 12642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 12870 14153 gene locus_tag LOCUS_39480 12870 14153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 15999 14737 gene locus_tag LOCUS_39490 gene uraA 15999 14737 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938325.1 protein_id gnl|my_center|LOCUS_39490 16462 16884 gene locus_tag LOCUS_39500 16462 16884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 17265 17456 gene locus_tag LOCUS_39510 17265 17456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 18994 17648 gene locus_tag LOCUS_39520 gene miaB 18994 17648 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB2 protein_id gnl|my_center|LOCUS_39520 19428 19619 gene locus_tag LOCUS_39530 19428 19619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 21134 19710 gene locus_tag LOCUS_39540 21134 19710 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142768.1 protein_id gnl|my_center|LOCUS_39540 21833 21405 gene locus_tag LOCUS_39550 21833 21405 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143550.1 protein_id gnl|my_center|LOCUS_39550 22233 25553 gene locus_tag LOCUS_39560 22233 25553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 26403 25942 gene locus_tag LOCUS_39570 gene dtd 26403 25942 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183H9 protein_id gnl|my_center|LOCUS_39570 26966 28138 gene locus_tag LOCUS_39580 26966 28138 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140489.1 protein_id gnl|my_center|LOCUS_39580 28149 29243 gene locus_tag LOCUS_39590 28149 29243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 29259 30542 gene locus_tag LOCUS_39600 29259 30542 CDS product 2-amino-3-ketobutyrate CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_39600 >Feature sequence089 184 867 gene locus_tag LOCUS_39610 184 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 1097 1990 gene locus_tag LOCUS_39620 1097 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39620 2939 3931 gene locus_tag LOCUS_39630 gene prs 2939 3931 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN6 protein_id gnl|my_center|LOCUS_39630 5523 4105 gene locus_tag LOCUS_39640 5523 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 6290 5685 gene locus_tag LOCUS_39650 6290 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056685.1 protein_id gnl|my_center|LOCUS_39650 6478 6996 gene locus_tag LOCUS_39660 gene apt 6478 6996 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH9 protein_id gnl|my_center|LOCUS_39660 7142 8206 gene locus_tag LOCUS_39670 7142 8206 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 protein_id gnl|my_center|LOCUS_39670 8459 8752 gene locus_tag LOCUS_39680 8459 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 9426 11516 gene locus_tag LOCUS_39690 gene fusA2 9426 11516 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7H2 protein_id gnl|my_center|LOCUS_39690 13315 11582 gene locus_tag LOCUS_39700 gene egl2 13315 11582 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4N3 protein_id gnl|my_center|LOCUS_39700 14128 13346 gene locus_tag LOCUS_39710 gene panB 14128 13346 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMK3 protein_id gnl|my_center|LOCUS_39710 14369 15322 gene locus_tag LOCUS_39720 14369 15322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 15597 16550 gene locus_tag LOCUS_39730 15597 16550 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_39730 16831 16685 gene locus_tag LOCUS_39740 16831 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 16889 17491 gene locus_tag LOCUS_39750 gene wcaF 16889 17491 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 protein_id gnl|my_center|LOCUS_39750 17756 18493 gene locus_tag LOCUS_39760 17756 18493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 19649 18708 gene locus_tag LOCUS_39770 19649 18708 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143363.1 protein_id gnl|my_center|LOCUS_39770 20221 21033 gene locus_tag LOCUS_39780 20221 21033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 21158 21763 gene locus_tag LOCUS_39790 21158 21763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 22168 22542 gene locus_tag LOCUS_39800 22168 22542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 24194 22641 gene locus_tag LOCUS_39810 24194 22641 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_39810 25167 24478 gene locus_tag LOCUS_39820 25167 24478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 26327 26989 gene locus_tag LOCUS_39830 26327 26989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 27173 27589 gene locus_tag LOCUS_39840 27173 27589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 27577 27915 gene locus_tag LOCUS_39850 27577 27915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 28141 28707 gene locus_tag LOCUS_39860 28141 28707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_39860 28815 29219 gene locus_tag LOCUS_39870 28815 29219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 29210 29554 gene locus_tag LOCUS_39880 29210 29554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 29911 30651 gene locus_tag LOCUS_39890 29911 30651 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_39890 >Feature sequence090 337 924 gene locus_tag LOCUS_39900 337 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057324.1 protein_id gnl|my_center|LOCUS_39900 1324 3156 gene locus_tag LOCUS_39910 1324 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 4347 3160 gene locus_tag LOCUS_39920 4347 3160 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_39920 6111 4525 gene locus_tag LOCUS_39930 gene dacB 6111 4525 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_39930 6236 6652 gene locus_tag LOCUS_39940 6236 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 7645 6671 gene locus_tag LOCUS_39950 7645 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 8243 9892 gene locus_tag LOCUS_39960 8243 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 10649 12019 gene locus_tag LOCUS_39970 10649 12019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 12368 12132 gene locus_tag LOCUS_39980 12368 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 12449 14932 gene locus_tag LOCUS_39990 12449 14932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 15386 14994 gene locus_tag LOCUS_40000 15386 14994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 15831 17207 gene locus_tag LOCUS_40010 15831 17207 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089836.1 protein_id gnl|my_center|LOCUS_40010 17626 18666 gene locus_tag LOCUS_40020 17626 18666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 18903 21047 gene locus_tag LOCUS_40030 18903 21047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 21465 23480 gene locus_tag LOCUS_40040 21465 23480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 23979 26579 gene locus_tag LOCUS_40050 23979 26579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 27104 28261 gene locus_tag LOCUS_40060 27104 28261 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837503.1 protein_id gnl|my_center|LOCUS_40060 29327 28551 gene locus_tag LOCUS_40070 29327 28551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 30089 29862 gene locus_tag LOCUS_40080 30089 29862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 >Feature sequence091 1712 420 gene locus_tag LOCUS_40090 1712 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 2636 1722 gene locus_tag LOCUS_40100 2636 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 3365 2679 gene locus_tag LOCUS_40110 3365 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 4265 3501 gene locus_tag LOCUS_40120 4265 3501 CDS product sulfohydrolase/glycosulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890732.1 protein_id gnl|my_center|LOCUS_40120 5163 4249 gene locus_tag LOCUS_40130 5163 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 6475 5699 gene locus_tag LOCUS_40140 6475 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 7756 7046 gene locus_tag LOCUS_40150 7756 7046 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056089.1 protein_id gnl|my_center|LOCUS_40150 9332 8124 gene locus_tag LOCUS_40160 9332 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 10474 9833 gene locus_tag LOCUS_40170 10474 9833 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_40170 10743 12161 gene locus_tag LOCUS_40180 10743 12161 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM0 protein_id gnl|my_center|LOCUS_40180 13349 12375 gene locus_tag LOCUS_40190 13349 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 13567 14022 gene locus_tag LOCUS_40200 13567 14022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 14275 15894 gene locus_tag LOCUS_40210 14275 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 16650 17240 gene locus_tag LOCUS_40220 16650 17240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143972.1 protein_id gnl|my_center|LOCUS_40220 17884 18855 gene locus_tag LOCUS_40230 17884 18855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_40230 18985 19251 gene locus_tag LOCUS_40240 18985 19251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 19711 19346 gene locus_tag LOCUS_40250 19711 19346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 19986 19711 gene locus_tag LOCUS_40260 19986 19711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 24399 20089 gene locus_tag LOCUS_40270 24399 20089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 26045 25158 gene locus_tag LOCUS_40280 gene cysH 26045 25158 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VEB8 protein_id gnl|my_center|LOCUS_40280 26468 26259 gene locus_tag LOCUS_40290 26468 26259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 29536 27254 gene locus_tag LOCUS_40300 29536 27254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056928.1 protein_id gnl|my_center|LOCUS_40300 29863 30522 gene locus_tag LOCUS_40310 29863 30522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 >Feature sequence092 1076 327 gene locus_tag LOCUS_40320 1076 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 2622 3932 gene locus_tag LOCUS_40330 2622 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 4150 4695 gene locus_tag LOCUS_40340 gene pyrR 4150 4695 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ7 protein_id gnl|my_center|LOCUS_40340 4731 5759 gene locus_tag LOCUS_40350 gene fni 4731 5759 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ26 protein_id gnl|my_center|LOCUS_40350 6065 7882 gene locus_tag LOCUS_40360 6065 7882 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_40360 8777 8109 gene locus_tag LOCUS_40370 8777 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 10163 8802 gene locus_tag LOCUS_40380 10163 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 10547 11029 gene locus_tag LOCUS_40390 10547 11029 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057352.1 protein_id gnl|my_center|LOCUS_40390 11573 12283 gene locus_tag LOCUS_40400 gene rpiA 11573 12283 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJF2 protein_id gnl|my_center|LOCUS_40400 13285 13686 gene locus_tag LOCUS_40410 13285 13686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 14492 13890 gene locus_tag LOCUS_40420 14492 13890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_40420 14868 16646 gene locus_tag LOCUS_40430 14868 16646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 17089 16751 gene locus_tag LOCUS_40440 17089 16751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 17288 18499 gene locus_tag LOCUS_40450 17288 18499 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_40450 18918 18505 gene locus_tag LOCUS_40460 18918 18505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 19367 19119 gene locus_tag LOCUS_40470 19367 19119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 19657 19448 gene locus_tag LOCUS_40480 19657 19448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 21787 19736 gene locus_tag LOCUS_40490 21787 19736 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 protein_id gnl|my_center|LOCUS_40490 22107 23360 gene locus_tag LOCUS_40500 22107 23360 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140351.1 protein_id gnl|my_center|LOCUS_40500 23357 23992 gene locus_tag LOCUS_40510 23357 23992 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140352.1 protein_id gnl|my_center|LOCUS_40510 27836 24246 gene locus_tag LOCUS_40520 27836 24246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_40520 30198 29188 gene locus_tag LOCUS_40530 30198 29188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087510.1 protein_id gnl|my_center|LOCUS_40530 >Feature sequence093 309 163 gene locus_tag LOCUS_40540 309 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 897 1694 gene locus_tag LOCUS_40550 897 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056927.1 protein_id gnl|my_center|LOCUS_40550 1962 2150 gene locus_tag LOCUS_40560 1962 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 2347 2598 gene locus_tag LOCUS_40570 2347 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 2611 4767 gene locus_tag LOCUS_40580 2611 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 4928 5518 gene locus_tag LOCUS_40590 4928 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 8249 5622 gene locus_tag LOCUS_40600 gene clpB1 8249 5622 CDS product chaperone protein ClpB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ40 protein_id gnl|my_center|LOCUS_40600 9330 8572 gene locus_tag LOCUS_40610 9330 8572 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND10 protein_id gnl|my_center|LOCUS_40610 9564 9836 gene locus_tag LOCUS_40620 9564 9836 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 protein_id gnl|my_center|LOCUS_40620 9944 11464 gene locus_tag LOCUS_40630 gene murE 9944 11464 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJI4 protein_id gnl|my_center|LOCUS_40630 11569 13005 gene locus_tag LOCUS_40640 11569 13005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 14773 13025 gene locus_tag LOCUS_40650 14773 13025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 15047 16231 gene locus_tag LOCUS_40660 gene ndhH 15047 16231 CDS product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD9 protein_id gnl|my_center|LOCUS_40660 16536 16880 gene locus_tag LOCUS_40670 16536 16880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 17436 18704 gene locus_tag LOCUS_40680 17436 18704 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_40680 18787 18714 gene locus_tag LOCUS_t00470 18787 18714 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18863 19357 gene locus_tag LOCUS_40690 gene moaC 18863 19357 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFZ6 protein_id gnl|my_center|LOCUS_40690 19980 19459 gene locus_tag LOCUS_40700 19980 19459 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MY1 protein_id gnl|my_center|LOCUS_40700 20086 20364 gene locus_tag LOCUS_40710 20086 20364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 protein_id gnl|my_center|LOCUS_40710 20626 20940 gene locus_tag LOCUS_40720 20626 20940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057560.1 protein_id gnl|my_center|LOCUS_40720 22156 21077 gene locus_tag LOCUS_40730 gene fbaA 22156 21077 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056231.1 protein_id gnl|my_center|LOCUS_40730 22853 22782 gene locus_tag LOCUS_t00480 22853 22782 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 23789 22920 gene locus_tag LOCUS_40740 23789 22920 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057510.1 protein_id gnl|my_center|LOCUS_40740 25294 25605 gene locus_tag LOCUS_40750 25294 25605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143670.1 protein_id gnl|my_center|LOCUS_40750 27320 25689 gene locus_tag LOCUS_40760 27320 25689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056997.1 protein_id gnl|my_center|LOCUS_40760 29753 30040 gene locus_tag LOCUS_40770 29753 30040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 >Feature sequence094 417 1718 gene locus_tag LOCUS_40780 417 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 3055 2249 gene locus_tag LOCUS_40790 3055 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40790 3181 3381 gene locus_tag LOCUS_40800 3181 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 8277 3469 gene locus_tag LOCUS_40810 gene glsF 8277 3469 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057208.1 protein_id gnl|my_center|LOCUS_40810 9493 11259 gene locus_tag LOCUS_40820 9493 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057687.1 protein_id gnl|my_center|LOCUS_40820 11576 12004 gene locus_tag LOCUS_40830 11576 12004 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142135.1 protein_id gnl|my_center|LOCUS_40830 12181 12525 gene locus_tag LOCUS_40840 gene ycf57 12181 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142103.1 protein_id gnl|my_center|LOCUS_40840 12614 12985 gene locus_tag LOCUS_40850 gene rpsL 12614 12985 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59168 protein_id gnl|my_center|LOCUS_40850 13310 13780 gene locus_tag LOCUS_40860 gene rpsG 13310 13780 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI44 protein_id gnl|my_center|LOCUS_40860 13922 15997 gene locus_tag LOCUS_40870 gene fusA 13922 15997 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI43 protein_id gnl|my_center|LOCUS_40870 16021 17250 gene locus_tag LOCUS_40880 gene tufA 16021 17250 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50064 protein_id gnl|my_center|LOCUS_40880 17349 17666 gene locus_tag LOCUS_40890 gene rpsJ 17349 17666 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA06 protein_id gnl|my_center|LOCUS_40890 19196 17841 gene locus_tag LOCUS_40900 19196 17841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478813.1 protein_id gnl|my_center|LOCUS_40900 21341 19221 gene locus_tag LOCUS_40910 21341 19221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202084.1 protein_id gnl|my_center|LOCUS_40910 22167 21349 gene locus_tag LOCUS_40920 22167 21349 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YN8 protein_id gnl|my_center|LOCUS_40920 22378 22566 gene locus_tag LOCUS_40930 22378 22566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40930 23690 24082 gene locus_tag LOCUS_40940 23690 24082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973607.1 protein_id gnl|my_center|LOCUS_40940 24754 24431 gene locus_tag LOCUS_40950 24754 24431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 26330 24714 gene locus_tag LOCUS_40960 26330 24714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 27482 28447 gene locus_tag LOCUS_40970 gene gmd 27482 28447 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ72 protein_id gnl|my_center|LOCUS_40970 30074 28590 gene locus_tag LOCUS_40980 30074 28590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 >Feature sequence095 881 606 gene locus_tag LOCUS_40990 881 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 836 1633 gene locus_tag LOCUS_41000 836 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 3555 1834 gene locus_tag LOCUS_41010 3555 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058194.1 protein_id gnl|my_center|LOCUS_41010 4354 5562 gene locus_tag LOCUS_41020 4354 5562 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056200.1 protein_id gnl|my_center|LOCUS_41020 5862 6227 gene locus_tag LOCUS_41030 5862 6227 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_41030 6249 6779 gene locus_tag LOCUS_41040 gene cheW 6249 6779 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056202.1 protein_id gnl|my_center|LOCUS_41040 6865 9924 gene locus_tag LOCUS_41050 6865 9924 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056203.1 protein_id gnl|my_center|LOCUS_41050 9932 10714 gene locus_tag LOCUS_41060 9932 10714 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_41060 10966 13575 gene locus_tag LOCUS_41070 10966 13575 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_41070 14650 13577 gene locus_tag LOCUS_41080 14650 13577 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787406.1 protein_id gnl|my_center|LOCUS_41080 20306 14937 gene locus_tag LOCUS_41090 20306 14937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 21037 22758 gene locus_tag LOCUS_41100 21037 22758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057497.1 protein_id gnl|my_center|LOCUS_41100 22912 23286 gene locus_tag LOCUS_41110 22912 23286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057498.1 protein_id gnl|my_center|LOCUS_41110 23757 23503 gene locus_tag LOCUS_41120 23757 23503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 24602 23754 gene locus_tag LOCUS_41130 24602 23754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 25031 26749 gene locus_tag LOCUS_41140 25031 26749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057114.1 protein_id gnl|my_center|LOCUS_41140 >Feature sequence096 1071 160 gene locus_tag LOCUS_41150 1071 160 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_41150 2152 1427 gene locus_tag LOCUS_41160 2152 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057518.1 protein_id gnl|my_center|LOCUS_41160 3181 3702 gene locus_tag LOCUS_41170 gene ycf52 3181 3702 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 protein_id gnl|my_center|LOCUS_41170 3766 3839 gene locus_tag LOCUS_t00490 3766 3839 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4103 4870 gene locus_tag LOCUS_41180 4103 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143602.1 protein_id gnl|my_center|LOCUS_41180 4867 5814 gene locus_tag LOCUS_41190 gene prmC 4867 5814 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHV7 protein_id gnl|my_center|LOCUS_41190 5917 6519 gene locus_tag LOCUS_41200 5917 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057957.1 protein_id gnl|my_center|LOCUS_41200 6952 7851 gene locus_tag LOCUS_41210 6952 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 8281 7811 gene locus_tag LOCUS_41220 gene ycf52 8281 7811 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140110.1 protein_id gnl|my_center|LOCUS_41220 8720 10696 gene locus_tag LOCUS_41230 8720 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 10904 11365 gene locus_tag LOCUS_41240 10904 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037583.1 protein_id gnl|my_center|LOCUS_41240 11542 11760 gene locus_tag LOCUS_41250 11542 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 12033 15122 gene locus_tag LOCUS_41260 12033 15122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 16681 17712 gene locus_tag LOCUS_41270 16681 17712 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870654.1 protein_id gnl|my_center|LOCUS_41270 18243 18172 gene locus_tag LOCUS_t00500 18243 18172 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 18984 19820 gene locus_tag LOCUS_41280 18984 19820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 21916 20345 gene locus_tag LOCUS_41290 21916 20345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_41290 22196 22717 gene locus_tag LOCUS_41300 22196 22717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 23765 22740 gene locus_tag LOCUS_41310 23765 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 24247 24879 gene locus_tag LOCUS_41320 24247 24879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 25003 27003 gene locus_tag LOCUS_41330 25003 27003 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 protein_id gnl|my_center|LOCUS_41330 27750 27118 gene locus_tag LOCUS_41340 gene trpF 27750 27118 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP3 protein_id gnl|my_center|LOCUS_41340 28171 27818 gene locus_tag LOCUS_41350 28171 27818 CDS product Fe-S cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056500.1 protein_id gnl|my_center|LOCUS_41350 28328 28507 gene locus_tag LOCUS_41360 28328 28507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 28775 29467 gene locus_tag LOCUS_41370 28775 29467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 >Feature sequence097 384 232 gene locus_tag LOCUS_41380 384 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 637 945 gene locus_tag LOCUS_41390 637 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 1360 1034 gene locus_tag LOCUS_41400 1360 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 1599 1348 gene locus_tag LOCUS_41410 1599 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 1791 1639 gene locus_tag LOCUS_41420 1791 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 2471 1848 gene locus_tag LOCUS_41430 2471 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_41430 5378 2949 gene locus_tag LOCUS_41440 5378 