COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..54852 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 288..1187 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215568.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1432..3333) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889030.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(3526..15090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 note possible pseudo, internal stop codon, frameshifted CDS complement(15402..17321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(17449..18723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(19061..20026) product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(19995..20798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(21855..23741) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW7 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene ftsH CDS complement(24234..24722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(25119..26570) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI5 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene gltX tRNA complement(26943..27016) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 27357..27839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(28004..29614) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056298.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(30483..31658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142879.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(32102..33703) product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 34260..35543 product cysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 35696..36784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 37014..37271 product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WE6 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 37268..37660 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887146.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(37785..38417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142166.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(38726..39634) product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(39785..40750) product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM6 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene ribF CDS complement(41043..41939) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(42223..43020) product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI06 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene surE CDS 43418..44422 product protochlorophyllide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene por CDS 45015..45248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 45302..45688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 45849..46859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(46988..47641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869506.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(48079..49269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125209.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 49884..50927 product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN07 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene aroF CDS complement(50961..51152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 51384..51863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709739.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 52142..53200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 53735..54826 product putative potassium channel protein YugO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q795M8 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene yugO sequence002 source 1..50939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 355..2946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 3082..4113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056254.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(4491..5135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 6308..7003 product aldehyde decarbonylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB4 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 7151..8170 product long-chain acyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 8563..9543 product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB6 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene accA CDS complement(9854..10483) product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP3 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene trpF CDS 10606..10857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 11267..12463 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057144.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 12648..13709 product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK51 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene cbiD CDS 13783..14349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 14954..15394 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene hspA CDS 15783..16520 product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390736.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(16876..17151) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(17329..18633) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056826.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene thrC CDS 20044..22776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968588.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 22902..23468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 24024..25586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 25583..30775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 30910..33057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(33139..33576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 34540..38610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 38940..40673 product putative diflavin flavoprotein A 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJY2 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene dfa1 CDS 41015..41383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 41506..43242 product putative diflavin flavoprotein A 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ55 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene dfa2 CDS 44373..44876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 45919..48669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(49129..49386) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 49815..50738 product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 sequence003 source 1..48728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 724..1512 product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA6 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene tatC CDS 1512..1844 product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724123.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene csaA CDS complement(1841..2158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886880.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(2630..2938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 3164..3703 product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N8 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene petC CDS 3892..4890 product cytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N5 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene petA CDS 7638..8879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 8879..9715 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene omt CDS 9968..11374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 12553..13179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 note possible pseudo, frameshifted CDS complement(13480..14451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267343.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(14735..15562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 16365..16595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(16918..18507) product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(18876..20057) product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK79 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene rsgA CDS complement(20041..20304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056832.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(20661..21785) product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR7 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene dnaJ CDS complement(22826..24787) product chaperone protein dnaK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR6 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene dnaK1 CDS complement(25052..25723) product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB3 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene grpE CDS 26406..28304 product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene pilB CDS 28389..29510 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene pilT CDS 29621..30850 product pilus biosynthesis protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene pilC CDS 31101..31655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 32547..32759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 32808..33194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene ycf35 CDS 33194..33652 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142874.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(33958..34281) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NM87 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(34924..36087) product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 36693..39155 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCX6 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene mutS2 CDS 39446..40234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 40239..41603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 41610..42659 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 42652..45330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 45465..46313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(46310..47347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(47340..48149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 sequence004 source 1..43026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(536..1627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(1653..2813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(3353..4501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140225.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(4564..5760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140224.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 6475..6816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(7377..7898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 7792..8013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 8823..10166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(10275..12326) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 13080..14471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 14494..15843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(16043..16663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 17166..22232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 22433..24871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 24875..25540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 25800..26330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 26431..26994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 27191..27562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 27559..27885 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(27911..28258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(28268..28471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(28500..29411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 29907..30215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(30371..31024) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948446.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(31063..31281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 31448..32161 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140746.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 32370..34559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(34962..35864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(35928..39446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 39871..42084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 42428..42934 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055903.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene fur sequence005 source 1..41822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 655..1407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 1568..3976 product kojibiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(4145..7072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403128.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 7635..9290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 9500..9763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 9975..11216 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056850.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 11221..11736 product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI8 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 11879..12451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057704.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 12554..13123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 13267..13485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 13478..13747 product plasmid addiction system poison protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016431.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(13773..14477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 note possible pseudo, frameshifted CDS complement(14567..15241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 note possible pseudo, frameshifted CDS complement(15247..15966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 16485..17075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(17256..18623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 18789..20966 product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057626.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 21784..23577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(23875..24864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 25534..27060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 27479..29665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(29933..32158) product photosystem I P700 chlorophyll a apoprotein A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A407 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene psaB CDS complement(32359..34623) product photosystem I P700 chlorophyll a apoprotein A1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A405 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene psaA CDS 35829..37193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 37591..39096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140390.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 39585..40124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 40514..41149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(41280..41753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880029.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 sequence006 source 1..41115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 718..1866 product hexosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 1863..3050 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene bme6 CDS 3125..4021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 4023..4991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 5089..5730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 5776..6612 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 6708..7661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(7887..8219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(8225..8497) product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140360.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 8751..9347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124316.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 9569..10108 product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(10202..11170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957621.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(11656..12222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 12321..13052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143111.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(13132..14262) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS3 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene aroB CDS complement(15278..16258) product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene bioB CDS 18378..18533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 18816..19112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 19218..20453 product 2-amino-3-ketobutyrate CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 20852..21517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(21861..22835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 23750..24835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 25646..26224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(26768..27250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(27361..28347) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057413.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 28516..29313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(29438..29617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(29981..30745) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene fabG CDS 31101..31418 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGN0 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene trxM1 CDS 31640..32221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(32553..33515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(33896..34468) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225839.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 34589..35269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140957.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(35461..35703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(35723..35938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(35874..36176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 36567..36848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 36965..37246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(37527..38504) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3K1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene garR CDS complement(38829..40319) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403192.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 sequence007 source 1..40870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 235..1095 product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893633.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene hybA CDS complement(1258..1641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 1947..3131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 3315..3785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 4263..4577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(4587..4799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 note possible pseudo, frameshifted CDS complement(4862..5410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 note possible pseudo, frameshifted CDS complement(5439..6128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 6238..7092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(7367..8884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 8939..9139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 9224..9439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 9441..10907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 10907..11782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 11837..12229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(12371..12820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(12824..13102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(13294..13755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 13754..14446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(14476..14625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 14740..16071 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene ydcM CDS 16031..16354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(16434..16844) product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888H9 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene vapC CDS complement(16825..17121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(17686..18180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 19459..20139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(20095..20274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 20333..21874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(21806..22864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 22969..24780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(25438..27441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(27470..29170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(29300..29563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(29616..30041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(30307..30507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 30977..31324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(32820..33026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 33282..33644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 33641..34255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 34327..34701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 34701..34868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 34905..35159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 35162..35887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 35991..37676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(38123..39439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 39709..40293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 sequence008 source 1..40246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 864..1001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(1295..1942) product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WN7 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene pdxH CDS 2221..3267 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058096.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 4054..4434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057512.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 4633..5463 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057495.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 5971..7140 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 7786..8925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(9064..11091) product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY6 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene speA CDS 11591..12067 product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM56 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene ndk CDS complement(12216..12935) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 13345..15048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 15576..15998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(16106..16498) product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H7H8 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 16947..17234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(17231..18472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 18715..19392 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 20159..21127 product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 21450..22436 product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986518.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 23324..24322 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(24820..25056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 25177..25554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 25582..26466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 26559..27296 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894813.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 27448..28044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(28215..30401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(30627..31790) product putative pyridoxal phosphate-dependent aminotransferase EpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q795J3 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene epsN CDS complement(31808..32950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(33128..34003) product SnoK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(34090..34737) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(35128..36312) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(36438..38123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(38101..39291) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931321.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 sequence009 source 1..37059 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 330..1880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 2389..3579 product putative bicarbonate transporter, IctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058082.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(3997..4662) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058278.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(5889..7226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 7197..7412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 7479..8063 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(8123..10018) product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(10410..10997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 11368..11508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 11512..11832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 11916..12785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(13284..14018) product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590206.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(14134..15516) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 15847..16359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 16769..17458 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q836Z5 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene ung CDS 17589..18608 product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIH2 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene tilS CDS complement(18707..20446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 21442..22674 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056200.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 22814..23179 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 23193..23723 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056202.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene cheW CDS 23740..26694 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056203.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 26797..31716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(32075..33991) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225606.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 34720..36795 product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 sequence010 source 1..36914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(143..811) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(979..2535) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140027.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 2762..3586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(3713..4159) product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140032.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 4506..6143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056580.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(6207..7664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 8078..8758 product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA0 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene tpiA CDS 8928..9779 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ9 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene folP CDS complement(9918..10763) product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142171.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(11079..12734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057554.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(14117..15559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 16947..17126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056193.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 18469..21099 product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHA3 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene dnaE CDS complement(21467..24004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(24289..24747) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082236.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 25162..25485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 25936..26463 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMC5 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(26746..29352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(29632..30093) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A499 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene rplI CDS complement(30762..31124) product photosystem II reaction center Psb28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ8 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene psb28 CDS complement(31438..32973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(33145..33876) product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIP3 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene trmJ tRNA complement(34211..34282) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(34448..34999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(35467..36135) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056429.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(36154..36426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 sequence011 source 1..35822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(397..4047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(4536..7622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(7729..8415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 8942..10573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 10761..11198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 note possible pseudo, frameshifted CDS 11170..11424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(11547..16232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(16355..17029) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL01 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene purQ CDS complement(17177..17455) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG9 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene purS CDS 17756..18148 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(18236..19231) product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058018.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(19281..19712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 20045..21970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056767.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 22657..22923 product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057357.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene ftrV CDS complement(22927..23154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(23232..23882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(24295..24810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(24788..26362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056133.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 26496..26786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(27326..27922) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNL2 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene rplY CDS complement(28021..29364) product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG2 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene purA CDS 30117..32630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 32717..33760 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 34655..35614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 sequence012 source 1..33983 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(143..4885) product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141955.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(4941..6680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(7022..7750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(7912..13464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(13755..14033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(15324..16733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 17900..19096 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 19220..20398 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 20533..21519 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932263.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 22216..22689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 22705..23103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 23614..24864 product ceramide glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122407.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 25020..26291 product 1,2-diacylglycerol 3-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 26895..27782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 28139..28582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 28583..28720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 29087..30241 product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125189.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 30533..30877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056921.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 31024..31695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 32193..33467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 sequence013 source 1..33314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 945..1925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(2271..2825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057284.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(3270..3749) product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJU2 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene ndhN CDS 4826..5458 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene rplC CDS 5569..6201 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN0 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene rplD CDS 6194..6508 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM9 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene rplW CDS 6645..7508 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM8 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene rplB CDS 7711..7986 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9W6 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene rpsS CDS 8038..8397 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM6 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene rplV CDS 8470..9222 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59187 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene rpsC CDS 9329..9757 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM5 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene rplP CDS 9761..9985 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEG0 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene rpmC CDS 10033..10281 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM3 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene rpsQ CDS 10330..10698 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM2 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene rplN CDS 10698..11051 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene rplX CDS 11133..11678 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM0 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene rplE CDS 11700..12101 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML9 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene rpsH CDS 12147..12698 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML8 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene rplF CDS 12702..13064 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML7 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene rplR CDS 13191..13718 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59126 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene rpsE CDS 13766..14209 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML6 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene rplO CDS 14290..15603 product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML5 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene secY CDS 15603..16160 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWT7 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene adk CDS 16360..16584 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML3 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene infA CDS 17640..18020 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene rpsM CDS 18086..18481 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59379 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene rpsK CDS 18858..19805 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFF5 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene rpoA CDS 19840..20190 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK9 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene rplQ CDS 20240..21100 product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM6 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene truA CDS 21149..21604 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK8 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene rplM CDS 21604..22020 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK7 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene rpsI CDS 22103..22342 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK6 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene rpmE CDS 22438..23535 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMG9 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene prfA CDS complement(23549..24043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 24271..24633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 24896..25264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 25419..26516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 26835..28529 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 28777..30384 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59177 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene gpmI CDS 30948..31181 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene secG CDS 31184..32110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 sequence014 source 1..32987 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 276..1445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(1450..5085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 5255..5545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(5687..9178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(9364..9720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(10459..11295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(11298..12980) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(13236..13709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(13782..14414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140508.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 15361..16494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 16496..16927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 16958..17698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 17646..17909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 17970..21749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 21799..22044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(22107..22466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 22811..23956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(24116..24400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(24426..24656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(24756..25655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(25767..26069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(26140..31056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(31186..31497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(31552..31920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 32160..32411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 sequence015 source 1..31940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(420..1304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(1351..1869) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene ilvH CDS complement(2306..4378) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056593.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(4845..5006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 5294..5899 product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI2 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene clpP1 CDS complement(6409..7281) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 7548..8195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 8192..9067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(9469..10425) product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHQ2 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene ctaB CDS complement(10625..11599) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 12145..13116 product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE8 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene ctaC CDS 13212..14948 product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE9 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene ctaD CDS 15051..15674 product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene ctaE CDS complement(15819..16325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 16788..17114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 17252..17800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057421.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 18225..18692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(18796..19992) product adaptive-response sensory-kinase SasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMT2 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene sasA CDS 20127..21644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 21963..22637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(22660..23490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 23604..24656 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61000 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene hisC CDS 24885..25760 product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 25936..27477 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972453.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(27773..28879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(29012..30520) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 sequence016 source 1..31752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(891..3314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 3720..4928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(5238..6626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(6623..6970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(7257..7421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(8532..9770) product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG49 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene trpB CDS complement(9887..10708) product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLN9 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene trpA CDS complement(10943..12391) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368546.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(12673..13929) product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(13962..15248) product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 16183..16548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(17066..18100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(18100..19575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(19870..21072) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene aroB CDS complement(21085..21957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(23304..23921) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 24732..26150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 26301..26600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 26806..28371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918445.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(28796..29752) product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(29784..30683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 sequence017 source 1..31691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 121..822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 1188..3017 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 3443..5020 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 5225..6001 product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(6103..6378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(6744..7205) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143783.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 7546..8910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(9210..10670) product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(11174..11713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(12246..13079) product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(13322..14875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 14979..15545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(15618..15890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(16061..16879) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002027497.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene fabG CDS complement(17765..19279) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 19384..22764 product trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 23227..25380 product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6D2 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene glgX CDS 25581..27410 product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHI0 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 27670..30483 product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393311.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 30899..31534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 sequence018 source 1..31506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(30..734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(912..2453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142479.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 3067..4413 product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142460.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 4526..5581 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142461.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 5782..6654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 6658..8007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 8266..9246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 9329..9568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(9606..9830) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_708688.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(9955..10164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 10658..11266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 11440..11874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(12296..14950) product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 15797..16801 product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 17076..17306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(17443..19887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 21411..21665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056812.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 21669..22982 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 23449..24489 product UDP-3-O-acylglucosamine N-acyltransferase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH24 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene lpxD3 CDS complement(24691..25020) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703865.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 25199..25438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(25508..26398) product heterodisulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056823.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 26801..27052 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS3 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene acpP CDS 27247..28509 product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS4 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 28830..30842 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS5 transl_table 11 codon_start 1 locus_tag LOCUS_05300 sequence019 source 1..31218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(852..1181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125076.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene mazG CDS complement(1518..3851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(4633..9858) product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USG5 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(10741..11106) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(11232..11513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 11804..12685 product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMU0 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene folD CDS 12744..13679 product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene crtE CDS 13777..14232 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(14359..15012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(15304..15633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene ycf54 CDS complement(15723..16508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(16678..17400) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPF2 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene pdxJ CDS complement(17569..17796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 18120..18821 product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 18843..19451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 20092..25521 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(25966..26895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37513 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene yyaK CDS 27282..27758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 28604..30073 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115333.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 30238..31101 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 sequence020 source 1..31049 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(55..930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(943..1359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(2028..2750) product thymidylate synthase (FAD) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289309.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 2855..3436 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(3647..4162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 4327..5673 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY3 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene aroA CDS complement(5801..6022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(6184..6954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(7006..7581) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142128.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(7609..8199) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142127.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(8222..8479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(9220..10542) product carbon dioxide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141007.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene cupA CDS complement(10679..12184) product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141006.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene ndhD CDS complement(12329..14167) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene ndhF3 CDS complement(14613..15452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140768.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(15455..15871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140769.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 16172..16909 product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS5 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene comB CDS complement(17864..19642) product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(19828..20511) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056348.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(20705..21991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(22217..23389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(24250..24459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(24490..24840) product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142094.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(24934..25245) product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene ccmK CDS complement(26437..28059) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 sequence021 source 1..30503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..762 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142186.1:glycosyl transferase locus_tag LOCUS_05760 CDS 1089..2024 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 2636..4654 product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene htpG CDS 5168..5404 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG62 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene rpmB CDS 6235..11175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 11281..11973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 12164..13213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 13475..14164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 14730..15701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 16029..16580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 16808..17434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 18358..19197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056247.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 19461..20324 product beta 1,4 glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene lgtF CDS 21379..22098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 22564..23187 product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS0 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene nusB CDS 23374..25080 product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKD1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene ftsY CDS 26120..26353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 26393..27781 product regulator of sigma-B activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(28183..28800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 28871..29422 product photosystem II oxygen-evolving complex 23K protein PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene psbP CDS 29558..30151 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC5 transl_table 11 codon_start 1 locus_tag LOCUS_05960 sequence022 source 1..30484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(62..787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(811..1551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(1585..2862) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880682.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene abcT4 CDS complement(2864..3724) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN7 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(3770..5128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(5139..6269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(6266..7675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(8109..8957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 9334..9552 product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056374.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 9624..10724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 10900..11886 product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057379.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene chlG CDS 12544..12729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 13307..14221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057104.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(14390..14896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(15003..15974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142445.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(15971..17116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(17607..18893) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147155.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(19003..20115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(21304..22896) product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 23265..24464 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939181.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(24607..25365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141101.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(25543..27216) product plant auxin-responsive GH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966681.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 28181..29431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 29559..30326 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 sequence023 source 1..30270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1405..3777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(4087..5154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 5686..6603 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140660.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(6600..8180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(8460..9902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 10253..11014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 11090..12394 product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26507 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene nifN CDS 12496..12921 product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084556.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene nifX CDS 12918..13394 product UPF0460 protein y4vQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55676 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 13624..13845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970913.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 13842..14159 product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS27 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene nifW CDS 14171..14971 product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene moeB CDS 15052..15405 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 15438..15737 product ferredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3C9 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene petF1 CDS complement(15996..16205) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065065.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 17355..17960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 19426..19614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 19639..20013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(20028..20516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(21224..22510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(22897..25329) product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056890.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(26279..26707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(26920..28008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 28309..29637 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 29714..30040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 sequence024 source 1..29639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(52..1755) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 2054..3550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(4511..4705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 5081..6172 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJJ6 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene thrC CDS 6648..6989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(7025..7651) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055917.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(7961..8209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene ycf34 CDS 8297..9574 product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056562.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(9819..10124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057560.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(10236..10493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 10760..11140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 note possible pseudo, internal stop codon CDS 11213..11458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 note possible pseudo, internal stop codon CDS complement(11649..12215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(12222..12857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(13004..13336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(13479..13994) product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UER6 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene moaC tRNA 14029..14103 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(14583..15896) product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(15995..17017) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene wcaA CDS complement(17032..17754) product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 17807..18748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058107.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 18992..19738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057978.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 20281..21114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(21437..23044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(23764..24144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144091.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(24199..24567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144090.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(24845..25378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144089.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(25516..25995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(26095..26583) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(26768..28483) product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144086.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(28927..29448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 sequence025 source 1..29309 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 199..3474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 3781..4359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040618.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 4805..12235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 12811..13587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 14234..15361 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM6 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene rfbB CDS 15629..16555 product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM7 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene rfbA CDS 17215..17610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 17870..19342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056379.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene tldD CDS 19514..20857 product modulator of DNA gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056923.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 22010..22975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 23229..24005 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056208.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 24073..25572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 26143..27897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(28455..28658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(28694..28966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 note possible pseudo, frameshifted sequence026 source 1..29027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(472..2433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(2995..4098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 4267..4545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(4880..5107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(5079..5915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 6365..9340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(10539..12083) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 13408..14199 product phosphonates import ATP-binding protein PhnC 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZU82 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene phnC2 CDS 14353..15381 product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113119.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 15684..16529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(16883..19798) product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene gcvP CDS complement(20471..20860) product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIB2 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene gcvH CDS complement(20889..22022) product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFJ5 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene gcvT CDS 22332..22826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056704.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(22929..24767) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 25273..26406 product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBU2 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene potA CDS 26528..27613 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255373.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene potD CDS 27911..28816 product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene potB sequence027 source 1..28896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(288..1484) product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene phnM CDS complement(1668..2075) product fosfomycin resistance glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207881.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene fosA CDS complement(2311..3441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(3707..4156) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(4351..4953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(4956..5381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 5807..6541 product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969863.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(6617..7480) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(7735..8478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 9385..10713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(10909..11925) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene rbsK CDS complement(12185..13630) product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(13946..16105) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144130.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 16362..16601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(17351..18661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(18658..21432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(22086..23078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(23459..27082) product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA7 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene mfd CDS 27579..28844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 sequence028 source 1..28565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(72..563) product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB0 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene purE CDS 981..2162 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH66 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(2434..2724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(2907..3407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(3863..5476) product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(6169..8553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 9134..10657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(10921..11802) product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS4 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(11890..12264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(12753..13259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(13313..14395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 14749..15660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 16107..17399 product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB2 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene miaB CDS 17948..19654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 20521..21369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 21763..22848 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH0 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene ddl CDS 23112..23672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(24948..25913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(26113..26616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(26712..27605) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930650.