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 5566 6567 gene locus_tag LOCUS_41450 gene miaA 5566 6567 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM5 protein_id gnl|my_center|LOCUS_41450 6895 7284 gene locus_tag LOCUS_41460 6895 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 8988 7486 gene locus_tag LOCUS_41470 gene recQ 8988 7486 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056643.1 protein_id gnl|my_center|LOCUS_41470 9164 10126 gene locus_tag LOCUS_41480 9164 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 10357 11151 gene locus_tag LOCUS_41490 10357 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_41490 11354 11938 gene locus_tag LOCUS_41500 11354 11938 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056410.1 protein_id gnl|my_center|LOCUS_41500 13316 12144 gene locus_tag LOCUS_41510 gene moeB 13316 12144 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_41510 13827 13351 gene locus_tag LOCUS_41520 13827 13351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_41520 14090 15277 gene locus_tag LOCUS_41530 14090 15277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 15555 17258 gene locus_tag LOCUS_41540 15555 17258 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_41540 18751 17438 gene locus_tag LOCUS_41550 18751 17438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 19119 19397 gene locus_tag LOCUS_41560 19119 19397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 19414 20271 gene locus_tag LOCUS_41570 19414 20271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 20435 20803 gene locus_tag LOCUS_41580 20435 20803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056657.1 protein_id gnl|my_center|LOCUS_41580 21082 21240 gene locus_tag LOCUS_41590 21082 21240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 22009 21533 gene locus_tag LOCUS_41600 22009 21533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962919.1 protein_id gnl|my_center|LOCUS_41600 22701 22372 gene locus_tag LOCUS_41610 22701 22372 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_41610 25460 22953 gene locus_tag LOCUS_41620 25460 22953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 29005 25856 gene locus_tag LOCUS_41630 29005 25856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 >Feature sequence098 3636 4505 gene locus_tag LOCUS_41640 3636 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_41640 5673 4777 gene locus_tag LOCUS_41650 5673 4777 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115019.1 protein_id gnl|my_center|LOCUS_41650 5851 6516 gene locus_tag LOCUS_41660 5851 6516 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705438.1 protein_id gnl|my_center|LOCUS_41660 6689 7582 gene locus_tag LOCUS_41670 6689 7582 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089805.1 protein_id gnl|my_center|LOCUS_41670 7630 8040 gene locus_tag LOCUS_41680 7630 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 8357 9079 gene locus_tag LOCUS_41690 8357 9079 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119458.1 protein_id gnl|my_center|LOCUS_41690 9157 9720 gene locus_tag LOCUS_41700 9157 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 10778 10122 gene locus_tag LOCUS_41710 gene tsf 10778 10122 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCB5 protein_id gnl|my_center|LOCUS_41710 11767 10937 gene locus_tag LOCUS_41720 gene rpsB 11767 10937 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA2 protein_id gnl|my_center|LOCUS_41720 13219 11993 gene locus_tag LOCUS_41730 13219 11993 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM4 protein_id gnl|my_center|LOCUS_41730 13519 14031 gene locus_tag LOCUS_41740 gene ppa 13519 14031 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR2 protein_id gnl|my_center|LOCUS_41740 14785 15696 gene locus_tag LOCUS_41750 14785 15696 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_41750 16692 16970 gene locus_tag LOCUS_41760 16692 16970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 18191 17148 gene locus_tag LOCUS_41770 18191 17148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938351.1 protein_id gnl|my_center|LOCUS_41770 18773 18288 gene locus_tag LOCUS_41780 18773 18288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 protein_id gnl|my_center|LOCUS_41780 19311 19895 gene locus_tag LOCUS_41790 19311 19895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 19983 21038 gene locus_tag LOCUS_41800 19983 21038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 21561 21028 gene locus_tag LOCUS_41810 21561 21028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 22007 23134 gene locus_tag LOCUS_41820 22007 23134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141501.1 protein_id gnl|my_center|LOCUS_41820 24702 23221 gene locus_tag LOCUS_41830 24702 23221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 26050 24782 gene locus_tag LOCUS_41840 26050 24782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947950.1 protein_id gnl|my_center|LOCUS_41840 26348 27829 gene locus_tag LOCUS_41850 26348 27829 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069707.1 protein_id gnl|my_center|LOCUS_41850 <28829 28009 gene locus_tag LOCUS_41860 <28829 28009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528925.1:gluconolactonase >Feature sequence099 1808 120 gene locus_tag LOCUS_41870 1808 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 2090 2896 gene locus_tag LOCUS_41880 2090 2896 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG38 protein_id gnl|my_center|LOCUS_41880 2897 3646 gene locus_tag LOCUS_41890 2897 3646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143324.1 protein_id gnl|my_center|LOCUS_41890 3789 4760 gene locus_tag LOCUS_41900 3789 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 4888 8229 gene locus_tag LOCUS_41910 4888 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 8427 9923 gene locus_tag LOCUS_41920 8427 9923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 9965 11146 gene locus_tag LOCUS_41930 9965 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 12413 11487 gene locus_tag LOCUS_41940 12413 11487 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_41940 13109 14719 gene locus_tag LOCUS_41950 13109 14719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 16092 14974 gene locus_tag LOCUS_41960 gene wbyK 16092 14974 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208591.1 protein_id gnl|my_center|LOCUS_41960 16819 16271 gene locus_tag LOCUS_41970 16819 16271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 18007 16958 gene locus_tag LOCUS_41980 18007 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 18723 18028 gene locus_tag LOCUS_41990 18723 18028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 19039 19233 gene locus_tag LOCUS_42000 19039 19233 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056374.1 protein_id gnl|my_center|LOCUS_42000 19276 20376 gene locus_tag LOCUS_42010 19276 20376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 protein_id gnl|my_center|LOCUS_42010 20386 21357 gene locus_tag LOCUS_42020 gene chlG 20386 21357 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057379.1 protein_id gnl|my_center|LOCUS_42020 22396 21644 gene locus_tag LOCUS_42030 22396 21644 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118886.1 protein_id gnl|my_center|LOCUS_42030 23596 22697 gene locus_tag LOCUS_42040 23596 22697 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660669.1 protein_id gnl|my_center|LOCUS_42040 24901 23693 gene locus_tag LOCUS_42050 24901 23693 CDS product LPS biosynthesis protein RfbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876009.1 protein_id gnl|my_center|LOCUS_42050 25888 24974 gene locus_tag LOCUS_42060 25888 24974 CDS product alkylphosphonate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477713.1 protein_id gnl|my_center|LOCUS_42060 28388 26214 gene locus_tag LOCUS_42070 28388 26214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 >Feature sequence100 2526 508 gene locus_tag LOCUS_42080 2526 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 3315 2830 gene locus_tag LOCUS_42090 3315 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 3405 4580 gene locus_tag LOCUS_42100 3405 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 4573 5676 gene locus_tag LOCUS_42110 4573 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 6116 8380 gene locus_tag LOCUS_42120 6116 8380 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056828.1 protein_id gnl|my_center|LOCUS_42120 8563 9450 gene locus_tag LOCUS_42130 8563 9450 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228102.1 protein_id gnl|my_center|LOCUS_42130 9727 9942 gene locus_tag LOCUS_42140 9727 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 10333 11247 gene locus_tag LOCUS_42150 10333 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 11760 11320 gene locus_tag LOCUS_42160 11760 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 12995 11859 gene locus_tag LOCUS_42170 12995 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 13359 13607 gene locus_tag LOCUS_42180 13359 13607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 13604 15670 gene locus_tag LOCUS_42190 13604 15670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_42190 15772 16398 gene locus_tag LOCUS_42200 15772 16398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 16793 18193 gene locus_tag LOCUS_42210 16793 18193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143146.1 protein_id gnl|my_center|LOCUS_42210 18440 19246 gene locus_tag LOCUS_42220 18440 19246 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND55 protein_id gnl|my_center|LOCUS_42220 19734 20168 gene locus_tag LOCUS_42230 19734 20168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 20548 22671 gene locus_tag LOCUS_42240 20548 22671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 23457 27962 gene locus_tag LOCUS_42250 23457 27962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 28291 28085 gene locus_tag LOCUS_42260 28291 28085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 >Feature sequence101 <1 2259 gene locus_tag LOCUS_42270 <1 2259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525338.1:outer membrane autotransporter barrel domain protein 2264 4840 gene locus_tag LOCUS_42280 2264 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 5242 6195 gene locus_tag LOCUS_42290 5242 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 6173 8188 gene locus_tag LOCUS_42300 6173 8188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 8768 8571 gene locus_tag LOCUS_42310 8768 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 8828 10219 gene locus_tag LOCUS_42320 8828 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 11580 10249 gene locus_tag LOCUS_42330 11580 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 11928 11593 gene locus_tag LOCUS_42340 11928 11593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 13589 12477 gene locus_tag LOCUS_42350 13589 12477 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 protein_id gnl|my_center|LOCUS_42350 13880 14668 gene locus_tag LOCUS_42360 gene map 13880 14668 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX4 protein_id gnl|my_center|LOCUS_42360 15085 17280 gene locus_tag LOCUS_42370 15085 17280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 17583 19628 gene locus_tag LOCUS_42380 17583 19628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 20022 19861 gene locus_tag LOCUS_42390 20022 19861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 20988 20722 gene locus_tag LOCUS_42400 20988 20722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 21490 22602 gene locus_tag LOCUS_42410 21490 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 23481 22858 gene locus_tag LOCUS_42420 23481 22858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_42420 23810 23616 gene locus_tag LOCUS_42430 23810 23616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 23932 24318 gene locus_tag LOCUS_42440 23932 24318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056846.1 protein_id gnl|my_center|LOCUS_42440 24707 25951 gene locus_tag LOCUS_42450 24707 25951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058187.1 protein_id gnl|my_center|LOCUS_42450 26680 26000 gene locus_tag LOCUS_42460 gene nanE 26680 26000 CDS product putative N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGQ5 protein_id gnl|my_center|LOCUS_42460 >Feature sequence102 1179 121 gene locus_tag LOCUS_42470 1179 121 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_42470 2526 2963 gene locus_tag LOCUS_42480 2526 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 4803 3418 gene locus_tag LOCUS_42490 4803 3418 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_42490 7590 5530 gene locus_tag LOCUS_42500 7590 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 9814 8330 gene locus_tag LOCUS_42510 9814 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 11374 9953 gene locus_tag LOCUS_42520 11374 9953 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210399.1 protein_id gnl|my_center|LOCUS_42520 13264 11378 gene locus_tag LOCUS_42530 13264 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 14006 13365 gene locus_tag LOCUS_42540 14006 13365 CDS product tellurium resistance protein TerY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001388628.1 protein_id gnl|my_center|LOCUS_42540 15363 14113 gene locus_tag LOCUS_42550 15363 14113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 16083 15583 gene locus_tag LOCUS_42560 16083 15583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 17179 16115 gene locus_tag LOCUS_42570 17179 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 18296 17370 gene locus_tag LOCUS_42580 18296 17370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 19057 18878 gene locus_tag LOCUS_42590 19057 18878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 21257 19332 gene locus_tag LOCUS_42600 21257 19332 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057278.1 protein_id gnl|my_center|LOCUS_42600 22289 23632 gene locus_tag LOCUS_42610 22289 23632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 24520 24107 gene locus_tag LOCUS_42620 24520 24107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_42620 25167 25610 gene locus_tag LOCUS_42630 25167 25610 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 protein_id gnl|my_center|LOCUS_42630 25627 26016 gene locus_tag LOCUS_42640 25627 26016 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143594.1 protein_id gnl|my_center|LOCUS_42640 26016 27053 gene locus_tag LOCUS_42650 gene cobD 26016 27053 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE1 protein_id gnl|my_center|LOCUS_42650 >Feature sequence103 1316 228 gene locus_tag LOCUS_42660 1316 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 1442 2161 gene locus_tag LOCUS_42670 1442 2161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_42670 2290 2772 gene locus_tag LOCUS_42680 2290 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142941.1 protein_id gnl|my_center|LOCUS_42680 3081 3977 gene locus_tag LOCUS_42690 3081 3977 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143303.1 protein_id gnl|my_center|LOCUS_42690 4185 5585 gene locus_tag LOCUS_42700 4185 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979630.1 protein_id gnl|my_center|LOCUS_42700 5592 6041 gene locus_tag LOCUS_42710 5592 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 6281 7159 gene locus_tag LOCUS_42720 6281 7159 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258385.1 protein_id gnl|my_center|LOCUS_42720 8451 7318 gene locus_tag LOCUS_42730 8451 7318 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140372.1 protein_id gnl|my_center|LOCUS_42730 9427 8945 gene locus_tag LOCUS_42740 9427 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 9999 10835 gene locus_tag LOCUS_42750 gene fabG2 9999 10835 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66782 protein_id gnl|my_center|LOCUS_42750 11168 12148 gene locus_tag LOCUS_42760 11168 12148 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868293.1 protein_id gnl|my_center|LOCUS_42760 12660 13325 gene locus_tag LOCUS_42770 12660 13325 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_42770 13959 13624 gene locus_tag LOCUS_42780 13959 13624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 14363 13947 gene locus_tag LOCUS_42790 14363 13947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 14616 15326 gene locus_tag LOCUS_42800 14616 15326 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_42800 16342 15482 gene locus_tag LOCUS_42810 gene pheA 16342 15482 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH54 protein_id gnl|my_center|LOCUS_42810 16892 18811 gene locus_tag LOCUS_42820 gene cobJ 16892 18811 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057147.1 protein_id gnl|my_center|LOCUS_42820 19660 19244 gene locus_tag LOCUS_42830 19660 19244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 protein_id gnl|my_center|LOCUS_42830 20072 20917 gene locus_tag LOCUS_42840 20072 20917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142803.1 protein_id gnl|my_center|LOCUS_42840 21227 21048 gene locus_tag LOCUS_42850 21227 21048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 21607 21377 gene locus_tag LOCUS_42860 21607 21377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_42860 22362 21745 gene locus_tag LOCUS_42870 22362 21745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 23064 23531 gene locus_tag LOCUS_42880 23064 23531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 23890 25026 gene locus_tag LOCUS_42890 23890 25026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057888.1 protein_id gnl|my_center|LOCUS_42890 25421 25215 gene locus_tag LOCUS_42900 25421 25215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 25360 25977 gene locus_tag LOCUS_42910 25360 25977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 26007 26837 gene locus_tag LOCUS_42920 26007 26837 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141338.1 protein_id gnl|my_center|LOCUS_42920 >Feature sequence104 2 790 gene locus_tag LOCUS_42930 2 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 1072 2397 gene locus_tag LOCUS_42940 1072 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 2394 5063 gene locus_tag LOCUS_42950 2394 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 5144 5464 gene locus_tag LOCUS_42960 5144 5464 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_42960 9076 5813 gene locus_tag LOCUS_42970 9076 5813 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 protein_id gnl|my_center|LOCUS_42970 9888 12038 gene locus_tag LOCUS_42980 gene pnp 9888 12038 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW9 protein_id gnl|my_center|LOCUS_42980 12293 13018 gene locus_tag LOCUS_42990 gene tpiA 12293 13018 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA0 protein_id gnl|my_center|LOCUS_42990 13154 13999 gene locus_tag LOCUS_43000 gene folP 13154 13999 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ9 protein_id gnl|my_center|LOCUS_43000 14885 14088 gene locus_tag LOCUS_43010 14885 14088 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142171.1 protein_id gnl|my_center|LOCUS_43010 15929 15324 gene locus_tag LOCUS_43020 15929 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056730.1 protein_id gnl|my_center|LOCUS_43020 16182 17861 gene locus_tag LOCUS_43030 16182 17861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 17986 19278 gene locus_tag LOCUS_43040 17986 19278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 20545 19322 gene locus_tag LOCUS_43050 20545 19322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057855.1 protein_id gnl|my_center|LOCUS_43050 20622 21443 gene locus_tag LOCUS_43060 gene desC1 20622 21443 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058212.1 protein_id gnl|my_center|LOCUS_43060 21776 22513 gene locus_tag LOCUS_43070 21776 22513 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144148.1 protein_id gnl|my_center|LOCUS_43070 23884 22649 gene locus_tag LOCUS_43080 gene chlP 23884 22649 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056005.1 protein_id gnl|my_center|LOCUS_43080 26049 24253 gene locus_tag LOCUS_43090 26049 24253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 >Feature sequence105 479 249 gene locus_tag LOCUS_43100 479 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 741 535 gene locus_tag LOCUS_43110 741 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 2476 1235 gene locus_tag LOCUS_43120 2476 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 protein_id gnl|my_center|LOCUS_43120 2559 3290 gene locus_tag LOCUS_43130 gene clpP 2559 3290 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI33 protein_id gnl|my_center|LOCUS_43130 3933 4529 gene locus_tag LOCUS_43140 gene clpP2 3933 4529 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJZ9 protein_id gnl|my_center|LOCUS_43140 4761 5384 gene locus_tag LOCUS_43150 4761 5384 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057273.1 protein_id gnl|my_center|LOCUS_43150 6578 5472 gene locus_tag LOCUS_43160 6578 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 7777 6596 gene locus_tag LOCUS_43170 7777 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 8296 7949 gene locus_tag LOCUS_43180 8296 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 9498 9151 gene locus_tag LOCUS_43190 9498 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 11835 10189 gene locus_tag LOCUS_43200 gene ilvB 11835 10189 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057661.1 protein_id gnl|my_center|LOCUS_43200 13789 12422 gene locus_tag LOCUS_43210 13789 12422 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_43210 14260 15867 gene locus_tag LOCUS_43220 14260 15867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 16241 17512 gene locus_tag LOCUS_43230 16241 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 18577 17675 gene locus_tag LOCUS_43240 18577 17675 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140660.1 protein_id gnl|my_center|LOCUS_43240 18761 19501 gene locus_tag LOCUS_43250 18761 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 20105 20350 gene locus_tag LOCUS_43260 20105 20350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 20630 21544 gene locus_tag LOCUS_43270 20630 21544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 22535 21711 gene locus_tag LOCUS_43280 22535 21711 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058216.1 protein_id gnl|my_center|LOCUS_43280 22833 23264 gene locus_tag LOCUS_43290 22833 23264 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_43290 <26743 23488 gene locus_tag LOCUS_43300 <26743 23488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257272.1:Na-Ca exchanger/integrin-beta4 >Feature sequence106 342 1031 gene locus_tag LOCUS_43310 342 1031 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142127.1 protein_id gnl|my_center|LOCUS_43310 1093 1518 gene locus_tag LOCUS_43320 1093 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 1750 2667 gene locus_tag LOCUS_43330 1750 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 2983 3789 gene locus_tag LOCUS_43340 2983 3789 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNW9 protein_id gnl|my_center|LOCUS_43340 4877 3876 gene locus_tag LOCUS_43350 gene fabH 4877 3876 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL4 protein_id gnl|my_center|LOCUS_43350 6398 5349 gene locus_tag LOCUS_43360 gene plsX 6398 5349 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL5 protein_id gnl|my_center|LOCUS_43360 6591 7922 gene locus_tag LOCUS_43370 6591 7922 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 protein_id gnl|my_center|LOCUS_43370 9230 8136 gene locus_tag LOCUS_43380 9230 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 11073 10471 gene locus_tag LOCUS_43390 11073 10471 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 protein_id gnl|my_center|LOCUS_43390 12770 11178 gene locus_tag LOCUS_43400 gene metG 12770 11178 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59081 protein_id gnl|my_center|LOCUS_43400 15149 16051 gene locus_tag LOCUS_43410 gene crtR 15149 16051 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_43410 16724 16278 gene locus_tag LOCUS_43420 gene aroH 16724 16278 CDS product chorismate mutase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHZ0 protein_id gnl|my_center|LOCUS_43420 17563 16739 gene locus_tag LOCUS_43430 17563 16739 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 