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(28098..28349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 sequence029 source 1..28413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..2011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(2551..3792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(4151..4873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(5240..6298) product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(6476..6733) product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116175.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(7094..7891) product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGK9 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 8088..8903 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141338.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 9252..10790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(10875..11570) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057523.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene ribC CDS 11896..12399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057876.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 12597..13667 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 13909..15102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 15107..15763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 15769..15987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 16106..18610 product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 18750..19589 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435784.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 19693..20202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 20450..22129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(22458..23375) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 23904..24407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 24513..25283 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF82 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 25393..25908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(26307..27281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056563.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 sequence030 source 1..28413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 304..2811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 2990..3229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 3929..6040 product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(6085..6417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(6408..6815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(7068..7370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(8026..10386) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(10739..13696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142223.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(13698..14972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 15321..16457 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385237.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 17292..17693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141871.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 17884..19008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141501.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 19501..20418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(20893..22458) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(23044..23598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057824.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(23860..24450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(25414..25974) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057826.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(25974..26855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057827.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 27410..28222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143821.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 sequence031 source 1..28382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(206..279) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 482..1372 product lipoyl synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL83 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene lipA1 CDS complement(1500..5087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 5634..6449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(6549..7673) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(8191..9180) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140505.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 9513..9788 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057702.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 10469..11125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140118.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 11689..13062 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 13110..14012 product putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705418.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 14457..15806 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 15871..17127 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599791.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 17458..18507 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 18753..19031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 note possible pseudo, internal stop codon, frameshifted CDS 19025..20008 product chlorophyll a oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979027.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 20270..21325 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 21612..22982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119646.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 23295..24806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 24939..26297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 26505..28019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 sequence032 source 1..27693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(22..1770) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056502.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(2263..2724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 3198..4199 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142814.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(4291..4866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(4927..6156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(6499..6996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 repeat_region 7288..7813 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccaactaatccgaattaacccaatcggtgggg CDS complement(8182..10719) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0I2 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene ppsA CDS 11370..13229 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141594.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 13788..17744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 17769..18164 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(18458..20566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(22188..22463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(24369..24716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 26116..26844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 26887..27450 product ribosomal protein S5 alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene rimJ sequence033 source 1..27668 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 498..1178 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(1688..2479) product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532388.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(2703..4085) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257475.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(4215..4862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 5409..5594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(5754..6689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(7370..7750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(7997..10018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144393.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 10596..11474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056085.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(11675..11857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 12016..12513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 12913..13398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(13666..14109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 14250..15128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056085.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(15380..15859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 15988..17085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(17295..20090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 20803..21249 product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 21322..21723 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731409.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(21769..22734) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 23519..24376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(25331..25669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(26301..27221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 sequence034 source 1..27573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 148..345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(417..1289) product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE4 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene mtnP CDS complement(1449..2027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 2555..4822 product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141880.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(6051..7853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 8628..9728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(10249..10620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(10631..11338) product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(11905..12057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(12095..12316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 12669..13289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 13466..14395 product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF59 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene gpsA CDS 14858..16117 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEW6 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 16562..17017 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(17155..18315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(18325..22416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 22509..24443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(24463..25437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(25636..27090) product neopullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143635.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 sequence035 source 1..27561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 229..903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003198.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 1059..1733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 1817..4000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 5087..5860 product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142205.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene rfbF CDS 5983..7200 product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 7242..8273 product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 8322..8927 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142202.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene rfbC CDS 9237..10550 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142201.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 10859..12067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 12060..12821 product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036822.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 13078..14160 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 14180..16438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 17872..18645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 19014..20855 product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142193.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 22019..23056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 23061..24035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 24100..25011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 25230..26378 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552050.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 26381..27313 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552051.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 sequence036 source 1..27382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(234..1745) product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7U9 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene ilvA CDS 1992..2261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 2242..2466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 2516..6277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 6483..7271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(7384..7968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(8098..9138) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene speB CDS 9280..9711 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228878.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(10135..10704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(10898..12934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 13125..13955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 14666..15499 product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 15765..17210 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene recQ CDS complement(17439..18434) product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL09 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene pheS CDS complement(18896..19705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(19889..20644) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(20854..21597) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA4 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene rph CDS 21762..22979 product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW4 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene xseA CDS 23065..23535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 23645..23851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(24048..24317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 24639..24866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 misc_feature complement(24928..>27382) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938280.1:multiphosphoryl transfer protein locus_tag LOCUS_09080 sequence037 source 1..26941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2444..2707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 3263..3961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140332.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(4014..4877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(4952..6547) product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948836.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(6783..9011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 note possible pseudo, frameshifted CDS complement(9931..15423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(15620..16009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(15961..22995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 misc_feature complement(23177..>26941) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973246.1:polyketide synthase locus_tag LOCUS_09170 sequence038 source 1..26560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(213..1334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(1386..1814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 3568..5934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 6334..7236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 7261..7539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 7540..8670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(8681..9916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(10082..11704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(11786..12370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 12525..12794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 13352..13879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 13903..14238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 14442..15047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(15530..15826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(16070..17359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(17771..19741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(19734..20450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(20447..20785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(20769..21392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(21376..21627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(21627..22103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(22115..22561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(22561..23388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(23391..23618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(23615..23860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(23857..24429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(24383..24784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 25386..25574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 25783..26229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 sequence039 source 1..26327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 109..1209 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene ccmA CDS 1247..2938 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074028.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 3122..5077 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262671.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 5476..11085 product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141952.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 11996..19303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 19635..24497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 24859..25665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 sequence040 source 1..25918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 115..867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 1837..3876 product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRK1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene katG CDS complement(4070..4246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 4311..5336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 note possible pseudo, internal stop codon, frameshifted CDS 5281..5622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(5953..6633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(6788..8350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(8353..9384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(9413..10489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 10921..15918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 16057..24144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(24533..25264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 sequence041 source 1..25816 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(409..1020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1461..3089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 3313..4467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057921.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 4693..5058 product ferredoxin-thioredoxin reductase, catalytic chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK3 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene ftrC CDS 5069..5458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 6172..6603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057412.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 6767..7495 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143254.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(7739..7906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 7947..8846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143323.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene ycf84 CDS 8988..10418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(11130..11408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(11452..11946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119100.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(12068..12934) product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(13111..14115) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 14599..15246 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404693.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 15630..15869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 15948..16271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(16435..17625) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 17718..17888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 18168..19190 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIT6 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene glk CDS 19239..19820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(20076..21566) product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965635.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(21950..22273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(22245..22589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 22720..23811 product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ8 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene ychF CDS 24239..25135 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112640.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(25162..25371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 sequence042 source 1..25628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(448..2868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056048.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 3762..5063 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR2 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene hisD CDS 5431..5856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(6040..6387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(6658..7626) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056119.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene sigD CDS complement(8167..11418) product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI5 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene pyrA CDS complement(12102..12656) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056462.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene dpsA CDS 13745..14389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057756.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 15516..15869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(16142..16711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(16723..17292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(17555..19558) product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC6 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene uvrB CDS 19821..20315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(20598..21308) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE8 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene rpe CDS 21676..23277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(23661..25265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 sequence043 source 1..25331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(122..775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(1230..4406) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(4654..5979) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143975.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(6368..6520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 6667..7065 product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143244.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(7165..7605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 8269..8733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 8886..10025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(10155..11678) product restriction endonuclease NspV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 12652..12960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(13323..14387) product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIH3 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene ccsA CDS complement(15132..16859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(17431..18039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene ycf21 tRNA complement(18291..18373) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 19010..20353 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene accC CDS 21345..22265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057849.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene ycf66 CDS 22283..22876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 22947..23459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(23490..23894) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338041.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(23968..25170) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 sequence044 source 1..25268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1113..2843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(3669..4976) product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144027.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(5325..6188) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(6385..8067) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 8602..10353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 10635..11909 product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVR9 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 12106..13440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(13595..14434) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM2 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene dapF CDS 14563..14793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(15043..17373) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056388.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(17587..17778) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140229.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(17879..20731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 20929..21852 product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(22156..22386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 22455..23291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 23481..24851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 sequence045 source 1..24786 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(81..818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(1261..2202) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227993.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene mmsB CDS complement(2259..2966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(3211..4404) product glycine/betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 5880..7037 product putative xanthine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32147 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene pucA CDS 7160..8263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 8267..10654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(10822..13602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(14096..14758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 15992..17569 product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106352.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 17760..19547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 19908..21320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 21977..22762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 sequence046 source 1..24767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1404..3821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 4275..4778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 4859..5347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 5671..6375 product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene dsbD CDS 6413..6988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 6991..7893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141159.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 8222..8872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 9258..10679 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057361.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 10723..11079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(11084..12178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 12638..13816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 14228..14668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 14738..15484 product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP8 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene atpB CDS 15651..15896 product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA59 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene atpE CDS 16079..16570 product ATP synthase subunit b' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP6 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene atpG CDS 16875..17432 product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP5 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene atpF CDS 17435..17989 product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP4 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene atpH CDS 18186..19706 product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP3 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene atpA CDS 19923..20870 product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLU1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene atpG tmRNA 21173..21551 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 21634..21972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 22069..22608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(22708..23211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056141.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(23734..24453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 sequence047 source 1..24753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 247..1413 product erythromycin biosynthesis sensory transduction protein EryC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 1529..2425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 2535..3248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 3432..4802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 4990..7152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(7446..8141) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144247.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(8318..9031) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144247.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 9533..11752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(11819..12304) product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(12372..12719) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKX6 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(13242..14237) product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV6 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene murB CDS complement(14395..15834) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV5 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene murC CDS 16938..17957 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIW5 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(18201..19202) product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGF1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene thiL CDS 19348..19752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(19788..20276) product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM0 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene smpB CDS 20812..21903 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 22345..24732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 sequence048 source 1..24697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1243..2400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 2397..3176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 3173..5032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(5187..5495) product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529821.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(5492..5764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 5907..7664 product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C922 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene dnaK CDS 7739..9046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(9107..10504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(10492..11676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(11673..12584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526405.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(12572..13735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(13786..18051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 18097..20244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 20251..21879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 22088..22705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(22724..23026) product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(23023..23283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141909.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(23760..24617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 sequence049 source 1..24549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 897..2708 product dimethylaniline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141962.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 2747..3751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(3865..4950) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI76 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene trpD CDS complement(5242..6468) product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG49 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene trpB CDS complement(6575..7393) product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLN9 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene trpA CDS complement(7672..8508) product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHI0 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene trpC CDS complement(8742..10940) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947460.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 11545..13209 product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930051.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(13357..14247) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086032.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 14676..15377 product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(15589..16140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 16462..17070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 17246..17872 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943220.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 18350..20299 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704555.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 20478..22031 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 22070..22627 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(23008..24099) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene ccmA sequence050 source 1..24532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 211..354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 645..1619 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058144.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene cysM CDS 2446..3114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(3415..4464) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(4964..5449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057705.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 5613..7436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(7614..8225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(8751..12389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(12610..14895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(14938..18954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(18951..19847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 23478..23783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056554.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 sequence051 source 1..24471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 45..1841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 1838..4177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 4464..5621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 5752..8097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 8870..11482 product cellulose synthase catalytic subunit (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene wssB CDS complement(11616..13367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(13510..13746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(14108..14272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 14425..16242 product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM20 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene lepA CDS 16932..17402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(17663..20152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(20806..23424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 sequence052 source 1..24310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(1699..3558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 4438..5265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 5466..5870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(5913..6536) product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FWS7 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(6792..7994) product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(8181..8393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(8548..9186) product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 9483..11042 product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN5 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene purH CDS 11347..12216 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257980.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(12494..12832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 13000..13257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(13254..13640) product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142884.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(13803..14537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(14600..14965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086800.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 15881..16495 product putative zinc metalloprotease YwhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P70995 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene ywhC CDS 16818..17312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 17352..18371 product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 18507..19349 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZX7 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene dapF CDS complement(19757..20671) product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y840 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(21442..24009) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH61 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene leuS sequence053 source 1..24273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 509..2086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 2175..5387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 5437..7413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 7579..8841 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974172.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 9047..9859 product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142182.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 9970..10623 product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142181.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 10733..10960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 11064..11792 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973506.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 12108..13436 product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 13847..14191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 14277..15284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 15678..16718 product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(16777..18192) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(18567..20126) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057178.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 20815..21426 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143281.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(21717..22163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 22299..23678 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 23750..24175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 note possible pseudo, frameshifted sequence054 source 1..24160 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1152..2090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(3189..4124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(4313..5488) product carbon dioxide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057960.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(5658..7187) product NAD(P)H-quinone oxidoreductase subunit D4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene ndhD CDS complement(7370..9226) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057958.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene ndhF4 CDS 9828..10136 product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142094.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 10563..10907 product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene ccmK1 CDS 10931..11230 product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene ccmL CDS 11433..13145 product carbon dioxide concentrating mechanism protein CcmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142091.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene ccmM CDS 13420..14169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 14825..15622 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142089.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene ccmO CDS 16149..17042 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057872.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 17462..19090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 19201..20130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(20195..21184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 21370..21786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(21858..24131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 sequence055 source 1..23918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 421..819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1135..1824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(1887..2375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(2644..3117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(3623..4405) product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 4783..6366 product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 6837..12662 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 13203..18551 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 19009..20454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 20698..22194 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555084.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(22284..23876) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ32 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene leuA sequence056 source 1..23708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1759..2259 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 2264..2641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 2699..3814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(4153..4857) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 5012..7132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(7314..9113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(9589..9990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(10132..10611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(10821..12290) product methylmalonate-semialdehyde dehydrogenase (CoA acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 13127..13867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 13870..14940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 15066..16547 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 16616..17449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 17616..18533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 19360..19608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 19608..21047 product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057654.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene ndhD5 CDS 21032..21418 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057653.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 21415..21669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 21666..21947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057651.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 21937..22524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057650.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 22521..23180 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 sequence057 source 1..23687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 93..1460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1680..2249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(2246..3136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 3288..4052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 4068..4928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 5036..5548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 6034..6651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 7247..10072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140619.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 10069..10857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 11170..12318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 12321..13127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 13127..15238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 15240..15989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 16031..17293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142037.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 17519..19261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142038.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 19264..19728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 19703..19972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 19965..22214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 22296..22544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 22538..22927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 22903..23196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 sequence058 source 1..23541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 792..2555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(2912..4690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(4820..5053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(5480..7417) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG5 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene ftsH CDS complement(7715..7882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 7988..9142 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 9252..9872 product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056234.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(9960..10748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 11206..12258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 12392..12583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(12683..13876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058195.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 14277..14747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(15072..16802) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057217.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene sdhA CDS complement(17020..17322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058283.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 17666..18952 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN0 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene serS CDS 19279..20364 product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE8 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 20340..21065 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE9 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene nth CDS 21102..21404 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VAZ6 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene rpsN CDS complement(21606..21935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056249.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 22224..22799 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKJ8 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene aat sequence059 source 1..23334 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 129..1196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(1680..2168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 2471..3670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057682.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(4115..5476) product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266449.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(5740..6969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057855.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 7117..7953 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058212.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene desC1 CDS 8468..9418 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene desA CDS 9992..11059 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene desA CDS complement(11449..12567) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(13063..14349) product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEF6 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene proA CDS complement(14367..14774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057546.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 tRNA complement(15243..15315) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(15885..16457) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP4 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene ribH CDS complement(16986..17174) product photosystem II reaction center protein Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHJ2 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene psbZ CDS 17552..17923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 17995..18396 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(18658..19101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(19363..22362) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS8 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene valS sequence060 source 1..23119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(173..949) product bacteriophage endolysin (N-acetylmuramoyl-L-alanine amidase) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254251.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1474..2058) product TIGR04376 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140547.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(2408..3781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(3917..4777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 5048..6985 product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF8 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene mnmG CDS 7126..7371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 7386..8717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(9128..9565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(9572..9865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(10097..10321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(10559..11392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(11716..12036) product cytochrome c6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X9 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene petJ CDS complement(12213..12728) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(12964..14100) product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL79 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene sigA CDS 14935..17511 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLR3 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene priA CDS 18594..20279 product potassium-transporting ATPase potassium-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN41 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene kdpA CDS 20553..22661 product potassium-transporting ATPase ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN40 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene kdpB sequence061 source 1..23087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056420.1:two-component system response regulator locus_tag LOCUS_13210 CDS complement(1400..3064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(3061..3495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 3795..5543 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDU0 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene hflX CDS 6075..6332 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 6531..7514 product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKF1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene gshB CDS complement(8056..9369) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNW0 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene ftsZ CDS complement(11191..12030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 13381..14673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 14963..20152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(20219..20530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056902.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 22000..22839 product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A431 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene psbO sequence062 source 1..22974 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 384..1811 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056420.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1926..2288 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 2992..5427 product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL37 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene pheT CDS 5540..5809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056004.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(6090..9128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 9518..10144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(10226..12679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(14682..14852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(15175..16200) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(16275..17693) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057298.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 18359..18694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055877.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 19256..20788 product photosystem II CP47 reaction center protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene psbB sequence063 source 1..22936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1318..1806 product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372763.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 1950..2804 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056343.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 3114..6983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 7392..9884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 10319..10654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(10836..13133) product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB8 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene glgB CDS complement(13446..13781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(14136..14297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 15016..15681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 16043..17875 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057909.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 18952..19152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(19268..20365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(20401..20763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 21558..22247 product nitrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057403.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 sequence064 source 1..22917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 130..540 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 732..1754 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 1789..4380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(4394..7210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(7335..8765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(9070..9714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 11197..14340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(14461..17280) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056416.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(17671..20262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(20367..20864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056418.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(20898..21275) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(21427..22344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 sequence065 source 1..22860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 204..623 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1442..1774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144365.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 2092..2466 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59168 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene rpsL CDS 3480..3950 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI44 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene rpsG CDS 4221..6299 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI43 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene fusA CDS 6323..7552 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI42 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene tuf CDS 7771..8088 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA06 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene rpsJ CDS 8911..9561 product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(9878..10750) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH54 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene pheA CDS 11148..11738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057548.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(11760..12428) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2G1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene rnhB CDS complement(12625..14643) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene rne CDS complement(15983..18580) product B12-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058092.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(19479..19874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 20265..20459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(20720..21070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 21730..21921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 sequence066 source 1..22634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 836..1174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 1174..4035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140619.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 4038..4901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 5201..5350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 5547..5804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 5896..6126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 6138..7607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 7678..8508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 8570..9484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 9453..9731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 9744..10310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 10298..10645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(10794..11177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 11231..12724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene ycf46 CDS complement(12862..13533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 13691..14851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 15005..15898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(16343..17752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(17856..18848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(18912..19385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(19399..19701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 20781..21002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 21043..21618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(21690..22286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 sequence067 source 1..22626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 176..841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 876..1802 product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8J6 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(1937..2158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 2305..2574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 2705..3382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 3890..4273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(4440..5141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883059.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(5337..6104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(6166..6447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(6637..7062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 7775..8122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(8864..9073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 9299..9682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 9694..10269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 10340..10687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 11064..11519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 11522..12241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 12324..14204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 14293..14571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(15093..15728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142166.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(15788..16999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 17456..17953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 17950..18489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(19071..19325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(19427..20353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(20400..21593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(21777..22565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 sequence068 source 1..22349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 300..2549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 2755..4554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 4721..6571 product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 6595..6762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 6941..7990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 8012..9109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 9120..9884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 9895..11145 product cytochrome P-450 like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141940.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(11146..11358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(11511..11882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 12104..13900 product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142261.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 14136..15527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(15814..16173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(16262..17455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(18359..19522) product hexosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118866.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(19560..20276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(20649..21815) product glycosyl transferase group 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(21799..21981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 21950..22111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 sequence069 source 1..22335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..884 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057983.1:molecular chaperone DnaJ locus_tag LOCUS_14580 CDS 1006..1572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1873..2145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(2513..3433) product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057599.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(3601..5025) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI31 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene lysA CDS 5114..5665 product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL5 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 6279..8765 product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene clpC CDS 8939..9514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(9597..10064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 10252..12144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(12214..12624) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM25 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene rplL CDS complement(12719..13300) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM26 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene rplJ CDS complement(13613..14332) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM27 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene rplA CDS complement(14436..14861) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM28 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene rplK CDS complement(14868..15509) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM29 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene nusG CDS complement(15506..15730) product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM30 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene secE tRNA complement(16111..16184) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(16469..16828) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC4 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene rplS CDS 17487..18452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(19132..22263) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057001.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 sequence070 source 1..22300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(375..1388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(2095..3279) product poly(glycerol-phosphate) alpha-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118864.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(3618..4790) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(5332..6372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(6500..8182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(8378..9853) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI20 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene glmM CDS 10980..11702 product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056220.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene ho1 CDS complement(11774..12430) product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 12742..13815 product protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZQ2 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene cobW CDS complement(14029..14331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 14486..15124 product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 15443..15982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(16020..17006) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(17200..19416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(19892..21973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 sequence071 source 1..22098 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 539..1126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(1228..1581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1870..2406 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(2595..4814) product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(5379..6146) product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142574.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene cobA CDS complement(6143..6901) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142573.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 tRNA complement(7440..7513) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 7635..8015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 8680..11223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(11431..12252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 13330..14178 product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene tauD CDS 14337..15497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537830.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(16845..17525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(17548..18375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 18717..19595 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382934.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 19856..20140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 20186..20428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(20703..21401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(21509..21826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 sequence072 source 1..21785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1274..2554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 3466..4410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(4533..5489) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(5680..6759) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBL3 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene hemE CDS 7670..9130 product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ME60 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene rtcB CDS 9729..12140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 12244..12465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(12842..13459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 13662..14960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 15258..16616 product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene der CDS 16729..17658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056139.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 18662..18841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 18838..19509 product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056880.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 20029..20622 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK7 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene sepF CDS 20695..21528 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMR1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene proC sequence073 source 1..21647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 337..681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 1592..1939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 2861..3313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057414.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 3752..4558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056104.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 4874..5539 product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056907.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(5629..6333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(6807..8141) product Na+-transporting ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056159.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 8462..9304 product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 9386..10327 product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene ubiA CDS 10772..11230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 11465..12181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 12242..13102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 note possible pseudo, internal stop codon CDS 13227..13940 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIP9 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene coaE CDS complement(14123..15520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143146.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 15841..17487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 18340..19044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 19432..19611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 19778..20965 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142859.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 21261..21635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 sequence074 source 1..21466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2199..3236) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087234.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 4362..4787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 4804..4968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 5739..6764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 6764..7009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(7301..8638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 9235..10251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 10518..11102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 11121..11417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(11423..12346) product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143340.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(12333..13091) product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(13503..13715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(13845..14156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(14903..15376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(15503..16147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(16191..16664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 16953..17573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(17594..17767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(18161..18877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(19164..19478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(19703..19969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(19982..20170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 20736..21149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 sequence075 source 1..21354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 546..2069 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA9 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene lysS CDS 2531..3226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143480.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 3264..3740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(4237..4719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 5181..5645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 5734..6828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(7222..8652) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058184.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 9729..10298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 10699..11205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 11290..12207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 12512..15904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 16322..18538 product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA8 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene ppk CDS 18696..19100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(19248..19427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057262.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 20050..20613 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(20622..20882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(20990..21313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 sequence076 source 1..21234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1821 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056720.1:hybrid sensor histidine kinase/response regulator locus_tag LOCUS_15840 CDS 1814..2776 product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377275.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene pleD CDS complement(3004..5157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(5463..6656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(6737..7309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(7336..7791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(7799..8761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(8999..9403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(10103..11107) product sodium/calcium exchanger membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061691.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(11264..12124) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123656.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(12124..13293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(13773..14822) product bifunctional transcriptional activator/DNA repair enzyme protein Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208972.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(15675..16337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 16932..17279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 17626..18087 product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 18080..19438 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 19699..19983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085796.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 19995..20297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 sequence077 source 1..21225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 302..3940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(4383..5231) product arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058267.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene tyrA CDS 5419..6978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 7275..7856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 8103..8972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141513.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(9094..10149) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene ccmA CDS 10359..11171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(11333..11800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(11819..12088) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCI7 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene rpsO CDS complement(12302..13156) product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 13466..15373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 16462..17160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 17552..18058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(18072..20492) product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056890.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 sequence078 source 1..20091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(203..664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 note possible pseudo, internal stop codon CDS complement(832..1686) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969781.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 1929..2651 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141153.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 3526..4161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144095.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(4328..7126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(7313..8635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(8924..9820) product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263409.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(9843..10604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143369.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 11267..12478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(12728..15181) product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene clpC CDS complement(16055..16456) product Fe-S cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056500.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(16929..19019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(19425..19850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 sequence079 source 1..19974 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..4973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 4970..13030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 13023..17975 product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973237.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 18097..18492 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957424.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(18500..18730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 18740..19783 product siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973236.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 sequence080 source 1..19949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(566..1816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 1972..2202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 2487..3077 product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH04 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene cpcT CDS complement(3127..3924) product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT4 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene cpdA tRNA 4596..4667 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(6087..6362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(6349..7752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 7826..8251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(8270..11479) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene hsdR CDS 11674..12549 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141221.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 12564..12908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141222.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 12911..13519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(13558..14787) product type I restriction-modification system subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403856.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(14784..16976) product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123230.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(17092..17283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 17456..18013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 18010..18336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 18448..19563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 sequence081 source 1..19927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 574..2298 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056806.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 2506..3117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 3281..3892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(4036..5685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 6709..7497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(7752..8072) product cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058261.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene cytM CDS 9263..9574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 note possible pseudo, frameshifted CDS complement(10023..11243) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143013.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(11690..13390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(14165..15508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(15689..15928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(16131..17393) product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59112 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene pcxA CDS 17564..19762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056596.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 sequence082 source 1..19701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(153..857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 1179..2519 product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143095.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 2866..3864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 4082..4777 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene ycf29 CDS complement(5033..5200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(5609..5761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(5908..6189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 7095..7490 product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKF6 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene ndhM CDS 9451..11895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 12016..13581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 13759..14415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(14741..16108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140772.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(16790..17389) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056410.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(17576..18625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057198.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(18727..19659) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene ntcB sequence083 source 1..19641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 295..1560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 1566..2066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(2096..2935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142412.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(2946..6140) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142413.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(6369..6725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 6859..7953 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257745.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 7950..8606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 9126..10826 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100021.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 10823..11866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(12011..12778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(12775..13227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 13430..13642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(13777..14973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(15314..16516) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969811.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene dnaN CDS complement(16576..17511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(17789..18733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(18820..19032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 sequence084 source 1..19551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(212..2077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 2409..5846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 6270..6473 product photosystem II reaction center protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ43 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene psbH CDS 6857..7108 product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ44 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene tatA CDS 7392..8042 product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN75 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene pth CDS complement(8447..8626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(8828..9700) product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR7 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene rsmI CDS 9878..10759 product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 10975..11832 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125459.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene cysQ CDS complement(12133..12909) product UPF0317 protein YcsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42966 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene ycsI CDS complement(13068..13511) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 14318..16585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 16973..17446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057132.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(17534..18304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 sequence085 source 1..19532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(261..1547) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(2333..2926) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(3016..3651) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP5 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene hisH CDS 4822..6195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058234.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 6960..7478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(7704..8333) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(8420..8965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 9517..9864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 9962..10120 product proteolipid membrane potential modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(10337..14527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(14527..16158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(17066..18616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(18852..19385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 sequence086 source 1..19517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(257..4396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(5452..6117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(6367..6558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 6659..8920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(8968..10386) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 11242..11619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057860.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 12117..13208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(13372..13758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(13900..14379) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 14489..15022 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 15275..15790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142895.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 16011..16505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056937.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 16607..17098 product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR4 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(17226..17783) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056062.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(17875..18222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(18236..18964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 sequence087 source 1..19505 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(498..1910) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058264.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(2565..3575) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene ycf30 CDS 3787..4509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056001.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 5757..6155 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH72 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene trxM2 CDS 7112..9199 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124327.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene ndhF CDS 9558..11129 product NAD(P)H-quinone oxidoreductase chain 4 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY0 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene ndhD1 CDS 11830..12792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057618.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 12804..13205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 13492..14232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142610.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 14369..14842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(15123..16622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(17397..17801) product photosystem II lipoprotein Psb27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG60 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene psb27 CDS complement(17903..19072) product FO synthase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DII8 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene cofH sequence088 source 1..19399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5..1390) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 1918..2655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 2888..6484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(6562..9183) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144168.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(9712..11010) product modulator of DNA gyrase PmbA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(11408..12262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 12397..13014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 13163..13903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene ycf23 CDS complement(14106..15230) product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 15596..16396 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602204.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene ybbM CDS 16675..16884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(17046..17516) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44786 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene def CDS complement(17542..17760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(18357..19181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 sequence089 source 1..19356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 535..1404 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880107.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(1592..3241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 3464..5149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(5409..6467) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(6530..6667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 6622..7359 product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055907.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene ccdA CDS 7363..8739 product cytochrome c biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL16 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene ccsB CDS complement(8897..9931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(10471..11460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144162.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(11559..12341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(12757..13293) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963787.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene yncA CDS complement(13456..13854) product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA3 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene queF CDS complement(14141..14539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(14793..15173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(15353..15619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(16108..16356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 16474..16902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(16913..17119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(17307..18803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 18875..19273 product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606465.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 sequence090 source 1..19268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(426..2735) product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056828.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(2992..3978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(3971..5161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 5381..5854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(6017..6988) product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene sds CDS 8549..8713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(9982..10893) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM3 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene murI CDS complement(11327..13234) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056106.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(14462..16345) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056106.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(17309..18736) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056302.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 sequence091 source 1..19251 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 766..1671 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 1769..2620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 2774..3616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702708.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(3842..5542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(5658..7673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(7958..8485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(8717..8974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 9137..9334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 9750..9935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 9939..10316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 10655..11503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 12128..15613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 16178..16549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 16884..17978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 17981..18532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 18573..19055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 sequence092 source 1..19187 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 30..950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 1374..2906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056025.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 3746..4507 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(4945..6528) product extracelullar DNA degradation protein EddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110915.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene eddA CDS 7224..7697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(8499..8789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 9683..11158 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816G8 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene glgA CDS 11608..12540 product ATP adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125113.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene APA2 CDS 13103..13570 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263922.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(14132..14827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(15025..15801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141358.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(15978..16466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(16655..16867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(16966..18936) product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH2 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene acsA sequence093 source 1..19171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(418..1407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(1678..2613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(2744..4906) product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964237.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(4913..5899) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(6113..7117) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476417.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(7397..8671) product teichuronic acid biosynthesis protein TuaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32273 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene tuaB CDS complement(9090..10355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(10359..11717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(12395..12856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142836.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(14549..16336) product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJS8 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene aspS CDS complement(16691..17560) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBM2 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene htpX sequence094 source 1..19163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 304..1692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 3002..5305 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 5253..5708 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 5859..7034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 7432..8142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(8249..9097) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089234.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(9291..9908) product putative HTH-type transcriptional regulator YdeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96676 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene ydeS CDS 10054..11040 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 11247..11558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 11593..12225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 12393..13232 product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227569.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 13296..14174 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674768.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 14257..14955 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140297.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 15163..16050 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 16216..17223 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969365.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 misc_feature complement(17309..>19163) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037121.1:sensor histidine kinase locus_tag LOCUS_18530 sequence095 source 1..19050 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 812..1036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(1735..2310) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(2310..2873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 3257..3454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 3747..5075 product carbon dioxide concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 6038..6730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(7066..7935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 tRNA complement(8683..8759) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(8803..9750) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056905.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(9828..10328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056906.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene ycf36 CDS complement(10325..10786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(10935..11504) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057165.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(11920..13191) product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(14322..15350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 15466..15615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 15678..16475 product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKG4 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene queE CDS complement(17096..17740) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(17820..18377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056409.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 sequence096 source 1..19014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 211..696 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE37 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 1020..1844 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 1854..2774 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057997.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 2799..3809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 3936..6263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 6372..7220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210797.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(7703..8551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(8942..9505) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200504.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene gst-1 CDS complement(9960..11198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 11651..12634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 12751..14166 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQV4 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene gabD2 CDS 14307..15710 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P5 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene hisS CDS complement(16039..17292) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene bme6 CDS complement(17430..18725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 sequence097 source 1..18936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(424..864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(1297..3954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(4119..6050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(6040..9777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(10173..10670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(10941..12452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781030.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(12509..14701) product bacteriocin cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681955.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(15038..15385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(16483..16914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 17183..17713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 17717..18256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 18268..18648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 sequence098 source 1..18877 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(296..595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(881..2038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(2584..4260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 5271..5483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 5553..6338 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN5 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene tatD CDS 7030..10326 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL55 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene rpoB CDS 10451..12328 product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL56 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene rpoC1 CDS 12565..16575 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL57 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene rpoC2 CDS complement(17116..18573) product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7J5 transl_table 11 codon_start 1 locus_tag LOCUS_19050 sequence099 source 1..18831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(182..3142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(3511..4503) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM4 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene pyrB CDS complement(5330..5650) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NM87 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 5920..6258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 6661..7608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 7840..10335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(10582..13170) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 13894..15537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(15520..15777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 16251..17174 product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(17435..18655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 sequence100 source 1..18790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(63..1064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057827.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(1432..1986) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057826.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2259..2630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057825.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(2710..3171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888810.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(3719..4639) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene murQ CDS complement(4840..5232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056170.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 5772..12116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 12414..13430 product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 13971..14138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(14348..14803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(15353..15988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 16423..17160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 17199..18569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 sequence101 source 1..18731 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(89..661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 2378..2998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(3518..3931) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene hspA CDS 4815..5294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(5453..5599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(5787..8339) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGS4 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene mutS CDS complement(8643..9710) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055927.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(10886..11515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 11683..12246 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141158.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 12240..12980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141159.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 13138..13842 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477331.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 14020..15255 product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH57 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene dapL CDS 15570..15758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 15758..15964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 16601..18460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 sequence102 source 1..18706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(495..1004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(1014..1961) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI27 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene thrB CDS 2361..2759 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707321.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 2764..3576 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435784.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(3784..4134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057714.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(4272..5783) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057713.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(5880..6224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057712.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 6626..7801 product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 8144..9292 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 9448..12012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(12300..12467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 12477..13214 product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIT5 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene purC CDS 13335..15590 product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057626.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 16132..16983 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI02 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene lpxC CDS 17119..17649 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TV98 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene fabZ CDS 17856..18671 product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI00 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene lpxA sequence103 source 1..18589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(786..2105) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL33 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 2414..3091 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHX1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 3878..5032 product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 5088..6836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene ycf45 CDS complement(7314..8117) product phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023447.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 8249..9046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125038.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 9126..9512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227585.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(9625..10182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 10283..10849 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087881.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(11240..12049) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(12579..13367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 13593..14945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056738.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(14961..15194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(15485..16210) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140299.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 16297..16989 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140298.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 17140..17784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(18092..18331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 sequence104 source 1..18562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 46..447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 1733..4273 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140331.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 4359..5558 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202642.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(6148..7566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 8432..9571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 9825..10562 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143646.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(10834..12912) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK2 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene ligA CDS 13132..13698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(13719..14381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(14788..15270) product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125616.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 16037..17020 product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056703.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene ycf39 CDS 17269..18186 product NAD kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene nadK1 sequence105 source 1..18476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3299..4501) product tyrosinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976100.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(4823..6001) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143789.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(5998..6573) product siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973245.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(6635..7111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(7141..7362) product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089636.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(7465..7803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(7908..8210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(8221..9708) product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973242.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(9875..10732) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973241.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 sequence106 source 1..18456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2873..3874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 5348..6304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 6510..6836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(7128..7373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(7694..8671) product photosystem reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056697.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(8730..12494) product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAK1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene smc CDS 12698..13303 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(13585..13857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(13823..15187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 15253..15444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 15769..17019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 17087..17278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 17295..18203 product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYN6 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene pqqB sequence107 source 1..18427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..1714) product dolichyl-phosphate-mannose-protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(1966..4437) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU0 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(6106..6339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058280.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(7987..8412) product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF9 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene rbfA CDS complement(8494..8706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057323.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene ycf33 CDS 8953..9630 product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHQ1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 note possible pseudo, frameshifted CDS complement(9578..9769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 10195..11661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(12520..13740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(14264..14914) product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 15033..16424 product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN71 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 17159..18070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124641.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 sequence108 source 1..18303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(161..529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 1643..1888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(2534..3022) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene bcp CDS 3438..3770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(3887..7030) product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(7149..8657) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(8939..9157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 9603..10535 product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085765.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 11028..11786 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND10 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 11904..12695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057694.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 12759..13997 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055994.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(14206..14481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142361.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 14916..15617 product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(15733..16593) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058143.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 16941..17474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056576.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 17863..18228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 sequence109 source 1..18272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 386..829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 1143..3935 product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHU4 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene secA CDS 4689..6095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102844.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(6612..8165) product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 8983..9732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 9861..10496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 note possible pseudo, internal stop codon, frameshifted CDS 10576..11472 product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393187.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 11829..12167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227643.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 12187..13680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 13677..14684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 14946..16076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 16148..17962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 sequence110 source 1..18247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 182..1297 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144084.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 1415..2092 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144083.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(2145..2315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 2356..3615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258026.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 4118..4468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 4739..4963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 4976..6937 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 7315..7767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(7982..8191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 8890..11394 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140434.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(11639..12043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(12366..12887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(12906..14753) product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140428.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(14829..15329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(15360..16421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(16432..17070) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140431.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(17070..17345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(17853..18050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 sequence111 source 1..18202 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 307..2049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 2519..2794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 2998..4287 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057127.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene glgC CDS 5260..6255 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene dnaJ CDS complement(6752..7288) product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057129.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(7804..8415) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene tpx tRNA complement(9015..9090) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(9433..11448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(12304..12765) product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(13029..14168) product putative glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(14844..16835) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(16986..17606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 sequence112 source 1..18151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 685..1884 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(2156..2593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(2799..3026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(3383..3808) product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086045.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 4164..5030 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(5220..5570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 5742..6185 product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271000.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 6730..7773 product protein sphX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(7969..9249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 9665..10135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057333.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(10201..10881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 11057..11719 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056872.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene ycf39 CDS 12189..12869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 12942..14291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(14757..15497) product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBE3 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene menH CDS complement(15651..16022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 16651..17865 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 sequence113 source 1..18099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(792..2150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 2458..4428 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB0 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene dnaG CDS complement(4731..5240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056704.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 5255..5710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(5810..6199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 6461..7672 product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKD7 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene queA CDS 7858..8997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(9385..9834) product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(9862..10290) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 10405..11919 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(12064..12843) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(12898..13635) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL42 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 13781..14473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(14766..15650) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene cdsA CDS complement(15879..16481) product precorrin-6B methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene cobL sequence114 source 1..18098 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(516..1217) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037144.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene psrA CDS 1670..3094 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120143.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 3156..6350 product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120142.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 7004..11362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 11426..17854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 sequence115 source 1..18061 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 349..3249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 3427..4395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 4402..6210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(6460..8103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(8115..8495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(8701..9027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 9232..9483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058260.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 10178..10645 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 11330..11839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(12071..13150) product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228588.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 13308..14990 product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7MBB4 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene groL2 CDS complement(15264..15695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(15838..16662) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9Y9 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 16854..17522 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140299.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 sequence116 source 1..17965 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2932..5298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 5321..6151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 6576..7298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(7439..8104) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705438.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(8392..8979) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223840.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(9132..9833) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 10257..11981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(12265..13305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141411.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(13496..15787) product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141412.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(15784..16209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141413.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 16338..16754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 16742..17080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(17131..17355) product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(17398..17739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 sequence117 source 1..17953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 387..878 product phosphinothricin acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193331.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(1480..2055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(2240..2527) product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141908.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(2524..2790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(3095..3655) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(4046..4702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(5133..9143) product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056126.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene chlH CDS complement(9587..11734) product bacteriocin cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(11731..12579) product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(12610..12867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(13282..13683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(14084..16060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 16353..17639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142706.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 sequence118 source 1..17831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 648..1697 product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF2 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene fbp CDS 2098..3249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 3593..5122 product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF3 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene zwf CDS 5461..6843 product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene opcA CDS 7283..8758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 8898..10655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(10737..11168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(11198..14293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(14727..15260) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIG8 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene infC CDS 15894..16823 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056888.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(16971..17726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 sequence119 source 1..17701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(210..2324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(2368..2559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 2845..4473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 4804..5589 product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(5618..6550) product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103054.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 6567..7772 product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GT3 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene dapL CDS 7888..8094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(8279..9298) product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057238.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 10080..10463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 11248..12414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143653.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 12553..13734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140225.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(13749..13892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 14230..15354 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144332.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(15665..16324) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140806.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 16656..17252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877100.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 sequence120 source 1..17681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1622..3217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 3711..4313 product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969792.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(4664..5485) product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 5574..6485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057461.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 7496..8731 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 9039..10394 product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLT5 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene glmU CDS complement(10482..11435) product isoaspartyl peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(11875..14700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057287.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 15040..16203 product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB7 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene pyrD misc_feature complement(16680..>17681) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846932.1:radical SAM protein locus_tag LOCUS_21940 sequence121 source 1..17650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 189..533 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 703..882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 1262..2320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056519.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 2454..2972 product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056337.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(3554..6100) product cellulose synthase catalytic subunit (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770918.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene wssB CDS complement(6463..8781) product cellulose synthase regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_106173.2 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(8939..10099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(10994..13372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(13369..15303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 15520..16308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(16643..17458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 sequence122 source 1..17560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1400..4648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(5039..5605) product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI91 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene cpcS CDS complement(5743..6426) product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(6746..7309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(7364..7957) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(8066..9499) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057361.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 9565..10086 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(10319..11098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057257.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 11339..12154 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056776.