protein_id gnl|my_center|LOCUS_43430 18006 18902 gene locus_tag LOCUS_43440 18006 18902 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 protein_id gnl|my_center|LOCUS_43440 19347 20408 gene locus_tag LOCUS_43450 19347 20408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 20772 21863 gene locus_tag LOCUS_43460 20772 21863 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056239.1 protein_id gnl|my_center|LOCUS_43460 21988 22188 gene locus_tag LOCUS_43470 21988 22188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 23727 22339 gene locus_tag LOCUS_43480 gene asnS 23727 22339 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG51 protein_id gnl|my_center|LOCUS_43480 24153 24611 gene locus_tag LOCUS_43490 24153 24611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 25729 24623 gene locus_tag LOCUS_43500 25729 24623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056632.1 protein_id gnl|my_center|LOCUS_43500 >Feature sequence107 1298 243 gene locus_tag LOCUS_43510 1298 243 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056246.1 protein_id gnl|my_center|LOCUS_43510 2389 1655 gene locus_tag LOCUS_43520 2389 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144039.1 protein_id gnl|my_center|LOCUS_43520 2450 5065 gene locus_tag LOCUS_43530 2450 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_43530 6233 9361 gene locus_tag LOCUS_43540 6233 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_43540 9966 9643 gene locus_tag LOCUS_43550 9966 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 10104 10934 gene locus_tag LOCUS_43560 10104 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058095.1 protein_id gnl|my_center|LOCUS_43560 11054 12811 gene locus_tag LOCUS_43570 11054 12811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 15898 13082 gene locus_tag LOCUS_43580 gene secA 15898 13082 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHU4 protein_id gnl|my_center|LOCUS_43580 16914 18044 gene locus_tag LOCUS_43590 16914 18044 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058231.1 protein_id gnl|my_center|LOCUS_43590 19098 18022 gene locus_tag LOCUS_43600 19098 18022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 19705 19917 gene locus_tag LOCUS_43610 19705 19917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 20071 21306 gene locus_tag LOCUS_43620 gene sapD 20071 21306 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039351.1 protein_id gnl|my_center|LOCUS_43620 21842 23467 gene locus_tag LOCUS_43630 21842 23467 CDS product D-glutamate deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384301.1 protein_id gnl|my_center|LOCUS_43630 24951 23638 gene locus_tag LOCUS_43640 24951 23638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 >Feature sequence108 627 1193 gene locus_tag LOCUS_43650 gene ycf4 627 1193 CDS product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ41 protein_id gnl|my_center|LOCUS_43650 1319 2077 gene locus_tag LOCUS_43660 1319 2077 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMH9 protein_id gnl|my_center|LOCUS_43660 2096 3292 gene locus_tag LOCUS_43670 2096 3292 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 protein_id gnl|my_center|LOCUS_43670 3422 4912 gene locus_tag LOCUS_43680 gene purF 3422 4912 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA6 protein_id gnl|my_center|LOCUS_43680 5195 5407 gene locus_tag LOCUS_43690 5195 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 protein_id gnl|my_center|LOCUS_43690 5732 6079 gene locus_tag LOCUS_43700 5732 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057900.1 protein_id gnl|my_center|LOCUS_43700 6305 6123 gene locus_tag LOCUS_43710 6305 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 7924 6356 gene locus_tag LOCUS_43720 gene cry 7924 6356 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_43720 8507 8277 gene locus_tag LOCUS_43730 8507 8277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 9525 10220 gene locus_tag LOCUS_43740 9525 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 10356 11213 gene locus_tag LOCUS_43750 10356 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 12658 13488 gene locus_tag LOCUS_43760 12658 13488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 14809 13766 gene locus_tag LOCUS_43770 gene ydcM 14809 13766 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_43770 15881 15075 gene locus_tag LOCUS_43780 15881 15075 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HLA3 protein_id gnl|my_center|LOCUS_43780 18321 16024 gene locus_tag LOCUS_43790 18321 16024 CDS product UDP-glucose-beta-D-glucan glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057632.1 protein_id gnl|my_center|LOCUS_43790 19206 19394 gene locus_tag LOCUS_43800 19206 19394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 20741 19575 gene locus_tag LOCUS_43810 20741 19575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 21292 20777 gene locus_tag LOCUS_43820 21292 20777 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ9 protein_id gnl|my_center|LOCUS_43820 21918 21391 gene locus_tag LOCUS_43830 gene ybeY 21918 21391 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIK0 protein_id gnl|my_center|LOCUS_43830 22317 22102 gene locus_tag LOCUS_43840 22317 22102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 23419 22556 gene locus_tag LOCUS_43850 gene prfB 23419 22556 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG6 protein_id gnl|my_center|LOCUS_43850 25324 24233 gene locus_tag LOCUS_43860 25324 24233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 >Feature sequence109 785 216 gene locus_tag LOCUS_43870 785 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 811 1182 gene locus_tag LOCUS_43880 811 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 1233 2495 gene locus_tag LOCUS_43890 1233 2495 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_43890 3294 2755 gene locus_tag LOCUS_43900 gene psbV2 3294 2755 CDS product cytochrome c-550-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE2 protein_id gnl|my_center|LOCUS_43900 4063 3575 gene locus_tag LOCUS_43910 gene psbV 4063 3575 CDS product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A386 protein_id gnl|my_center|LOCUS_43910 4397 4209 gene locus_tag LOCUS_43920 4397 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057126.1 protein_id gnl|my_center|LOCUS_43920 5524 4592 gene locus_tag LOCUS_43930 gene accD 5524 4592 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE7 protein_id gnl|my_center|LOCUS_43930 5752 5564 gene locus_tag LOCUS_43940 5752 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 6695 6051 gene locus_tag LOCUS_43950 6695 6051 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL0 protein_id gnl|my_center|LOCUS_43950 7235 6972 gene locus_tag LOCUS_43960 7235 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 8498 7410 gene locus_tag LOCUS_43970 gene leuB 8498 7410 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59029 protein_id gnl|my_center|LOCUS_43970 8996 9946 gene locus_tag LOCUS_43980 8996 9946 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_43980 9999 11717 gene locus_tag LOCUS_43990 9999 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 12047 12838 gene locus_tag LOCUS_44000 12047 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44000 12989 13330 gene locus_tag LOCUS_44010 12989 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44010 13339 13674 gene locus_tag LOCUS_44020 13339 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 14388 16172 gene locus_tag LOCUS_44030 gene ilvG 14388 16172 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD1 protein_id gnl|my_center|LOCUS_44030 16838 17290 gene locus_tag LOCUS_44040 16838 17290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 18168 17542 gene locus_tag LOCUS_44050 18168 17542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 18707 18345 gene locus_tag LOCUS_44060 18707 18345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 20307 18811 gene locus_tag LOCUS_44070 20307 18811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 20513 21457 gene locus_tag LOCUS_44080 gene aroE 20513 21457 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA6 protein_id gnl|my_center|LOCUS_44080 22367 21753 gene locus_tag LOCUS_44090 22367 21753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 23518 22397 gene locus_tag LOCUS_44100 gene hypD 23518 22397 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 protein_id gnl|my_center|LOCUS_44100 24212 23556 gene locus_tag LOCUS_44110 gene gmhA 24212 23556 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225648.1 protein_id gnl|my_center|LOCUS_44110 >Feature sequence110 1795 3042 gene locus_tag LOCUS_44120 1795 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 5672 3078 gene locus_tag LOCUS_44130 5672 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 8350 5840 gene locus_tag LOCUS_44140 8350 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 9168 8728 gene locus_tag LOCUS_44150 9168 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 11848 9449 gene locus_tag LOCUS_44160 11848 9449 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057757.1 protein_id gnl|my_center|LOCUS_44160 12246 13352 gene locus_tag LOCUS_44170 12246 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 13580 14893 gene locus_tag LOCUS_44180 13580 14893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 16586 14976 gene locus_tag LOCUS_44190 16586 14976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 16817 18166 gene locus_tag LOCUS_44200 16817 18166 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057372.1 protein_id gnl|my_center|LOCUS_44200 18374 18670 gene locus_tag LOCUS_44210 18374 18670 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_44210 18837 19145 gene locus_tag LOCUS_44220 18837 19145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 19593 19183 gene locus_tag LOCUS_44230 19593 19183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 20198 21373 gene locus_tag LOCUS_44240 gene aspC 20198 21373 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG0 protein_id gnl|my_center|LOCUS_44240 21934 21482 gene locus_tag LOCUS_44250 21934 21482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 21927 22151 gene locus_tag LOCUS_44260 21927 22151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 22252 24249 gene locus_tag LOCUS_44270 22252 24249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 >Feature sequence111 170 511 gene locus_tag LOCUS_44280 170 511 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_44280 670 1254 gene locus_tag LOCUS_44290 670 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44290 1444 1815 gene locus_tag LOCUS_44300 1444 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44300 2332 2108 gene locus_tag LOCUS_44310 2332 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 3255 2677 gene locus_tag LOCUS_44320 3255 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141116.1 protein_id gnl|my_center|LOCUS_44320 5242 3593 gene locus_tag LOCUS_44330 5242 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 6708 5251 gene locus_tag LOCUS_44340 6708 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 7665 7087 gene locus_tag LOCUS_44350 7665 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 10696 7772 gene locus_tag LOCUS_44360 10696 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 11228 12253 gene locus_tag LOCUS_44370 11228 12253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 12688 13035 gene locus_tag LOCUS_44380 12688 13035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 14301 13234 gene locus_tag LOCUS_44390 14301 13234 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947883.1 protein_id gnl|my_center|LOCUS_44390 14693 15178 gene locus_tag LOCUS_44400 14693 15178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 15671 15453 gene locus_tag LOCUS_44410 15671 15453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 15959 16723 gene locus_tag LOCUS_44420 15959 16723 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728711.1 protein_id gnl|my_center|LOCUS_44420 17367 16747 gene locus_tag LOCUS_44430 17367 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 18874 17789 gene locus_tag LOCUS_44440 18874 17789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 19022 18858 gene locus_tag LOCUS_44450 19022 18858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 19619 20191 gene locus_tag LOCUS_44460 19619 20191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 20532 20834 gene locus_tag LOCUS_44470 20532 20834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 21912 20731 gene locus_tag LOCUS_44480 21912 20731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 22645 23148 gene locus_tag LOCUS_44490 22645 23148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 23288 23593 gene locus_tag LOCUS_44500 23288 23593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 24122 24805 gene locus_tag LOCUS_44510 24122 24805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 >Feature sequence112 662 1147 gene locus_tag LOCUS_44520 gene apcA 662 1147 CDS product allophycocyanin alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50030 protein_id gnl|my_center|LOCUS_44520 1243 1728 gene locus_tag LOCUS_44530 gene apcB 1243 1728 CDS product allophycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50031 protein_id gnl|my_center|LOCUS_44530 2015 2215 gene locus_tag LOCUS_44540 gene apcC 2015 2215 CDS product phycobilisome 7.8 kDa linker polypeptide, allophycocyanin-associated, core inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50036 protein_id gnl|my_center|LOCUS_44540 2739 3947 gene locus_tag LOCUS_44550 gene ftsW 2739 3947 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056295.1 protein_id gnl|my_center|LOCUS_44550 4464 4027 gene locus_tag LOCUS_44560 4464 4027 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057581.1 protein_id gnl|my_center|LOCUS_44560 5076 4570 gene locus_tag LOCUS_44570 5076 4570 CDS product TIGR02652 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058200.1 protein_id gnl|my_center|LOCUS_44570 5232 5783 gene locus_tag LOCUS_44580 5232 5783 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056687.1 protein_id gnl|my_center|LOCUS_44580 7353 6448 gene locus_tag LOCUS_44590 7353 6448 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057872.1 protein_id gnl|my_center|LOCUS_44590 8247 7480 gene locus_tag LOCUS_44600 8247 7480 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056990.1 protein_id gnl|my_center|LOCUS_44600 9171 9653 gene locus_tag LOCUS_44610 9171 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 9896 9702 gene locus_tag LOCUS_44620 9896 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 11156 12553 gene locus_tag LOCUS_44630 11156 12553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 13092 13937 gene locus_tag LOCUS_44640 13092 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140036.1 protein_id gnl|my_center|LOCUS_44640 13937 14845 gene locus_tag LOCUS_44650 13937 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 15123 16556 gene locus_tag LOCUS_44660 15123 16556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 16596 16892 gene locus_tag LOCUS_44670 16596 16892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 17534 23260 gene locus_tag LOCUS_44680 17534 23260 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_44680 23945 23502 gene locus_tag LOCUS_44690 23945 23502 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_44690 24304 23942 gene locus_tag LOCUS_44700 24304 23942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 24666 24349 gene locus_tag LOCUS_44710 24666 24349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 >Feature sequence113 724 389 gene locus_tag LOCUS_44720 724 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 1279 1064 gene locus_tag LOCUS_44730 1279 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 1770 2012 gene locus_tag LOCUS_44740 1770 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 2793 2332 gene locus_tag LOCUS_44750 2793 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 4025 4225 gene locus_tag LOCUS_44760 4025 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 4767 5345 gene locus_tag LOCUS_44770 4767 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 5345 5731 gene locus_tag LOCUS_44780 5345 5731 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_44780 5915 6598 gene locus_tag LOCUS_44790 5915 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142612.1 protein_id gnl|my_center|LOCUS_44790 7881 6658 gene locus_tag LOCUS_44800 7881 6658 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140568.1 protein_id gnl|my_center|LOCUS_44800 8035 8580 gene locus_tag LOCUS_44810 8035 8580 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_44810 10380 8638 gene locus_tag LOCUS_44820 10380 8638 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_44820 11233 13008 gene locus_tag LOCUS_44830 11233 13008 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057611.1 protein_id gnl|my_center|LOCUS_44830 13492 13085 gene locus_tag LOCUS_44840 13492 13085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 13833 14036 gene locus_tag LOCUS_44850 13833 14036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 14358 14594 gene locus_tag LOCUS_44860 14358 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140743.1 protein_id gnl|my_center|LOCUS_44860 16821 14716 gene locus_tag LOCUS_44870 16821 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056358.1 protein_id gnl|my_center|LOCUS_44870 17040 17885 gene locus_tag LOCUS_44880 17040 17885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 18117 19031 gene locus_tag LOCUS_44890 18117 19031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 20006 19155 gene locus_tag LOCUS_44900 20006 19155 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_44900 21108 20014 gene locus_tag LOCUS_44910 gene aroC 21108 20014 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_44910 >Feature sequence114 252 974 gene locus_tag LOCUS_44920 252 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 1464 1045 gene locus_tag LOCUS_44930 1464 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 1624 2925 gene locus_tag LOCUS_44940 1624 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 3264 2908 gene locus_tag LOCUS_44950 3264 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 4712 5944 gene locus_tag LOCUS_44960 4712 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 6253 6507 gene locus_tag LOCUS_44970 6253 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44970 6601 6960 gene locus_tag LOCUS_44980 6601 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 7746 7351 gene locus_tag LOCUS_44990 7746 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 8472 8996 gene locus_tag LOCUS_45000 8472 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 9995 9192 gene locus_tag LOCUS_45010 9995 9192 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 protein_id gnl|my_center|LOCUS_45010 10503 10267 gene locus_tag LOCUS_45020 10503 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 10798 10989 gene locus_tag LOCUS_45030 10798 10989 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549779.1 protein_id gnl|my_center|LOCUS_45030 12034 11072 gene locus_tag LOCUS_45040 12034 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 13575 12439 gene locus_tag LOCUS_45050 13575 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 14794 14003 gene locus_tag LOCUS_45060 14794 14003 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMU1 protein_id gnl|my_center|LOCUS_45060 16080 15136 gene locus_tag LOCUS_45070 16080 15136 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140677.1 protein_id gnl|my_center|LOCUS_45070 16831 17382 gene locus_tag LOCUS_45080 16831 17382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 17396 17683 gene locus_tag LOCUS_45090 17396 17683 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_45090 17792 18115 gene locus_tag LOCUS_45100 gene ycf64 17792 18115 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI5 protein_id gnl|my_center|LOCUS_45100 19384 18512 gene locus_tag LOCUS_45110 19384 18512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_45110 20431 19592 gene locus_tag LOCUS_45120 20431 19592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_45120 20672 21982 gene locus_tag LOCUS_45130 20672 21982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 22017 23051 gene locus_tag LOCUS_45140 22017 23051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 >Feature sequence115 108 359 gene locus_tag LOCUS_45150 108 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 2466 553 gene locus_tag LOCUS_45160 gene shc 2466 553 CDS product squalene-hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058142.1 protein_id gnl|my_center|LOCUS_45160 2570 3910 gene locus_tag LOCUS_45170 2570 3910 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144044.1 protein_id gnl|my_center|LOCUS_45170 4154 3957 gene locus_tag LOCUS_45180 4154 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 4395 5168 gene locus_tag LOCUS_45190 4395 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 6094 5213 gene locus_tag LOCUS_45200 6094 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 6690 6265 gene locus_tag LOCUS_45210 6690 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 7119 8903 gene locus_tag LOCUS_45220 7119 8903 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 protein_id gnl|my_center|LOCUS_45220 9873 9217 gene locus_tag LOCUS_45230 9873 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 10893 9964 gene locus_tag LOCUS_45240 10893 9964 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_45240 11351 11022 gene locus_tag LOCUS_45250 11351 11022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 11799 12755 gene locus_tag LOCUS_45260 gene rnz 11799 12755 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKE4 protein_id gnl|my_center|LOCUS_45260 15163 12899 gene locus_tag LOCUS_45270 15163 12899 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056432.1 protein_id gnl|my_center|LOCUS_45270 15479 15853 gene locus_tag LOCUS_45280 15479 15853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 16232 17086 gene locus_tag LOCUS_45290 16232 17086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 18130 17405 gene locus_tag LOCUS_45300 18130 17405 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_45300 19115 18447 gene locus_tag LOCUS_45310 gene nox 19115 18447 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q60049 protein_id gnl|my_center|LOCUS_45310 19527 20423 gene locus_tag LOCUS_45320 19527 20423 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_45320 21153 20455 gene locus_tag LOCUS_45330 21153 20455 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 protein_id gnl|my_center|LOCUS_45330 23353 21245 gene locus_tag LOCUS_45340 23353 21245 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143951.1 protein_id gnl|my_center|LOCUS_45340 24049 23438 gene locus_tag LOCUS_45350 24049 23438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_45350 >Feature sequence116 477 1952 gene locus_tag LOCUS_45360 477 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056673.1 protein_id gnl|my_center|LOCUS_45360 1988 2998 gene locus_tag LOCUS_45370 1988 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 4027 3119 gene locus_tag LOCUS_45380 4027 3119 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_45380 5924 4407 gene locus_tag LOCUS_45390 5924 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 7184 6165 gene locus_tag LOCUS_45400 gene cheB3 7184 6165 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 3 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXT8 protein_id gnl|my_center|LOCUS_45400 9757 7238 gene locus_tag LOCUS_45410 9757 7238 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525365.1 protein_id gnl|my_center|LOCUS_45410 10493 9882 gene locus_tag LOCUS_45420 10493 9882 CDS product chew domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525366.1 protein_id gnl|my_center|LOCUS_45420 12988 11411 gene locus_tag LOCUS_45430 12988 11411 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525369.1 protein_id gnl|my_center|LOCUS_45430 14259 12985 gene locus_tag LOCUS_45440 14259 12985 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546679.1 protein_id gnl|my_center|LOCUS_45440 16083 14410 gene locus_tag LOCUS_45450 16083 14410 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552066.1 protein_id gnl|my_center|LOCUS_45450 17454 16111 gene locus_tag LOCUS_45460 