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(12551..13063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(13249..13956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 note possible pseudo, internal stop codon CDS complement(14068..14328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(14330..15172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(15159..16010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(16020..16568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 tRNA complement(17197..17270) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 sequence123 source 1..17525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(225..839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(1171..1950) product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(2208..2705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058114.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(2816..3196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(3613..5649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(5741..7303) product circadian clock protein kinase KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V60 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene kaiC CDS complement(7376..7753) product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V61 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene kaiB CDS complement(7989..8366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 9305..12700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(12912..14720) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125444.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene arnT CDS 14942..15274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene ycf20 CDS complement(15484..16341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(16676..17347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 sequence124 source 1..17524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(580..1317) product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59288 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene pcyA CDS complement(1815..2489) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056125.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(2641..3837) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254458.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 4218..5150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056124.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 5407..5859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056063.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 5868..6299 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224139.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(6400..6870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(7053..7250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 7305..8324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 8285..8653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 8817..8996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(9029..9286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(9495..9908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144373.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(10288..10671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 11667..13238 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 13475..14869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143184.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 14953..15648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143183.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(16171..16398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 16448..17398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 sequence125 source 1..17480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 266..2404 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058305.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 2699..3649 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene rfbB CDS 3838..5223 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(5296..5784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 5988..6125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(6242..7480) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957913.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(7863..8654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140639.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(9239..9784) product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023351.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(9781..10155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(10427..11677) product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH31 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(11984..13327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(13375..13965) product IS607 family transposase ISTko1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(14124..15845) product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058297.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene mutL misc_feature complement(16331..>17480) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897221.1:transposase locus_tag LOCUS_22660 sequence126 source 1..17405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 232..1878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141468.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 2123..3109 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143431.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 3272..4060 product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143432.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(4389..6791) product general secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058177.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(6942..7691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058176.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(7688..8449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058175.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(8455..9561) product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058174.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene pilM CDS complement(10861..12159) product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056045.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene folC CDS complement(12393..12554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(12730..13260) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056687.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 13514..14026 product TIGR02652 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058200.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 14101..14553 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057581.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 sequence127 source 1..17382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057537.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 689..1042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(1113..3398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143158.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(4619..5662) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143157.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 6998..8875 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 8992..9423 product photosystem I reaction center subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A420 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene psaD CDS 9926..10762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208554.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(10895..11425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 note possible pseudo, internal stop codon CDS complement(11589..12386) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(12681..13721) product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 13865..14782 product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(15371..16012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266385.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(16009..17265) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 sequence128 source 1..17329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(254..664) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 752..1957 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP7 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene pgk CDS 2395..3018 product putative ADP-ribose pyrophosphatase YjhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0SPC3 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene yjhB CDS complement(3227..3688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(3897..6107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(6452..8176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 8664..10223 product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142005.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(10312..14265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(14265..15836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(16312..17172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 sequence129 source 1..17313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(982..1797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(1934..2398) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057290.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 3487..3765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 4294..4470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057571.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(4557..5954) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLW0 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene argH CDS complement(6077..6328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(6379..7155) product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057031.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene cpmA CDS complement(7501..9270) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(9371..9847) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC4 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene ispF CDS complement(10055..10753) product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM2 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene trmD CDS 11464..12327 product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P3 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene cphB CDS 12573..15197 product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058004.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(15274..15453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 16084..16503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(16557..16907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 misc_feature complement(16795..>17313) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964010.1:alginate O-acetyltransferase locus_tag LOCUS_23170 sequence130 source 1..17257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(933..1151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(1886..2068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(2065..2493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(2548..5112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(5115..6272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(6244..7176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(7486..10806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(11058..11444) product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(11444..12127) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(12124..13188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 note possible pseudo, internal stop codon, frameshifted CDS complement(13337..13990) product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(13987..15564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(15637..16143) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(16328..16690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(16734..17174) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 sequence131 source 1..17214 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5415..5750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 note possible pseudo, frameshifted CDS 6110..7831 product putative diflavin flavoprotein A 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJY2 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene dfa1 CDS 7948..9660 product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141774.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(10757..11578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(11900..12940) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227640.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(13337..14446) product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614684.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(14565..15569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(15651..17027) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVA6 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene hemL sequence132 source 1..17212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(21..293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058031.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(335..1225) product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL01 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene trpC CDS complement(1372..2808) product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056712.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(2920..3522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(3667..5940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 tRNA complement(6824..6911) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 7008..7376 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 7588..8076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 8274..9098 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 9587..10543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 10540..11778 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD8 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene hisZ CDS 12221..12454 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057929.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(12543..12908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 13103..13402 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(13616..14881) product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59112 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene pcxA CDS complement(15592..16692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 sequence133 source 1..17211 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 71..391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(892..1557) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(1668..2888) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140351.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 3229..3684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 3939..4376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(4516..5295) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene dltE CDS 5843..6493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(6818..7177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(7498..7938) product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258015.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(8285..9193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 9582..9887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(10391..12034) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057661.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene ilvB CDS complement(12103..13470) product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(14049..15029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 sequence134 source 1..17097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(624..2810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(2837..3754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(3764..4444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(4861..5280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(5416..7236) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 7590..8432 product primosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057597.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 8511..8927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142917.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 9488..11419 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140600.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(11655..12737) product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(12770..13960) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(14079..14951) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141972.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(15356..16225) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143303.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(16322..17041) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 sequence135 source 1..17011 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 1424..3640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 3844..4926 product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056246.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(5006..6286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057293.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(6659..7591) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKE4 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene rnz CDS complement(7979..9373) product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene mnmE CDS 9689..9892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(10185..10811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 11210..12577 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(13044..13547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142230.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(13654..14166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142229.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(14166..15152) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL96 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene yidC CDS complement(15557..15949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 note possible pseudo, frameshifted CDS complement(15936..16358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 note possible pseudo, frameshifted sequence136 source 1..17007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(228..545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 636..1952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393799.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 2115..3407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 4063..5391 product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459224.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 6381..8063 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(8284..8985) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(9234..10415) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(10494..11852) product devB secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 11978..12826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(13011..13781) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266205.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 14333..15190 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462954.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 sequence137 source 1..16997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 254..1456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 1516..2151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142166.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 2931..3959 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 3961..6417 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126413.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(6607..7026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(7173..8483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(8675..10660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(10660..11388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(11388..11723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(11707..12336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(12320..12574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(12576..13058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(13070..13540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(13546..14289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(14379..14606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(14593..14847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(14844..15443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(15397..15801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(16174..16392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 sequence138 source 1..16941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 656..1744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 1758..2987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 3145..3528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 3583..4959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889590.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 5164..5754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 6242..8104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 8347..10461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(10911..11306) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140008.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(11451..12575) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125726.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene proP CDS complement(12716..13729) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAP0 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(14069..15472) product putative pyridine nucleotide-disulphide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705587.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(15891..16601) product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140007.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 sequence139 source 1..16896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(63..1226) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(1499..2107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(2255..3232) product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030519.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(3317..4627) product devB secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(4653..5228) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124477.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(5463..6215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141905.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(6654..7721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 8529..10004 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene glcD sequence140 source 1..16812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 603..1823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 2154..2507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(2750..4069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143874.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(4038..4577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 4698..6044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143874.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 6764..7048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 7073..7702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144203.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(7794..8216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(9282..9737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(9867..10262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(10510..10767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 11180..13267 product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7H2 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene fusA2 CDS 13693..14121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(14532..15110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 15642..16385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 sequence141 source 1..16729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1422..1826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(1887..3620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(4190..4555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(4798..5148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(5239..5376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(5373..5630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(5630..6655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(7141..9471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(9497..10291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(10308..10475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(10887..11048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(11124..11387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(11387..11545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 11941..12135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 12128..12367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 12516..12764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(12887..16261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(16353..16661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 sequence142 source 1..16695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 42..2183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(2923..3750) product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256575.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(4179..6155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(6635..7336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(7665..9191) product light-independent protochlorophyllide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC6 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene chlB CDS 9782..9985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 9988..10635 product cell wall assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525294.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(10875..11417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(11643..12551) product glutamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142777.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(12692..13048) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9L1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene rplT CDS complement(13108..13305) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH01 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene rpmI CDS 13386..13916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 14109..15302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(15480..16571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 sequence143 source 1..16657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 126..413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 427..918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 note possible pseudo, internal stop codon CDS 952..1305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 note possible pseudo, internal stop codon CDS complement(1622..2530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(3624..4508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142464.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 4608..6731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 7036..7308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142024.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 7305..7679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 7679..10987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 11026..12057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 12063..12794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 13029..13751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 repeat_region 14711..15603 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttgaaattcaaattaatcccttttagggattgaaa CDS 15824..16306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 sequence144 source 1..16646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058305.1:sodium:proton antiporter locus_tag LOCUS_25070 CDS complement(3190..4680) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(4772..5299) product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene ctaE CDS complement(5636..7321) product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMM5 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene ctaD CDS complement(7607..8494) product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIL9 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene ctaC CDS complement(8644..9243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140740.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(9243..9743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140739.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(11401..12045) product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene ctaE CDS complement(12238..13965) product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMM5 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene ctaD CDS complement(14155..15069) product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIL9 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene ctaC CDS complement(15325..15924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140740.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(15924..16424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140739.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 sequence145 source 1..16606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 93..482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 688..2454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142898.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 2983..3429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 3501..4316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 4666..5667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 5726..5962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 6206..7786 product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene speE1 CDS 7888..8481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 9111..9635 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055903.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene fur CDS complement(9853..9987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(10107..11138) product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(11294..12583) product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC8 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(12647..12841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 13006..13527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(14009..14458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141484.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(14499..16484) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 sequence146 source 1..16378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 116..1891 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595064.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene ggt CDS complement(2082..2336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140743.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(2783..3376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728496.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(4201..4410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(4618..4920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(4886..5482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 note possible pseudo, frameshifted CDS complement(5891..6961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 note possible pseudo, frameshifted CDS complement(8196..9716) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055969.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(10477..10701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(11609..12478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 12613..12891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 14281..14952 product chitooligosaccharide deacetylase NodB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144237.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(15148..15504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 sequence147 source 1..16375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 190..645 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 749..1231 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142677.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(1432..2319) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920384.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(2558..3880) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120048.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(3915..6518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(6728..9865) product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120142.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(9880..11193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887384.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 11330..11866 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(12118..13749) product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD4 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene groL CDS complement(13871..14182) product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TV92 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene groS CDS 15277..15924 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 sequence148 source 1..16315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 130..1077 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143278.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 2220..2681 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948097.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 2777..3682 product inward rectifier potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(3867..4544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057488.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(4730..5821) product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU4 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene hrcA CDS complement(6142..6501) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055899.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 6869..8473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 8841..9332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 9516..10328 product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK8 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene cysE CDS complement(10684..11118) product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H2VFJ7 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene rnhA CDS complement(11123..11704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 11906..13141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 13314..14282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 14288..15370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 15573..15791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144012.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 sequence149 source 1..16300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(155..1339) product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD9 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene ndhH CDS 1868..3088 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(3116..4609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 5030..5317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532573.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 5381..6286 product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH87 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene rsmH CDS complement(6703..7425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(7434..8330) product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144354.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 8595..10400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 10633..11901 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228175.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 12252..13331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(13446..15143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(15314..16093) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408189.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 sequence150 source 1..16260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(60..302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 304..2202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142700.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 2825..3175 product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJY3 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene clpS CDS 3181..3510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057100.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(3574..3855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144346.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(4379..4867) product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 5690..8497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 8655..11966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 12269..12715 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 12733..14628 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFU0 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 14998..15393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140146.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(15563..16105) product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ7 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene pyrR sequence151 source 1..16251 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2755..3549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(3833..6337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(6876..8279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143874.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(8301..8909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(9328..10581) product nitrogenase molybdenum-iron protein beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20621 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene nifK CDS 10688..12076 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124678.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 12831..14222 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124678.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(14604..14903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 sequence152 source 1..16194 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(27..1112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(1714..3039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140919.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(3226..3891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 4698..6854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142653.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(6977..7123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(7116..7322) product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022341.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(7693..9327) product preprotein translocase subunit Tim44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 9752..10339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(10469..11758) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLJ0 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene gdhA CDS complement(11842..12942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 13243..13434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 14064..15872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 sequence153 source 1..16096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 191..1267 product magnesium-protoporphyrin IX monomethyl ester [oxidative] cyclase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI68 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene acsF2 CDS 1413..1841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(2244..2708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(2834..5788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(5814..7169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 7656..7937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 8231..10306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 10299..11588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 11816..12070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 12460..15078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(15226..15474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 sequence154 source 1..16001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 133..657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(782..4249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(5248..7107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(7248..7634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(8118..8483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(8650..9129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(9126..9317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(9347..9592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(9821..10000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 10257..11255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 11252..11515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 11519..11773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 12134..12439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 12464..13036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 13485..14873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 15236..15889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 sequence155 source 1..15932 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 439..2157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 2379..3419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(3603..5063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 5651..6442 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705617.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 6756..7025 product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143493.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 7114..7389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 7386..7763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 7984..8238 product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 8245..8511 product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143493.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 8521..8814 product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141908.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(8842..12009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 12424..12666 product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 12813..13238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 13736..14656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 sequence156 source 1..15842 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(283..639) product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKV4 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(737..1150) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172548.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(1929..2537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(2707..3192) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057261.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 3612..4949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 5078..5548 product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531618.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 5675..6496 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 6726..7382 product SanA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462605.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 7819..11100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(11222..13111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 13205..15727 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM14 transl_table 11 codon_start 1 locus_tag LOCUS_26690 sequence157 source 1..15781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1285..2253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 2274..2720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(2801..3364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(3515..5125) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK13 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene ilvD CDS 5684..6655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 6766..7386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228758.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(7582..8217) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979013.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(8357..9121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(9535..9681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 9889..10437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 10769..11200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 12014..12844 product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE4 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene hemC CDS 13357..14775 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU2 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene glgA sequence158 source 1..15766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..805 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948654.1:MBL fold hydrolase locus_tag LOCUS_26830 CDS 1294..3798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(4195..4734) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SW2 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(4956..5693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 6137..6751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(6772..6957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 6980..7324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265866.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 7964..8740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140925.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(9032..9208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 9278..10471 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(10526..11803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 12670..14121 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056280.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene phrA CDS 14681..15595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 sequence159 source 1..15531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 251..1336 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59029 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene leuB CDS 1432..1692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056328.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 1811..2638 product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL0 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 3524..4495 product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE7 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene accD CDS complement(4867..6453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 7631..8173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(8181..9167) product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(9612..10619) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI38 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 12089..12523 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056992.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 12913..13734 product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141847.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(14166..15278) product geranylgeranyl bacteriochlorophyll reductase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058112.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 sequence160 source 1..15516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1229..2023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(2252..3400) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057372.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(3470..5335) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(5614..6624) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141068.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(6933..8153) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141067.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(8248..9432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141066.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(9571..10803) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141065.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 12534..13982 product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG8 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene atpD CDS 14162..14575 product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG7 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene atpC sequence161 source 1..15498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 541..801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(873..1079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 1637..2353 product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056220.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene ho1 CDS 2798..4180 product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI70 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene hemN1 CDS 4657..6429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(6771..8279) product lignostilbene alpha-beta-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055870.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(8692..10125) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055871.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 10297..10527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(10624..11901) product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(12082..12849) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMH9 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(13013..13582) product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ41 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene ycf4 sequence162 source 1..15354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 104..763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 1795..2670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 3245..5020 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(5550..5987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(5990..7309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 7732..9216 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC4 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene gatB CDS 10432..11742 product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN4 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene argJ CDS 12291..13622 product oxidoreductase FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530417.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 13800..14849 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141174.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 sequence163 source 1..15351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 446..1369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(1329..1796) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140110.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene ycf52 CDS complement(2324..2719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056714.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(2890..3861) product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB9 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene secF CDS complement(3858..5276) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB8 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene secD CDS complement(5653..6636) product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(7239..7583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(9221..9562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 9697..11298 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGV7 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene prfC CDS 11520..13787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 14634..15125 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057352.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 sequence164 source 1..15194 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1195..1944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(2023..3576) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089032.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene hlyD CDS complement(3723..6452) product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(6457..7101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 7649..11590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 11600..15154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 sequence165 source 1..15163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 377..1537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(1789..3111) product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 4446..5468 product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL5 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene plsX CDS 5594..6586 product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL4 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene fabH CDS 6778..7656 product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMS0 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene fabD CDS 7752..8390 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR9 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 9102..9404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943940.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(9677..10186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27600 tRNA complement(10902..10976) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(10993..12111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143082.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(12973..13800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143597.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(13972..14799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143597.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 sequence166 source 1..15148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(380..1567) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM4 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 2359..2856 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 3384..4679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057105.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 4752..5246 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057106.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 5360..6499 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC5 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 7232..8350 product NAD(P)H-quinone oxidoreductase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL32 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene ndhA CDS 8442..9023 product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL31 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene ndhI CDS 9146..9748 product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene ndhG CDS 9897..10202 product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL29 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene ndhE CDS 10207..11130 product NAD kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RR32 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene nadK2 CDS complement(11187..11576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(11968..12750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(12861..13214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 13378..13572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(14049..15041) product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 sequence167 source 1..15102 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(589..810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(1007..1399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(1416..1934) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889035.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 2337..2672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141134.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 3455..5482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 5479..6042 product oligoketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125274.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 tRNA complement(6104..6177) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 6821..8743 product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057278.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(8710..9345) product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8M7 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene petB CDS complement(9433..10125) product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057817.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 10955..12643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(12980..13333) product plastocyanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125233.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene petE CDS complement(13523..13780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 13935..14228 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140281.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 14194..14586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 sequence168 source 1..15052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 273..1223 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 1285..2994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(3203..4084) product succinyl-CoA synthetase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879674.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(4725..5957) product succinyl-CoA synthetase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869705.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 6917..7666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 7689..8834 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 9734..11485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(11929..14244) product cell division protein Ftn2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056603.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 sequence169 source 1..15045 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(266..1744) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI74 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene cobQ CDS complement(1973..2377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(2698..3621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(3656..4837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(5142..6635) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141779.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(6692..7540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(7615..8424) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(8596..10251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(10294..11238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(11446..12909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(12979..13968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 sequence170 source 1..15019 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(72..704) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 800..1090 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888273.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(1075..1575) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003091.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(1578..2042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920353.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 2425..3327 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156746.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 3447..3905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206995.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(4045..5445) product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9N7 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene mgtE CDS complement(5573..6217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(6225..6575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(6572..7306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 7616..8206 product 4-diphosphocytidyl-2C-methyl-D-erythritol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 8304..8918 product fibrillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 9186..12101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 12423..12860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(13207..14751) product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene merA sequence171 source 1..15007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(333..863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(1154..1663) product putative HTH-type transcriptional regulator YetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31541 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene yetL CDS complement(1913..2251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(2403..3665) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH91 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene nifS CDS complement(3925..5280) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(5280..6068) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(6161..7597) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene ycf24 CDS 7822..8490 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056342.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 8585..8845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(9094..9423) product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN47 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 10133..10756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(11300..12667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(13371..15005) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene nadE sequence172 source 1..14953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 203..1423 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 1487..2200 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(2329..2967) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024041.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(2942..3919) product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA9 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene queG CDS 4136..4654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057109.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 4848..5255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(5321..5761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056629.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(6016..6453) product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(6457..8133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(8323..9036) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 9669..10520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 10630..11379 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140651.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(11413..11991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(12388..12969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 13463..14362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141368.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(14621..14932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 sequence173 source 1..14912 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 172..2823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 3536..5356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 5708..7630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(7739..8677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057334.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 9983..10384 product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143701.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 10427..10909 product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143700.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 10983..13010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140457.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 13320..14675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143704.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 sequence174 source 1..14892 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3328..4614 product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143064.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene glcE CDS 4754..6106 product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCA7 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene glcF CDS complement(6211..7575) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(7610..7846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(7837..8928) product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141720.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(9321..9962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 note possible pseudo, internal stop codon CDS complement(9981..10505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28700 note possible pseudo, internal stop codon CDS 10562..10750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 10973..11227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 misc_feature complement(11362..>14892) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase locus_tag LOCUS_28730 sequence175 source 1..14815 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(156..1442) product phycocyanin operon protein Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene cpeY CDS complement(1649..2143) product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141189.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene cpeA CDS complement(2222..2776) product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141190.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene cpeB CDS complement(3091..3996) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141255.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(4147..4956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141258.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 5224..5787 product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL67 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene cpcS CDS 6278..8026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(8214..8405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 8472..9992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(10427..11341) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141255.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 11909..12910 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393451.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 13151..14632 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252764.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 sequence176 source 1..14809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(543..2420) product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI39 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene uvrC CDS complement(2669..3091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(3616..4179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(4590..5795) product succinyldiaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143457.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(6057..6389) product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818650.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene trxA CDS complement(6775..7563) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057529.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(7731..8420) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene pspA CDS complement(8691..10001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 10119..10670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056696.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 11215..11511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(11944..12777) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG66 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene menB CDS 13244..14632 product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143683.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 sequence177 source 1..14774 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(406..1074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(1309..2376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(2369..2923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(2920..3924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(4022..4963) product CRISPR-associated RAMP protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258158.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(5256..5681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(5907..7238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(7396..8139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(8136..10490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 10797..11333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(11406..11744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(12212..13039) product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703658.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(13276..13977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 14200..14346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 sequence178 source 1..14696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 331..3003 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056205.