gene wspC 17454 16111 CDS product putative biofilm formation methyltransferase WspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXT5 protein_id gnl|my_center|LOCUS_45460 17950 17474 gene locus_tag LOCUS_45470 17950 17474 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266947.1 protein_id gnl|my_center|LOCUS_45470 18771 20276 gene locus_tag LOCUS_45480 18771 20276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056673.1 protein_id gnl|my_center|LOCUS_45480 22609 20471 gene locus_tag LOCUS_45490 22609 20471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 >Feature sequence117 2508 526 gene locus_tag LOCUS_45500 2508 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 2713 2525 gene locus_tag LOCUS_45510 2713 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 5724 3448 gene locus_tag LOCUS_45520 5724 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_45520 8270 5844 gene locus_tag LOCUS_45530 8270 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 10446 8425 gene locus_tag LOCUS_45540 10446 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_45540 12093 10768 gene locus_tag LOCUS_45550 12093 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 13049 12090 gene locus_tag LOCUS_45560 13049 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 14152 13256 gene locus_tag LOCUS_45570 14152 13256 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023900.1 protein_id gnl|my_center|LOCUS_45570 16348 16064 gene locus_tag LOCUS_45580 16348 16064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 17730 16702 gene locus_tag LOCUS_45590 17730 16702 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105038.1 protein_id gnl|my_center|LOCUS_45590 18127 19140 gene locus_tag LOCUS_45600 18127 19140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 19527 19982 gene locus_tag LOCUS_45610 19527 19982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056063.1 protein_id gnl|my_center|LOCUS_45610 20522 20184 gene locus_tag LOCUS_45620 gene glnB 20522 20184 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140260.1 protein_id gnl|my_center|LOCUS_45620 22702 20861 gene locus_tag LOCUS_45630 gene feoB 22702 20861 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIY3 protein_id gnl|my_center|LOCUS_45630 >Feature sequence118 623 1243 gene locus_tag LOCUS_45640 623 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 1374 1703 gene locus_tag LOCUS_45650 1374 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 1709 4516 gene locus_tag LOCUS_45660 1709 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140619.1 protein_id gnl|my_center|LOCUS_45660 4636 5343 gene locus_tag LOCUS_45670 4636 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 5706 6704 gene locus_tag LOCUS_45680 5706 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 6705 7502 gene locus_tag LOCUS_45690 6705 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142034.1 protein_id gnl|my_center|LOCUS_45690 7634 9457 gene locus_tag LOCUS_45700 7634 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 9669 10523 gene locus_tag LOCUS_45710 9669 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 10513 11898 gene locus_tag LOCUS_45720 10513 11898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142037.1 protein_id gnl|my_center|LOCUS_45720 12173 14119 gene locus_tag LOCUS_45730 12173 14119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142038.1 protein_id gnl|my_center|LOCUS_45730 14251 14583 gene locus_tag LOCUS_45740 14251 14583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 14588 16111 gene locus_tag LOCUS_45750 14588 16111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 16374 17966 gene locus_tag LOCUS_45760 16374 17966 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057713.1 protein_id gnl|my_center|LOCUS_45760 18992 18180 gene locus_tag LOCUS_45770 18992 18180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 19259 20239 gene locus_tag LOCUS_45780 19259 20239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 21422 20340 gene locus_tag LOCUS_45790 21422 20340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 22938 22066 gene locus_tag LOCUS_45800 22938 22066 CDS product 6-pyruvoyltetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056938.1 protein_id gnl|my_center|LOCUS_45800 >Feature sequence119 1386 268 gene locus_tag LOCUS_45810 1386 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 3373 1853 gene locus_tag LOCUS_45820 3373 1853 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_45820 4147 3794 gene locus_tag LOCUS_45830 4147 3794 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LR0 protein_id gnl|my_center|LOCUS_45830 4380 4144 gene locus_tag LOCUS_45840 4380 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 4860 4426 gene locus_tag LOCUS_45850 4860 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 5384 4962 gene locus_tag LOCUS_45860 5384 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140553.1 protein_id gnl|my_center|LOCUS_45860 6722 5508 gene locus_tag LOCUS_45870 6722 5508 CDS product modification methylase, putative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_277101.1 protein_id gnl|my_center|LOCUS_45870 7528 6728 gene locus_tag LOCUS_45880 7528 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 8371 7736 gene locus_tag LOCUS_45890 gene ctaE 8371 7736 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 protein_id gnl|my_center|LOCUS_45890 10046 8358 gene locus_tag LOCUS_45900 gene ctaD 10046 8358 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMM5 protein_id gnl|my_center|LOCUS_45900 10984 10043 gene locus_tag LOCUS_45910 gene ctaC 10984 10043 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIL9 protein_id gnl|my_center|LOCUS_45910 11598 10993 gene locus_tag LOCUS_45920 11598 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140740.1 protein_id gnl|my_center|LOCUS_45920 12095 11595 gene locus_tag LOCUS_45930 12095 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140739.1 protein_id gnl|my_center|LOCUS_45930 13335 14897 gene locus_tag LOCUS_45940 13335 14897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 protein_id gnl|my_center|LOCUS_45940 15093 15470 gene locus_tag LOCUS_45950 15093 15470 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 protein_id gnl|my_center|LOCUS_45950 15498 16814 gene locus_tag LOCUS_45960 15498 16814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056607.1 protein_id gnl|my_center|LOCUS_45960 17088 16828 gene locus_tag LOCUS_45970 17088 16828 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 protein_id gnl|my_center|LOCUS_45970 17564 20296 gene locus_tag LOCUS_45980 17564 20296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 20854 21639 gene locus_tag LOCUS_45990 20854 21639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 22349 22032 gene locus_tag LOCUS_46000 22349 22032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 >Feature sequence120 1062 121 gene locus_tag LOCUS_46010 1062 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 1241 1420 gene locus_tag LOCUS_46020 1241 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 1747 1992 gene locus_tag LOCUS_46030 1747 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 2770 2063 gene locus_tag LOCUS_46040 2770 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 protein_id gnl|my_center|LOCUS_46040 2833 3198 gene locus_tag LOCUS_46050 2833 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 3249 3959 gene locus_tag LOCUS_46060 3249 3959 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG61 protein_id gnl|my_center|LOCUS_46060 4250 4651 gene locus_tag LOCUS_46070 4250 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056170.1 protein_id gnl|my_center|LOCUS_46070 4775 5713 gene locus_tag LOCUS_46080 gene murQ 4775 5713 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ1 protein_id gnl|my_center|LOCUS_46080 5716 7257 gene locus_tag LOCUS_46090 5716 7257 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057032.1 protein_id gnl|my_center|LOCUS_46090 7720 8694 gene locus_tag LOCUS_46100 7720 8694 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057211.1 protein_id gnl|my_center|LOCUS_46100 8880 9329 gene locus_tag LOCUS_46110 8880 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 10278 11855 gene locus_tag LOCUS_46120 10278 11855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 12194 13597 gene locus_tag LOCUS_46130 gene putP 12194 13597 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_46130 15073 13958 gene locus_tag LOCUS_46140 15073 13958 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021990.1 protein_id gnl|my_center|LOCUS_46140 16128 15091 gene locus_tag LOCUS_46150 gene hisC 16128 15091 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61000 protein_id gnl|my_center|LOCUS_46150 16962 16207 gene locus_tag LOCUS_46160 gene hpcH 16962 16207 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_46160 17471 17755 gene locus_tag LOCUS_46170 17471 17755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 17755 18423 gene locus_tag LOCUS_46180 17755 18423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 18499 18903 gene locus_tag LOCUS_46190 18499 18903 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037385.1 protein_id gnl|my_center|LOCUS_46190 18928 19695 gene locus_tag LOCUS_46200 18928 19695 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_46200 20161 19787 gene locus_tag LOCUS_46210 20161 19787 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_46210 22422 20500 gene locus_tag LOCUS_46220 22422 20500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 >Feature sequence121 481 317 gene locus_tag LOCUS_46230 481 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 1477 509 gene locus_tag LOCUS_46240 1477 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528117.1 protein_id gnl|my_center|LOCUS_46240 2886 2653 gene locus_tag LOCUS_46250 2886 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 3797 3285 gene locus_tag LOCUS_46260 3797 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 5053 3800 gene locus_tag LOCUS_46270 5053 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404780.1 protein_id gnl|my_center|LOCUS_46270 5987 5046 gene locus_tag LOCUS_46280 5987 5046 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_46280 6356 6571 gene locus_tag LOCUS_46290 6356 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 6568 7011 gene locus_tag LOCUS_46300 6568 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 7499 7164 gene locus_tag LOCUS_46310 7499 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 8006 8290 gene locus_tag LOCUS_46320 8006 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 10002 8971 gene locus_tag LOCUS_46330 10002 8971 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141699.1 protein_id gnl|my_center|LOCUS_46330 10339 10139 gene locus_tag LOCUS_46340 10339 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142236.1 protein_id gnl|my_center|LOCUS_46340 12818 10401 gene locus_tag LOCUS_46350 gene mrcB 12818 10401 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124578.1 protein_id gnl|my_center|LOCUS_46350 13195 14811 gene locus_tag LOCUS_46360 13195 14811 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 protein_id gnl|my_center|LOCUS_46360 15149 15769 gene locus_tag LOCUS_46370 15149 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 16251 16430 gene locus_tag LOCUS_46380 16251 16430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 16609 16427 gene locus_tag LOCUS_46390 16609 16427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 16727 17347 gene locus_tag LOCUS_46400 16727 17347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 17999 18181 gene locus_tag LOCUS_46410 17999 18181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 18688 19482 gene locus_tag LOCUS_46420 18688 19482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 20098 20454 gene locus_tag LOCUS_46430 20098 20454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 20632 20805 gene locus_tag LOCUS_46440 20632 20805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 21060 21233 gene locus_tag LOCUS_46450 21060 21233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 21491 22003 gene locus_tag LOCUS_46460 21491 22003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 >Feature sequence122 752 3559 gene locus_tag LOCUS_46470 752 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 4766 3828 gene locus_tag LOCUS_46480 4766 3828 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058242.1 protein_id gnl|my_center|LOCUS_46480 5809 5168 gene locus_tag LOCUS_46490 5809 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143744.1 protein_id gnl|my_center|LOCUS_46490 6375 7361 gene locus_tag LOCUS_46500 gene uppP 6375 7361 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG92 protein_id gnl|my_center|LOCUS_46500 7375 8709 gene locus_tag LOCUS_46510 7375 8709 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057484.1 protein_id gnl|my_center|LOCUS_46510 9296 9550 gene locus_tag LOCUS_46520 9296 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 9913 10308 gene locus_tag LOCUS_46530 9913 10308 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272733.1 protein_id gnl|my_center|LOCUS_46530 11764 10502 gene locus_tag LOCUS_46540 11764 10502 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_46540 12471 14291 gene locus_tag LOCUS_46550 12471 14291 CDS product zinc-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393690.1 protein_id gnl|my_center|LOCUS_46550 14472 14317 gene locus_tag LOCUS_46560 14472 14317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 14761 14504 gene locus_tag LOCUS_46570 14761 14504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 15396 14869 gene locus_tag LOCUS_46580 15396 14869 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140415.1 protein_id gnl|my_center|LOCUS_46580 20485 15650 gene locus_tag LOCUS_46590 20485 15650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 22007 20676 gene locus_tag LOCUS_46600 22007 20676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 >Feature sequence123 1284 727 gene locus_tag LOCUS_46610 1284 727 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228166.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46610 1797 1468 gene locus_tag LOCUS_46620 1797 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 2639 1935 gene locus_tag LOCUS_46630 2639 1935 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057817.1 protein_id gnl|my_center|LOCUS_46630 2680 3390 gene locus_tag LOCUS_46640 gene cobI 2680 3390 CDS product precorrin-2 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057289.1 protein_id gnl|my_center|LOCUS_46640 4215 3724 gene locus_tag LOCUS_46650 4215 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 4106 5380 gene locus_tag LOCUS_46660 4106 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 6125 5673 gene locus_tag LOCUS_46670 6125 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 7916 8893 gene locus_tag LOCUS_46680 7916 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 10625 9060 gene locus_tag LOCUS_46690 gene ndhB 10625 9060 CDS product NAD(P)H-quinone oxidoreductase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR6 protein_id gnl|my_center|LOCUS_46690 11314 13989 gene locus_tag LOCUS_46700 gene topA 11314 13989 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR4 protein_id gnl|my_center|LOCUS_46700 14064 15575 gene locus_tag LOCUS_46710 14064 15575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 16117 15674 gene locus_tag LOCUS_46720 16117 15674 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976297.1 protein_id gnl|my_center|LOCUS_46720 16886 16332 gene locus_tag LOCUS_46730 16886 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 17256 18131 gene locus_tag LOCUS_46740 17256 18131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090797.1 protein_id gnl|my_center|LOCUS_46740 18345 18818 gene locus_tag LOCUS_46750 18345 18818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 18865 19203 gene locus_tag LOCUS_46760 18865 19203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227643.1 protein_id gnl|my_center|LOCUS_46760 19220 20077 gene locus_tag LOCUS_46770 19220 20077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 20093 21094 gene locus_tag LOCUS_46780 20093 21094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 21098 22063 gene locus_tag LOCUS_46790 21098 22063 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204064.1 protein_id gnl|my_center|LOCUS_46790 >Feature sequence124 1103 246 gene locus_tag LOCUS_46800 1103 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 1256 1837 gene locus_tag LOCUS_46810 gene yezE 1256 1837 CDS product putative HTH-type transcriptional regulator YezE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WY76 protein_id gnl|my_center|LOCUS_46810 1929 2585 gene locus_tag LOCUS_46820 1929 2585 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_46820 2903 3250 gene locus_tag LOCUS_46830 gene trx 2903 3250 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ76 protein_id gnl|my_center|LOCUS_46830 3397 3996 gene locus_tag LOCUS_46840 3397 3996 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144355.1 protein_id gnl|my_center|LOCUS_46840 4908 4192 gene locus_tag LOCUS_46850 4908 4192 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140746.1 protein_id gnl|my_center|LOCUS_46850 5567 7135 gene locus_tag LOCUS_46860 5567 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 7525 8994 gene locus_tag LOCUS_46870 7525 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 10622 9090 gene locus_tag LOCUS_46880 10622 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 11554 11159 gene locus_tag LOCUS_46890 11554 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 12794 14005 gene locus_tag LOCUS_46900 gene pilT 12794 14005 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056402.1 protein_id gnl|my_center|LOCUS_46900 14188 15135 gene locus_tag LOCUS_46910 14188 15135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 16915 15197 gene locus_tag LOCUS_46920 16915 15197 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_46920 19661 17526 gene locus_tag LOCUS_46930 19661 17526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 <21998 20352 gene locus_tag LOCUS_46940 <21998 20352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064383.1:type I secretion C-terminal target domain-containing protein >Feature sequence125 1098 643 gene locus_tag LOCUS_46950 1098 643 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_46950 1569 6137 gene locus_tag LOCUS_46960 1569 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 6318 6782 gene locus_tag LOCUS_46970 6318 6782 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_46970 7020 8912 gene locus_tag LOCUS_46980 7020 8912 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFU0 protein_id gnl|my_center|LOCUS_46980 10184 9309 gene locus_tag LOCUS_46990 10184 9309 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057622.1 protein_id gnl|my_center|LOCUS_46990 11428 10403 gene locus_tag LOCUS_47000 11428 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528117.1 protein_id gnl|my_center|LOCUS_47000 14254 12437 gene locus_tag LOCUS_47010 14254 12437 CDS product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142261.1 protein_id gnl|my_center|LOCUS_47010 15189 14263 gene locus_tag LOCUS_47020 15189 14263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528117.1 protein_id gnl|my_center|LOCUS_47020 15602 15414 gene locus_tag LOCUS_47030 15602 15414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 15890 15693 gene locus_tag LOCUS_47040 15890 15693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 16251 16054 gene locus_tag LOCUS_47050 16251 16054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 16497 16297 gene locus_tag LOCUS_47060 16497 16297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 16834 16679 gene locus_tag LOCUS_47070 16834 16679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 18972 16954 gene locus_tag LOCUS_47080 18972 16954 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_47080 19415 18969 gene locus_tag LOCUS_47090 19415 18969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 19704 19399 gene locus_tag LOCUS_47100 19704 19399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 >Feature sequence126 305 123 gene locus_tag LOCUS_47110 305 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 1085 663 gene locus_tag LOCUS_47120 1085 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 1510 1106 gene locus_tag LOCUS_47130 1510 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 3548 2376 gene locus_tag LOCUS_47140 gene aspC 3548 2376 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67781 protein_id gnl|my_center|LOCUS_47140 3870 4358 gene locus_tag LOCUS_47150 3870 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 4355 6025 gene locus_tag LOCUS_47160 4355 6025 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267691.1 protein_id gnl|my_center|LOCUS_47160 6088 8265 gene locus_tag LOCUS_47170 6088 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 8473 9285 gene locus_tag LOCUS_47180 8473 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 11292 9319 gene locus_tag LOCUS_47190 11292 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 11600 11776 gene locus_tag LOCUS_47200 11600 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 12090 13286 gene locus_tag LOCUS_47210 12090 13286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_47210 13455 13919 gene locus_tag LOCUS_47220 13455 13919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 16508 15786 gene locus_tag LOCUS_47230 16508 15786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 protein_id gnl|my_center|LOCUS_47230 16661 17407 gene locus_tag LOCUS_47240 16661 17407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141905.1 protein_id gnl|my_center|LOCUS_47240 19673 17415 gene locus_tag LOCUS_47250 19673 17415 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057331.1 protein_id gnl|my_center|LOCUS_47250 20379 19927 gene locus_tag LOCUS_47260 20379 19927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 20659 20955 gene locus_tag LOCUS_47270 20659 20955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 >Feature sequence127 5826 205 gene locus_tag LOCUS_47280 5826 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 6770 6546 gene locus_tag LOCUS_47290 6770 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 7239 6763 gene locus_tag LOCUS_47300 7239 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002249008.2 protein_id gnl|my_center|LOCUS_47300 8519 7590 gene locus_tag LOCUS_47310 8519 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 8992 10779 gene locus_tag LOCUS_47320 8992 10779 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142407.1 protein_id gnl|my_center|LOCUS_47320 10979 11638 gene locus_tag LOCUS_47330 10979 11638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869506.1 protein_id gnl|my_center|LOCUS_47330 12604 11873 gene locus_tag LOCUS_47340 12604 11873 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_47340 14154 13078 gene locus_tag LOCUS_47350 14154 13078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 15196 14207 gene locus_tag LOCUS_47360 15196 14207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 16199 16750 gene locus_tag LOCUS_47370 16199 16750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 17384 18295 gene locus_tag LOCUS_47380 17384 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 20410 19106 gene locus_tag LOCUS_47390 gene proA 20410 19106 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU1 protein_id gnl|my_center|LOCUS_47390 >Feature sequence128 518 330 gene locus_tag LOCUS_47400 518 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 1273 7335 gene locus_tag LOCUS_47410 1273 7335 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_47410 7504 13755 gene locus_tag LOCUS_47420 7504 13755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 14177 20311 gene locus_tag LOCUS_47430 14177 20311 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_47430 >Feature sequence129 556 293 gene locus_tag LOCUS_47440 556 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 1289 2563 gene locus_tag LOCUS_47450 1289 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140792.1 protein_id gnl|my_center|LOCUS_47450 2704 2776 gene locus_tag LOCUS_t00510 2704 2776 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3021 5555 gene locus_tag LOCUS_47460 3021 5555 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140924.1 