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(3601..7182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 7386..7865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 7914..8357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 8435..9643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 9668..10033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(10262..10906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(12042..12623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(12781..14418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104215.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 sequence179 source 1..14675 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(252..1079) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932754.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(1412..2020) product IS607 family transposase ISSto13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980553.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 2402..4003 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(4034..5275) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091709.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 5798..5977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(6008..7078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 8200..9654 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHI6 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene ffh CDS 9951..10214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 10174..10614 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055894.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 11372..12325 product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 12649..13050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056319.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(13321..14388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 sequence180 source 1..14641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 7788..14333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29330 sequence181 source 1..14625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 564..764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(908..1369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388762.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(1480..2091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(2279..2758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(2938..3528) product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene ctaE CDS complement(3845..4255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(4572..5954) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124678.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(6069..6917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 note possible pseudo, internal stop codon CDS 7589..8716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 8721..9698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(9875..10126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 10959..11135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(11069..12487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(12490..12819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(12946..13932) product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE8 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene ctaC sequence182 source 1..14591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1178..1960) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143437.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 2189..2812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057912.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(3148..5097) product peptidase S9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140278.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 5586..6236 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958400.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 7252..8253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 8842..9261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(9329..9697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(9579..9866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29560 note possible pseudo, frameshifted CDS complement(9838..10152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 note possible pseudo, frameshifted CDS complement(10199..10804) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene leuD CDS complement(10992..12401) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFV7 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene leuC CDS 13170..13784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 13772..13954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 14260..14442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 sequence183 source 1..14568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 174..1919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 1922..2941 product chemotaxis response regulator protein-glutamate methylesterase of group 3 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXT8 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene cheB3 CDS 2970..4436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 4834..7731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 8080..8742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(9226..9720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 10303..10869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(11201..12715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(12720..14369) product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142825.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 sequence184 source 1..14554 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1409..2032 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(2417..3421) product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142928.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(3682..4209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(4295..5329) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530538.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(5427..5762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(5855..6607) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene cysH CDS complement(6691..7866) product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK26 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene sat CDS complement(8133..9923) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903944.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(10514..11404) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(11660..12937) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123037.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(13018..14214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 sequence185 source 1..14426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 15..452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(1051..2196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(2746..3705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(3979..4767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(5835..7625) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903944.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 9019..9573 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN99 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene cysC CDS 9701..10888 product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK26 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene sat CDS complement(11102..12991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(13251..14069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 sequence186 source 1..14418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1008 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141685.1:two-component sensor histidine kinase locus_tag LOCUS_29920 CDS 1293..1688 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272733.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 1791..3722 product zinc-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393690.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 4064..4624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 4697..6190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(6211..8601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 9073..10842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 10988..11422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 sequence187 source 1..14410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1479..1925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(1940..2587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056977.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(2746..3936) product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056978.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene ndbB CDS 4149..4499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886888.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(4487..5260) product circadian oscillation regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056401.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(5445..6722) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056402.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene pilT CDS 7722..9857 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142623.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene recQ CDS 10836..12065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057902.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 12834..13805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 sequence188 source 1..14388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2796 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141955.1:type I polyketide synthase locus_tag LOCUS_30090 CDS 3231..4850 product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142825.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 5115..6626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 7105..8379 product ceramide glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122407.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 10490..11743 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 12028..13194 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 13268..13951 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 sequence189 source 1..14378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2039..2257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(2493..4790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(4937..8926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 9674..12283 product ferrichrome-iron receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140317.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 12700..13944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 sequence190 source 1..14337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..1930) product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142261.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(2017..2895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528117.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(3159..3353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(3503..5527) product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(5929..6243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(7005..7268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 tRNA 7902..7973 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 9033..11243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(11387..11866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(12335..13432) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966332.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 misc_feature complement(13439..>14337) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000922020.1:glycosyl transferase locus_tag LOCUS_30300 sequence191 source 1..14225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(826..1998) product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene moeB CDS complement(2227..2712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 3094..3783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 4228..6222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 6294..8360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(8605..9825) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(10306..11307) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS 11879..13420 product NAD(P)H-quinone oxidoreductase chain 4 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY0 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene ndhD1 CDS complement(13490..14104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 sequence192 source 1..14179 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 233..391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 778..1875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 2076..2591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 2846..6736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(6863..7702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(7844..12862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(13232..14164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 sequence193 source 1..14170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(258..521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(829..1746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(1743..2948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(3305..3436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(3508..5013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(5010..6089) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868132.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(6191..6352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(6693..6998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(7158..7403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(7434..7796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(8026..10791) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387994.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS complement(10850..13942) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931303.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 sequence194 source 1..14162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 678..905 product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHG5 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(2494..2979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(3016..3873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 6352..11214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 11198..11980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 12400..14115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 sequence195 source 1..14146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 127..3744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(3759..4514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(4664..6829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 7518..7967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 7973..9352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 9934..10185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 10276..11673 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124678.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 12052..12633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 12644..12784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 12815..13039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 13026..13364 product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P779 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene mazf9 sequence196 source 1..14140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 169..1560 product alkaline invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 1661..2140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(2311..2949) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141001.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 3270..6710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(6764..7288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(7600..7764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 7999..8250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 8247..8633 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 8638..8784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(8909..9745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(9785..12430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(12684..13685) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 sequence197 source 1..14076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 453..920 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 1797..2306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057148.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(2303..2749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056323.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 3073..3432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 4462..6798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 6979..7638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 7782..8900 product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057271.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(9198..9971) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene gloB CDS 10552..11739 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768296.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 11830..14076 product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142193.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 sequence198 source 1..14009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 369..1439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 1688..3811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(3957..4151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(4237..4881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 5334..6797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 6941..8308 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057372.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 8429..9694 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057373.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene pyrC CDS 9714..10130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 10118..10450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 10521..11156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144095.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(11341..11508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(11695..12003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(12288..13799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene crtH sequence199 source 1..14005 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 495..800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(854..1552) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene surE CDS complement(1736..3214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 4021..5445 product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431680.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS 5654..10090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 10123..10566 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ62 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene ureE CDS 10544..11233 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ63 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene ureF CDS 11322..11915 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ4 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene ureG CDS complement(12066..13862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058248.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 sequence200 source 1..13855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 272..487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(824..1444) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW5 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene pyrE CDS 1548..1979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 tRNA complement(2075..2147) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 2381..3034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055926.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 3428..4663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(4766..5455) product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI59 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene queC CDS 6473..7609 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057568.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 8643..9794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 9800..10315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 10911..12347 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057360.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 12477..13049 product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHZ6 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(13142..13480) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene glnB sequence201 source 1..13838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1161..2045) product lipoyl synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLC2 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene lipA2 CDS 2281..2484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 2811..3419 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058037.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 4023..9773 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(10286..11020) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030956.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(11160..12749) product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222804.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(12862..13575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555960.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 sequence202 source 1..13831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(310..1302) product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056558.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(1759..4332) product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLX1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(4648..7029) product putative phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLX2 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(7820..8416) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9R4 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene rimM CDS complement(8603..9886) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057579.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene avtA CDS complement(10315..10716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS complement(10713..11381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142966.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 11861..12976 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056993.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 sequence203 source 1..13815 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(206..1129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(1253..1945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(2064..2483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 2746..4029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 4073..7324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(7383..8066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(8063..8560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(9109..9798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(9788..10897) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085739.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(10897..12405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS complement(12640..13692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31570 note possible pseudo, internal stop codon sequence204 source 1..13781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 494..1696 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544567.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 1911..3056 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973141.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(3153..3479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 3674..4951 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC8 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene ahcY CDS 5708..6196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 7552..7950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144333.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 8505..8855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057913.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(8905..9909) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene fmt CDS 10723..12072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(12568..12870) product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene minE CDS complement(12901..13707) product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE2 transl_table 11 codon_start 1 locus_tag LOCUS_31680 gene minD sequence205 source 1..13741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 229..1488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947950.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 1690..2913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947951.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 3037..3669 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTB9 transl_table 11 codon_start 1 locus_tag LOCUS_31710 gene upp CDS complement(3837..4478) product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH6 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene trmB CDS 4709..5809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057388.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(5837..7057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS 7357..7656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 8653..9243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057787.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 9706..10005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058081.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 10861..12489 product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA5 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene guaA CDS 12677..13300 product IS607 family transposase ISTko1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 sequence206 source 1..13736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(505..1593) product IS element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_454711.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(2529..4079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 5067..5663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 5745..6467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(6605..8161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 9613..9954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 10077..11423 product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566866.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 11568..12854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 sequence207 source 1..13694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 47..220 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccctaccgattgggttaaatcggattagttggaaa CDS 361..585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 582..740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 1144..2157 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405402.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 2488..3642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 4707..4952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 4952..5749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(5821..6453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 6777..8567 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 9950..10669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 10566..13337 product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 sequence208 source 1..13691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 167..979 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(1230..1532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(1630..2598) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056885.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(2699..3178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(3812..4216) product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCJ4 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene spoIIAA CDS complement(4427..5593) product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU5 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene carA CDS 6209..7432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 8432..10267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 11830..12111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 12505..13524 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404555.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene nce sequence209 source 1..13689 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 113..1333 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLW9 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene ackA CDS complement(1576..2667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(2679..2927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 3708..4493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058196.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 4859..7885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058009.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(8236..9891) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142407.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 tRNA complement(10629..10702) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(10831..11193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057286.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(11246..11722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(12199..12435) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK60 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene rpoZ CDS complement(12608..13678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32170 sequence210 source 1..13686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 379..1305 product cobalamin biosynthesis protein CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259515.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 1298..1960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 2238..3035 product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DN5 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 3235..3552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 4014..4490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 5164..5826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140730.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(6071..8485) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QZ84 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 8840..9094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(9004..10134) product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHY0 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene recF CDS complement(10270..13131) product magnesium-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 sequence211 source 1..13681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 359..1408 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309930.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene ydcM CDS complement(1607..1981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(2623..3837) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK29 transl_table 11 codon_start 1 locus_tag LOCUS_32300 gene ispH CDS complement(4012..4851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 4790..5080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(5311..6615) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCB8 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 7405..9021 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056013.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 misc_feature complement(9322..>13681) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase locus_tag LOCUS_32350 sequence212 source 1..13659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(165..326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(547..3549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(3781..3996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(4386..5048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(5782..7191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 7414..8823 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124678.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(9118..9360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 9409..10782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143874.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 11677..11829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(11872..12051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(12243..13412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 sequence213 source 1..13610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 606..821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141741.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(1016..2302) product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(2476..3705) product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK70 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene ispG CDS complement(4400..5875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 6121..7122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(7208..7960) product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083253.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 8676..9887 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(10004..10348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057859.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(10563..11108) product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL3 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(11500..12147) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL91 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene ispD CDS 12447..13388 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057967.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 sequence214 source 1..13561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(162..1856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(2396..3301) product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIA2 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene hslO CDS 3638..4027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143307.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(4114..4770) product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056611.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(5144..5608) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057639.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(5755..6798) product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728943.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(7035..8063) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140956.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(8389..9723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057642.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(9931..10365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057567.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS complement(10834..11412) product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene cobU CDS 11587..12387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 12562..13491 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257508.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 sequence215 source 1..13555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(709..4680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 5316..5696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 6186..7226 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 7675..8586 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124827.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(8793..9314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 9298..9819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 9988..10728 product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 11014..13416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 sequence216 source 1..13510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(530..994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056684.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 1390..2124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(2329..2736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 3404..4654 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057131.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(4707..5225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(5468..5773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(6481..7182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(7381..8037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 note possible pseudo, frameshifted CDS complement(8096..8734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(9113..9898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(10188..11696) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058059.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 sequence217 source 1..13508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 321..1274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(1469..2431) product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729098.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 2678..4240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057082.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(4297..4503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056763.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(5590..8730) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK04 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene infB CDS complement(9490..10866) product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHL2 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene nusA CDS complement(10985..11167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(11224..11688) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHL1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene rimP CDS complement(11891..13303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057693.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 sequence218 source 1..13434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(66..1865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(1894..2724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(2953..4656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057554.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 5076..5267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(5264..5545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(5959..7458) product (6-4) photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CH39 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene phrB CDS 7789..8295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(8818..9255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(9236..10177) product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 gene ispE CDS complement(10170..10988) product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59157 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene rsmA CDS 12108..12524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 12645..13016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 sequence219 source 1..13430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 587..1828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 2066..3157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 3469..3870 product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLK3 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(3906..5396) product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057063.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene menE CDS complement(5433..6443) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP8 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene menC CDS complement(6725..7543) product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW6 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene menA CDS 7931..9352 product menaquinone-specific isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057055.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(9989..11299) product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene proA CDS 12159..12641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(12842..13165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 sequence220 source 1..13343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 241..723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS 957..1319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144314.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 1815..2603 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144315.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS 2578..3858 product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141636.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 4243..5274 product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141637.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 5727..6254 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056033.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene folK CDS 6299..7018 product bifunctional dihydropteridine reductase/dihydrofolate reductase TmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172549.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 7091..7984 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082506.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS 8024..9196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS 9310..9972 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 10064..11398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(11448..11624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 11743..13275 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860982.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene opuCC sequence221 source 1..13269 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(17..661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143006.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS complement(863..1060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(1240..2559) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057422.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(2665..3735) product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKJ7 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(4968..5489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057249.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 6503..7546 product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL15 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene hemF CDS 7781..8146 product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D91 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene rsbV CDS 8560..9261 product protein Thf1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJT8 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene thf1 CDS complement(9333..9695) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057146.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(9890..10624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(10925..11710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 11929..12246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 12396..13208 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257811.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 sequence222 source 1..13205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(395..2482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056981.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 2640..2873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(3119..4732) product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056694.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS 5155..5526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 5929..7977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 8241..8420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055918.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 8681..10912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(11444..12631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 12876..13049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33540 sequence223 source 1..13204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 680..1093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701719.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(1545..1718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(2427..3587) product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNL4 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene bioF CDS complement(3766..4404) product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene ruvA CDS complement(4401..5147) product sucrose-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143827.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(5956..6699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 7028..8101 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938278.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 8329..8958 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379705.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS 9041..12901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 sequence224 source 1..13202 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(181..822) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142214.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(2425..2628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS 3617..7117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 7234..8697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 tRNA 8757..8827 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(9057..9860) product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCZ3 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene pstB CDS complement(10101..10994) product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG4 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(11025..11987) product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCZ1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene pstC misc_feature complement(12097..>13202) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NIZ8:phosphate-binding protein locus_tag LOCUS_33710 sequence225 source 1..13131 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(69..368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 1770..2579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057555.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(2784..3140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(3312..6044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(6330..8735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(8732..9976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(9981..11498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS 12517..12810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 sequence226 source 1..13092 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(103..1449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(1710..3602) product arachidonate 15-lipoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G8 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene loxA CDS 4086..4772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 4897..6057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(6124..7506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 8114..8374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(8641..9501) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732449.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS complement(9636..10223) product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(10473..11378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933730.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(11893..12060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 12278..12454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 misc_feature complement(12524..>13092) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EHZ2:peptide deformylase 2 locus_tag LOCUS_33910 sequence227 source 1..13089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 515..1300 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(1438..2901) product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK65 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene gatA CDS 3204..4577 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057904.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene dnaE CDS 4862..5407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(5935..6102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS 6709..8019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227755.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 8245..9771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 10092..11240 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(11520..12062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 12465..13046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34010 sequence228 source 1..13058 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2051 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase locus_tag LOCUS_34020 CDS complement(2452..3558) product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(3881..4270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS 5022..7193 product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU9 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene topA CDS complement(7450..8346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 8526..9524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 9761..10030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06715 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene yisB CDS complement(10978..11934) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709054.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(12288..12788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 sequence229 source 1..12961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(99..722) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS 1539..1745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 1766..3370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS 3407..4669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS 4768..5022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 5019..5366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 5434..6420 product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057563.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS 6672..6869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(7018..7392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 7482..8702 product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529988.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 8867..9400 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MY1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS 9759..11375 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 11765..12766 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056663.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 sequence230 source 1..12936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(171..2540) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056029.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene recJ CDS complement(2581..3438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056927.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 3657..4322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(4547..4753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057514.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(4766..5329) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIB4 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene def CDS complement(5869..6207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(6800..8161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 8602..9423 product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMW7 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(9456..9845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(9842..12394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34330 sequence231 source 1..12911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(264..1181) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG6 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene prfB CDS complement(1722..2456) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056315.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 2927..3592 product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene sigF CDS complement(3913..5547) product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(5961..6932) product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L85 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene dusA CDS 7339..7950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(8090..10120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 10472..11629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS 12268..12870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34420 sequence232 source 1..12908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(362..910) product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM64 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene frr CDS complement(897..1625) product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM63 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene pyrH CDS complement(1695..2231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 3188..4096 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141217.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS complement(4358..5671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058187.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(6079..6471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 6786..7799 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055927.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS complement(8168..9502) product serine protease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 9767..12151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 sequence233 source 1..12771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 509..1516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS 1553..3031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056673.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 3707..3907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 4028..8851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS 9114..9461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142926.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(9609..11492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(12218..12634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34580 sequence234 source 1..12732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141154.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 1332..2183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS 2188..5892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 6092..8755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(8949..9440) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJT5 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene ruvC CDS 9620..11017 product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHJ8 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 11569..12069 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142985.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 sequence235 source 1..12731 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 354..1136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(1418..3727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227744.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(3809..4555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 5646..6728 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225697.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 6767..7495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 7761..9173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 sequence236 source 1..12688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(407..1621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142861.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 2055..2888 product delta-9 desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057556.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene desC3 CDS complement(3101..5566) product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083030.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(6018..6221) product phycobilisome 7.8 kDa linker polypeptide, allophycocyanin-associated, core inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50036 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene apcC CDS complement(6606..7091) product allophycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50031 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene apcB CDS complement(7321..7806) product allophycocyanin alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50030 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene apcA CDS complement(8134..10932) product photosystem I reaction center subunit X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058198.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene apcE CDS complement(11350..12123) product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008992035.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 sequence237 source 1..12646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(143..400) product phycobilisome 8.9 kDa linker polypeptide, phycocyanin-associated, rod inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50035 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene cpcD CDS complement(440..1300) product phycobilisome 32.1 kDa linker polypeptide, phycocyanin-associated, rod inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50034 transl_table 11 codon_start 1 locus_tag LOCUS_34810 gene cpcC CDS complement(1599..2417) product phycobilisome 32.1 kDa linker polypeptide, phycocyanin-associated, rod inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50034 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene cpcC CDS complement(2597..3085) product C-phycocyanin alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50032 transl_table 11 codon_start 1 locus_tag LOCUS_34830 gene cpcA CDS complement(3149..3667) product C-phycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50033 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene cpcB CDS 4305..9701 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(10162..11148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(11508..12455) product putative UDP-glucose epimerase YtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34886 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene ytcB sequence238 source 1..12643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 204..602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 556..1152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS 1161..1424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 1408..1626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 1640..2476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS 2540..3040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 3050..3535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 3770..4834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 4836..6848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 7091..8389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 8653..9003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS complement(9182..9391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(9391..10758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256724.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 note possible pseudo, frameshifted CDS complement(10755..11420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 sequence239 source 1..12642 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(459..803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(857..1909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(2037..3005) product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537568.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(3719..4639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(4774..5214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 5138..5311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(5424..5723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 6540..7370 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH2 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene dapB CDS 7512..8372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(8453..8746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 9321..10094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS 10790..11248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 11599..12441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142803.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 sequence240 source 1..12599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1006..1476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 1718..2200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 2231..2932 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582912.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 2982..4301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 4626..5624 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056675.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 gene sigB CDS 5636..5764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(5737..6084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 6218..6748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 6808..7572 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 7621..8910 product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 9132..9527 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807906.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 9628..11556 product zinc-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393690.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 11595..12218 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404339.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 sequence241 source 1..12586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 332..1117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 1405..1695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 2150..3196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(3314..4531) product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 gene gltP CDS 5837..7642 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 tRNA complement(7985..8058) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(8204..9520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 9749..10543 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 sequence242 source 1..12551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(766..1461) product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZU3 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene cobI CDS complement(1458..2081) product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193154.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 gene cobH CDS 2403..3287 product 2-hydroxy-6-oxohepta-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS complement(3327..4052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142459.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(4101..4325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35390 note possible pseudo, internal stop codon CDS 4598..5932 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(6136..6492) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966797.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(6986..8848) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144195.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(8887..9279) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(9276..11477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS complement(11582..12382) product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59288 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene pcyA sequence243 source 1..12522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(315..887) product pili assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056853.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS 1119..1751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140697.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS 1888..3312 product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM2 transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS 3601..4488 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056948.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 4657..5205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS 5332..6243 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058188.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS complement(6390..6818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS complement(6934..8589) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT7 transl_table 11 codon_start 1 locus_tag LOCUS_35530 gene pyrG CDS 8658..10433 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057611.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 sequence244 source 1..12497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3381..3629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(4689..6086) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124678.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(6495..7391) product nitrogen fixation protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BM9 transl_table 11 codon_start 1 locus_tag LOCUS_35570 gene nifU CDS complement(7546..8754) product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene nifS-1 CDS complement(8929..9381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS complement(9416..10705) product FeMo cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06770 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene nifB CDS 10736..12124 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124678.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 sequence245 source 1..12434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(362..1399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS complement(1558..2439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(2653..3171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(3156..3491) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 3878..5473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057114.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(6122..7324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS complement(7799..8404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 8461..9927 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142768.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS complement(10023..11366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 sequence246 source 1..12406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 218..1441 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 1604..1861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35720 note possible pseudo, internal stop codon CDS 2174..2848 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 4475..4912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125900.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS 4976..5209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(5210..6301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 6672..6974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS 7197..8084 product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071881.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS 9168..9398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS 9530..12109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35800 sequence247 source 1..12398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(463..1974) product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528010.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS complement(2499..3044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS complement(3615..4628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 4720..5445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(5515..6408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(6409..8085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(8352..9392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(9436..10794) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403192.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS 10979..12202 product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 sequence248 source 1..12390 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 80..529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(729..2120) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083861.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS complement(2140..2754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS complement(2882..3073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 3261..3809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 3890..4129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 4465..5451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(5769..7298) product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(7616..9046) product sodium:glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056889.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS 9103..9648 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS 9757..10332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144386.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(10532..10999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 11295..11639 product pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene phhB sequence249 source 1..12359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(482..1063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(2125..5109) product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJM9 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS 5351..5635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS 6567..6785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 7018..7689 product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN8 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(7763..9049) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI53 transl_table 11 codon_start 1 locus_tag LOCUS_36080 gene hemA CDS complement(9252..10289) product D-fructose 1,6-bisphosphatase class 2/sedoheptulose 1,7-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE9 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 10736..11431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS 11603..11920 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 sequence250 source 1..12353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(461..1069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS 1361..1975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS complement(2018..3787) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNY7 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene recN CDS 4243..6243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056794.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS 6510..6731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 6721..6933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020810.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 7376..9166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 9313..9759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 10358..11713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36200 sequence251 source 1..12330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2404..3276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142464.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 3525..4775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS 4802..5818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 5964..6734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS 6724..9003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 9130..9969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 10244..10756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 10826..11830 product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEP2 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene cas1 CDS 11921..12205 product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDC5 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene cas2 sequence252 source 1..12294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(85..1227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(1414..3060) product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(3516..4796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 5936..7066 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085156.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene exoZ CDS 7063..8100 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837707.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene galE1 CDS 8260..9465 product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(9902..11146) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529544.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS complement(11227..12231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36370 sequence253 source 1..12273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1310..3676) product transcription activator GutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39143 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene gutR CDS 4281..4799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 5014..5313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(5515..11079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(11279..11911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105970.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 sequence254 source 1..12248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 239..1711 product bifunctional pantoate ligase/cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG73 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene panC/cmk CDS 2550..2750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 2817..3275 product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 3356..3700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 3757..3963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140926.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 4086..5114 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY2 transl_table 11 codon_start 1 locus_tag LOCUS_36480 gene purM CDS 5458..6144 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056089.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(6523..7686) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056182.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS complement(8064..9572) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058069.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(9745..10677) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPH1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 gene recO CDS complement(10838..11521) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJZ1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 gene deoC sequence255 source 1..12240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(880..1398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 3921..5522 product 60 kDa SS-A/Ro ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUW8 transl_table 11 codon_start 1 locus_tag LOCUS_36550 gene rsr CDS 5833..6804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 7363..7623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(8171..8698) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140132.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 9617..12097 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729174.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 sequence256 source 1..12192 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 394..1047 product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB8 transl_table 11 codon_start 1 locus_tag LOCUS_36600 gene folE CDS complement(1404..2417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 2894..3034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 3347..6229 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142684.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 6587..9133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 9170..9520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(9517..10134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(10285..11136) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(11230..12156) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 sequence257 source 1..12182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1068..1937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS complement(1990..4461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056216.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(4757..6028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS complement(6321..6995) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 7776..8048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 8209..9387 product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK26 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene sat CDS 9500..11707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057163.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 sequence258 source 1..12150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2758 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525338.1:outer membrane autotransporter barrel domain protein locus_tag LOCUS_36760 CDS complement(2887..3963) product magnesium-protoporphyrin IX monomethyl ester [oxidative] cyclase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ05 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene acsF1 CDS complement(4221..4949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS complement(5081..6487) product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59109 transl_table 11 codon_start 1 locus_tag LOCUS_36790 gene trmFO CDS 6634..7302 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948395.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS complement(7693..8343) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141890.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(8687..9280) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS complement(9484..9924) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS complement(10200..11909) product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141774.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 sequence259 source 1..12146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 207..2078 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG5 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene ftsH CDS 2256..3575 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201931.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS 3742..4170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS 4182..4631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS complement(4839..10850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36890 sequence260 source 1..12140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(108..1457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS complement(1508..2440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS complement(2709..4151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(4237..5550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(5798..6670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS complement(6727..7014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141943.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(7092..8072) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141945.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(8057..9814) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 10346..11767 product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 sequence261 source 1..12124 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(101..1300) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 1628..1807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(1920..2108) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCZ9 transl_table 11 codon_start 1 locus_tag LOCUS_37010 gene rpsU CDS complement(2658..2966) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(3416..4678) product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59322 transl_table 11 codon_start 1 locus_tag LOCUS_37030 gene argD CDS 5169..6245 product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140935.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(6725..7279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(7592..7798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057172.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(7881..8285) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055910.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS complement(8445..9092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(9213..10379) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056491.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 sequence262 source 1..12072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(172..693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 2055..3215 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 gene pntA CDS 3434..3721 product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS 3877..5277 product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene pntB CDS 6101..6685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 7401..7868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 7924..8484 product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267269.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS complement(8624..9619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS complement(9660..10739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS complement(11512..11850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37190 sequence263 source 1..12045 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 127..2406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS complement(2474..3001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 3939..5597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143446.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 5723..6448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 6560..7678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(7815..8525) product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJF2 transl_table 11 codon_start 1 locus_tag LOCUS_37250 gene rpiA CDS 8709..9491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS 9834..11741 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL74 transl_table 11 codon_start 1 locus_tag LOCUS_37270 gene dxs sequence264 source 1..12032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(278..2170) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene ilvG CDS complement(2552..3811) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057231.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(3970..4590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS 5107..6225 product protoporphyrin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP87 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 6524..7636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37320 repeat_region 8564..8817 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tctttacatacctcttcccctcaacggggatggaaacg CDS 9402..11126 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097733.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 repeat_region 11250..11861 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttacaaaccaattcccctcagcggggatggaaac sequence265 source 1..12023 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..2624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS complement(2923..3075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 3514..4062 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056278.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 4682..9433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(9769..9945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS complement(9949..10896) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459306.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(11050..11613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886848.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 sequence266 source 1..11976 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(537..962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS complement(1127..1591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS complement(1588..2436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37430 tRNA complement(3259..3330) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 3883..4809 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJW4 transl_table 11 codon_start 1 locus_tag LOCUS_37440 gene argF CDS 4958..5602 product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VAW7 transl_table 11 codon_start 1 locus_tag LOCUS_37450 gene lexA CDS 6123..7604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 8482..8667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 8664..10730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 10868..11341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37490 sequence267 source 1..11925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 184..816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181592.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 gene ynaE CDS complement(1997..3400) product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN8 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene murD CDS complement(3484..5634) product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGX0 transl_table 11 codon_start 1 locus_tag LOCUS_37520 gene glyS CDS 6074..6640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS complement(6768..7085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS complement(7165..7359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS complement(7735..8649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807011.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(8649..10526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064744.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS complement(11066..11539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS complement(11607..11801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37590 sequence268 source 1..11802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS complement(739..951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 1089..1562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS complement(1640..2554) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 gene rps1 CDS complement(3126..3866) product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 4073..5059 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144236.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(5400..6296) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS complement(7323..8675) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDN9 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene clpX CDS complement(8685..9269) product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI2 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene clpP1 CDS complement(9710..11158) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDP0 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene tig sequence269 source 1..11773 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 210..1418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258620.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS 1856..4240 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0L9 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene hypF CDS 4540..4794 product hydrogenase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816727.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene hypC CDS 5066..6193 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225639.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 gene hypD CDS 6285..6500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS 6768..7868 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene hypE CDS 8107..8448 product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225637.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene hypA CDS 8439..9272 product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene hypB CDS complement(9438..9620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 10533..11633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37790 sequence270 source 1..11680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(133..1308) product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL79 transl_table 11 codon_start 1 locus_tag LOCUS_37800 gene sigA CDS complement(3568..5508) product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL50 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene gyrB CDS 5838..6779 product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM5 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene miaA CDS 7312..8058 product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(8266..9015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143833.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(9075..9863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(9883..10593) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 misc_feature complement(10846..>11680) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970686.1:methyltransferase locus_tag LOCUS_37870 sequence271 source 1..11640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 29..1621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701838.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS 1899..3887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701839.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS 4068..4454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701840.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS 4686..6155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701841.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 7034..7438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 7581..7805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS 7825..8319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 8666..9424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 10706..11617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 sequence272 source 1..11597 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(355..1014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS complement(1656..1871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS complement(2487..5015) product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143331.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(5636..6778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS complement(7112..7660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(8015..9229) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268208.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 9785..11506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38030 note possible pseudo, internal stop codon sequence273 source 1..11571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1579..4428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(4719..5408) product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNE0 transl_table 11 codon_start 1 locus_tag LOCUS_38050 gene plsY CDS complement(5744..6991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056951.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(7405..7797) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056952.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS complement(8188..8985) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS 10040..10858 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 10958..11410 product chorismate mutase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHZ0 transl_table 11 codon_start 1 locus_tag LOCUS_38100 gene aroH sequence274 source 1..11566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 641..991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(1145..1735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(2347..3414) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS 4486..5268 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057622.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS 5421..6296 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141460.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS 6558..8054 product RTX toxin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705262.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 gene rtxD CDS 8241..8714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(9167..10642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38180 sequence275 source 1..11563 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(295..891) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS complement(1123..2103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55650 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(2168..3304) product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865056.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS 3713..4519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(4682..4867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS 4936..5991 product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970710.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(5968..7596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS complement(7691..8368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 8539..9399 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056400.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS 9620..10294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS 10501..10803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS 10992..11294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38300 sequence276 source 1..11547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(94..1926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(2197..4806) product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530161.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS complement(5031..5789) product guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876603.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS complement(5779..6228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(6502..7890) product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030574.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(8061..8342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(8335..8598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS 8983..10032 product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ26 transl_table 11 codon_start 1 locus_tag LOCUS_38380 gene fni sequence277 source 1..11535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(220..1977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(2141..2953) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057314.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS complement(2954..3967) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS 4397..6478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS 6687..7514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS complement(7726..9258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140407.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 9840..10970 product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHK2 transl_table 11 codon_start 1 locus_tag LOCUS_38450 gene thiE CDS 10957..11166 product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056654.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 gene ycf40 sequence278 source 1..11498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(73..477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS 791..1123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS 1395..2000 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS 2086..3489 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 4093..4389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS 4585..7917 product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS 8080..9162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141214.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS complement(10203..10742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(11097..11339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38550 sequence279 source 1..11473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(525..1703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS complement(1730..3064) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103412.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS complement(3595..4755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS complement(5662..6627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS complement(6645..8231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS complement(8316..8846) product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3G5 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene kdsC CDS complement(8846..9685) product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61655 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene kdsA CDS complement(9685..10425) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY2 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene kdsB CDS complement(10422..11369) product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243982.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 sequence280 source 1..11473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(528..1919) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG51 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene asnS CDS complement(2041..2451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS 2499..2786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(2874..3326) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057301.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS complement(3756..5141) product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKB7 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS 5353..5838 product allophycocyanin-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057391.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene apcD CDS 6555..7901 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 8026..8664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS 9203..10360 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM42 transl_table 11 codon_start 1 locus_tag LOCUS_38730 gene hisC CDS complement(10380..10934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38740 sequence281 source 1..11470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1563 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705192.1:sulfatase family protein locus_tag LOCUS_38750 CDS 1713..2195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS complement(2509..3096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704431.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS complement(3521..5359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(5508..6242) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057285.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 gene ycf63 CDS 6826..7782 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS 8148..8759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(8767..9984) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 sequence282 source 1..11438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 392..1051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS complement(1230..1610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056206.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(1755..2933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS 4465..6396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS complement(6827..7894) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS complement(8039..8758) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH89 transl_table 11 codon_start 1 locus_tag LOCUS_38880 gene rnc CDS complement(9581..10297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS complement(10316..11026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS complement(10983..11159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38910 sequence283 source 1..11375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1124..2872 product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880206.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS 2860..3981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 4060..4866 product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082339.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS 4869..5261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS 5426..7099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(7344..8366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(9064..9582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38980 sequence284 source 1..11332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1683..7106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS complement(7136..7525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 9011..9229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39010 misc_feature complement(10075..>11332) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056970.1:serine/threonine protein kinase locus_tag LOCUS_39020 sequence285 source 1..11320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 115..465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 729..2039 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS complement(2201..2665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS 3394..4098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 note possible pseudo, frameshifted CDS 4122..4352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS complement(4524..5003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS complement(5110..5442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS complement(5453..6184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39100 note possible pseudo, frameshifted CDS complement(6408..7376) product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537568.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS complement(7624..9489) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083788.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 9858..10628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 sequence286 source 1..11270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(237..1130) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510956.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS 1214..1726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142174.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 1785..4796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS 5131..5784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS 6392..7360 product FO synthase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR6 transl_table 11 codon_start 1 locus_tag LOCUS_39180 gene cofG CDS 8709..10076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39190 sequence287 source 1..11247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 460..627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS 998..3022 product glycogen debranching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143985.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS complement(3342..4703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS 5578..7134 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS 7237..8409 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125074.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 gene salY CDS 8545..10044 product type I secretion outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958458.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 10491..10661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39260 sequence288 source 1..11222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 767..2401 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS complement(3343..5064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057893.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS complement(5889..6854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS complement(6868..7335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS complement(7994..8572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS 9636..9869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS complement(10209..10400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS complement(10550..11020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39340 sequence289 source 1..11201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 170..2182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS 2683..3033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 3478..4380 product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFX8 transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(4488..5153) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS complement(5706..6770) product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFS8 transl_table 11 codon_start 1 locus_tag LOCUS_39390 gene rsgA CDS 7720..8184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 8360..9073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057843.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 9377..10816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39420 sequence290 source 1..11177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1808..6106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(6193..7497) product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FC6 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS complement(7760..8275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS complement(8401..10035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS 10642..10839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39470 sequence291 source 1..11157 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(509..1852) product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865056.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(2674..4419) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(4428..4682) product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172914.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS complement(5004..5660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(6531..7124) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS 8004..8966 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H5 transl_table 11 codon_start 1 locus_tag LOCUS_39530 gene argC CDS complement(9059..9229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS complement(9399..9935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS complement(10161..10928) product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMQ7 transl_table 11 codon_start 1 locus_tag LOCUS_39560 gene rsmG sequence292 source 1..11122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 107..1060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056857.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 1140..1685 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269321.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(1875..3482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS 3991..4875 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 gene rfbD CDS 5385..6257 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS 6529..7626 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS complement(7719..9488) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 9987..10877 product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 gene crtR sequence293 source 1..11112 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..579 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250792.1:IS607 family transposase ISTko2 locus_tag LOCUS_39650 CDS 625..1179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS complement(1350..1640) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143844.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS complement(1654..2217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS 3319..3789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS 4013..5191 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142380.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 6007..6882 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537992.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 7402..7755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS 7737..10769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39730 sequence294 source 1..11068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(730..2451) product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI64 transl_table 11 codon_start 1 locus_tag LOCUS_39740 gene ribA CDS 2705..3763 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59312 transl_table 11 codon_start 1 locus_tag LOCUS_39750 gene argC CDS complement(4225..5778) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS complement(6544..7359) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002027497.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 gene fabG CDS complement(7624..8904) product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL40 transl_table 11 codon_start 1 locus_tag LOCUS_39780 gene eno CDS 9304..10920 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057086.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 sequence295 source 1..11062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(442..2094) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124214.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 gene arnT CDS 2364..3008 product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS 3411..3920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056084.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS 4277..5167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056085.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(5247..5765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS complement(6714..7478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(7739..10834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39860 sequence296 source 1..11056 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(631..876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142102.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(1219..1596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 1841..4459 product chaperone protein ClpB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ40 transl_table 11 codon_start 1 locus_tag LOCUS_39890 gene clpB1 CDS 6368..8080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS 9030..10481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057275.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS complement(10670..10972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39920 sequence297 source 1..11037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 37..996 product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI7 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene cysK CDS complement(1190..2689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS complement(3023..3901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS complement(4449..4892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142941.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS complement(5127..6008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS 6628..7947 product devB secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS 8074..9249 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS 9447..10166 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 sequence298 source 1..11017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 647..5899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS 6503..9481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS 10513..10962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40030 sequence299 source 1..10998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 86..571 product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLR8 transl_table 11 codon_start 1 locus_tag LOCUS_40040 gene tadA CDS 688..1458 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056649.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(1737..3776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 4011..4610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS 4965..5222 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS 5372..5695 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI5 transl_table 11 codon_start 1 locus_tag LOCUS_40090 gene ycf64 CDS complement(5940..6188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141287.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS 6894..7703 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(8074..8847) product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532420.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS 9277..10458 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 sequence300 source 1..10933 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 297..1217 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG6 transl_table 11 codon_start 1 locus_tag LOCUS_40140 gene prfB CDS 2126..2665 product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIK0 transl_table 11 codon_start 1 locus_tag LOCUS_40150 gene ybeY CDS 2803..3264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS 3724..4323 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 gene trpG CDS 4324..5106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057312.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS complement(5297..6100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141905.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS complement(6303..7583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS 7776..8273 product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389455.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS 8551..9105 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS 9296..9877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141674.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 sequence301 source 1..10929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(777..2069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS complement(2076..4457) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819015.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene hsdR CDS 4739..4939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 5075..5389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS 5485..7269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS complement(7778..7996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS 8176..10023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40300 sequence302 source 1..10924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(924..1229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125696.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 1537..1917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS complement(2040..2312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS complement(2476..5562) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X5 transl_table 11 codon_start 1 locus_tag LOCUS_40340 gene ppc CDS complement(5677..5916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 6141..9074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS 9201..10703 product putative alginate O-acetylase AlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887Q6 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene algI sequence303 source 1..10910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 431..1567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058078.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS 2225..4720 product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS 5237..6280 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187699.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS 6481..6951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS 7049..8251 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140060.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS 8433..9443 product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIZ8 transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS complement(9822..10910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40440 sequence304 source 1..10904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 262..1872 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS 2222..3535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS 3956..9013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40470 sequence305 source 1..10841 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(196..1029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40480 note possible pseudo, frameshifted CDS complement(1011..1556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40490 note possible pseudo, frameshifted CDS complement(1776..1928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS complement(2654..3403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS complement(3714..3899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS complement(3928..5298) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS complement(5344..9537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40540 misc_feature complement(9714..>10841) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141962.1:dimethylaniline monooxygenase locus_tag LOCUS_40550 sequence306 source 1..10835 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(244..1011) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN7 transl_table 11 codon_start 1 locus_tag LOCUS_40560 gene hisF CDS 1321..2430 product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGP9 transl_table 11 codon_start 1 locus_tag LOCUS_40570 gene ruvB CDS 2717..3523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS complement(3650..4957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119646.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS complement(5539..6327) product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056155.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS 6507..6824 product putative 30S ribosomal protein PSRP-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59327 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS 7992..8627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387862.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS 8672..9016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969314.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS 9144..10619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40640 sequence307 source 1..10833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(96..323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS complement(432..875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS complement(1114..1302) product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143465.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS complement(1483..3117) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS complement(3114..3383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125345.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS complement(3705..4082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS complement(4244..5332) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 gene aroC CDS complement(5538..5708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(5905..6654) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140297.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS complement(6873..7523) product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222779.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS complement(7547..8305) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS 8483..9424 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887534.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS 9430..9747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS complement(9888..10163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249916.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS complement(10156..10410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40790 sequence308 source 1..10818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1046..1603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS 1869..2591 product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI45 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 2816..3883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056632.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(4019..4237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS 4769..5020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS complement(5284..5910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS complement(6127..6471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS 6841..7899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40870 sequence309 source 1..10798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(95..1477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS 1691..2236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106538.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS 2754..6395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS complement(6986..7825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 8042..8608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS complement(9333..10673) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 sequence310 source 1..10788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(283..3483) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975001.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 5250..6116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS 6390..6800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS complement(6961..8979) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URV2 transl_table 11 codon_start 1 locus_tag LOCUS_40970 gene fusA CDS complement(9344..10648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40980 sequence311 source 1..10773 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 29..1558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 gene crtH CDS complement(2548..3081) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101141.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS complement(3749..4585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS complement(5602..7800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS 8384..10144 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056407.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS 10268..10591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41040 sequence312 source 1..10725 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 171..2061 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccaactaatccgaattaacccaatcggtgggg CDS complement(2281..2556) product CRISPR-associated endoribonuclease Cas2 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJV5 transl_table 11 codon_start 1 locus_tag LOCUS_41050 gene cas2-3 CDS complement(2640..4775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(5066..5662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(5676..7196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS 8065..8445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS 8448..8876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 9374..9739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS 9886..10086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS 10358..10507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41130 sequence313 source 1..10716 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1078..2907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS complement(3128..3796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS complement(4595..5641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS complement(6128..6343) product NAD(P)H-quinone oxidoreductase subunit O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFI1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 gene ndhO CDS complement(6506..7531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS complement(7625..7843) product photosystem I reaction center subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFW6 transl_table 11 codon_start 1 locus_tag LOCUS_41190 gene psaE CDS complement(8196..8786) product fibrillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS 9009..9260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 9321..10439 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK95 transl_table 11 codon_start 1 locus_tag LOCUS_41220 gene mraY sequence314 source 1..10707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(327..1760) product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLC0 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS 2170..2946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS 3411..6422 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI7 transl_table 11 codon_start 1 locus_tag LOCUS_41250 gene ileS CDS complement(6717..7601) product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701079.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS complement(7761..8417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS complement(8766..8978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS 9235..9540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS 9763..10515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41300 sequence315 source 1..10668 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS complement(322..540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS 813..1013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS 1118..1354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS complement(1609..1788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS 3626..5626 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816805.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS 6221..6409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS 6473..6691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS 6763..7536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS 7746..9827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS complement(10002..10622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41410 sequence316 source 1..10603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(719..1003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS complement(1175..2224) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS complement(2467..2985) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH9 transl_table 11 codon_start 1 locus_tag LOCUS_41440 gene apt CDS 3999..4625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056685.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS 4622..6049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS complement(6520..8787) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057331.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS 9237..10196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41480 sequence317 source 1..10602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 358..936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS complement(1065..1370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141186.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 gene cpeR CDS complement(1553..2176) product chromophore lyase CpcT/CpeT 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD3 transl_table 11 codon_start 1 locus_tag LOCUS_41510 gene cpcT3 CDS complement(2272..2790) product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD4 transl_table 11 codon_start 1 locus_tag LOCUS_41520 gene cpeS CDS complement(2881..3138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS complement(3534..4295) product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141265.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 gene cpeE CDS complement(4474..5220) product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141264.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 gene cpeD CDS complement(5260..6129) product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141263.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 gene cpeC CDS complement(7122..7601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS 8171..8782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS 9347..9574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS complement(9920..10159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41600 sequence318 source 1..10508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(607..1173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS 1747..2094 product period-extender gene product inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057790.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS 2159..2680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143752.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS 3145..3324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS complement(4117..4437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS 4717..6027 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056050.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS complement(6082..7323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057279.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS complement(8164..8826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS complement(9496..10320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41690 sequence319 source 1..10465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(593..1756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS 1907..3355 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW6 transl_table 11 codon_start 1 locus_tag LOCUS_41710 gene cysS CDS 3579..4622 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287791.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS 5417..6706 product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056233.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS 6924..8270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056219.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS 9062..10096 product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525363.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 tRNA complement(10125..10196) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 sequence320 source 1..10426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(12..164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS 303..737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS 751..1470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS 1567..1905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS 1966..2631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS 2738..3319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS 3336..4766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS 4914..5495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS complement(5650..6153) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142301.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 6536..6874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS complement(7158..7577) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS complement(7574..7858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS complement(8053..8712) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140995.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 gene xer CDS 8951..9166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS 9169..9390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41900 sequence321 source 1..10411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(364..1095) product galactosyl-1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125542.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 gene wcaJ CDS complement(1205..2365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS complement(2521..2820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(2886..3104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS 3416..4357 product mRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 transl_table 11 codon_start 1 locus_tag LOCUS_41950 gene wcaG CDS 4775..5989 product hypothetical monooxygenase, FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703349.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS complement(6018..6467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS complement(6833..7354) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS 7576..8982 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141457.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 gene aspA CDS 9179..10150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056713.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 sequence322 source 1..10402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(338..1411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS 1525..2259 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS 2329..3228 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143303.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS 3312..4553 product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558755.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS 4800..5225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS complement(5318..5935) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404339.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 6130..8403 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS 8421..8630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS 8751..8954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS complement(9319..9528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS complement(9583..10092) product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704904.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 sequence323 source 1..10383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2003..3370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS complement(3627..3905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141943.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS complement(3935..5779) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS complement(5931..7241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS complement(7678..7974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS complement(8337..8570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS complement(8561..9397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42180 misc_feature complement(9625..>10383) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142246.1:IS4 family transposase locus_tag LOCUS_42190 sequence324 source 1..10381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(272..1825) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 gene crnA CDS complement(2130..3668) product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 gene nirA CDS 3990..5237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS 5565..7961 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA7 transl_table 11 codon_start 1 locus_tag LOCUS_42230 gene purL CDS 8158..9660 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA6 transl_table 11 codon_start 1 locus_tag LOCUS_42240 gene purF sequence325 source 1..10370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(21..1631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(2026..2751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058095.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS complement(2921..3475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS 3607..4014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS complement(4378..5289) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59303 transl_table 11 codon_start 1 locus_tag LOCUS_42290 gene argB CDS complement(5459..6004) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH7 transl_table 11 codon_start 1 locus_tag LOCUS_42300 gene aroK CDS complement(6041..7648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS 8136..8330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS complement(8356..8955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS complement(9582..10199) product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN84 transl_table 11 codon_start 1 locus_tag LOCUS_42340 gene ubiX sequence326 source 1..10237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(99..380) product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096161.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS 1274..3088 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057670.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS complement(3618..4061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42370 CDS complement(4230..5003) product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N3G7 transl_table 11 codon_start 1 locus_tag LOCUS_42380 gene rutB CDS 5207..6604 product hydroxyatrazine ethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223813.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS complement(6606..8018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42400 misc_feature complement(8384..>10237) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase locus_tag LOCUS_42410 sequence327 source 1..10226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(381..1205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS complement(1736..5869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS complement(6259..7011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS complement(7445..8155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS 8604..9332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS complement(9374..9547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42470 misc_feature complement(9609..>10226) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P50038:phycocyanobilin lyase subunit beta locus_tag LOCUS_42480 sequence328 source 1..10188 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 133..894 product CDP-3, 6-dideoxy-D-glycero-L-glycero-4-hexulose-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056807.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS 914..1243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS complement(1561..2514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS complement(2601..4373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS complement(4422..4910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS complement(5332..9993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42540 sequence329 source 1..10154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 58..372 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttacaaaccccttatccctaatagggatggaaac CDS 1284..1868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS complement(2036..2806) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS complement(3548..6415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS complement(6869..8752) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056770.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 sequence330 source 1..10147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1174..2457 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH33 transl_table 11 codon_start 1 locus_tag LOCUS_42590 gene glyA CDS 3191..4003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532837.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS 4762..6201 product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057401.