protein_id gnl|my_center|LOCUS_47460 6279 5659 gene locus_tag LOCUS_47470 6279 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_47470 6459 7031 gene locus_tag LOCUS_47480 6459 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 protein_id gnl|my_center|LOCUS_47480 9563 7251 gene locus_tag LOCUS_47490 9563 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 11061 9874 gene locus_tag LOCUS_47500 gene sat 11061 9874 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK26 protein_id gnl|my_center|LOCUS_47500 11715 11179 gene locus_tag LOCUS_47510 gene cysC 11715 11179 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFJ4 protein_id gnl|my_center|LOCUS_47510 12893 12366 gene locus_tag LOCUS_47520 gene purE 12893 12366 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB0 protein_id gnl|my_center|LOCUS_47520 12940 14130 gene locus_tag LOCUS_47530 12940 14130 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH66 protein_id gnl|my_center|LOCUS_47530 14490 14705 gene locus_tag LOCUS_47540 gene psaE 14490 14705 CDS product photosystem I reaction center subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A423 protein_id gnl|my_center|LOCUS_47540 14799 15647 gene locus_tag LOCUS_47550 gene mutM 14799 15647 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59065 protein_id gnl|my_center|LOCUS_47550 15911 16132 gene locus_tag LOCUS_47560 gene ndhO 15911 16132 CDS product NAD(P)H-quinone oxidoreductase subunit O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFI1 protein_id gnl|my_center|LOCUS_47560 16473 17444 gene locus_tag LOCUS_47570 gene mdh 16473 17444 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHJ3 protein_id gnl|my_center|LOCUS_47570 17940 17530 gene locus_tag LOCUS_47580 17940 17530 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957424.1 protein_id gnl|my_center|LOCUS_47580 18133 19560 gene locus_tag LOCUS_47590 18133 19560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 >Feature sequence130 1575 1417 gene locus_tag LOCUS_47600 1575 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 3149 2154 gene locus_tag LOCUS_47610 3149 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 4283 3198 gene locus_tag LOCUS_47620 4283 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 4727 4536 gene locus_tag LOCUS_47630 4727 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 6383 5271 gene locus_tag LOCUS_47640 6383 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 7897 6737 gene locus_tag LOCUS_47650 7897 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 8954 8709 gene locus_tag LOCUS_47660 8954 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 12412 9119 gene locus_tag LOCUS_47670 12412 9119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 12934 12632 gene locus_tag LOCUS_47680 12934 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 17805 13228 gene locus_tag LOCUS_47690 17805 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 19356 17986 gene locus_tag LOCUS_47700 19356 17986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 >Feature sequence131 543 1127 gene locus_tag LOCUS_47710 543 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_47710 1561 1232 gene locus_tag LOCUS_47720 1561 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 2355 1954 gene locus_tag LOCUS_47730 2355 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 4106 3216 gene locus_tag LOCUS_47740 4106 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 6335 5385 gene locus_tag LOCUS_47750 6335 5385 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 protein_id gnl|my_center|LOCUS_47750 6522 8258 gene locus_tag LOCUS_47760 6522 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 8651 9085 gene locus_tag LOCUS_47770 8651 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 9365 9063 gene locus_tag LOCUS_47780 9365 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 10028 9453 gene locus_tag LOCUS_47790 10028 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_47790 11537 10158 gene locus_tag LOCUS_47800 11537 10158 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_47800 12174 11569 gene locus_tag LOCUS_47810 12174 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_47810 12891 12208 gene locus_tag LOCUS_47820 12891 12208 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_47820 13819 13310 gene locus_tag LOCUS_47830 gene apcF 13819 13310 CDS product phycobilisome core component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 protein_id gnl|my_center|LOCUS_47830 14681 16102 gene locus_tag LOCUS_47840 gene glnA 14681 16102 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ7 protein_id gnl|my_center|LOCUS_47840 16430 17350 gene locus_tag LOCUS_47850 16430 17350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142304.1 protein_id gnl|my_center|LOCUS_47850 17593 18096 gene locus_tag LOCUS_47860 17593 18096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056683.1 protein_id gnl|my_center|LOCUS_47860 18384 18199 gene locus_tag LOCUS_47870 18384 18199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 18306 18998 gene locus_tag LOCUS_47880 18306 18998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056083.1 protein_id gnl|my_center|LOCUS_47880 >Feature sequence132 1600 227 gene locus_tag LOCUS_47890 1600 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087425.1 protein_id gnl|my_center|LOCUS_47890 1810 2115 gene locus_tag LOCUS_47900 1810 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125696.1 protein_id gnl|my_center|LOCUS_47900 2574 3107 gene locus_tag LOCUS_47910 2574 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 3322 4464 gene locus_tag LOCUS_47920 3322 4464 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256700.1 protein_id gnl|my_center|LOCUS_47920 5531 4461 gene locus_tag LOCUS_47930 5531 4461 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_47930 6758 5877 gene locus_tag LOCUS_47940 gene ctaB 6758 5877 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHQ2 protein_id gnl|my_center|LOCUS_47940 8127 7279 gene locus_tag LOCUS_47950 8127 7279 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 protein_id gnl|my_center|LOCUS_47950 8917 9843 gene locus_tag LOCUS_47960 gene ctaC 8917 9843 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE8 protein_id gnl|my_center|LOCUS_47960 10099 11781 gene locus_tag LOCUS_47970 gene ctaD 10099 11781 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE9 protein_id gnl|my_center|LOCUS_47970 11974 12600 gene locus_tag LOCUS_47980 gene ctaE 11974 12600 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_47980 13042 12851 gene locus_tag LOCUS_47990 13042 12851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 13080 13388 gene locus_tag LOCUS_48000 13080 13388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 13482 13718 gene locus_tag LOCUS_48010 13482 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 14582 16333 gene locus_tag LOCUS_48020 14582 16333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 16738 17136 gene locus_tag LOCUS_48030 16738 17136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 17328 17699 gene locus_tag LOCUS_48040 gene panD 17328 17699 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYW7 protein_id gnl|my_center|LOCUS_48040 17680 18498 gene locus_tag LOCUS_48050 17680 18498 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_48050 18599 19228 gene locus_tag LOCUS_48060 18599 19228 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336871.1 protein_id gnl|my_center|LOCUS_48060 >Feature sequence133 3050 237 gene locus_tag LOCUS_48070 3050 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 3687 3043 gene locus_tag LOCUS_48080 3687 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 4158 4292 gene locus_tag LOCUS_48090 4158 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 4344 5186 gene locus_tag LOCUS_48100 4344 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057260.1 protein_id gnl|my_center|LOCUS_48100 5472 5966 gene locus_tag LOCUS_48110 5472 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057259.1 protein_id gnl|my_center|LOCUS_48110 5953 6630 gene locus_tag LOCUS_48120 5953 6630 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057258.1 protein_id gnl|my_center|LOCUS_48120 7029 6706 gene locus_tag LOCUS_48130 7029 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 7228 7512 gene locus_tag LOCUS_48140 7228 7512 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057572.1 protein_id gnl|my_center|LOCUS_48140 7651 7938 gene locus_tag LOCUS_48150 7651 7938 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055881.1 protein_id gnl|my_center|LOCUS_48150 8559 8044 gene locus_tag LOCUS_48160 8559 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 10123 8906 gene locus_tag LOCUS_48170 10123 8906 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056650.1 protein_id gnl|my_center|LOCUS_48170 10376 11041 gene locus_tag LOCUS_48180 10376 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143972.1 protein_id gnl|my_center|LOCUS_48180 11175 11972 gene locus_tag LOCUS_48190 11175 11972 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123031.1 protein_id gnl|my_center|LOCUS_48190 13474 12185 gene locus_tag LOCUS_48200 gene pyrD 13474 12185 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB7 protein_id gnl|my_center|LOCUS_48200 14270 13797 gene locus_tag LOCUS_48210 14270 13797 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 protein_id gnl|my_center|LOCUS_48210 15999 14548 gene locus_tag LOCUS_48220 15999 14548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_48220 16356 18674 gene locus_tag LOCUS_48230 16356 18674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 >Feature sequence134 764 2131 gene locus_tag LOCUS_48240 764 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 2092 3072 gene locus_tag LOCUS_48250 2092 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 3302 4222 gene locus_tag LOCUS_48260 3302 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 4544 4344 gene locus_tag LOCUS_48270 4544 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 4933 5928 gene locus_tag LOCUS_48280 4933 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 6811 9525 gene locus_tag LOCUS_48290 6811 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 9537 10001 gene locus_tag LOCUS_48300 9537 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 9994 11391 gene locus_tag LOCUS_48310 9994 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 11434 12288 gene locus_tag LOCUS_48320 11434 12288 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538091.1 protein_id gnl|my_center|LOCUS_48320 13104 12529 gene locus_tag LOCUS_48330 13104 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142343.1 protein_id gnl|my_center|LOCUS_48330 13867 16062 gene locus_tag LOCUS_48340 13867 16062 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056777.1 protein_id gnl|my_center|LOCUS_48340 16913 16254 gene locus_tag LOCUS_48350 16913 16254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 >Feature sequence135 462 166 gene locus_tag LOCUS_48360 462 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 906 658 gene locus_tag LOCUS_48370 906 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 2000 1023 gene locus_tag LOCUS_48380 2000 1023 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_48380 4515 2137 gene locus_tag LOCUS_48390 4515 2137 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056777.1 protein_id gnl|my_center|LOCUS_48390 4607 4798 gene locus_tag LOCUS_48400 4607 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 5907 4924 gene locus_tag LOCUS_48410 5907 4924 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_48410 6242 6469 gene locus_tag LOCUS_48420 6242 6469 CDS product proteolipid membrane potential modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 protein_id gnl|my_center|LOCUS_48420 7961 8536 gene locus_tag LOCUS_48430 7961 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057704.1 protein_id gnl|my_center|LOCUS_48430 8705 9682 gene locus_tag LOCUS_48440 8705 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141130.1 protein_id gnl|my_center|LOCUS_48440 9976 10527 gene locus_tag LOCUS_48450 9976 10527 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056346.1 protein_id gnl|my_center|LOCUS_48450 10872 11135 gene locus_tag LOCUS_48460 10872 11135 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 protein_id gnl|my_center|LOCUS_48460 11289 12263 gene locus_tag LOCUS_48470 gene gshB 11289 12263 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKF1 protein_id gnl|my_center|LOCUS_48470 12471 12800 gene locus_tag LOCUS_48480 12471 12800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 12832 13971 gene locus_tag LOCUS_48490 12832 13971 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144332.1 protein_id gnl|my_center|LOCUS_48490 14330 14956 gene locus_tag LOCUS_48500 14330 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 15064 15378 gene locus_tag LOCUS_48510 15064 15378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_48510 15653 15399 gene locus_tag LOCUS_48520 15653 15399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 15652 17730 gene locus_tag LOCUS_48530 gene aslA 15652 17730 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395844.1 protein_id gnl|my_center|LOCUS_48530 18269 19327 gene locus_tag LOCUS_48540 18269 19327 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_48540 >Feature sequence136 454 612 gene locus_tag LOCUS_48550 454 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 1927 860 gene locus_tag LOCUS_48560 gene chlI 1927 860 CDS product Mg-protoporphyrin IX chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS0 protein_id gnl|my_center|LOCUS_48560 2782 2000 gene locus_tag LOCUS_48570 2782 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057978.1 protein_id gnl|my_center|LOCUS_48570 3037 3252 gene locus_tag LOCUS_48580 3037 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 5560 3293 gene locus_tag LOCUS_48590 gene narB 5560 3293 CDS product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057195.1 protein_id gnl|my_center|LOCUS_48590 7523 6000 gene locus_tag LOCUS_48600 gene crnA 7523 6000 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_48600 9628 8252 gene locus_tag LOCUS_48610 9628 8252 CDS product nitrate transporter NrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143944.1 protein_id gnl|my_center|LOCUS_48610 11408 9873 gene locus_tag LOCUS_48620 gene nirA 11408 9873 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_48620 12761 11652 gene locus_tag LOCUS_48630 12761 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 14519 12774 gene locus_tag LOCUS_48640 14519 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 15889 14612 gene locus_tag LOCUS_48650 gene avtA 15889 14612 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057579.1 protein_id gnl|my_center|LOCUS_48650 15958 16662 gene locus_tag LOCUS_48660 15958 16662 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055917.1 protein_id gnl|my_center|LOCUS_48660 16680 17816 gene locus_tag LOCUS_48670 16680 17816 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057271.1 protein_id gnl|my_center|LOCUS_48670 17821 18816 gene locus_tag LOCUS_48680 17821 18816 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WXS5 protein_id gnl|my_center|LOCUS_48680 18899 19255 gene locus_tag LOCUS_48690 18899 19255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 >Feature sequence137 1988 1320 gene locus_tag LOCUS_48700 1988 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 2932 2000 gene locus_tag LOCUS_48710 2932 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 5995 2945 gene locus_tag LOCUS_48720 5995 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 6396 5995 gene locus_tag LOCUS_48730 6396 5995 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_48730 6932 6537 gene locus_tag LOCUS_48740 6932 6537 CDS product PAAR motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065296.1 protein_id gnl|my_center|LOCUS_48740 7616 6969 gene locus_tag LOCUS_48750 7616 6969 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_48750 8686 7613 gene locus_tag LOCUS_48760 8686 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941649.1 protein_id gnl|my_center|LOCUS_48760 9415 8699 gene locus_tag LOCUS_48770 9415 8699 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974728.1 protein_id gnl|my_center|LOCUS_48770 11004 9418 gene locus_tag LOCUS_48780 11004 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 11738 11340 gene locus_tag LOCUS_48790 11738 11340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_48790 12167 11742 gene locus_tag LOCUS_48800 12167 11742 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_48800 13426 12215 gene locus_tag LOCUS_48810 13426 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 14387 13455 gene locus_tag LOCUS_48820 14387 13455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 15375 15866 gene locus_tag LOCUS_48830 15375 15866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 16944 17354 gene locus_tag LOCUS_48840 16944 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 17345 17686 gene locus_tag LOCUS_48850 17345 17686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 17733 18038 gene locus_tag LOCUS_48860 17733 18038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 18263 18406 gene locus_tag LOCUS_48870 18263 18406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 18382 18729 gene locus_tag LOCUS_48880 18382 18729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 >Feature sequence138 1241 834 gene locus_tag LOCUS_48890 1241 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 3283 1934 gene locus_tag LOCUS_48900 gene hlyD 3283 1934 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089032.1 protein_id gnl|my_center|LOCUS_48900 6954 3730 gene locus_tag LOCUS_48910 6954 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 8485 9768 gene locus_tag LOCUS_48920 8485 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 10294 11520 gene locus_tag LOCUS_48930 10294 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 11923 13746 gene locus_tag LOCUS_48940 11923 13746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 15110 14352 gene locus_tag LOCUS_48950 15110 14352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 15658 15362 gene locus_tag LOCUS_48960 15658 15362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 16205 15918 gene locus_tag LOCUS_48970 16205 15918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 16814 16527 gene locus_tag LOCUS_48980 16814 16527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 17448 17119 gene locus_tag LOCUS_48990 17448 17119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 >Feature sequence139 3098 1221 gene locus_tag LOCUS_49000 3098 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 3300 4328 gene locus_tag LOCUS_49010 gene era 3300 4328 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ5 protein_id gnl|my_center|LOCUS_49010 5017 4451 gene locus_tag LOCUS_49020 5017 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_49020 7727 5133 gene locus_tag LOCUS_49030 gene gyrA 7727 5133 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ59 protein_id gnl|my_center|LOCUS_49030 8286 9221 gene locus_tag LOCUS_49040 8286 9221 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 protein_id gnl|my_center|LOCUS_49040 9560 9378 gene locus_tag LOCUS_49050 9560 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 9622 10338 gene locus_tag LOCUS_49060 9622 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 11334 10447 gene locus_tag LOCUS_49070 11334 10447 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_49070 12388 11390 gene locus_tag LOCUS_49080 12388 11390 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258587.1 protein_id gnl|my_center|LOCUS_49080 13580 12411 gene locus_tag LOCUS_49090 13580 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 15245 14091 gene locus_tag LOCUS_49100 gene aglE 15245 14091 CDS product alpha-glucoside ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384638.1 protein_id gnl|my_center|LOCUS_49100 >Feature sequence140 <1 1914 gene locus_tag LOCUS_49110 <1 1914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056204.1:two-component hybrid sensor and regulator 2273 2599 gene locus_tag LOCUS_49120 2273 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 2743 3345 gene locus_tag LOCUS_49130 gene ureG 2743 3345 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ4 protein_id gnl|my_center|LOCUS_49130 3876 4949 gene locus_tag LOCUS_49140 3876 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 5788 6255 gene locus_tag LOCUS_49150 5788 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 7810 7073 gene locus_tag LOCUS_49160 7810 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 8783 8544 gene locus_tag LOCUS_49170 8783 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 9151 9762 gene locus_tag LOCUS_49180 9151 9762 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_49180 11378 9921 gene locus_tag LOCUS_49190 11378 9921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 12163 11570 gene locus_tag LOCUS_49200 12163 11570 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969753.1 protein_id gnl|my_center|LOCUS_49200 13585 12566 gene locus_tag LOCUS_49210 13585 12566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 14088 15605 gene locus_tag LOCUS_49220 14088 15605 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767667.1 protein_id gnl|my_center|LOCUS_49220 16609 17115 gene locus_tag LOCUS_49230 gene ectA 16609 17115 CDS product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263923.1 protein_id gnl|my_center|LOCUS_49230 17132 17932 gene locus_tag LOCUS_49240 17132 17932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 >Feature sequence141 952 1731 gene locus_tag LOCUS_49250 gene glyQ 952 1731 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK36 protein_id gnl|my_center|LOCUS_49250 2841 1828 gene locus_tag LOCUS_49260 2841 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 3139 2915 gene locus_tag LOCUS_49270 3139 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 3915 3313 gene locus_tag LOCUS_49280 gene leuD 3915 3313 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_49280 5333 3927 gene locus_tag LOCUS_49290 gene leuC 5333 3927 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFV7 protein_id gnl|my_center|LOCUS_49290 6167 5475 gene locus_tag LOCUS_49300 6167 5475 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_49300 6769 6458 gene locus_tag LOCUS_49310 gene ndhE 6769 6458 CDS product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL29 protein_id gnl|my_center|LOCUS_49310 7506 6892 gene locus_tag LOCUS_49320 gene ndhG 7506 6892 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 protein_id gnl|my_center|LOCUS_49320 8271 7666 gene locus_tag LOCUS_49330 gene ndhI 8271 7666 CDS product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL31 protein_id gnl|my_center|LOCUS_49330 9565 8447 gene locus_tag LOCUS_49340 gene ndhA 9565 8447 CDS product NAD(P)H-quinone oxidoreductase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL32 protein_id gnl|my_center|LOCUS_49340 10364 12172 gene locus_tag LOCUS_49350 10364 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 13594 12323 gene locus_tag LOCUS_49360 gene purD 13594 12323 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHV4 protein_id gnl|my_center|LOCUS_49360 13781 14737 gene locus_tag LOCUS_49370 gene ytcB 13781 14737 CDS product putative UDP-glucose epimerase YtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34886 protein_id gnl|my_center|LOCUS_49370 16924 15035 gene locus_tag LOCUS_49380 16924 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 17266 16949 gene locus_tag LOCUS_49390 17266 16949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 >Feature sequence142 1709 1515 gene locus_tag LOCUS_49400 1709 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 2687 2490 gene locus_tag LOCUS_49410 2687 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 3412 2768 gene locus_tag LOCUS_49420 3412 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402995.1 protein_id gnl|my_center|LOCUS_49420 3924 3595 gene locus_tag LOCUS_49430 3924 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 4372 4181 gene locus_tag LOCUS_49440 4372 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 4976 5428 gene locus_tag LOCUS_49450 4976 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 7988 5631 gene locus_tag LOCUS_49460 7988 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227744.1 