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 gene pds CDS 6215..7117 product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057400.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 gene pys tRNA 7247..7335 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(8537..9307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42630 sequence331 source 1..10101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS complement(936..1646) product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK22 transl_table 11 codon_start 1 locus_tag LOCUS_42650 gene pyrF CDS complement(1778..2968) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 gene tyrS CDS 3144..5069 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055904.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS complement(5210..5533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057879.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS 6452..6826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS 7101..7634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42700 CDS complement(7881..8450) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS3 transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS 9244..10041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42720 sequence332 source 1..10055 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 303..1100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS 1162..1818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS 1945..3510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS 3827..4306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS complement(4503..6185) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIC3 transl_table 11 codon_start 1 locus_tag LOCUS_42770 gene lnt CDS complement(6260..6460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS complement(6799..9426) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ59 transl_table 11 codon_start 1 locus_tag LOCUS_42790 gene gyrA sequence333 source 1..10044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056984.1:transposase locus_tag LOCUS_42800 CDS complement(746..1102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS 1271..1510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS complement(1656..2429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS 2762..3115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS 3248..5062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS 5493..6950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS 7106..10006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42870 sequence334 source 1..10013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(707..2344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142439.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS 3092..3448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056711.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 gene ycf57 CDS 3535..3957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143379.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS 4102..4347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056709.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS complement(4458..5378) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS 5633..5980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057889.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS complement(6473..6979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS complement(7208..9625) product P-type ATPase transporter for copper inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124308.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 gene zntA sequence335 source 1..10007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 861..1640 product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 gene sigF CDS 1823..2773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS 2777..3022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS 3222..6302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS 6904..7461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS complement(8090..8338) product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP0 transl_table 11 codon_start 1 locus_tag LOCUS_43010 gene psbE CDS complement(8469..9437) product Ycf48-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI95 transl_table 11 codon_start 1 locus_tag LOCUS_43020 sequence336 source 1..9986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 60..2150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS 3090..3356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS complement(3811..4248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS complement(4507..5340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS 5619..6581 product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG92 transl_table 11 codon_start 1 locus_tag LOCUS_43070 gene uppP CDS 6912..7901 product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG92 transl_table 11 codon_start 1 locus_tag LOCUS_43080 gene uppP CDS 8091..9413 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057484.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 sequence337 source 1..9986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 576..1937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS 3489..3755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS 4065..4520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43120 CDS 5107..6000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS 6340..7890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS 7934..8659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43150 sequence338 source 1..9953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(132..1136) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN2 transl_table 11 codon_start 1 locus_tag LOCUS_43160 gene prk CDS 2462..3733 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93RE3 transl_table 11 codon_start 1 locus_tag LOCUS_43170 gene petH CDS 3822..5159 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM46 transl_table 11 codon_start 1 locus_tag LOCUS_43180 gene thrA CDS 5854..7062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS complement(7898..8338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057805.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS complement(9308..9763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43210 sequence339 source 1..9942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 643..1185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS 1175..1861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS 1858..3348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS complement(3612..3971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS complement(3971..4288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS 4535..5038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142733.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS 5035..5577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS 5631..6161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS 6699..7559 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087234.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS complement(7986..8150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43310 sequence340 source 1..9924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 257..934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43320 CDS 985..1914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS 2797..7404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS 7608..8444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43350 sequence341 source 1..9910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1659..2702 product iron stress-induced chlorophyll-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK20 transl_table 11 codon_start 1 locus_tag LOCUS_43360 gene isiA CDS 2767..3732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS 4848..5357 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNU5 transl_table 11 codon_start 1 locus_tag LOCUS_43380 gene isiB CDS 5473..6525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS complement(6864..7100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS 7452..7667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS complement(7604..7972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS 8163..9167 product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057358.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 sequence342 source 1..9899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 524..1489 product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528925.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS complement(2305..2517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS 2703..2933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS 3214..4542 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826423.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 gene ydcM CDS complement(4911..7679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS complement(7749..8897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43490 sequence343 source 1..9872 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1196..4246) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056416.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS complement(4368..7193) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056417.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS complement(7256..7759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056418.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS complement(7764..8141) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS complement(8217..9299) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056420.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 sequence344 source 1..9850 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(81..3647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43550 CDS 4107..4526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43560 CDS 4821..5687 product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA6 transl_table 11 codon_start 1 locus_tag LOCUS_43570 gene aroE CDS 6283..8007 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS 8186..9613 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056302.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 sequence345 source 1..9838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(130..1260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS complement(1415..2620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS complement(2860..3270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS complement(3280..3870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226677.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS 4356..6191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS 6802..8934 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS 9177..9500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS 9518..9817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43670 sequence346 source 1..9825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1844..4900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS complement(5075..8638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43690 misc_feature complement(8838..>9825) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110104.1:non-ribosomal peptide synthetase locus_tag LOCUS_43700 sequence347 source 1..9818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 201..872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS 926..1168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS 1615..2469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS 2469..2654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS 2796..3566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS 3754..4410 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHL9 transl_table 11 codon_start 1 locus_tag LOCUS_43760 gene msrA CDS complement(4460..5521) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGD6 transl_table 11 codon_start 1 locus_tag LOCUS_43770 gene rfbB CDS complement(5665..6657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS complement(6991..7410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS complement(7449..8267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 sequence348 source 1..9808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS complement(642..1151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS 1547..1750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS 2570..5668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS complement(5843..6025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS 7229..8110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43860 sequence349 source 1..9807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2521..2943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS complement(3155..3661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS complement(3645..3947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141200.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS 4054..5187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS complement(5323..5973) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706105.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS 6227..7366 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091709.1 transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS complement(7430..8176) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125719.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS complement(8412..9221) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125718.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 sequence350 source 1..9783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 388..1302 product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK36 transl_table 11 codon_start 1 locus_tag LOCUS_43950 gene glyQ CDS 1628..1762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS 1826..4180 product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057539.1 transl_table 11 codon_start 1 locus_tag LOCUS_43970 gene comE tRNA 4263..4351 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 4948..6141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43980 CDS complement(6411..7244) product TIGR00268 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057083.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS complement(7331..9070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44000 sequence351 source 1..9747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 137..346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS 445..873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44020 note possible pseudo, frameshifted CDS 854..1207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44030 note possible pseudo, frameshifted CDS 1280..1690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44040 CDS 1758..2069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44050 CDS complement(2407..2814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44060 CDS 3033..3650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS 3743..4318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44080 note possible pseudo, internal stop codon CDS 4902..5105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS 5102..5335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS complement(5614..6963) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA9 transl_table 11 codon_start 1 locus_tag LOCUS_44110 gene dnaB CDS complement(6956..8020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS complement(8023..8325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS 8567..8944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44140 sequence352 source 1..9677 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(536..1627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS 2212..3741 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056140.1 transl_table 11 codon_start 1 locus_tag LOCUS_44160 gene trpE CDS 4063..4575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44170 CDS 4601..4954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS complement(5059..5487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS 5939..6889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056269.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS 6906..8153 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057854.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS complement(8239..9171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44220 sequence353 source 1..9558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 782..1219 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS complement(1301..1756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS complement(1797..2696) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJA3 transl_table 11 codon_start 1 locus_tag LOCUS_44250 gene ycf38 CDS complement(2826..3845) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055865.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS 4243..5613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS complement(5722..6810) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH53 transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS 7097..7273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057753.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS 7840..8136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44300 CDS 8409..9557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44310 sequence354 source 1..9556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1007..1738) product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI83 transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS complement(1966..2919) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND12 transl_table 11 codon_start 1 locus_tag LOCUS_44330 gene prk CDS complement(3224..5107) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057147.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 gene cobJ CDS complement(5138..5338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44350 CDS complement(5942..7219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS complement(8069..9127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44370 sequence355 source 1..9555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 494..1648 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC2 transl_table 11 codon_start 1 locus_tag LOCUS_44380 gene anmK CDS 1813..2259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057015.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS 2833..4398 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056298.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 CDS complement(4765..4965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44410 CDS complement(5676..6404) product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS complement(6422..8107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058075.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 CDS complement(8253..8591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144163.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 sequence356 source 1..9539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1078..1389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS complement(1523..3049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44460 tRNA complement(3544..3618) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(3623..3695) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(4010..5239) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS complement(5727..6287) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086720.1 transl_table 11 codon_start 1 locus_tag LOCUS_44480 CDS 6469..7077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44490 CDS 7227..7622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS 7733..8332 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969753.1 transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS 8427..9392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44520 sequence357 source 1..9515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(24..713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS complement(927..2324) product polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141791.1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 CDS complement(2444..3667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44550 CDS complement(4018..5121) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 transl_table 11 codon_start 1 locus_tag LOCUS_44560 CDS complement(5210..6424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143703.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS complement(6466..7506) product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143707.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS complement(7909..9264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143704.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 sequence358 source 1..9512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 321..3440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS 3800..4486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141522.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS complement(5529..6983) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903305.1 transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS complement(7270..9081) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23970 transl_table 11 codon_start 1 locus_tag LOCUS_44630 gene menD sequence359 source 1..9452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 403..2643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS 3178..3792 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS 3972..5573 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS 6261..7880 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS complement(8160..8396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS 8858..9451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058121.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 sequence360 source 1..9450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(256..591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS complement(579..995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44710 CDS 1335..1988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS 1985..3082 product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143340.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS 3135..3335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS complement(3719..5248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS complement(5245..7845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44760 sequence361 source 1..9423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2714..3655 product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142703.1 transl_table 11 codon_start 1 locus_tag LOCUS_44770 CDS 3677..4615 product type II restriction endonuclease MjaIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870104.1 transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS 4880..7486 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140924.1 transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS complement(7585..7995) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606465.1 transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS 8078..9259 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 transl_table 11 codon_start 1 locus_tag LOCUS_44810 sequence362 source 1..9407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2572 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DH56:alanine--tRNA ligase locus_tag LOCUS_44820 CDS complement(3254..3610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44830 CDS complement(4139..4516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS 5243..6379 product homoserine/choline kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124950.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 CDS 6552..7085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS 7432..7995 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943048.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS 8105..9301 product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766061.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 sequence363 source 1..9355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 210..1229 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP2 transl_table 11 codon_start 1 locus_tag LOCUS_44890 gene asd CDS 1494..2387 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK4 transl_table 11 codon_start 1 locus_tag LOCUS_44900 gene dapA CDS 2660..4435 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK3 transl_table 11 codon_start 1 locus_tag LOCUS_44910 gene rnj CDS 5664..6041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44920 CDS complement(6086..7852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS 8241..8780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44940 CDS 8930..9103 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMH4 transl_table 11 codon_start 1 locus_tag LOCUS_44950 gene rpmF sequence364 source 1..9274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..418 product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS 402..812 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967516.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS 974..1615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS 1731..2600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS 2673..3131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45000 CDS 3365..6154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45010 sequence365 source 1..9269 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..2018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS complement(2140..3045) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114872.1 transl_table 11 codon_start 1 locus_tag LOCUS_45030 CDS 3150..3650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS 3723..4712 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS 4760..5389 product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 CDS 5560..5988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45070 CDS 6040..6783 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS 6838..7515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039531.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 gene mmyQ CDS 7563..8555 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940020.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 gene qor CDS complement(8666..8872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45110 sequence366 source 1..9248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 188..1444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45120 CDS 2135..3274 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 CDS 3385..4101 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 transl_table 11 codon_start 1 locus_tag LOCUS_45140 CDS 4489..6156 product fused response regulator/thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 CDS 6236..7648 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142209.1 transl_table 11 codon_start 1 locus_tag LOCUS_45160 CDS 7901..9049 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 sequence367 source 1..9239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(230..3163) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057179.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 gene polA CDS 3841..4674 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 transl_table 11 codon_start 1 locus_tag LOCUS_45190 CDS complement(4844..5635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45200 CDS 5953..6711 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 transl_table 11 codon_start 1 locus_tag LOCUS_45210 CDS complement(6729..7808) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057692.1 transl_table 11 codon_start 1 locus_tag LOCUS_45220 CDS complement(7915..8955) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057692.1 transl_table 11 codon_start 1 locus_tag LOCUS_45230 sequence368 source 1..9229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(150..407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143542.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 CDS 773..2368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS complement(2403..2690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45260 CDS 2671..4419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45270 CDS complement(4628..4846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS 5206..5778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45290 CDS complement(5975..8992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45300 sequence369 source 1..9226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(588..1358) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 transl_table 11 codon_start 1 locus_tag LOCUS_45310 CDS complement(1509..2321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057850.1 transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS 2487..3560 product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY4 transl_table 11 codon_start 1 locus_tag LOCUS_45330 gene murG CDS 3825..4805 product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5M7 transl_table 11 codon_start 1 locus_tag LOCUS_45340 CDS complement(5190..6254) product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262781.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 CDS complement(6415..7005) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056210.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 gene trxA CDS 7510..7914 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 transl_table 11 codon_start 1 locus_tag LOCUS_45370 CDS complement(8074..9153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141362.1 transl_table 11 codon_start 1 locus_tag LOCUS_45380 sequence370 source 1..9224 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(187..354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45390 CDS complement(568..1632) product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889292.1 transl_table 11 codon_start 1 locus_tag LOCUS_45400 CDS 1748..3184 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057595.1 transl_table 11 codon_start 1 locus_tag LOCUS_45410 CDS 3303..3809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125002.1 transl_table 11 codon_start 1 locus_tag LOCUS_45420 CDS 4091..5716 product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG7 transl_table 11 codon_start 1 locus_tag LOCUS_45430 CDS 6045..6980 product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 transl_table 11 codon_start 1 locus_tag LOCUS_45440 gene acdS CDS 7121..7723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45450 CDS complement(7743..8240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45460 CDS complement(8227..8514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45470 CDS complement(8703..8963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45480 CDS complement(8973..9224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45490 sequence371 source 1..9182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(295..3315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45500 CDS 3522..3788 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 transl_table 11 codon_start 1 locus_tag LOCUS_45510 CDS 3855..5354 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJI4 transl_table 11 codon_start 1 locus_tag LOCUS_45520 gene murE CDS 5581..6993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS complement(7104..8630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057405.1 transl_table 11 codon_start 1 locus_tag LOCUS_45540 sequence372 source 1..9143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 361..774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45550 CDS 981..1532 product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141084.1 transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS 1776..2297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45570 CDS complement(2483..4696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45580 CDS complement(4733..5962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45590 CDS complement(6092..6985) product acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203012.1 transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS complement(7030..8028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45610 sequence373 source 1..9108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 980..2080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45620 CDS 2631..3986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS 4379..4948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS 4958..5314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45650 CDS 5456..6082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS 6379..8202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45670 CDS 8189..8419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45680 sequence374 source 1..9101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 336..554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45690 CDS 1044..1613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS complement(1848..3089) product UPF0754 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM9 transl_table 11 codon_start 1 locus_tag LOCUS_45710 CDS complement(3622..4314) product 2-phytyl-1,4-naphtoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPC8 transl_table 11 codon_start 1 locus_tag LOCUS_45720 gene menG CDS complement(4434..5378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45730 CDS 5745..6833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142156.1 transl_table 11 codon_start 1 locus_tag LOCUS_45740 CDS 7032..7589 product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXC0 transl_table 11 codon_start 1 locus_tag LOCUS_45750 gene mtnD CDS 7634..8278 product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXC1 transl_table 11 codon_start 1 locus_tag LOCUS_45760 gene mtnB CDS 8313..9020 product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB8 transl_table 11 codon_start 1 locus_tag LOCUS_45770 gene mtnC sequence375 source 1..9091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 840..1034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45780 CDS 1309..1521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45790 CDS complement(1867..2046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45800 CDS 2135..2599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45810 CDS complement(2792..4855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45820 CDS complement(5201..5566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45830 CDS complement(5580..5807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45840 CDS complement(5844..6053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45850 CDS 6875..7708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45860 CDS 8527..8943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45870 sequence376 source 1..9091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(709..1926) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 transl_table 11 codon_start 1 locus_tag LOCUS_45880 CDS complement(2326..3327) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 transl_table 11 codon_start 1 locus_tag LOCUS_45890 CDS complement(3495..5288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45900 CDS 5826..7340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 transl_table 11 codon_start 1 locus_tag LOCUS_45910 gene ycf46 sequence377 source 1..9048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(123..458) product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI94 transl_table 11 codon_start 1 locus_tag LOCUS_45920 gene rub CDS 1099..1320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45930 CDS 1311..2048 product NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ4 transl_table 11 codon_start 1 locus_tag LOCUS_45940 gene ndhK CDS 2041..2565 product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ01 transl_table 11 codon_start 1 locus_tag LOCUS_45950 gene ndhJ CDS complement(3312..3806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45960 CDS complement(3914..4822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45970 CDS 6413..8740 product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057710.1 transl_table 11 codon_start 1 locus_tag LOCUS_45980 gene zam sequence378 source 1..9001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1652..2092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140049.1 transl_table 11 codon_start 1 locus_tag LOCUS_45990 CDS complement(2421..3695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46000 CDS complement(3934..5439) product zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933081.1 transl_table 11 codon_start 1 locus_tag LOCUS_46010 CDS complement(5511..5939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46020 CDS complement(6468..8687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205662.1 transl_table 11 codon_start 1 locus_tag LOCUS_46030 sequence379 source 1..8956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(392..1249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702708.1 transl_table 11 codon_start 1 locus_tag LOCUS_46040 CDS 1681..3804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46050 CDS 4004..4582 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140022.1 transl_table 11 codon_start 1 locus_tag LOCUS_46060 CDS 5352..7301 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNN8 transl_table 11 codon_start 1 locus_tag LOCUS_46070 CDS complement(7651..8118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46080 sequence380 source 1..8947 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(279..1946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46090 CDS 2348..2560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 transl_table 11 codon_start 1 locus_tag LOCUS_46100 CDS 3733..4080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057900.1 transl_table 11 codon_start 1 locus_tag LOCUS_46110 CDS 5068..5565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46120 CDS complement(5626..5835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46130 CDS complement(5763..6959) product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK30 transl_table 11 codon_start 1 locus_tag LOCUS_46140 gene dxr CDS complement(7181..8530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46150 sequence381 source 1..8938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(303..1148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46160 CDS 1793..2383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 transl_table 11 codon_start 1 locus_tag LOCUS_46170 CDS complement(2581..8802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46180 sequence382 source 1..8907 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(707..1867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46190 CDS complement(1959..2750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46200 CDS complement(2767..4191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46210 CDS complement(4636..5523) product iron(III) dicitrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198719.1 transl_table 11 codon_start 1 locus_tag LOCUS_46220 CDS complement(5738..8404) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204654.1 transl_table 11 codon_start 1 locus_tag LOCUS_46230 sequence383 source 1..8884 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(189..962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46240 CDS 2200..3798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46250 CDS 3812..5053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46260 CDS 5046..7436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46270 CDS complement(7559..8038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46280 sequence384 source 1..8865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 289..1800 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 transl_table 11 codon_start 1 locus_tag LOCUS_46290 CDS 1909..2106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46300 CDS 2218..3477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 transl_table 11 codon_start 1 locus_tag LOCUS_46310 CDS 4061..4429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46320 sequence385 source 1..8863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 284..502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46330 CDS 512..1720 product precorrin-6Y C5,15-methyltransferase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390740.1 transl_table 11 codon_start 1 locus_tag LOCUS_46340 CDS complement(1795..1968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46350 CDS complement(2345..5557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46360 CDS complement(5554..8676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46370 sequence386 source 1..8845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(155..874) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 transl_table 11 codon_start 1 locus_tag LOCUS_46380 CDS 1592..2218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 transl_table 11 codon_start 1 locus_tag LOCUS_46390 CDS complement(2299..3009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46400 CDS complement(3847..4920) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229829.1 transl_table 11 codon_start 1 locus_tag LOCUS_46410 CDS complement(5539..7146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46420 CDS complement(7940..8668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46430 sequence387 source 1..8822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(503..862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46440 CDS complement(866..2281) product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533405.1 transl_table 11 codon_start 1 locus_tag LOCUS_46450 CDS complement(2278..2658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46460 CDS complement(2662..3174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46470 CDS 3290..3652 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224021.1 transl_table 11 codon_start 1 locus_tag LOCUS_46480 CDS 3689..4267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46490 CDS complement(4819..5172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46500 CDS complement(5265..6743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46510 CDS 7011..7160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46520 CDS 7300..7488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46530 CDS 7638..7895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46540 CDS 8065..8328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46550 sequence388 source 1..8820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(375..3281) product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD5 transl_table 11 codon_start 1 locus_tag LOCUS_46560 gene uvrA CDS complement(4136..6385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46570 CDS complement(6382..7197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46580 CDS complement(7213..7437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46590 CDS 7582..7944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46600 CDS 7947..8585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46610 sequence389 source 1..8783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(138..2096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057687.1 transl_table 11 codon_start 1 locus_tag LOCUS_46620 CDS 3376..8223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46630 sequence390 source 1..8771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1144..3939 product NHLP family bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 transl_table 11 codon_start 1 locus_tag LOCUS_46640 CDS 4332..5501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46650 CDS 5911..6222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46660 CDS 6429..7898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55687 transl_table 11 codon_start 1 locus_tag LOCUS_46670 sequence391 source 1..8766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 519..1118 product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 transl_table 11 codon_start 1 locus_tag LOCUS_46680 CDS 1272..1757 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057216.1 transl_table 11 codon_start 1 locus_tag LOCUS_46690 CDS 1940..2614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057176.1 transl_table 11 codon_start 1 locus_tag LOCUS_46700 CDS 2686..3156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46710 CDS complement(3284..4075) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ91 transl_table 11 codon_start 1 locus_tag LOCUS_46720 gene cobS CDS 4540..4914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46730 CDS 5696..6694 product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM7 transl_table 11 codon_start 1 locus_tag LOCUS_46740 gene tgt CDS 7097..7393 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 transl_table 11 codon_start 1 locus_tag LOCUS_46750 CDS complement(7717..8571) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057366.1 transl_table 11 codon_start 1 locus_tag LOCUS_46760 sequence392 source 1..8709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 301..1536 product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056005.1 transl_table 11 codon_start 1 locus_tag LOCUS_46770 gene chlP CDS 2054..2788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46780 CDS 3383..5200 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142666.1 transl_table 11 codon_start 1 locus_tag LOCUS_46790 tRNA 5435..5518 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 5579..5650 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(6420..7562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46800 CDS complement(7570..8007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46810 CDS complement(8023..8484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46820 sequence393 source 1..8680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 73..366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46830 CDS complement(514..1926) product reverse transcriptase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 transl_table 11 codon_start 1 locus_tag LOCUS_46840 CDS complement(2368..3996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 transl_table 11 codon_start 1 locus_tag LOCUS_46850 CDS complement(4269..7565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46860 CDS complement(7899..8234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46870 sequence394 source 1..8673 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 321..716 product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 transl_table 11 codon_start 1 locus_tag LOCUS_46880 CDS 843..2081 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240954.1 transl_table 11 codon_start 1 locus_tag LOCUS_46890 gene cypA CDS complement(2477..4696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46900 CDS 5922..7118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143653.1 transl_table 11 codon_start 1 locus_tag LOCUS_46910 CDS 7204..8382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140225.1 transl_table 11 codon_start 1 locus_tag LOCUS_46920 sequence395 source 1..8633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(249..2402) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW9 transl_table 11 codon_start 1 locus_tag LOCUS_46930 gene pnp CDS complement(2539..3123) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886775.1 transl_table 11 codon_start 1 locus_tag LOCUS_46940 CDS complement(3457..3720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46950 CDS 3714..7619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46960 CDS 7779..8609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 transl_table 11 codon_start 1 locus_tag LOCUS_46970 sequence396 source 1..8601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(504..920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46980 CDS complement(1393..2556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 transl_table 11 codon_start 1 locus_tag LOCUS_46990 CDS complement(2562..3413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47000 CDS complement(3502..3660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47010 CDS complement(3678..5201) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104558.1 transl_table 11 codon_start 1 locus_tag LOCUS_47020 CDS 5510..5875 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592531.1 transl_table 11 codon_start 1 locus_tag LOCUS_47030 gene cadC CDS 5958..6569 product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 transl_table 11 codon_start 1 locus_tag LOCUS_47040 misc_feature complement(7052..>8601) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057543.1:porin locus_tag LOCUS_47050 sequence397 source 1..8584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 75..578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47060 CDS complement(553..870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47070 CDS 1551..2564 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 transl_table 11 codon_start 1 locus_tag LOCUS_47080 CDS complement(2690..5284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47090 CDS complement(5443..8184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47100 sequence398 source 1..8570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 278..1348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47110 CDS 1466..3958 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW6 transl_table 11 codon_start 1 locus_tag LOCUS_47120 gene recG CDS 4101..4355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47130 CDS complement(4665..5720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47140 CDS complement(6264..6617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056501.1 transl_table 11 codon_start 1 locus_tag LOCUS_47150 CDS 7120..8007 product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057245.1 transl_table 11 codon_start 1 locus_tag LOCUS_47160 sequence399 source 1..8535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(336..3053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47170 CDS complement(3171..4832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47180 CDS complement(5181..6344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47190 CDS complement(6661..7665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47200 misc_feature complement(7974..>8535) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861290.1:transposase locus_tag LOCUS_47210 sequence400 source 1..8515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..711 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DI28:uracil phosphoribosyltransferase locus_tag LOCUS_47220 CDS 791..1156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47230 CDS 1327..1602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143529.1 transl_table 11 codon_start 1 locus_tag LOCUS_47240 gene ycf19 CDS complement(1659..2240) product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141254.1 transl_table 11 codon_start 1 locus_tag LOCUS_47250 CDS complement(2806..3048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47260 CDS 3161..3823 product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141257.1 transl_table 11 codon_start 1 locus_tag LOCUS_47270 gene nblB CDS 4066..4800 product 15,16-dihydrobiliverdin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL66 transl_table 11 codon_start 1 locus_tag LOCUS_47280 gene pebA CDS 4797..5543 product phycoerythrobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL65 transl_table 11 codon_start 1 locus_tag LOCUS_47290 gene pebB CDS 6196..6714 product C-phycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50033 transl_table 11 codon_start 1 locus_tag LOCUS_47300 gene cpcB CDS 6802..7290 product C-phycocyanin alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50032 transl_table 11 codon_start 1 locus_tag LOCUS_47310 gene cpcA sequence401 source 1..8476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 435..1229 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124285.1 transl_table 11 codon_start 1 locus_tag LOCUS_47320 gene gst CDS 1537..3267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144388.1 transl_table 11 codon_start 1 locus_tag LOCUS_47330 CDS 4458..5441 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056675.1 transl_table 11 codon_start 1 locus_tag LOCUS_47340 gene sigB CDS 6658..7461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47350 CDS complement(7709..8374) product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056120.1 transl_table 11 codon_start 1 locus_tag LOCUS_47360 gene cobO sequence402 source 1..8472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4..609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47370 CDS complement(1002..1346) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259906.1 transl_table 11 codon_start 1 locus_tag LOCUS_47380 CDS 1431..1754 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKP7 transl_table 11 codon_start 1 locus_tag LOCUS_47390 CDS 2586..4334 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 transl_table 11 codon_start 1 locus_tag LOCUS_47400 CDS 4334..4993 product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMT7 transl_table 11 codon_start 1 locus_tag LOCUS_47410 gene tmk CDS 5075..6022 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056369.1 transl_table 11 codon_start 1 locus_tag LOCUS_47420 gene dnaX CDS 6523..7485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47430 CDS complement(7844..8449) product IS607 family transposase ISTko1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 transl_table 11 codon_start 1 locus_tag LOCUS_47440 sequence403 source 1..8472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 873..1442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 transl_table 11 codon_start 1 locus_tag LOCUS_47450 CDS complement(1597..2733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47460 CDS complement(2843..3802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47470 CDS complement(4214..5284) product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188806.1 transl_table 11 codon_start 1 locus_tag LOCUS_47480 CDS complement(5630..8113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47490 sequence404 source 1..8405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(120..7961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47500 CDS complement(8193..8330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47510 sequence405 source 1..8397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1181..1834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 transl_table 11 codon_start 1 locus_tag LOCUS_47520 CDS 1992..2231 product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057133.1 transl_table 11 codon_start 1 locus_tag LOCUS_47530 CDS 2295..4532 product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057117.1 transl_table 11 codon_start 1 locus_tag LOCUS_47540 CDS 4947..6005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47550 CDS 6395..8359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47560 sequence406 source 1..8361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..728 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057465.1:Zn-dependent hydrolase locus_tag LOCUS_47570 CDS 1126..1320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47580 CDS 1436..3415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47590 CDS complement(3454..4113) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD9 transl_table 11 codon_start 1 locus_tag LOCUS_47600 gene hisG CDS 4302..4991 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 transl_table 11 codon_start 1 locus_tag LOCUS_47610 CDS complement(5131..5793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47620 CDS complement(6085..7185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47630 CDS 7356..8306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47640 sequence407 source 1..8356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(922..2004) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868908.1 transl_table 11 codon_start 1 locus_tag LOCUS_47650 CDS complement(2453..3325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 transl_table 11 codon_start 1 locus_tag LOCUS_47660 CDS complement(3334..4095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47670 CDS complement(4237..6999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47680 CDS complement(7009..8070) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 transl_table 11 codon_start 1 locus_tag LOCUS_47690 sequence408 source 1..8313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 508..843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47700 CDS complement(1052..2551) product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883980.1 transl_table 11 codon_start 1 locus_tag LOCUS_47710 CDS 3043..3342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47720 CDS 3580..3837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47730 CDS 3943..5529 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY2 transl_table 11 codon_start 1 locus_tag LOCUS_47740 gene pgi CDS 5653..6102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47750 CDS 6747..7430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47760 sequence409 source 1..8286 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(174..680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47770 CDS complement(953..2047) product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLZ9 transl_table 11 codon_start 1 locus_tag LOCUS_47780 gene pdxA CDS 2797..4611 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW1 transl_table 11 codon_start 1 locus_tag LOCUS_47790 gene ftsH CDS complement(4835..5518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47800 CDS 6270..6653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140108.1 transl_table 11 codon_start 1 locus_tag LOCUS_47810 CDS 6864..7730 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082650.1 transl_table 11 codon_start 1 locus_tag LOCUS_47820 sequence410 source 1..8255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(560..2545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47830 CDS complement(2776..3360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47840 CDS complement(3632..4297) product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGM4 transl_table 11 codon_start 1 locus_tag LOCUS_47850 gene nfi CDS 4738..4992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47860 CDS 4985..5311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47870 CDS complement(5547..6614) product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X28 transl_table 11 codon_start 1 locus_tag LOCUS_47880 CDS 7025..8119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47890 sequence411 source 1..8251 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(99..467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47900 CDS complement(770..1690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47910 note possible pseudo, internal stop codon, frameshifted CDS complement(1687..2061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47920 note possible pseudo, internal stop codon, frameshifted CDS complement(2009..2497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47930 note possible pseudo, frameshifted CDS complement(3124..3351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47940 CDS 3653..4285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142166.1 transl_table 11 codon_start 1 locus_tag LOCUS_47950 CDS complement(4319..5008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47960 CDS 6332..7426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47970 CDS complement(7660..7929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47980 sequence412 source 1..8219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1640..2008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47990 CDS complement(2473..4236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48000 CDS 5139..5417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48010 CDS complement(5484..5966) product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071200.1 transl_table 11 codon_start 1 locus_tag LOCUS_48020 CDS complement(6275..7429) product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614684.1 transl_table 11 codon_start 1 locus_tag LOCUS_48030 CDS complement(7802..7984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48040 sequence413 source 1..8210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(698..2230) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 transl_table 11 codon_start 1 locus_tag LOCUS_48050 CDS complement(2745..4043) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLK8 transl_table 11 codon_start 1 locus_tag LOCUS_48060 gene hemL CDS 4157..4345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48070 CDS 4451..5098 product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM88 transl_table 11 codon_start 1 locus_tag LOCUS_48080 gene hisI CDS complement(5371..6621) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141544.1 transl_table 11 codon_start 1 locus_tag LOCUS_48090 CDS 7262..7459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056228.1 transl_table 11 codon_start 1 locus_tag LOCUS_48100 sequence414 source 1..8183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 377..3889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48110 CDS 4300..5691 product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 transl_table 11 codon_start 1 locus_tag LOCUS_48120 CDS complement(6080..6826) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 transl_table 11 codon_start 1 locus_tag LOCUS_48130 CDS complement(7328..7687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48140 sequence415 source 1..8163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(940..2211) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056715.1 transl_table 11 codon_start 1 locus_tag LOCUS_48150 CDS 2171..2371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48160 CDS 2593..3288 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056716.1 transl_table 11 codon_start 1 locus_tag LOCUS_48170 CDS complement(3408..4625) product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 transl_table 11 codon_start 1 locus_tag LOCUS_48180 gene ctpA CDS 5026..5673 product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8M7 transl_table 11 codon_start 1 locus_tag LOCUS_48190 gene petB CDS 5899..6381 product cytochrome b6-f complex subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N3 transl_table 11 codon_start 1 locus_tag LOCUS_48200 gene petD CDS 7073..7513 product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 transl_table 11 codon_start 1 locus_tag LOCUS_48210 sequence416 source 1..8159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(583..2727) product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056777.1 transl_table 11 codon_start 1 locus_tag LOCUS_48220 CDS complement(2985..4250) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058122.1 transl_table 11 codon_start 1 locus_tag LOCUS_48230 CDS complement(4369..5094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48240 CDS complement(5173..5931) product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DME3 transl_table 11 codon_start 1 locus_tag LOCUS_48250 CDS complement(6220..7686) product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX41 transl_table 11 codon_start 1 locus_tag LOCUS_48260 gene kmo sequence417 source 1..8136 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 590..2917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 transl_table 11 codon_start 1 locus_tag LOCUS_48270 CDS 2975..4324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140460.1 transl_table 11 codon_start 1 locus_tag LOCUS_48280 CDS complement(4449..5387) product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKP2 transl_table 11 codon_start 1 locus_tag LOCUS_48290 CDS 5991..7013 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHG3 transl_table 11 codon_start 1 locus_tag LOCUS_48300 gene trpS CDS 7074..7994 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI21 transl_table 11 codon_start 1 locus_tag LOCUS_48310 sequence418 source 1..8130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2164 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065100.1:peptide transporter locus_tag LOCUS_48320 CDS 2306..2713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48330 CDS 3119..4579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48340 CDS 4646..5941 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW4 transl_table 11 codon_start 1 locus_tag LOCUS_48350 gene purB CDS 6297..6845 product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056727.1 transl_table 11 codon_start 1 locus_tag LOCUS_48360 CDS complement(7176..7901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48370 sequence419 source 1..8116 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(146..859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS complement(1278..1679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48390 CDS 2301..3794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48400 CDS 3794..4924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48410 CDS 4959..7328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48420 sequence420 source 1..8106 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 65..1387 product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918387.1 transl_table 11 codon_start 1 locus_tag LOCUS_48430 gene hfsI CDS 1645..2814 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065081.1 transl_table 11 codon_start 1 locus_tag LOCUS_48440 gene wbaD CDS 2825..3994 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530226.1 transl_table 11 codon_start 1 locus_tag LOCUS_48450 CDS 4286..5332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48460 CDS 5756..6958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730934.1 transl_table 11 codon_start 1 locus_tag LOCUS_48470 sequence421 source 1..8069 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(288..980) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266326.1 transl_table 11 codon_start 1 locus_tag LOCUS_48480 CDS complement(999..1508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48490 CDS 2052..3110 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125344.1 transl_table 11 codon_start 1 locus_tag LOCUS_48500 gene tas CDS complement(3436..3804) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 transl_table 11 codon_start 1 locus_tag LOCUS_48510 CDS complement(4042..5565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48520 misc_feature complement(5558..>8069) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057122.1:two-component hybrid sensor and regulator locus_tag LOCUS_48530 sequence422 source 1..8064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1684..1765) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(1744..2622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 transl_table 11 codon_start 1 locus_tag LOCUS_48540 CDS complement(2954..4363) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS7 transl_table 11 codon_start 1 locus_tag LOCUS_48550 gene murA tRNA 4754..4837 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 4950..5732 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057803.1 transl_table 11 codon_start 1 locus_tag LOCUS_48560 CDS complement(5885..6127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48570 CDS complement(6261..6902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48580 CDS 7313..7837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48590 sequence423 source 1..8055 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 14..409 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccaactaatccgatttaacccaatcggtaggg CDS complement(1163..4591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48600 CDS complement(4861..7422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48610 sequence424 source 1..8054 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 318..758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48620 CDS 983..4030 product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 transl_table 11 codon_start 1 locus_tag LOCUS_48630 CDS 4544..5026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48640 CDS complement(5294..5719) product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632647.1 transl_table 11 codon_start 1 locus_tag LOCUS_48650 CDS complement(5957..6748) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945820.1 transl_table 11 codon_start 1 locus_tag LOCUS_48660 CDS 7229..7981 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 transl_table 11 codon_start 1 locus_tag LOCUS_48670 sequence425 source 1..8052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(317..1090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48680 CDS 1760..3364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48690 CDS 3419..5635 product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 transl_table 11 codon_start 1 locus_tag LOCUS_48700 CDS 6150..7667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48710 sequence426 source 1..7997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 384..1781 product putative amidase AmiB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQ97 transl_table 11 codon_start 1 locus_tag LOCUS_48720 gene amiB2 CDS complement(1973..2851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48730 CDS complement(3720..5288) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A988 transl_table 11 codon_start 1 locus_tag LOCUS_48740 gene proS CDS 5406..6533 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH42 transl_table 11 codon_start 1 locus_tag LOCUS_48750 gene proB CDS complement(6633..7628) product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR0 transl_table 11 codon_start 1 locus_tag LOCUS_48760 gene ilvC sequence427 source 1..7965 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 638..2674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48770 CDS 3234..4232 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056675.1 transl_table 11 codon_start 1 locus_tag LOCUS_48780 gene sigB CDS 4242..5009 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 transl_table 11 codon_start 1 locus_tag LOCUS_48790 CDS 5058..6347 product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 transl_table 11 codon_start 1 locus_tag LOCUS_48800 CDS 6507..6905 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272733.1 transl_table 11 codon_start 1 locus_tag LOCUS_48810 sequence428 source 1..7961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 543..1283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48820 CDS 1674..1895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48830 CDS complement(2018..2539) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760630.1 transl_table 11 codon_start 1 locus_tag LOCUS_48840 CDS complement(2672..3328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 transl_table 11 codon_start 1 locus_tag LOCUS_48850 CDS complement(3997..4563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48860 note possible pseudo, internal stop codon CDS 4756..6300 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX9 transl_table 11 codon_start 1 locus_tag LOCUS_48870 gene radA misc_feature complement(6691..