protein_id gnl|my_center|LOCUS_49460 8239 8436 gene locus_tag LOCUS_49470 8239 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 9061 8456 gene locus_tag LOCUS_49480 9061 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 9339 9653 gene locus_tag LOCUS_49490 9339 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144191.1 protein_id gnl|my_center|LOCUS_49490 10224 9793 gene locus_tag LOCUS_49500 10224 9793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 10433 10224 gene locus_tag LOCUS_49510 10433 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 10751 12673 gene locus_tag LOCUS_49520 10751 12673 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141594.1 protein_id gnl|my_center|LOCUS_49520 13448 15082 gene locus_tag LOCUS_49530 13448 15082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 15370 15122 gene locus_tag LOCUS_49540 15370 15122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 <17513 15522 gene locus_tag LOCUS_49550 <17513 15522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057813.1:CHAT domain-containing protein >Feature sequence143 959 324 gene locus_tag LOCUS_49560 959 324 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057826.1 protein_id gnl|my_center|LOCUS_49560 1723 1352 gene locus_tag LOCUS_49570 1723 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057825.1 protein_id gnl|my_center|LOCUS_49570 2539 1985 gene locus_tag LOCUS_49580 2539 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057824.1 protein_id gnl|my_center|LOCUS_49580 3703 3176 gene locus_tag LOCUS_49590 3703 3176 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057826.1 protein_id gnl|my_center|LOCUS_49590 5101 3998 gene locus_tag LOCUS_49600 5101 3998 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141720.1 protein_id gnl|my_center|LOCUS_49600 5656 6258 gene locus_tag LOCUS_49610 5656 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 6882 8240 gene locus_tag LOCUS_49620 6882 8240 CDS product chloride channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057316.1 protein_id gnl|my_center|LOCUS_49620 9810 8617 gene locus_tag LOCUS_49630 9810 8617 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_49630 10878 16031 gene locus_tag LOCUS_49640 10878 16031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 16777 16106 gene locus_tag LOCUS_49650 16777 16106 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140651.1 protein_id gnl|my_center|LOCUS_49650 >Feature sequence144 2753 2103 gene locus_tag LOCUS_49660 2753 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 4303 3938 gene locus_tag LOCUS_49670 4303 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 4926 5372 gene locus_tag LOCUS_49680 4926 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 5668 5937 gene locus_tag LOCUS_49690 5668 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 5950 6459 gene locus_tag LOCUS_49700 5950 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 6550 7599 gene locus_tag LOCUS_49710 6550 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 7596 8369 gene locus_tag LOCUS_49720 7596 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 8604 9584 gene locus_tag LOCUS_49730 8604 9584 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141174.1 protein_id gnl|my_center|LOCUS_49730 9824 10861 gene locus_tag LOCUS_49740 9824 10861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 10933 11499 gene locus_tag LOCUS_49750 10933 11499 CDS product acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097939.1 protein_id gnl|my_center|LOCUS_49750 12027 12782 gene locus_tag LOCUS_49760 12027 12782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 14093 12894 gene locus_tag LOCUS_49770 14093 12894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058195.1 protein_id gnl|my_center|LOCUS_49770 15386 14184 gene locus_tag LOCUS_49780 15386 14184 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057389.1 protein_id gnl|my_center|LOCUS_49780 15734 16411 gene locus_tag LOCUS_49790 15734 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 >Feature sequence145 2305 2676 gene locus_tag LOCUS_49800 2305 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 2673 4217 gene locus_tag LOCUS_49810 2673 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 4551 4892 gene locus_tag LOCUS_49820 4551 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 5076 5825 gene locus_tag LOCUS_49830 5076 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 6286 6726 gene locus_tag LOCUS_49840 6286 6726 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS29 protein_id gnl|my_center|LOCUS_49840 7251 6787 gene locus_tag LOCUS_49850 7251 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 8284 7586 gene locus_tag LOCUS_49860 8284 7586 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057791.1 protein_id gnl|my_center|LOCUS_49860 8446 9144 gene locus_tag LOCUS_49870 8446 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 9185 9484 gene locus_tag LOCUS_49880 9185 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 10022 9438 gene locus_tag LOCUS_49890 gene kptA 10022 9438 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBX9 protein_id gnl|my_center|LOCUS_49890 10927 10367 gene locus_tag LOCUS_49900 10927 10367 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122464.1 protein_id gnl|my_center|LOCUS_49900 12984 11515 gene locus_tag LOCUS_49910 12984 11515 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903305.1 protein_id gnl|my_center|LOCUS_49910 13708 15060 gene locus_tag LOCUS_49920 13708 15060 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y936 protein_id gnl|my_center|LOCUS_49920 15257 15463 gene locus_tag LOCUS_49930 15257 15463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 >Feature sequence146 667 1950 gene locus_tag LOCUS_49940 667 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 2016 5048 gene locus_tag LOCUS_49950 2016 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 5303 8338 gene locus_tag LOCUS_49960 5303 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 8400 9410 gene locus_tag LOCUS_49970 gene ribF 8400 9410 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM6 protein_id gnl|my_center|LOCUS_49970 10474 10289 gene locus_tag LOCUS_49980 10474 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 10526 11434 gene locus_tag LOCUS_49990 10526 11434 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_49990 11526 12023 gene locus_tag LOCUS_50000 11526 12023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 12663 14498 gene locus_tag LOCUS_50010 12663 14498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 14842 15186 gene locus_tag LOCUS_50020 14842 15186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 16408 15299 gene locus_tag LOCUS_50030 16408 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 >Feature sequence147 218 778 gene locus_tag LOCUS_50040 218 778 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK86 protein_id gnl|my_center|LOCUS_50040 3099 838 gene locus_tag LOCUS_50050 3099 838 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143682.1 protein_id gnl|my_center|LOCUS_50050 5259 4351 gene locus_tag LOCUS_50060 5259 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 5861 5391 gene locus_tag LOCUS_50070 gene aroQ 5861 5391 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ7 protein_id gnl|my_center|LOCUS_50070 6011 5871 gene locus_tag LOCUS_50080 6011 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 7249 6275 gene locus_tag LOCUS_50090 7249 6275 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057358.1 protein_id gnl|my_center|LOCUS_50090 8827 7424 gene locus_tag LOCUS_50100 8827 7424 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141145.1 protein_id gnl|my_center|LOCUS_50100 9754 8918 gene locus_tag LOCUS_50110 9754 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 10484 9843 gene locus_tag LOCUS_50120 10484 9843 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056166.1 protein_id gnl|my_center|LOCUS_50120 10706 10551 gene locus_tag LOCUS_50130 10706 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 11216 13027 gene locus_tag LOCUS_50140 gene proS 11216 13027 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT0 protein_id gnl|my_center|LOCUS_50140 14702 13446 gene locus_tag LOCUS_50150 14702 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 16316 15009 gene locus_tag LOCUS_50160 16316 15009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 >Feature sequence148 2016 808 gene locus_tag LOCUS_50170 2016 808 CDS product cysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 protein_id gnl|my_center|LOCUS_50170 2555 2917 gene locus_tag LOCUS_50180 2555 2917 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 protein_id gnl|my_center|LOCUS_50180 3358 6318 gene locus_tag LOCUS_50190 3358 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 6700 6377 gene locus_tag LOCUS_50200 6700 6377 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NM87 protein_id gnl|my_center|LOCUS_50200 8580 7417 gene locus_tag LOCUS_50210 8580 7417 CDS product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_50210 10829 8742 gene locus_tag LOCUS_50220 10829 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 11662 10961 gene locus_tag LOCUS_50230 11662 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056209.1 protein_id gnl|my_center|LOCUS_50230 12350 13234 gene locus_tag LOCUS_50240 12350 13234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228704.1 protein_id gnl|my_center|LOCUS_50240 13789 16287 gene locus_tag LOCUS_50250 gene mutS2 13789 16287 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJD6 protein_id gnl|my_center|LOCUS_50250 >Feature sequence149 344 156 gene locus_tag LOCUS_50260 344 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 2546 510 gene locus_tag LOCUS_50270 2546 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 3384 2845 gene locus_tag LOCUS_50280 3384 2845 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_50280 6068 3660 gene locus_tag LOCUS_50290 6068 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 6893 6216 gene locus_tag LOCUS_50300 6893 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 7493 7251 gene locus_tag LOCUS_50310 7493 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142102.1 protein_id gnl|my_center|LOCUS_50310 8400 7813 gene locus_tag LOCUS_50320 8400 7813 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_50320 10450 8513 gene locus_tag LOCUS_50330 10450 8513 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_50330 10726 10944 gene locus_tag LOCUS_50340 10726 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 12586 11363 gene locus_tag LOCUS_50350 12586 11363 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056970.1 protein_id gnl|my_center|LOCUS_50350 14899 12812 gene locus_tag LOCUS_50360 14899 12812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 15554 16273 gene locus_tag LOCUS_50370 15554 16273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 >Feature sequence150 479 1360 gene locus_tag LOCUS_50380 479 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 2602 1526 gene locus_tag LOCUS_50390 2602 1526 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057332.1 protein_id gnl|my_center|LOCUS_50390 2801 2646 gene locus_tag LOCUS_50400 2801 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 3118 2849 gene locus_tag LOCUS_50410 3118 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 3908 8464 gene locus_tag LOCUS_50420 3908 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 9410 8700 gene locus_tag LOCUS_50430 9410 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 9826 9569 gene locus_tag LOCUS_50440 9826 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 10304 10104 gene locus_tag LOCUS_50450 10304 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 11799 10672 gene locus_tag LOCUS_50460 11799 10672 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_50460 11902 13377 gene locus_tag LOCUS_50470 gene cysS 11902 13377 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW6 protein_id gnl|my_center|LOCUS_50470 13574 14608 gene locus_tag LOCUS_50480 13574 14608 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192663.1 protein_id gnl|my_center|LOCUS_50480 15869 14856 gene locus_tag LOCUS_50490 15869 14856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 >Feature sequence151 1664 675 gene locus_tag LOCUS_50500 gene yedY 1664 675 CDS product mononuclear molybdenum enzyme YedY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_50500 1947 2333 gene locus_tag LOCUS_50510 1947 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 3448 2354 gene locus_tag LOCUS_50520 gene pdxA 3448 2354 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLZ9 protein_id gnl|my_center|LOCUS_50520 3943 4920 gene locus_tag LOCUS_50530 gene ycf39 3943 4920 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056703.1 protein_id gnl|my_center|LOCUS_50530 5146 6069 gene locus_tag LOCUS_50540 gene nadK1 5146 6069 CDS product NAD kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK1 protein_id gnl|my_center|LOCUS_50540 6265 7902 gene locus_tag LOCUS_50550 6265 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142439.1 protein_id gnl|my_center|LOCUS_50550 8984 7944 gene locus_tag LOCUS_50560 gene purM 8984 7944 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY2 protein_id gnl|my_center|LOCUS_50560 9552 10634 gene locus_tag LOCUS_50570 9552 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 11479 12264 gene locus_tag LOCUS_50580 11479 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 12381 13937 gene locus_tag LOCUS_50590 gene panC/cmk 12381 13937 CDS product bifunctional pantoate ligase/cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG73 protein_id gnl|my_center|LOCUS_50590 14067 14984 gene locus_tag LOCUS_50600 14067 14984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 >Feature sequence152 813 1613 gene locus_tag LOCUS_50610 813 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 1721 3988 gene locus_tag LOCUS_50620 1721 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 4271 4471 gene locus_tag LOCUS_50630 4271 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 6410 4758 gene locus_tag LOCUS_50640 6410 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141468.1 protein_id gnl|my_center|LOCUS_50640 6679 6751 gene locus_tag LOCUS_t00520 6679 6751 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7398 6886 gene locus_tag LOCUS_50650 7398 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 7784 7458 gene locus_tag LOCUS_50660 7784 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142926.1 protein_id gnl|my_center|LOCUS_50660 10638 8029 gene locus_tag LOCUS_50670 10638 8029 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL06 protein_id gnl|my_center|LOCUS_50670 11257 10832 gene locus_tag LOCUS_50680 11257 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056168.1 protein_id gnl|my_center|LOCUS_50680 11694 11512 gene locus_tag LOCUS_50690 11694 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 12456 15026 gene locus_tag LOCUS_50700 12456 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 >Feature sequence153 911 276 gene locus_tag LOCUS_50710 911 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_50710 2184 1171 gene locus_tag LOCUS_50720 2184 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 2624 2998 gene locus_tag LOCUS_50730 2624 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 3022 3771 gene locus_tag LOCUS_50740 3022 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259509.1 protein_id gnl|my_center|LOCUS_50740 8071 3884 gene locus_tag LOCUS_50750 8071 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 10421 8259 gene locus_tag LOCUS_50760 10421 8259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258039.1 protein_id gnl|my_center|LOCUS_50760 10954 12369 gene locus_tag LOCUS_50770 10954 12369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 12909 12565 gene locus_tag LOCUS_50780 12909 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 13199 12912 gene locus_tag LOCUS_50790 13199 12912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 14307 15263 gene locus_tag LOCUS_50800 14307 15263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 >Feature sequence154 1988 156 gene locus_tag LOCUS_50810 1988 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 2753 3574 gene locus_tag LOCUS_50820 2753 3574 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_50820 4033 4551 gene locus_tag LOCUS_50830 4033 4551 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 protein_id gnl|my_center|LOCUS_50830 4640 6265 gene locus_tag LOCUS_50840 gene leuA 4640 6265 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ32 protein_id gnl|my_center|LOCUS_50840 6778 7308 gene locus_tag LOCUS_50850 6778 7308 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140022.1 protein_id gnl|my_center|LOCUS_50850 7986 7624 gene locus_tag LOCUS_50860 gene mazf9 7986 7624 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P779 protein_id gnl|my_center|LOCUS_50860 8257 7991 gene locus_tag LOCUS_50870 8257 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 8544 8777 gene locus_tag LOCUS_50880 8544 8777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 9516 10805 gene locus_tag LOCUS_50890 9516 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 11258 14383 gene locus_tag LOCUS_50900 11258 14383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 14795 14331 gene locus_tag LOCUS_50910 14795 14331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 15206 14883 gene locus_tag LOCUS_50920 15206 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 >Feature sequence155 2647 1913 gene locus_tag LOCUS_50930 2647 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258024.1 protein_id gnl|my_center|LOCUS_50930 3554 3030 gene locus_tag LOCUS_50940 3554 3030 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_50940 5382 3718 gene locus_tag LOCUS_50950 5382 3718 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258022.1 protein_id gnl|my_center|LOCUS_50950 5885 6886 gene locus_tag LOCUS_50960 5885 6886 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143431.1 protein_id gnl|my_center|LOCUS_50960 7080 7868 gene locus_tag LOCUS_50970 7080 7868 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143432.1 protein_id gnl|my_center|LOCUS_50970 7908 8870 gene locus_tag LOCUS_50980 7908 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 8973 9044 gene locus_tag LOCUS_t00530 8973 9044 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9080 9286 gene locus_tag LOCUS_50990 9080 9286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 9716 9393 gene locus_tag LOCUS_51000 9716 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 10510 9908 gene locus_tag LOCUS_51010 10510 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 11855 10854 gene locus_tag LOCUS_51020 gene yjgB 11855 10854 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_51020 >Feature sequence156 1134 307 gene locus_tag LOCUS_51030 1134 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141358.1 protein_id gnl|my_center|LOCUS_51030 1834 2382 gene locus_tag LOCUS_51040 1834 2382 CDS product pili assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056853.1 protein_id gnl|my_center|LOCUS_51040 2576 5173 gene locus_tag LOCUS_51050 2576 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 6034 5696 gene locus_tag LOCUS_51060 6034 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 6372 6563 gene locus_tag LOCUS_51070 6372 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 6820 7419 gene locus_tag LOCUS_51080 6820 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142575.1 protein_id gnl|my_center|LOCUS_51080 7615 8370 gene locus_tag LOCUS_51090 7615 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 protein_id gnl|my_center|LOCUS_51090 8568 9359 gene locus_tag LOCUS_51100 gene gst 8568 9359 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124285.1 protein_id gnl|my_center|LOCUS_51100 9443 9655 gene locus_tag LOCUS_51110 9443 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 9666 11381 gene locus_tag LOCUS_51120 9666 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057930.1 protein_id gnl|my_center|LOCUS_51120 11826 12668 gene locus_tag LOCUS_51130 11826 12668 CDS product primosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057597.1 protein_id gnl|my_center|LOCUS_51130 12937 14868 gene locus_tag LOCUS_51140 12937 14868 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140600.1 protein_id gnl|my_center|LOCUS_51140 >Feature sequence157 883 353 gene locus_tag LOCUS_51150 883 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 1385 2530 gene locus_tag LOCUS_51160 1385 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_51160 3396 3043 gene locus_tag LOCUS_51170 3396 3043 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL6 protein_id gnl|my_center|LOCUS_51170 3754 4581 gene locus_tag LOCUS_51180 gene dapB 3754 4581 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH2 protein_id gnl|my_center|LOCUS_51180 4741 5442 gene locus_tag LOCUS_51190 4741 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056056.1 protein_id gnl|my_center|LOCUS_51190 6554 5502 gene locus_tag LOCUS_51200 gene dnaJ 6554 5502 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057983.1 protein_id gnl|my_center|LOCUS_51200 8839 6824 gene locus_tag LOCUS_51210 gene dnaK3 8839 6824 CDS product chaperone protein dnaK3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH10 protein_id gnl|my_center|LOCUS_51210 9258 10241 gene locus_tag LOCUS_51220 9258 10241 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_51220 10479 11873 gene locus_tag LOCUS_51230 gene secD 10479 11873 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB8 protein_id gnl|my_center|LOCUS_51230 12257 13258 gene locus_tag LOCUS_51240 gene secF 12257 13258 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB9 protein_id gnl|my_center|LOCUS_51240 13285 13689 gene locus_tag LOCUS_51250 13285 13689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056714.1 protein_id gnl|my_center|LOCUS_51250 14617 13691 gene locus_tag LOCUS_51260 14617 13691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 >Feature sequence158 298 798 gene locus_tag LOCUS_51270 298 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 2364 1153 gene locus_tag LOCUS_51280 2364 1153 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_51280 3702 2911 gene locus_tag LOCUS_51290 3702 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 4899 4276 gene locus_tag LOCUS_51300 4899 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 6588 5197 gene locus_tag LOCUS_51310 gene der 6588 5197 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI1 protein_id gnl|my_center|LOCUS_51310 7797 6721 gene locus_tag LOCUS_51320 7797 6721 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_51320 8185 7787 gene locus_tag LOCUS_51330 8185 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057705.1 protein_id gnl|my_center|LOCUS_51330 8503 10722 gene locus_tag LOCUS_51340 8503 10722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 11066 10869 gene locus_tag LOCUS_51350 11066 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 11418 12353 gene locus_tag LOCUS_51360 11418 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 12359 13486 gene locus_tag LOCUS_51370 12359 13486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 14031 13579 gene locus_tag LOCUS_51380 14031 13579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 >Feature sequence159 1223 477 gene locus_tag LOCUS_51390 1223 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 1156 1386 gene locus_tag LOCUS_51400 1156 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 4120 1796 gene locus_tag LOCUS_51410 4120 1796 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056743.1 protein_id gnl|my_center|LOCUS_51410 4303 4464 gene locus_tag LOCUS_51420 4303 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 4874 4521 gene locus_tag LOCUS_51430 4874 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 5106 4864 gene locus_tag LOCUS_51440 5106 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 5465 5716 gene locus_tag LOCUS_51450 5465 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 6001 6708 gene locus_tag LOCUS_51460 6001 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 7139 6951 gene locus_tag LOCUS_51470 7139 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 7558 8001 gene locus_tag LOCUS_51480 gene hspA 7558 8001 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_51480 8474 8983 gene locus_tag LOCUS_51490 8474 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 9979 9029 gene locus_tag LOCUS_51500 9979 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 protein_id gnl|my_center|LOCUS_51500 10245 11033 gene locus_tag LOCUS_51510 10245 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 11155 11541 gene locus_tag LOCUS_51520 11155 11541 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142884.1 protein_id gnl|my_center|LOCUS_51520 13148 11538 gene locus_tag LOCUS_51530 13148 11538 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887610.1 protein_id gnl|my_center|LOCUS_51530 14046 13516 gene locus_tag LOCUS_51540 14046 13516 CDS product calcium sensor EFh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026879.1 protein_id gnl|my_center|LOCUS_51540 >Feature sequence160 303 1523 gene locus_tag LOCUS_51550 303 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 1604 2935 gene locus_tag LOCUS_51560 1604 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 6872 2964 gene locus_tag LOCUS_51570 gene cobN 6872 2964 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143069.1 protein_id gnl|my_center|LOCUS_51570 8472 6937 gene locus_tag LOCUS_51580 8472 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 9333 8617 gene locus_tag LOCUS_51590 9333 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 9571 9410 gene locus_tag LOCUS_51600 9571 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 10737 9565 gene locus_tag LOCUS_51610 10737 9565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 11655 11392 gene locus_tag LOCUS_51620 11655 11392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 11924 11733 gene locus_tag LOCUS_51630 11924 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 12025 14526 gene locus_tag LOCUS_51640 12025 14526 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM14 protein_id gnl|my_center|LOCUS_51640 >Feature sequence161 226 316 gene locus_tag LOCUS_t00540 226 316 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1684 551 gene locus_tag LOCUS_51650 1684 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 2336 3025 gene locus_tag LOCUS_51660 2336 3025 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058023.1 protein_id gnl|my_center|LOCUS_51660 3307 6099 gene locus_tag LOCUS_51670 3307 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 6240 7202 gene locus_tag LOCUS_51680 6240 7202 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP3 protein_id gnl|my_center|LOCUS_51680 7964 7182 gene locus_tag LOCUS_51690 gene cpcG2 7964 7182 CDS product phycobilisome rod-core linker polypeptide CpcG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50040 protein_id gnl|my_center|LOCUS_51690 8908 8327 gene locus_tag LOCUS_51700 8908 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 9503 8865 gene locus_tag LOCUS_51710 gene ycf58 9503 8865 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD5 protein_id gnl|my_center|LOCUS_51710 10002 10169 gene locus_tag LOCUS_51720 10002 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 >Feature sequence162 3324 4427 gene locus_tag LOCUS_51730 3324 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 5318 4554 gene locus_tag LOCUS_51740 5318 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141492.1 protein_id gnl|my_center|LOCUS_51740 8295 5464 gene locus_tag LOCUS_51750 8295 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140732.1 protein_id gnl|my_center|LOCUS_51750 9328 9020 gene locus_tag LOCUS_51760 9328 9020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_51760 9699 10079 gene locus_tag LOCUS_51770 9699 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 10249 11412 gene locus_tag LOCUS_51780 gene purK 10249 11412 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJG7 protein_id gnl|my_center|LOCUS_51780 13820 11529 gene locus_tag LOCUS_51790 13820 11529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 >Feature sequence163 221 1033 gene locus_tag LOCUS_51800 221 1033 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124685.1 protein_id gnl|my_center|LOCUS_51800 1269 1189 gene locus_tag LOCUS_t00550 1269 1189 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1554 2900 gene locus_tag LOCUS_51810 gene accC 1554 2900 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_51810 3393 3950 gene locus_tag LOCUS_51820 3393 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 4315 4031 gene locus_tag LOCUS_51830 4315 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057417.1 protein_id gnl|my_center|LOCUS_51830 5026 6015 gene locus_tag LOCUS_51840 5026 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 7162 6158 gene locus_tag LOCUS_51850 7162 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 8676 7627 gene locus_tag LOCUS_51860 8676 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 9189 8908 gene locus_tag LOCUS_51870 9189 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 9871 9581 gene locus_tag LOCUS_51880 9871 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 10427 10236 gene locus_tag LOCUS_51890 10427 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 10698 10501 gene locus_tag LOCUS_51900 10698 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 10969 10772 gene locus_tag LOCUS_51910 10969 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 11237 11043 gene locus_tag LOCUS_51920 11237 11043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 11774 11481 gene locus_tag LOCUS_51930 11774 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 12638 12357 gene locus_tag LOCUS_51940 12638 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 <13691 13157 gene locus_tag LOCUS_51950 <13691 13157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256001.1:HEAT repeat-containing PBS lyase >Feature sequence164 7130 2028 gene locus_tag LOCUS_51960 7130 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 7927 7367 gene locus_tag LOCUS_51970 7927 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 8309 7938 gene locus_tag LOCUS_51980 8309 7938 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_51980 9774 8533 gene locus_tag LOCUS_51990 9774 8533 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056868.1 protein_id gnl|my_center|LOCUS_51990 11626 11171 gene locus_tag LOCUS_52000 11626 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 <13521 11673 gene locus_tag LOCUS_52010 <13521 11673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056204.1:two-component hybrid sensor and regulator >Feature sequence165 916 509 gene locus_tag LOCUS_52020 916 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 1316 1588 gene locus_tag LOCUS_52030 1316 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 1569 1841 gene locus_tag LOCUS_52040 1569 1841 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481712.1 protein_id gnl|my_center|LOCUS_52040 2320 2532 gene locus_tag LOCUS_52050 2320 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 3057 2833 gene locus_tag LOCUS_52060 3057 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 3592 4941 gene locus_tag LOCUS_52070 gene lysA 3592 4941 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225484.1 protein_id gnl|my_center|LOCUS_52070 4979 5917 gene locus_tag LOCUS_52080 gene ceo 4979 5917 CDS product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZ59 protein_id gnl|my_center|LOCUS_52080 5973 7463 gene locus_tag LOCUS_52090 5973 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 7507 8199 gene locus_tag LOCUS_52100 7507 8199 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_52100 8251 8997 gene locus_tag LOCUS_52110 8251 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 10347 9502 gene locus_tag LOCUS_52120 10347 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52120 10842 11327 gene locus_tag LOCUS_52130 10842 11327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 >Feature sequence166 324 1211 gene locus_tag LOCUS_52140 324 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52140 1198 1428 gene locus_tag LOCUS_52150 1198 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 2577 1729 gene locus_tag LOCUS_52160 gene fdhD 2577 1729 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNU3 protein_id gnl|my_center|LOCUS_52160 3125 5371 gene locus_tag LOCUS_52170 3125 5371 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229107.1 protein_id gnl|my_center|LOCUS_52170 5936 5643 gene locus_tag LOCUS_52180 5936 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 6917 7873 gene locus_tag LOCUS_52190 6917 7873 CDS product isoaspartyl peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_52190 11239 8006 gene locus_tag LOCUS_52200 11239 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 12762 11395 gene locus_tag LOCUS_52210 gene glmU 12762 11395 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLT5 protein_id gnl|my_center|LOCUS_52210 >Feature sequence167 10256 4107 gene locus_tag LOCUS_52220 10256 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 <13210 10339 gene locus_tag LOCUS_52230 <13210 10339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701685.1:putative polyketide synthase >Feature sequence168 193 393 gene locus_tag LOCUS_52240 193 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 1578 982 gene locus_tag LOCUS_52250 1578 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 2314 1547 gene locus_tag LOCUS_52260 2314 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 3008 6553 gene locus_tag LOCUS_52270 3008 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_52270 6824 7078 gene locus_tag LOCUS_52280 6824 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 7155 10883 gene locus_tag LOCUS_52290 7155 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 >Feature sequence169 158 346 gene locus_tag LOCUS_52300 158 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 663 475 gene locus_tag LOCUS_52310 663 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 1924 1235 gene locus_tag LOCUS_52320 1924 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 4465 1985 gene locus_tag LOCUS_52330 4465 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 5691 4519 gene locus_tag LOCUS_52340 5691 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 7228 5696 gene locus_tag LOCUS_52350 7228 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 7572 8333 gene locus_tag LOCUS_52360 7572 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 8736 9281 gene locus_tag LOCUS_52370 gene rmlC 8736 9281 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU21 protein_id gnl|my_center|LOCUS_52370 9278 10177 gene locus_tag LOCUS_52380 gene rfbD 9278 10177 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 protein_id gnl|my_center|LOCUS_52380 10443 11516 gene locus_tag LOCUS_52390 gene rfbA 10443 11516 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_52390 11606 12703 gene locus_tag LOCUS_52400 gene rfbB 11606 12703 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGD6 protein_id gnl|my_center|LOCUS_52400 >Feature sequence170 1311 3005 gene locus_tag LOCUS_52410 1311 3005 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975934.1 protein_id gnl|my_center|LOCUS_52410 3405 4031 gene locus_tag LOCUS_52420 3405 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 6787 7545 gene locus_tag LOCUS_52430 6787 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 7843 10791 gene locus_tag LOCUS_52440 7843 10791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 10799 12409 gene locus_tag LOCUS_52450 gene rtxD 10799 12409 CDS product RTX toxin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705262.1 protein_id gnl|my_center|LOCUS_52450 12668 12892 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccattccacgatgatgcccattcca >Feature sequence171 3285 3692 gene locus_tag LOCUS_52460 3285 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 4937 4053 gene locus_tag LOCUS_52470 4937 4053 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057245.1 protein_id gnl|my_center|LOCUS_52470 5315 5479 gene locus_tag LOCUS_52480 5315 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 5909 6535 gene locus_tag LOCUS_52490 5909 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 7376 7549 gene locus_tag LOCUS_52500 7376 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 7884 8951 gene locus_tag LOCUS_52510 7884 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 9451 9278 gene locus_tag LOCUS_52520 9451 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 9563 10207 gene locus_tag LOCUS_52530 9563 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 10285 11538 gene locus_tag LOCUS_52540 10285 11538 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_769989.2 protein_id gnl|my_center|LOCUS_52540 11558 11935 gene locus_tag LOCUS_52550 gene ectC 11558 11935 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZL6 protein_id gnl|my_center|LOCUS_52550 11955 12299 gene locus_tag LOCUS_52560 11955 12299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 >Feature sequence172 1049 378 gene locus_tag LOCUS_52570 gene plsY 1049 378 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNE0 protein_id gnl|my_center|LOCUS_52570 2512 1271 gene locus_tag LOCUS_52580 2512 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 2968 2582 gene locus_tag LOCUS_52590 2968 2582 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056952.1 protein_id gnl|my_center|LOCUS_52590 3257 3169 gene locus_tag LOCUS_t00560 3257 3169 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5842 3482 gene locus_tag LOCUS_52600 gene comE 5842 3482 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057539.1 protein_id gnl|my_center|LOCUS_52600 6228 5842 gene locus_tag LOCUS_52610 6228 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 7832 6939 gene locus_tag LOCUS_52620 7832 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 8318 9172 gene locus_tag LOCUS_52630 8318 9172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 10618 9287 gene locus_tag LOCUS_52640 10618 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 11319 10714 gene locus_tag LOCUS_52650 11319 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 >Feature sequence173 2345 351 gene locus_tag LOCUS_52660 2345 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 3589 3738 gene locus_tag LOCUS_52670 3589 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 4262 3744 gene locus_tag LOCUS_52680 4262 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 5227 4334 gene locus_tag LOCUS_52690 gene argB 5227 4334 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59303 protein_id gnl|my_center|LOCUS_52690 6901 8997 gene locus_tag LOCUS_52700 6901 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 9018 9467 gene locus_tag LOCUS_52710 9018 9467 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_52710 9470 10795 gene locus_tag LOCUS_52720 9470 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 11768 10941 gene locus_tag LOCUS_52730 11768 10941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 >Feature sequence174 421 840 gene locus_tag LOCUS_52740 421 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_52740 1145 1408 gene locus_tag LOCUS_52750 1145 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058048.1 protein_id gnl|my_center|LOCUS_52750 1989 1588 gene locus_tag LOCUS_52760 1989 1588 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL47 protein_id gnl|my_center|LOCUS_52760 2149 2892 gene locus_tag LOCUS_52770 2149 2892 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705617.1 protein_id gnl|my_center|LOCUS_52770 3421 2978 gene locus_tag LOCUS_52780 3421 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 5116 4736 gene locus_tag LOCUS_52790 5116 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 6334 5132 gene locus_tag LOCUS_52800 6334 5132 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706450.1 protein_id gnl|my_center|LOCUS_52800 7665 6688 gene locus_tag LOCUS_52810 7665 6688 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_52810 8502 9539 gene locus_tag LOCUS_52820 gene ssuA 8502 9539 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230639.1 protein_id gnl|my_center|LOCUS_52820 9615 10433 gene locus_tag LOCUS_52830 9615 10433 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140177.1 protein_id gnl|my_center|LOCUS_52830 10726 11517 gene locus_tag LOCUS_52840 10726 11517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140178.1 protein_id gnl|my_center|LOCUS_52840 >Feature sequence175 252 1373 gene locus_tag LOCUS_52850 252 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121691.1 protein_id gnl|my_center|LOCUS_52850 1370 2335 gene locus_tag LOCUS_52860 1370 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142445.1 protein_id gnl|my_center|LOCUS_52860 2347 3642 gene locus_tag LOCUS_52870 2347 3642 CDS product devB secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_52870 4230 3730 gene locus_tag LOCUS_52880 4230 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 5320 4811 gene locus_tag LOCUS_52890 5320 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 6102 5332 gene locus_tag LOCUS_52900 6102 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 6571 7869 gene locus_tag LOCUS_52910 gene eno 6571 7869 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL40 protein_id gnl|my_center|LOCUS_52910 9174 8113 gene locus_tag LOCUS_52920 gene argC 9174 8113 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59312 protein_id gnl|my_center|LOCUS_52920 9748 11427 gene locus_tag LOCUS_52930 gene ribA 9748 11427 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI64 protein_id gnl|my_center|LOCUS_52930 >Feature sequence176 814 308 gene locus_tag LOCUS_52940 814 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 1893 1093 gene locus_tag LOCUS_52950 1893 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 2565 2254 gene locus_tag LOCUS_52960 2565 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 2750 3778 gene locus_tag LOCUS_52970 2750 3778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_52970 4077 4874 gene locus_tag LOCUS_52980 4077 4874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057314.1 protein_id gnl|my_center|LOCUS_52980 5229 6149 gene locus_tag LOCUS_52990 5229 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703787.1 protein_id gnl|my_center|LOCUS_52990 8058 6142 gene locus_tag LOCUS_53000 8058 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 8846 10333 gene locus_tag LOCUS_53010 8846 10333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_53010 10501 11136 gene locus_tag LOCUS_53020 10501 11136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142966.1 protein_id gnl|my_center|LOCUS_53020 >Feature sequence177 325 1515 gene locus_tag LOCUS_53030 325 1515 CDS product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 protein_id gnl|my_center|LOCUS_53030 1979 1557 gene locus_tag LOCUS_53040 1979 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 3197 3664 gene locus_tag LOCUS_53050 gene smpB 3197 3664 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM0 protein_id gnl|my_center|LOCUS_53050 5036 3801 gene locus_tag LOCUS_53060 5036 3801 CDS product putative bicarbonate transporter, IctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058082.1 protein_id gnl|my_center|LOCUS_53060 7090 5504 gene locus_tag LOCUS_53070 7090 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 8041 7280 gene locus_tag LOCUS_53080 gene ycf53 8041 7280 CDS product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057433.1 protein_id gnl|my_center|LOCUS_53080 9029 8541 gene locus_tag LOCUS_53090 9029 8541 CDS product cytidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057432.1 protein_id gnl|my_center|LOCUS_53090 10882 10460 gene locus_tag LOCUS_53100 10882 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53100 >Feature sequence178 1093 158 gene locus_tag LOCUS_53110 1093 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 2827 1223 gene locus_tag LOCUS_53120 2827 1223 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 protein_id gnl|my_center|LOCUS_53120 3164 4522 gene locus_tag LOCUS_53130 3164 4522 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_53130 4524 5408 gene locus_tag LOCUS_53140 4524 5408 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057658.1 protein_id gnl|my_center|LOCUS_53140 6181 5411 gene locus_tag LOCUS_53150 6181 5411 CDS product sporulation-control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486625.1 protein_id gnl|my_center|LOCUS_53150 7786 6512 gene locus_tag LOCUS_53160 7786 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 8243 8416 gene locus_tag LOCUS_53170 8243 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 10556 8376 gene locus_tag LOCUS_53180 10556 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 >Feature sequence179 497 1885 gene locus_tag LOCUS_53190 497 1885 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038655.1 protein_id gnl|my_center|LOCUS_53190 4682 1941 gene locus_tag LOCUS_53200 4682 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 6178 4892 gene locus_tag LOCUS_53210 6178 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 7711 6935 gene locus_tag LOCUS_53220 7711 6935 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141462.1 protein_id gnl|my_center|LOCUS_53220 9867 8083 gene locus_tag LOCUS_53230 9867 8083 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_53230 >Feature sequence180 381 1820 gene locus_tag LOCUS_53240 gene crtQ 381 1820 CDS product Zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY9 protein_id gnl|my_center|LOCUS_53240 1843 2283 gene locus_tag LOCUS_53250 1843 2283 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 protein_id gnl|my_center|LOCUS_53250 3404 2496 gene locus_tag LOCUS_53260 gene lipA2 3404 2496 CDS product lipoyl synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLC2 protein_id gnl|my_center|LOCUS_53260 5505 4819 gene locus_tag LOCUS_53270 5505 4819 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939178.1 protein_id gnl|my_center|LOCUS_53270 5793 6380 gene locus_tag LOCUS_53280 5793 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869506.1 protein_id gnl|my_center|LOCUS_53280 7290 6664 gene locus_tag LOCUS_53290 7290 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 protein_id gnl|my_center|LOCUS_53290 8473 7616 gene locus_tag LOCUS_53300 8473 7616 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701079.1 protein_id gnl|my_center|LOCUS_53300 8530 9396 gene locus_tag LOCUS_53310 gene parA 8530 9396 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_53310 9686 10162 gene locus_tag LOCUS_53320 9686 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 >Feature sequence181 161 463 gene locus_tag LOCUS_53330 161 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 447 2573 gene locus_tag LOCUS_53340 447 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 4022 2751 gene locus_tag LOCUS_53350 4022 2751 CDS product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056562.1 protein_id gnl|my_center|LOCUS_53350 4238 4486 gene locus_tag LOCUS_53360 gene ycf34 4238 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 protein_id gnl|my_center|LOCUS_53360 4713 5342 gene locus_tag LOCUS_53370 4713 5342 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141508.1 protein_id gnl|my_center|LOCUS_53370 6620 5418 gene locus_tag LOCUS_53380 gene argG 6620 5418 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY7 protein_id gnl|my_center|LOCUS_53380 7928 6702 gene locus_tag LOCUS_53390 7928 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 8558 8082 gene locus_tag LOCUS_53400 8558 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 9980 8673 gene locus_tag LOCUS_53410 9980 8673 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_53410 >Feature sequence182 1446 2846 gene locus_tag LOCUS_53420 1446 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 5760 2953 gene locus_tag LOCUS_53430 5760 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 8008 6125 gene locus_tag LOCUS_53440 8008 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 8736 8290 gene locus_tag LOCUS_53450 8736 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 9204 9410 gene locus_tag LOCUS_53460 9204 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 >Feature sequence183 983 174 gene locus_tag LOCUS_53470 983 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143458.1 protein_id gnl|my_center|LOCUS_53470 2315 1239 gene locus_tag LOCUS_53480 gene acsF1 2315 1239 CDS product magnesium-protoporphyrin IX monomethyl ester [oxidative] cyclase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ05 protein_id gnl|my_center|LOCUS_53480 3129 3467 gene locus_tag LOCUS_53490 3129 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 4955 3687 gene locus_tag LOCUS_53500 4955 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 5244 5426 gene locus_tag LOCUS_53510 5244 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 6359 7351 gene locus_tag LOCUS_53520 6359 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 8953 7499 gene locus_tag LOCUS_53530 gene sun 8953 7499 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB2 protein_id gnl|my_center|LOCUS_53530 9290 9742 gene locus_tag LOCUS_53540 9290 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 >Feature sequence184 672 1205 gene locus_tag LOCUS_53550 672 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 1440 3128 gene locus_tag LOCUS_53560 1440 3128 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057909.1 protein_id gnl|my_center|LOCUS_53560 5262 3157 gene locus_tag LOCUS_53570 5262 3157 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056593.1 protein_id gnl|my_center|LOCUS_53570 7715 5430 gene locus_tag LOCUS_53580 7715 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057041.1 protein_id gnl|my_center|LOCUS_53580 9408 8140 gene locus_tag LOCUS_53590 9408 8140 CDS product sucrose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143828.1 protein_id gnl|my_center|LOCUS_53590 >Feature sequence185 9806 4080 gene locus_tag LOCUS_53600 9806 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 >Feature sequence186 680 3226 gene locus_tag LOCUS_53610 680 3226 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS5 protein_id gnl|my_center|LOCUS_53610 3676 4578 gene locus_tag LOCUS_53620 3676 4578 CDS product heparan sulfate glucosamine 3-O-sulfotransferase 3B1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887312.1 protein_id gnl|my_center|LOCUS_53620 4671 4598 gene locus_tag LOCUS_t00570 4671 4598 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5101 7743 gene locus_tag LOCUS_53630 5101 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 7819 8595 gene locus_tag LOCUS_53640 7819 8595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055914.1 protein_id gnl|my_center|LOCUS_53640 9124 8705 gene locus_tag LOCUS_53650 9124 8705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 >Feature sequence187 1354 626 gene locus_tag LOCUS_53660 gene purC 1354 626 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIT5 protein_id gnl|my_center|LOCUS_53660 1689 1910 gene locus_tag LOCUS_53670 1689 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 4513 1931 gene locus_tag LOCUS_53680 4513 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53680 6120 4987 gene locus_tag LOCUS_53690 6120 4987 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_53690 7002 6382 gene locus_tag LOCUS_53700 gene cpcT 7002 6382 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH04 protein_id gnl|my_center|LOCUS_53700 8422 7262 gene locus_tag LOCUS_53710 8422 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057862.1 protein_id gnl|my_center|LOCUS_53710 9090 8848 gene locus_tag LOCUS_53720 9090 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 >Feature sequence188 2307 6725 gene locus_tag LOCUS_53730 2307 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 7259 7050 gene locus_tag LOCUS_53740 7259 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 7731 7246 gene locus_tag LOCUS_53750 7731 7246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002249008.2 protein_id gnl|my_center|LOCUS_53750 >Feature sequence189 1373 453 gene locus_tag LOCUS_53760 1373 453 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483085.1 protein_id gnl|my_center|LOCUS_53760 1899 1699 gene locus_tag LOCUS_53770 1899 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 3168 2308 gene locus_tag LOCUS_53780 3168 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087510.1 protein_id gnl|my_center|LOCUS_53780 4721 3600 gene locus_tag LOCUS_53790 4721 3600 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 protein_id gnl|my_center|LOCUS_53790 6827 5091 gene locus_tag LOCUS_53800 6827 5091 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_53800 8078 7596 gene locus_tag LOCUS_53810 8078 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 >Feature sequence190 191 622 gene locus_tag LOCUS_53820 191 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 4213 911 gene locus_tag LOCUS_53830 4213 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141913.1 protein_id gnl|my_center|LOCUS_53830 5667 4255 gene locus_tag LOCUS_53840 gene murD 5667 4255 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN8 protein_id gnl|my_center|LOCUS_53840 6521 5895 gene locus_tag LOCUS_53850 6521 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141284.1 protein_id gnl|my_center|LOCUS_53850 7253 7705 gene locus_tag LOCUS_53860 7253 7705 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_53860 >Feature sequence191 972 658 gene locus_tag LOCUS_53870 972 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 1316 1167 gene locus_tag LOCUS_53880 1316 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 2713 6417 gene locus_tag LOCUS_53890 2713 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 7085 6549 gene locus_tag LOCUS_53900 7085 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_53900 >Feature sequence192 513 4622 gene locus_tag LOCUS_53910 513 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 5258 4941 gene locus_tag LOCUS_53920 5258 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_53920 5497 6039 gene locus_tag LOCUS_53930 gene petC 5497 6039 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N8 protein_id gnl|my_center|LOCUS_53930 6178 7143 gene locus_tag LOCUS_53940 gene petA 6178 7143 CDS product cytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N5 protein_id gnl|my_center|LOCUS_53940 7356 7547 gene locus_tag LOCUS_53950 7356 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 >Feature sequence193 249 1421 gene locus_tag LOCUS_53960 249 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 2310 1723 gene locus_tag LOCUS_53970 2310 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 2896 2363 gene locus_tag LOCUS_53980 2896 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 3643 3050 gene locus_tag LOCUS_53990 3643 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 4158 7772 gene locus_tag LOCUS_54000 4158 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 >Feature sequence194 24 125 gene locus_tag LOCUS_r00010 24 125 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1078 290 gene locus_tag LOCUS_54010 1078 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 2609 1239 gene locus_tag LOCUS_54020 2609 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140772.1 protein_id gnl|my_center|LOCUS_54020 3287 3084 gene locus_tag LOCUS_54030 3287 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144412.1 protein_id gnl|my_center|LOCUS_54030 4182 3619 gene locus_tag LOCUS_54040 gene def 4182 3619 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIB4 protein_id gnl|my_center|LOCUS_54040 4610 5521 gene locus_tag LOCUS_54050 4610 5521 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMW7 protein_id gnl|my_center|LOCUS_54050 5688 6542 gene locus_tag LOCUS_54060 5688 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141575.1 protein_id gnl|my_center|LOCUS_54060 7411 6749 gene locus_tag LOCUS_54070 7411 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 >Feature sequence195 1230 2225 gene locus_tag LOCUS_54080 gene ntcB 1230 2225 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057199.1 protein_id gnl|my_center|LOCUS_54080 2256 3353 gene locus_tag LOCUS_54090 2256 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057198.1 protein_id gnl|my_center|LOCUS_54090 3946 3440 gene locus_tag LOCUS_54100 3946 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 4293 4988 gene locus_tag LOCUS_54110 4293 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 6154 5432 gene locus_tag LOCUS_54120 6154 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 >Feature sequence196 305 517 gene locus_tag LOCUS_54130 305 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 2925 541 gene locus_tag LOCUS_54140 2925 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 4209 2995 gene locus_tag LOCUS_54150 4209 2995 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259616.1 protein_id gnl|my_center|LOCUS_54150 6020 4791 gene locus_tag LOCUS_54160 6020 4791 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_54160 6317 7276 gene locus_tag LOCUS_54170 6317 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 >Feature sequence197 804 1259 gene locus_tag LOCUS_54180 804 1259 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_54180 1360 2145 gene locus_tag LOCUS_54190 1360 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 2641 3318 gene locus_tag LOCUS_54200 2641 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 5179 4238 gene locus_tag LOCUS_54210 5179 4238 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020472.1 protein_id gnl|my_center|LOCUS_54210 5504 6277 gene locus_tag LOCUS_54220 5504 6277 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974250.1 protein_id gnl|my_center|LOCUS_54220 >Feature sequence198 361 179 gene locus_tag LOCUS_54230 361 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54230 968 1933 gene locus_tag LOCUS_54240 968 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 2853 2035 gene locus_tag LOCUS_54250 gene lpxA 2853 2035 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI00 protein_id gnl|my_center|LOCUS_54250 3734 3222 gene locus_tag LOCUS_54260 gene fabZ 3734 3222 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TV98 protein_id gnl|my_center|LOCUS_54260 4751 3753 gene locus_tag LOCUS_54270 gene lpxC 4751 3753 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI02 protein_id gnl|my_center|LOCUS_54270 7218 4858 gene locus_tag LOCUS_54280 7218 4858 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057626.1 protein_id gnl|my_center|LOCUS_54280 >Feature sequence199 3 2036 gene locus_tag LOCUS_54290 3 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 2048 4630 gene locus_tag LOCUS_54300 2048 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 5129 4710 gene locus_tag LOCUS_54310 5129 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_54310 5687 5520 gene locus_tag LOCUS_54320 5687 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 6084 6809 gene locus_tag LOCUS_54330 6084 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 >Feature sequence200 5780 1386 gene locus_tag LOCUS_54340 5780 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 6314 6183 gene locus_tag LOCUS_54350 6314 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 >Feature sequence201 2774 228 gene locus_tag LOCUS_54360 2774 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 3250 4659 gene locus_tag LOCUS_54370 3250 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 5163 6311 gene locus_tag LOCUS_54380 5163 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 >Feature sequence202 348 2198 gene locus_tag LOCUS_54390 348 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 3571 2654 gene locus_tag LOCUS_54400 3571 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 4967 4569 gene locus_tag LOCUS_54410 gene vapC 4967 4569 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AB8 protein_id gnl|my_center|LOCUS_54410 5200 4964 gene locus_tag LOCUS_54420 5200 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 5494 5850 gene locus_tag LOCUS_54430 5494 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 >Feature sequence203 105 701 gene locus_tag LOCUS_54440 105 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 930 1202 gene locus_tag LOCUS_54450 930 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 1467 1183 gene locus_tag LOCUS_54460 1467 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54460 3514 2804 gene locus_tag LOCUS_54470 gene ycf29 3514 2804 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 protein_id gnl|my_center|LOCUS_54470 4196 5620 gene locus_tag LOCUS_54480 gene icd 4196 5620 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9S5 protein_id gnl|my_center|LOCUS_54480 >Feature sequence204 912 1193 gene locus_tag LOCUS_54490 912 1193 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW8 protein_id gnl|my_center|LOCUS_54490 1894 3849 gene locus_tag LOCUS_54500 1894 3849 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_54500 4147 5097 gene locus_tag LOCUS_54510 gene cysK 4147 5097 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI7 protein_id gnl|my_center|LOCUS_54510 5234 5935 gene locus_tag LOCUS_54520 5234 5935 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142393.1 protein_id gnl|my_center|LOCUS_54520 >Feature sequence205 247 1854 gene locus_tag LOCUS_54530 gene nnr 247 1854 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC3 protein_id gnl|my_center|LOCUS_54530 2242 1823 gene locus_tag LOCUS_54540 2242 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 3245 2325 gene locus_tag LOCUS_54550 3245 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143297.1 protein_id gnl|my_center|LOCUS_54550 4022 3504 gene locus_tag LOCUS_54560 4022 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 4632 4246 gene locus_tag LOCUS_54570 4632 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 4975 4778 gene locus_tag LOCUS_54580 4975 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 5176 5018 gene locus_tag LOCUS_54590 5176 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 5460 5173 gene locus_tag LOCUS_54600 5460 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 >Feature sequence206 1293 415 gene locus_tag LOCUS_54610 1293 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 2627 1788 gene locus_tag LOCUS_54620 2627 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 3438 2704 gene locus_tag LOCUS_54630 3438 2704 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932875.1 protein_id gnl|my_center|LOCUS_54630 4123 3842 gene locus_tag LOCUS_54640 4123 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 5054 5995 gene locus_tag LOCUS_54650 5054 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 >Feature sequence207 712 107 gene locus_tag LOCUS_54660 712 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 1330 3213 gene locus_tag LOCUS_54670 1330 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 3227 3898 gene locus_tag LOCUS_54680 gene bioD 3227 3898 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB5 protein_id gnl|my_center|LOCUS_54680 3944 5356 gene locus_tag LOCUS_54690 3944 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058239.1 protein_id gnl|my_center|LOCUS_54690 5685 5377 gene locus_tag LOCUS_54700 5685 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143740.1 protein_id gnl|my_center|LOCUS_54700 >Feature sequence208 3 1061 gene locus_tag LOCUS_54710 gene psbD2 3 1061 CDS product photosystem II reaction center D2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_681245.1 protein_id gnl|my_center|LOCUS_54710 1066 2427 gene locus_tag LOCUS_54720 gene psbC 1066 2427 CDS product photosystem II CP43 reaction center protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF8 protein_id gnl|my_center|LOCUS_54720 3274 2525 gene locus_tag LOCUS_54730 3274 2525 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056649.1 protein_id gnl|my_center|LOCUS_54730 4171 3680 gene locus_tag LOCUS_54740 gene tadA 4171 3680 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLR8 protein_id gnl|my_center|LOCUS_54740 5448 4462 gene locus_tag LOCUS_54750 5448 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 >Feature sequence209 695 832 gene locus_tag LOCUS_54760 695 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54760 1318 920 gene locus_tag LOCUS_54770 1318 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 2328 1393 gene locus_tag LOCUS_54780 2328 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54780 2620 2462 gene locus_tag LOCUS_54790 2620 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 4207 3356 gene locus_tag LOCUS_54800 4207 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 5300 4464 gene locus_tag LOCUS_54810 5300 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 >Feature sequence210 1025 1351 gene locus_tag LOCUS_54820 1025 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 5116 1673 gene locus_tag LOCUS_54830 5116 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 >Feature sequence211 437 817 gene locus_tag LOCUS_54840 437 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 1842 964 gene locus_tag LOCUS_54850 1842 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056085.1 protein_id gnl|my_center|LOCUS_54850 3211 2129 gene locus_tag LOCUS_54860 3211 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 4205 3324 gene locus_tag LOCUS_54870 4205 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056085.1 protein_id gnl|my_center|LOCUS_54870 5111 4515 gene locus_tag LOCUS_54880 5111 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 >Feature sequence212 <1 772 gene locus_tag LOCUS_54890 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528925.1:gluconolactonase 1692 892 gene locus_tag LOCUS_54900 1692 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 2603 1791 gene locus_tag LOCUS_54910 2603 1791 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546523.1 protein_id gnl|my_center|LOCUS_54910 3231 2725 gene locus_tag LOCUS_54920 3231 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 >Feature sequence213 640 1569 gene locus_tag LOCUS_54930 640 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476068.1 protein_id gnl|my_center|LOCUS_54930 1727 4930 gene locus_tag LOCUS_54940 1727 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 >Feature sequence214 1229 2839 gene locus_tag LOCUS_54950 1229 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 <4970 2943 gene locus_tag LOCUS_54960 <4970 2943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057813.1:CHAT domain-containing protein >Feature sequence215 1227 2705 gene locus_tag LOCUS_54970 gene pepA 1227 2705 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI46 protein_id gnl|my_center|LOCUS_54970 3861 3460 gene locus_tag LOCUS_54980 3861 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 4144 3845 gene locus_tag LOCUS_54990 4144 3845 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_54990 >Feature sequence216 1483 971 gene locus_tag LOCUS_55000 1483 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55000 3552 2293 gene locus_tag LOCUS_55010 3552 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 >Feature sequence217 189 608 gene locus_tag LOCUS_55020 189 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 707 2206 gene locus_tag LOCUS_55030 gene betA 707 2206 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230760.1 protein_id gnl|my_center|LOCUS_55030 2449 3036 gene locus_tag LOCUS_55040 2449 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 >Feature sequence218 420 1634 gene locus_tag LOCUS_55050 420 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 1641 1847 gene locus_tag LOCUS_55060 1641 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 2489 1884 gene locus_tag LOCUS_55070 2489 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_55070 2661 4376 gene locus_tag LOCUS_55080 2661 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 >Feature sequence219 398 114 gene locus_tag LOCUS_55090 398 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 1704 829 gene locus_tag LOCUS_55100 1704 829 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038034.1 protein_id gnl|my_center|LOCUS_55100 2034 2582 gene locus_tag LOCUS_55110 2034 2582 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477143.1 protein_id gnl|my_center|LOCUS_55110 2623 3444 gene locus_tag LOCUS_55120 2623 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 >Feature sequence220 <4433 1064 gene locus_tag LOCUS_55130 <4433 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147038.1:hemagglutinin >Feature sequence221 1504 173 gene locus_tag LOCUS_55140 1504 173 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_55140 2048 1509 gene locus_tag LOCUS_55150 2048 1509 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_55150 4082 3774 gene locus_tag LOCUS_55160 4082 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 >Feature sequence222 154 387 gene locus_tag LOCUS_55170 154 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 >Feature sequence223 50 223 gene locus_tag LOCUS_55180 50 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 703 1047 gene locus_tag LOCUS_55190 703 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 1049 2689 gene locus_tag LOCUS_55200 1049 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 3553 3726 gene locus_tag LOCUS_55210 3553 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 >Feature sequence224 463 179 gene locus_tag LOCUS_55220 463 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 3170 1746 gene locus_tag LOCUS_55230 gene phrA 3170 1746 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056280.1 protein_id gnl|my_center|LOCUS_55230 3714 3163 gene locus_tag LOCUS_55240 3714 3163 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056278.1 protein_id gnl|my_center|LOCUS_55240 >Feature sequence225 3297 3554 gene locus_tag LOCUS_55250 3297 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 >Feature sequence226 1187 303 gene locus_tag LOCUS_55260 1187 303 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096645.1 protein_id gnl|my_center|LOCUS_55260 1832 2056 gene locus_tag LOCUS_55270 1832 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 2108 3079 gene locus_tag LOCUS_55280 2108 3079 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_55280 >Feature sequence227 616 224 gene locus_tag LOCUS_55290 616 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 1121 840 gene locus_tag LOCUS_55300 1121 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 1935 1441 gene locus_tag LOCUS_55310 1935 1441 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142184.1 protein_id gnl|my_center|LOCUS_55310 3202 2324 gene locus_tag LOCUS_55320 3202 2324 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_55320 >Feature sequence228 3464 942 gene locus_tag LOCUS_55330 3464 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 >Feature sequence229 211 399 gene locus_tag LOCUS_55340 211 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55340 578 336 gene locus_tag LOCUS_55350 578 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 1038 550 gene locus_tag LOCUS_55360 1038 550 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141835.1 protein_id gnl|my_center|LOCUS_55360 2975 1731 gene locus_tag LOCUS_55370 2975 1731 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058122.1 protein_id gnl|my_center|LOCUS_55370 >Feature sequence230 >Feature sequence231 1414 713 gene locus_tag LOCUS_55380 1414 713 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_55380 1684 1454 gene locus_tag LOCUS_55390 1684 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 1569 2429 gene locus_tag LOCUS_55400 1569 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 >Feature sequence232 715 356 gene locus_tag LOCUS_55410 715 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 1378 725 gene locus_tag LOCUS_55420 1378 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 >Feature sequence233 493 260 gene locus_tag LOCUS_55430 493 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 792 1040 gene locus_tag LOCUS_55440 792 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 1033 1302 gene locus_tag LOCUS_55450 1033 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55450 2143 1985 gene locus_tag LOCUS_55460 2143 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55460 >Feature sequence234 1560 1769 gene locus_tag LOCUS_55470 1560 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 >Feature sequence235 487 275 gene locus_tag LOCUS_55480 487 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55480 813 1196 gene locus_tag LOCUS_55490 813 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 1320 1532 gene locus_tag LOCUS_55500 1320 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 1537 1767 gene locus_tag LOCUS_55510 1537 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 >Feature sequence236 361 957 gene locus_tag LOCUS_55520 361 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55520 1297 1860 gene locus_tag LOCUS_55530 1297 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530