>7961) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545144.1:polysaccharide deacetylase locus_tag LOCUS_48880 sequence429 source 1..7944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1312..2199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530228.1 transl_table 11 codon_start 1 locus_tag LOCUS_48890 CDS complement(2629..3840) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061719.1 transl_table 11 codon_start 1 locus_tag LOCUS_48900 CDS complement(3890..4474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48910 CDS complement(5146..7332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 transl_table 11 codon_start 1 locus_tag LOCUS_48920 misc_feature complement(7437..>7944) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203060.1:beta-1,4-N-acetyl- mannosaminyltransferase locus_tag LOCUS_48930 sequence430 source 1..7938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(365..718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48940 CDS 1324..1953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48950 CDS complement(2203..3399) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY7 transl_table 11 codon_start 1 locus_tag LOCUS_48960 gene argG CDS 3783..4184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48970 CDS 4461..5408 product glycosly transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056836.1 transl_table 11 codon_start 1 locus_tag LOCUS_48980 CDS 5650..6459 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA2 transl_table 11 codon_start 1 locus_tag LOCUS_48990 gene rpsB CDS 6876..7820 product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4L2 transl_table 11 codon_start 1 locus_tag LOCUS_49000 gene tsf sequence431 source 1..7927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 323..1315 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056675.1 transl_table 11 codon_start 1 locus_tag LOCUS_49010 gene sigB CDS complement(1645..2844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49020 CDS complement(2850..4772) product copper resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114867.1 transl_table 11 codon_start 1 locus_tag LOCUS_49030 gene pcoA CDS 5105..5491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49040 CDS 5593..5892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49050 sequence432 source 1..7865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1764 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein locus_tag LOCUS_49060 CDS complement(2141..2344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49070 CDS complement(2425..2646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49080 CDS complement(2643..3008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49090 CDS 3078..3395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49100 CDS complement(3812..5710) product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJI6 transl_table 11 codon_start 1 locus_tag LOCUS_49110 gene glmS CDS complement(6111..6356) product photosystem I iron-sulfur center inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9R1 transl_table 11 codon_start 1 locus_tag LOCUS_49120 gene psaC CDS 6845..7564 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144233.1 transl_table 11 codon_start 1 locus_tag LOCUS_49130 sequence433 source 1..7861 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(65..397) product putative monooxygenase YcnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94425 transl_table 11 codon_start 1 locus_tag LOCUS_49140 gene ycnE CDS complement(744..1274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49150 CDS complement(1315..2709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49160 CDS complement(3011..3874) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144410.1 transl_table 11 codon_start 1 locus_tag LOCUS_49170 CDS 4089..6782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49180 CDS complement(7046..7756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49190 sequence434 source 1..7840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..987 product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965124.1 transl_table 11 codon_start 1 locus_tag LOCUS_49200 CDS 1132..2700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49210 CDS 2697..4091 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058014.1 transl_table 11 codon_start 1 locus_tag LOCUS_49220 CDS 4094..4837 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058012.1 transl_table 11 codon_start 1 locus_tag LOCUS_49230 CDS 6271..7704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49240 sequence435 source 1..7813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(305..2764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49250 CDS 3083..3748 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI33 transl_table 11 codon_start 1 locus_tag LOCUS_49260 gene clpP CDS 3944..4540 product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJZ9 transl_table 11 codon_start 1 locus_tag LOCUS_49270 gene clpP2 CDS 4907..5545 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057273.1 transl_table 11 codon_start 1 locus_tag LOCUS_49280 CDS complement(5974..6171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49290 sequence436 source 1..7778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(955..1710) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144148.1 transl_table 11 codon_start 1 locus_tag LOCUS_49300 CDS 2745..3554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 transl_table 11 codon_start 1 locus_tag LOCUS_49310 CDS complement(3991..5727) product carnitine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228673.1 transl_table 11 codon_start 1 locus_tag LOCUS_49320 CDS 5995..6849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228671.1 transl_table 11 codon_start 1 locus_tag LOCUS_49330 sequence437 source 1..7766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 153..758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49340 CDS 926..1291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49350 CDS 1245..3995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140619.1 transl_table 11 codon_start 1 locus_tag LOCUS_49360 CDS 4219..5010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49370 CDS complement(5243..6016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49380 CDS 6534..7565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49390 sequence438 source 1..7757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(340..474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49400 CDS 741..2849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49410 CDS complement(2875..3216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49420 CDS 3744..5027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49430 misc_feature complement(5237..>7757) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NFU0:histidine kinase locus_tag LOCUS_49440 sequence439 source 1..7736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 437..1471 product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ3 transl_table 11 codon_start 1 locus_tag LOCUS_49450 gene pdhA CDS 1671..2540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142558.1 transl_table 11 codon_start 1 locus_tag LOCUS_49460 tRNA 2604..2677 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 2979..4058 product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056231.1 transl_table 11 codon_start 1 locus_tag LOCUS_49470 gene fbaA CDS complement(4429..5478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49480 CDS complement(6197..7009) product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 transl_table 11 codon_start 1 locus_tag LOCUS_49490 sequence440 source 1..7715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..3670 product pyruvate-flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC02 transl_table 11 codon_start 1 locus_tag LOCUS_49500 gene nifJ CDS 3953..4459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49510 CDS 4493..6145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49520 CDS 6658..7437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49530 sequence441 source 1..7702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 704..1987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49540 CDS 1954..7248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49550 sequence442 source 1..7636 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 112..1098 product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCF5 transl_table 11 codon_start 1 locus_tag LOCUS_49560 gene moaA CDS 1398..2222 product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090538.1 transl_table 11 codon_start 1 locus_tag LOCUS_49570 CDS complement(2266..3306) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057332.1 transl_table 11 codon_start 1 locus_tag LOCUS_49580 CDS complement(3482..5068) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 transl_table 11 codon_start 1 locus_tag LOCUS_49590 CDS complement(5201..6202) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 transl_table 11 codon_start 1 locus_tag LOCUS_49600 CDS complement(6483..6728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49610 CDS complement(7049..7540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49620 sequence443 source 1..7628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 541..807 product UPF0296 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ID1 transl_table 11 codon_start 1 locus_tag LOCUS_49630 CDS 986..1591 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ7 transl_table 11 codon_start 1 locus_tag LOCUS_49640 gene gmk CDS complement(2713..3240) product photosystem I reaction center subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGB4 transl_table 11 codon_start 1 locus_tag LOCUS_49650 gene psaL CDS complement(4081..4575) product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A401 transl_table 11 codon_start 1 locus_tag LOCUS_49660 gene psaF CDS 4755..5795 product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI9 transl_table 11 codon_start 1 locus_tag LOCUS_49670 gene tsaD CDS complement(6645..7550) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 transl_table 11 codon_start 1 locus_tag LOCUS_49680 sequence444 source 1..7589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(297..500) product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533514.1 transl_table 11 codon_start 1 locus_tag LOCUS_49690 CDS complement(497..769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49700 CDS complement(756..1895) product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583977.1 transl_table 11 codon_start 1 locus_tag LOCUS_49710 gene aksA CDS complement(2449..2649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058211.1 transl_table 11 codon_start 1 locus_tag LOCUS_49720 CDS complement(2831..3073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49730 CDS complement(3076..3843) product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK8 transl_table 11 codon_start 1 locus_tag LOCUS_49740 gene cysE CDS 5372..5590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49750 CDS 5686..7074 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124678.1 transl_table 11 codon_start 1 locus_tag LOCUS_49760 sequence445 source 1..7588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..1140 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141348.1 transl_table 11 codon_start 1 locus_tag LOCUS_49770 CDS complement(1292..2527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49780 CDS complement(3230..4111) product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140661.1 transl_table 11 codon_start 1 locus_tag LOCUS_49790 CDS 4670..4861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49800 CDS complement(4988..6172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49810 sequence446 source 1..7556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1459..1776 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125063.1 transl_table 11 codon_start 1 locus_tag LOCUS_49820 CDS complement(1785..2012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49830 CDS complement(2187..4058) product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141553.1 transl_table 11 codon_start 1 locus_tag LOCUS_49840 CDS 4209..4718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140148.1 transl_table 11 codon_start 1 locus_tag LOCUS_49850 CDS 4841..5677 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 transl_table 11 codon_start 1 locus_tag LOCUS_49860 CDS 6030..6596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49870 sequence447 source 1..7543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(280..3324) product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 transl_table 11 codon_start 1 locus_tag LOCUS_49880 CDS complement(3542..3985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49890 CDS complement(4156..5796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49900 CDS complement(5760..5996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49910 CDS 6374..6811 product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057725.1 transl_table 11 codon_start 1 locus_tag LOCUS_49920 sequence448 source 1..7527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1162..1530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49930 CDS complement(1776..5315) product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056870.1 transl_table 11 codon_start 1 locus_tag LOCUS_49940 gene metH CDS 5399..5869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49950 CDS complement(6091..6927) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227999.1 transl_table 11 codon_start 1 locus_tag LOCUS_49960 CDS 7050..7427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49970 sequence449 source 1..7522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 557..3625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49980 CDS 3677..5245 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975076.1 transl_table 11 codon_start 1 locus_tag LOCUS_49990 CDS 5871..6107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50000 CDS 6487..7272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50010 sequence450 source 1..7477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(7..663) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976086.1 transl_table 11 codon_start 1 locus_tag LOCUS_50020 CDS complement(775..2376) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083241.1 transl_table 11 codon_start 1 locus_tag LOCUS_50030 CDS complement(2439..5774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50040 CDS 6227..6727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50050 sequence451 source 1..7475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(78..1004) product putative ABC transporter substrate-binding lipoprotein YvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34805 transl_table 11 codon_start 1 locus_tag LOCUS_50060 gene yvrC CDS complement(940..1152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50070 CDS complement(1242..3572) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 transl_table 11 codon_start 1 locus_tag LOCUS_50080 gene phuR CDS 4359..4658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50090 CDS 4589..4843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50100 CDS 5275..6285 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732470.1 transl_table 11 codon_start 1 locus_tag LOCUS_50110 CDS 6366..7142 product iron-dicitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212060.1 transl_table 11 codon_start 1 locus_tag LOCUS_50120 sequence452 source 1..7471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 342..2369 product sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056194.1 transl_table 11 codon_start 1 locus_tag LOCUS_50130 gene sir CDS complement(2694..3536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 transl_table 11 codon_start 1 locus_tag LOCUS_50140 CDS 3945..7100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 transl_table 11 codon_start 1 locus_tag LOCUS_50150 CDS 7111..7464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50160 sequence453 source 1..7462 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 652..2280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50170 CDS complement(2347..2730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50180 CDS complement(4877..5281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 transl_table 11 codon_start 1 locus_tag LOCUS_50190 CDS 5701..6144 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 transl_table 11 codon_start 1 locus_tag LOCUS_50200 sequence454 source 1..7450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(230..1096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057453.1 transl_table 11 codon_start 1 locus_tag LOCUS_50210 CDS 1198..2253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50220 CDS 2810..3043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50230 CDS 3196..5694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50240 CDS 6264..6782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50250 sequence455 source 1..7450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 552..3896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50260 CDS complement(3978..5048) product glycoside hydrolase family 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 transl_table 11 codon_start 1 locus_tag LOCUS_50270 CDS 5263..5694 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 transl_table 11 codon_start 1 locus_tag LOCUS_50280 CDS complement(5669..6292) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 transl_table 11 codon_start 1 locus_tag LOCUS_50290 gene lipA CDS 6787..7299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50300 sequence456 source 1..7425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(482..835) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433620.1 transl_table 11 codon_start 1 locus_tag LOCUS_50310 CDS complement(1053..1295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50320 CDS complement(1267..1485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50330 CDS complement(1607..2059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50340 CDS complement(2353..2751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50350 CDS complement(2755..3387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50360 CDS 4082..5464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50370 CDS complement(5842..6525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402995.1 transl_table 11 codon_start 1 locus_tag LOCUS_50380 CDS 6647..7063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055866.1 transl_table 11 codon_start 1 locus_tag LOCUS_50390 sequence457 source 1..7419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 415..1206 product cobalt transport protein CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFD3 transl_table 11 codon_start 1 locus_tag LOCUS_50400 gene cbiM CDS 1184..1495 product cobalt transport protein CbiN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFD4 transl_table 11 codon_start 1 locus_tag LOCUS_50410 gene cbiN CDS 1492..2298 product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058272.1 transl_table 11 codon_start 1 locus_tag LOCUS_50420 CDS 2279..3100 product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG84 transl_table 11 codon_start 1 locus_tag LOCUS_50430 CDS complement(3378..4835) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858205.1 transl_table 11 codon_start 1 locus_tag LOCUS_50440 CDS complement(4969..5529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50450 CDS complement(5711..6340) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404339.1 transl_table 11 codon_start 1 locus_tag LOCUS_50460 misc_feature complement(6341..>7419) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146750.1:heavy metal translocating P-type ATPase locus_tag LOCUS_50470 sequence458 source 1..7388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..836 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142854.1:LysR family transcriptional regulator locus_tag LOCUS_50480 CDS complement(1457..4159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50490 CDS complement(4490..5683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50500 sequence459 source 1..7375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 740..1846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50510 CDS 1855..2223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50520 CDS 2250..3245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50530 CDS 3242..3964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50540 CDS complement(3980..4189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50550 sequence460 source 1..7357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1369..2703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50560 CDS complement(2954..3595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50570 CDS 4033..6267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50580 CDS complement(6416..6805) product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 transl_table 11 codon_start 1 locus_tag LOCUS_50590 CDS complement(6836..7063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50600 sequence461 source 1..7341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2201 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890758.1:bacteriocin cleavage/export ABC transporter locus_tag LOCUS_50610 CDS 2364..2543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50620 CDS complement(2723..4252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50630 CDS complement(4690..4914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50640 CDS complement(5566..7230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50650 sequence462 source 1..7334 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1384..1785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50660 note possible pseudo, frameshifted CDS 1694..2194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143800.1 transl_table 11 codon_start 1 locus_tag LOCUS_50670 note possible pseudo, frameshifted CDS 2287..2682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50680 CDS 3020..4729 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100021.1 transl_table 11 codon_start 1 locus_tag LOCUS_50690 CDS 4726..5646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50700 CDS complement(5572..6393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50710 CDS complement(6446..6742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50720 sequence463 source 1..7306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3582..4019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50730 note possible pseudo, frameshifted CDS 4094..5071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50740 note possible pseudo, internal stop codon, frameshifted CDS complement(5113..5481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50750 CDS complement(5648..6238) product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153597.1 transl_table 11 codon_start 1 locus_tag LOCUS_50760 gene wcaF misc_feature complement(6390..>7306) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546558.1:glycosyl transferase locus_tag LOCUS_50770 sequence464 source 1..7284 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(492..854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50780 CDS complement(903..1151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50790 CDS complement(1155..1760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50800 CDS 2448..3635 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056224.1 transl_table 11 codon_start 1 locus_tag LOCUS_50810 CDS complement(4090..5259) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG0 transl_table 11 codon_start 1 locus_tag LOCUS_50820 gene aspC CDS 5555..7255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50830 sequence465 source 1..7282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2357..3631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50840 CDS 3864..4682 product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJU8 transl_table 11 codon_start 1 locus_tag LOCUS_50850 gene sfsA CDS 4738..4956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50860 CDS complement(5371..5700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50870 CDS complement(5799..6758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140054.1 transl_table 11 codon_start 1 locus_tag LOCUS_50880 sequence466 source 1..7280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(100..1566) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 transl_table 11 codon_start 1 locus_tag LOCUS_50890 CDS 1880..2878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057926.1 transl_table 11 codon_start 1 locus_tag LOCUS_50900 CDS complement(3584..4003) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390954.1 transl_table 11 codon_start 1 locus_tag LOCUS_50910 CDS 4234..6756 product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIY2 transl_table 11 codon_start 1 locus_tag LOCUS_50920 gene gyrA sequence467 source 1..7247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(618..2963) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056432.1 transl_table 11 codon_start 1 locus_tag LOCUS_50930 CDS 3180..3536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50940 CDS 4050..5723 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056296.1 transl_table 11 codon_start 1 locus_tag LOCUS_50950 CDS complement(6025..6912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50960 sequence468 source 1..7245 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1472..2491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50970 CDS 3004..3711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208448.1 transl_table 11 codon_start 1 locus_tag LOCUS_50980 misc_feature complement(3890..>7245) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267337.1:non-ribosomal peptide synthetase locus_tag LOCUS_50990 sequence469 source 1..7233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(98..586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51000 CDS complement(843..1547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51010 CDS complement(1810..2100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51020 CDS complement(2277..2567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51030 misc_feature complement(2788..>7233) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110104.1:non-ribosomal peptide synthetase locus_tag LOCUS_51040 sequence470 source 1..7233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1685..2356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51050 CDS complement(2433..3650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 transl_table 11 codon_start 1 locus_tag LOCUS_51060 CDS 4053..4718 product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 transl_table 11 codon_start 1 locus_tag LOCUS_51070 CDS 4728..5054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51080 CDS complement(5351..6691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 transl_table 11 codon_start 1 locus_tag LOCUS_51090 sequence471 source 1..7224 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 45..752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51100 CDS 918..1157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51110 CDS complement(1204..1731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51120 CDS complement(1849..3501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51130 CDS 4352..5452 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 transl_table 11 codon_start 1 locus_tag LOCUS_51140 CDS 5867..6514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51150 CDS complement(6562..7158) product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144254.1 transl_table 11 codon_start 1 locus_tag LOCUS_51160 sequence472 source 1..7191 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 232..900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51170 CDS 1031..3274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51180 CDS 3371..3898 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 transl_table 11 codon_start 1 locus_tag LOCUS_51190 CDS 3900..6341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51200 misc_feature complement(6686..>7191) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065100.1:peptide transporter locus_tag LOCUS_51210 sequence473 source 1..7165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 183..818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51220 CDS 1085..2239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51230 sequence474 source 1..7144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(818..1192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51240 CDS 1970..3115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51250 CDS 3240..3809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51260 sequence475 source 1..7117 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(654..1646) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056675.1 transl_table 11 codon_start 1 locus_tag LOCUS_51270 gene sigB CDS 2240..2527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51280 CDS 2748..3152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51290 CDS 3476..3814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531104.1 transl_table 11 codon_start 1 locus_tag LOCUS_51300 CDS 4745..4975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51310 CDS 5034..5276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51320 CDS 5280..5945 product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090714.1 transl_table 11 codon_start 1 locus_tag LOCUS_51330 CDS 6000..6416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51340 sequence476 source 1..7090 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(848..1375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058296.1 transl_table 11 codon_start 1 locus_tag LOCUS_51350 CDS complement(1994..3355) product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJA6 transl_table 11 codon_start 1 locus_tag LOCUS_51360 CDS 5116..6975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51370 sequence477 source 1..7081 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(27..707) product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKM7 transl_table 11 codon_start 1 locus_tag LOCUS_51380 gene lipB CDS 1264..1917 product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 transl_table 11 codon_start 1 locus_tag LOCUS_51390 gene lrtA CDS 2943..3203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51400 CDS 3435..4220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51410 CDS 5085..5615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51420 CDS 5645..5911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51430 CDS complement(6017..7060) product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG4 transl_table 11 codon_start 1 locus_tag LOCUS_51440 gene obg sequence478 source 1..7074 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 153..1028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51450 CDS 1232..1849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51460 CDS 2049..4844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51470 CDS 4909..6342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51480 sequence479 source 1..7055 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(274..1704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118815.1 transl_table 11 codon_start 1 locus_tag LOCUS_51490 CDS 2440..3219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51500 CDS complement(3498..4391) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 transl_table 11 codon_start 1 locus_tag LOCUS_51510 CDS 4807..6927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51520 sequence480 source 1..7044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 100..2256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51530 CDS 2422..3606 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 transl_table 11 codon_start 1 locus_tag LOCUS_51540 CDS complement(3684..3857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51550 CDS 4012..6876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51560 sequence481 source 1..7026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(441..581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51570 CDS complement(795..962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51580 CDS 1883..3223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51590 CDS 3538..5739 product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 transl_table 11 codon_start 1 locus_tag LOCUS_51600 CDS complement(5854..6012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51610 CDS 6728..6901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51620 sequence482 source 1..6952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(204..863) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 transl_table 11 codon_start 1 locus_tag LOCUS_51630 CDS complement(1357..4500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51640 CDS complement(4765..5094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51650 CDS 5369..6118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392938.1 transl_table 11 codon_start 1 locus_tag LOCUS_51660 CDS complement(6497..6844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51670 sequence483 source 1..6949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1158..2174) product sulfate/thiosulfate import ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA0 transl_table 11 codon_start 1 locus_tag LOCUS_51680 gene cysA CDS complement(3327..6107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51690 CDS 6613..6948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51700 sequence484 source 1..6942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 656..1369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51710 CDS complement(1852..2931) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 transl_table 11 codon_start 1 locus_tag LOCUS_51720 CDS 4310..5140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 transl_table 11 codon_start 1 locus_tag LOCUS_51730 CDS complement(5321..5620) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 transl_table 11 codon_start 1 locus_tag LOCUS_51740 CDS complement(6002..6862) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257977.1 transl_table 11 codon_start 1 locus_tag LOCUS_51750 sequence485 source 1..6924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(38..307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51760 CDS complement(836..1330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51770 CDS complement(1507..3558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51780 CDS complement(3721..4068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51790 CDS 4576..5031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51800 CDS complement(5058..5429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057511.1 transl_table 11 codon_start 1 locus_tag LOCUS_51810 CDS complement(5583..6761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51820 sequence486 source 1..6916 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(416..988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51830 CDS complement(1130..2647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51840 note possible pseudo, internal stop codon CDS 3053..3283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51850 CDS 3713..5428 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGB1 transl_table 11 codon_start 1 locus_tag LOCUS_51860 gene nadB CDS 5471..6259 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJS3 transl_table 11 codon_start 1 locus_tag LOCUS_51870 gene coaX sequence487 source 1..6877 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 186..1571 product photosystem II CP43 reaction center protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF8 transl_table 11 codon_start 1 locus_tag LOCUS_51880 gene psbC CDS 1959..3173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51890 CDS complement(3430..4779) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084306.1 transl_table 11 codon_start 1 locus_tag LOCUS_51900 CDS complement(4799..5983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51910 CDS complement(6535..6834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51920 sequence488 source 1..6857 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 660..1370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51930 CDS 1457..2503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51940 CDS 2511..3311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51950 CDS 3547..5202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51960 CDS 5216..5965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51970 sequence489 source 1..6854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1120..1677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51980 CDS 1670..3493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142038.1 transl_table 11 codon_start 1 locus_tag LOCUS_51990 CDS 3505..3825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52000 CDS 3831..5198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52010 CDS 5208..6776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 transl_table 11 codon_start 1 locus_tag LOCUS_52020 gene ycf46 sequence490 source 1..6851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 602..2332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52030 CDS 2754..3251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125563.1 transl_table 11 codon_start 1 locus_tag LOCUS_52040 CDS complement(3410..4114) product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 transl_table 11 codon_start 1 locus_tag LOCUS_52050 CDS complement(4254..6197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 transl_table 11 codon_start 1 locus_tag LOCUS_52060 sequence491 source 1..6851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(219..1484) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 transl_table 11 codon_start 1 locus_tag LOCUS_52070 CDS 1659..3029 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL93 transl_table 11 codon_start 1 locus_tag LOCUS_52080 gene dnaA CDS 3649..4824 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VEL1 transl_table 11 codon_start 1 locus_tag LOCUS_52090 gene dnaN CDS complement(4940..6127) product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 transl_table 11 codon_start 1 locus_tag LOCUS_52100 CDS complement(6170..6559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142480.1 transl_table 11 codon_start 1 locus_tag LOCUS_52110 sequence492 source 1..6849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1333..2751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52120 CDS 2987..3280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52130 CDS 3724..4677 product sulfate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 transl_table 11 codon_start 1 locus_tag LOCUS_52140 gene sbpA CDS 4888..5724 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056130.1 transl_table 11 codon_start 1 locus_tag LOCUS_52150 gene cysT CDS 5878..6669 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 transl_table 11 codon_start 1 locus_tag LOCUS_52160 gene cysW sequence493 source 1..6843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(252..1049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52170 CDS complement(1239..1832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143393.1 transl_table 11 codon_start 1 locus_tag LOCUS_52180 tRNA 2229..2301 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(2599..3144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52190 CDS complement(3338..3988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52200 CDS complement(4045..5412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52210 CDS complement(5471..6499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52220 note possible pseudo, frameshifted sequence494 source 1..6842 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 613..1011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52230 CDS 1021..3276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52240 CDS complement(3810..5033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52250 CDS complement(5604..6803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52260 sequence495 source 1..6816 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(440..2944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52270 CDS complement(3061..5211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52280 CDS complement(5900..6211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52290 CDS complement(6282..6575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52300 sequence496 source 1..6809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 111..281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52310 CDS 514..1071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52320 CDS 1171..3168 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 transl_table 11 codon_start 1 locus_tag LOCUS_52330 CDS 3411..4532 product Mg-protoporphyrin IX chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS0 transl_table 11 codon_start 1 locus_tag LOCUS_52340 gene chlI CDS 4662..4940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52350 CDS complement(5002..5253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52360 misc_feature complement(5323..>6809) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267709.1:membrane protein locus_tag LOCUS_52370 sequence497 source 1..6776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 289..1338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52380 CDS complement(1668..2924) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK75 transl_table 11 codon_start 1 locus_tag LOCUS_52390 CDS 3664..5583 product chaperone protein dnaK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI58 transl_table 11 codon_start 1 locus_tag LOCUS_52400 gene dnaK2 CDS 5925..6560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52410 sequence498 source 1..6767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 652..1869 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056420.1 transl_table 11 codon_start 1 locus_tag LOCUS_52420 CDS 2118..2480 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 transl_table 11 codon_start 1 locus_tag LOCUS_52430 CDS 2542..3009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52440 CDS 3055..6504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52450 sequence499 source 1..6765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 781..1251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52460 CDS 1842..2384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52470 CDS 2773..3663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52480 CDS complement(3794..6670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52490 sequence500 source 1..6761 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2431..5271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52500 sequence501 source 1..6706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1166..1582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52510 sequence502 source 1..6678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(400..1233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52520 CDS complement(1625..3670) product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 transl_table 11 codon_start 1 locus_tag LOCUS_52530 CDS complement(3851..4066) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH98 transl_table 11 codon_start 1 locus_tag LOCUS_52540 gene rpsR CDS 4731..4886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52550 CDS 5112..6344 product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 transl_table 11 codon_start 1 locus_tag LOCUS_52560 sequence503 source 1..6640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(167..1048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52570 CDS complement(1353..1562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52580 CDS complement(2162..2374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52590 CDS 2630..3310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52600 CDS 3342..4352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52610 CDS 4576..5400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 transl_table 11 codon_start 1 locus_tag LOCUS_52620 CDS 5577..6623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52630 sequence504 source 1..6637 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(319..1278) product biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140852.1 transl_table 11 codon_start 1 locus_tag LOCUS_52640 gene bvdR CDS 1747..2046 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 transl_table 11 codon_start 1 locus_tag LOCUS_52650 gene fdx CDS 2177..2470 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143612.1 transl_table 11 codon_start 1 locus_tag LOCUS_52660 gene petF CDS complement(2696..4294) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125969.1 transl_table 11 codon_start 1 locus_tag LOCUS_52670 gene spoIID CDS 4616..4879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056018.1 transl_table 11 codon_start 1 locus_tag LOCUS_52680 CDS complement(5180..6505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52690 sequence505 source 1..6636 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1543..2166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52700 CDS 2525..3916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52710 CDS 4223..6445 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057047.1 transl_table 11 codon_start 1 locus_tag LOCUS_52720 sequence506 source 1..6618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 100..1050 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Z7 transl_table 11 codon_start 1 locus_tag LOCUS_52730 gene speE CDS 1068..2735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52740 CDS 2956..3693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52750 CDS complement(3727..6429) product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056370.1 transl_table 11 codon_start 1 locus_tag LOCUS_52760 sequence507 source 1..6564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(255..1280) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056436.1 transl_table 11 codon_start 1 locus_tag LOCUS_52770 CDS complement(1566..2414) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 transl_table 11 codon_start 1 locus_tag LOCUS_52780 gene btpA CDS 3282..4595 product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL8 transl_table 11 codon_start 1 locus_tag LOCUS_52790 gene rimO CDS 4705..6246 product DEAD-box ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHF7 transl_table 11 codon_start 1 locus_tag LOCUS_52800 gene cshA sequence508 source 1..6544 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 422..1543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52810 CDS 1760..3619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52820 CDS complement(3989..6478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52830 sequence509 source 1..6538 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 414..1805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52840 CDS complement(2701..3225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142303.1 transl_table 11 codon_start 1 locus_tag LOCUS_52850 CDS 3463..5001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 transl_table 11 codon_start 1 locus_tag LOCUS_52860 CDS 5508..6440 product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EIH6 transl_table 11 codon_start 1 locus_tag LOCUS_52870 gene ttcA sequence510 source 1..6522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(582..1679) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 transl_table 11 codon_start 1 locus_tag LOCUS_52880 CDS complement(1871..3292) product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWJ8 transl_table 11 codon_start 1 locus_tag LOCUS_52890 CDS complement(3359..5428) product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 transl_table 11 codon_start 1 locus_tag LOCUS_52900 sequence511 source 1..6519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 320..2554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52910 CDS 2551..3888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52920 CDS complement(4516..4926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 transl_table 11 codon_start 1 locus_tag LOCUS_52930 CDS complement(5215..6327) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 transl_table 11 codon_start 1 locus_tag LOCUS_52940 sequence512 source 1..6508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 685..3660 product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056271.1 transl_table 11 codon_start 1 locus_tag LOCUS_52950 gene putA CDS complement(3869..5728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52960 sequence513 source 1..6494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 417..3272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52970 CDS 3302..5056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 transl_table 11 codon_start 1 locus_tag LOCUS_52980 CDS complement(5109..5729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52990 note possible pseudo, frameshifted CDS complement(5789..6217) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228165.1 transl_table 11 codon_start 1 locus_tag LOCUS_53000 sequence514 source 1..6494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(405..1520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53010 CDS complement(2001..3140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53020 CDS 3178..3972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53030 CDS 4081..5928 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI5 transl_table 11 codon_start 1 locus_tag LOCUS_53040 gene ftsH sequence515 source 1..6481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 486..2342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53050 CDS complement(2444..3334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53060 CDS 4076..4663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53070 CDS 5216..6292 product porphyromonas-type peptidyl-arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701340.1 transl_table 11 codon_start 1 locus_tag LOCUS_53080 sequence516 source 1..6473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(72..1193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378843.1 transl_table 11 codon_start 1 locus_tag LOCUS_53090 CDS complement(1586..2374) product DNA ligase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 transl_table 11 codon_start 1 locus_tag LOCUS_53100 CDS 2694..3920 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 transl_table 11 codon_start 1 locus_tag LOCUS_53110 CDS 4572..6095 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057215.1 transl_table 11 codon_start 1 locus_tag LOCUS_53120 sequence517 source 1..6466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 320..793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53130 CDS complement(1275..3470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53140 CDS 3982..4413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53150 CDS complement(4483..5499) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057872.1 transl_table 11 codon_start 1 locus_tag LOCUS_53160 sequence518 source 1..6449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1186..1962 product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058216.1 transl_table 11 codon_start 1 locus_tag LOCUS_53170 CDS 2169..2927 product foldase protein PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM18 transl_table 11 codon_start 1 locus_tag LOCUS_53180 gene prsA CDS 2876..5590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53190 CDS complement(5873..6304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53200 sequence519 source 1..6431 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(252..605) product phenylpyruvate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125356.1 transl_table 11 codon_start 1 locus_tag LOCUS_53210 CDS complement(680..1159) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125105.1 transl_table 11 codon_start 1 locus_tag LOCUS_53220 CDS complement(1274..2077) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141377.1 transl_table 11 codon_start 1 locus_tag LOCUS_53230 gene cobM CDS complement(2377..3327) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH03 transl_table 11 codon_start 1 locus_tag LOCUS_53240 gene lgt CDS 3746..4369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53250 CDS 4412..6181 product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545305.1 transl_table 11 codon_start 1 locus_tag LOCUS_53260 gene asnB sequence520 source 1..6422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 547..4176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53270 CDS complement(4487..5008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53280 CDS 5188..6204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 transl_table 11 codon_start 1 locus_tag LOCUS_53290 sequence521 source 1..6405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..1134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53300 CDS 2067..6080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53310 sequence522 source 1..6400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 243..482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53320 CDS complement(669..2315) product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC3 transl_table 11 codon_start 1 locus_tag LOCUS_53330 gene nnr CDS complement(2401..3150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53340 CDS complement(3417..4136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53350 CDS 4636..5691 product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM0 transl_table 11 codon_start 1 locus_tag LOCUS_53360 gene mnmA CDS complement(5965..6276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53370 sequence523 source 1..6381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(339..4430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53380 CDS 5074..5775 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057970.1 transl_table 11 codon_start 1 locus_tag LOCUS_53390 sequence524 source 1..6377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 221..5332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142241.1 transl_table 11 codon_start 1 locus_tag LOCUS_53400 CDS 5670..6041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53410 sequence525 source 1..6373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1412 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035617.1:(2Fe-2S)-binding protein locus_tag LOCUS_53420 CDS 1623..2000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53430 CDS 2368..3462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53440 CDS complement(3544..4752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 transl_table 11 codon_start 1 locus_tag LOCUS_53450 CDS complement(4841..6211) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 transl_table 11 codon_start 1 locus_tag LOCUS_53460 sequence526 source 1..6360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1213..2394) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 transl_table 11 codon_start 1 locus_tag LOCUS_53470 CDS complement(2540..3670) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 transl_table 11 codon_start 1 locus_tag LOCUS_53480 CDS complement(3700..4641) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065032.1 transl_table 11 codon_start 1 locus_tag LOCUS_53490 CDS complement(4884..6002) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975614.1 transl_table 11 codon_start 1 locus_tag LOCUS_53500 sequence527 source 1..6356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 695..2845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53510 CDS complement(2839..3147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53520 CDS complement(3226..3423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53530 CDS 3479..4897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53540 CDS complement(4961..5686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53550 sequence528 source 1..6349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1145..1429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53560 CDS complement(1905..2735) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031846.1 transl_table 11 codon_start 1 locus_tag LOCUS_53570 CDS complement(3147..6110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53580 sequence529 source 1..6346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 215..1630 product devB secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 transl_table 11 codon_start 1 locus_tag LOCUS_53590 CDS 1674..2825 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140489.1 transl_table 11 codon_start 1 locus_tag LOCUS_53600 CDS 2892..3596 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 transl_table 11 codon_start 1 locus_tag LOCUS_53610 CDS complement(3675..4484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53620 CDS 5098..5796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142774.1 transl_table 11 codon_start 1 locus_tag LOCUS_53630 sequence530 source 1..6345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(563..1225) product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ32 transl_table 11 codon_start 1 locus_tag LOCUS_53640 gene macB CDS complement(1349..2614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140776.1 transl_table 11 codon_start 1 locus_tag LOCUS_53650 CDS complement(2798..4306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140777.1 transl_table 11 codon_start 1 locus_tag LOCUS_53660 CDS complement(4618..5052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53670 CDS complement(5218..5466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53680 sequence531 source 1..6340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 843..2483 product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056162.1 transl_table 11 codon_start 1 locus_tag LOCUS_53690 CDS 3109..4392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055996.1 transl_table 11 codon_start 1 locus_tag LOCUS_53700 CDS complement(4504..5325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53710 CDS 6041..6319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53720 sequence532 source 1..6338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1260..1859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53730 note possible pseudo, frameshifted CDS 1873..2214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53740 note possible pseudo, frameshifted CDS 2633..3943 product putative ABC transporter-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUE8 transl_table 11 codon_start 1 locus_tag LOCUS_53750 CDS 4100..4990 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 transl_table 11 codon_start 1 locus_tag LOCUS_53760 CDS 5226..6062 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969445.1 transl_table 11 codon_start 1 locus_tag LOCUS_53770 sequence533 source 1..6338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(41..2275) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058113.1 transl_table 11 codon_start 1 locus_tag LOCUS_53780 CDS complement(2727..3653) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 transl_table 11 codon_start 1 locus_tag LOCUS_53790 CDS 3768..4658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53800 CDS complement(4744..5766) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975045.1 transl_table 11 codon_start 1 locus_tag LOCUS_53810 CDS complement(6093..6314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53820 sequence534 source 1..6257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(120..857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 transl_table 11 codon_start 1 locus_tag LOCUS_53830 CDS complement(947..2113) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056757.1 transl_table 11 codon_start 1 locus_tag LOCUS_53840 gene nifS CDS 2616..4250 product competence protein ComE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058172.1 transl_table 11 codon_start 1 locus_tag LOCUS_53850 sequence535 source 1..6240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 742..972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53860 CDS 1031..1231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53870 CDS 1277..1927 product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 transl_table 11 codon_start 1 locus_tag LOCUS_53880 CDS 1972..2385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53890 CDS 2579..4117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140695.1 transl_table 11 codon_start 1 locus_tag LOCUS_53900 CDS 4173..5402 product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 transl_table 11 codon_start 1 locus_tag LOCUS_53910 sequence536 source 1..6238 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(836..1714) product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM3 transl_table 11 codon_start 1 locus_tag LOCUS_53920 gene truB CDS complement(1867..3513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140887.1 transl_table 11 codon_start 1 locus_tag LOCUS_53930 CDS complement(3847..4761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141984.1 transl_table 11 codon_start 1 locus_tag LOCUS_53940 CDS complement(4994..6169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582900.1 transl_table 11 codon_start 1 locus_tag LOCUS_53950 sequence537 source 1..6237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 345..1553 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728N7 transl_table 11 codon_start 1 locus_tag LOCUS_53960 gene lysA-2 CDS 1583..2884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53970 CDS complement(3173..4894) product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772517.1 transl_table 11 codon_start 1 locus_tag LOCUS_53980 gene asnB-1 CDS 5137..5688 product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ7 transl_table 11 codon_start 1 locus_tag LOCUS_53990 gene coaD sequence538 source 1..6220 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 359..1951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54000 CDS 2119..5310 product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870125.1 transl_table 11 codon_start 1 locus_tag LOCUS_54010 CDS complement(5357..5938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 transl_table 11 codon_start 1 locus_tag LOCUS_54020 sequence539 source 1..6203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 252..854 product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144355.1 transl_table 11 codon_start 1 locus_tag LOCUS_54030 CDS complement(1011..2243) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058279.1 transl_table 11 codon_start 1 locus_tag LOCUS_54040 CDS complement(2356..3036) product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB5 transl_table 11 codon_start 1 locus_tag LOCUS_54050 gene bioD CDS complement(3268..5082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54060 sequence540 source 1..6183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 238..474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54070 CDS complement(578..1759) product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH08 transl_table 11 codon_start 1 locus_tag LOCUS_54080 gene ribD CDS complement(2858..3487) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056784.1 transl_table 11 codon_start 1 locus_tag LOCUS_54090 CDS complement(3511..4299) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056783.1 transl_table 11 codon_start 1 locus_tag LOCUS_54100 CDS complement(4402..5409) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056782.1 transl_table 11 codon_start 1 locus_tag LOCUS_54110 CDS 5776..6138 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIU1 transl_table 11 codon_start 1 locus_tag LOCUS_54120 gene ssb sequence541 source 1..6175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..1088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54130 CDS complement(1448..4723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 transl_table 11 codon_start 1 locus_tag LOCUS_54140 sequence542 source 1..6169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1264..2676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54150 CDS complement(2844..3329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54160 CDS complement(3384..3593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54170 CDS complement(3751..4134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54180 CDS complement(4135..4710) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087827.1 transl_table 11 codon_start 1 locus_tag LOCUS_54190 CDS 4857..5309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54200 repeat_region 5435..>6169 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccaactaatccgaattaacccaatcggtgggg sequence543 source 1..6154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3858..5054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54210 CDS 5392..5739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54220 sequence544 source 1..6126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 79..1731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54230 CDS 1922..4561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54240 sequence545 source 1..6108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(481..759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54250 CDS complement(813..1019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54260 CDS 1117..4914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54270 sequence546 source 1..6073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 223..1701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055916.1 transl_table 11 codon_start 1 locus_tag LOCUS_54280 CDS 1892..2242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54290 CDS 2288..2623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54300 CDS 2714..3049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54310 CDS complement(3156..4340) product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD9 transl_table 11 codon_start 1 locus_tag LOCUS_54320 gene ndhH CDS complement(4633..5316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54330 sequence547 source 1..6067 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(169..2019) product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142193.1 transl_table 11 codon_start 1 locus_tag LOCUS_54340 CDS complement(2122..3063) product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143779.1 transl_table 11 codon_start 1 locus_tag LOCUS_54350 CDS 4261..4458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54360 CDS 5244..6017 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405125.1 transl_table 11 codon_start 1 locus_tag LOCUS_54370 sequence548 source 1..6066 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(657..1637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54380 CDS 2092..2847 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056437.1 transl_table 11 codon_start 1 locus_tag LOCUS_54390 CDS 3030..4223 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056769.1 transl_table 11 codon_start 1 locus_tag LOCUS_54400 CDS 4236..4922 product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E156 transl_table 11 codon_start 1 locus_tag LOCUS_54410 sequence549 source 1..6042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 31..618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54420 CDS 869..1564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54430 CDS 2338..4851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54440 CDS complement(5097..5354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54450 sequence550 source 1..6040 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..1562) product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9S5 transl_table 11 codon_start 1 locus_tag LOCUS_54460 gene icd CDS 2134..2850 product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057433.1 transl_table 11 codon_start 1 locus_tag LOCUS_54470 gene ycf53 CDS 2857..3150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54480 CDS 3147..3293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54490 CDS 3875..4921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54500 CDS complement(4922..5290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54510 sequence551 source 1..5999 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4138..4980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54520 CDS complement(5310..5777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54530 sequence552 source 1..5996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 341..1552 product dTDP-4-dehydro-6-deoxyglucose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943648.1 transl_table 11 codon_start 1 locus_tag LOCUS_54540 CDS 1542..2555 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202930.1 transl_table 11 codon_start 1 locus_tag LOCUS_54550 CDS 2536..3600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54560 CDS 3766..5514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144393.1 transl_table 11 codon_start 1 locus_tag LOCUS_54570 sequence553 source 1..5994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 374..1270 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764184.1 transl_table 11 codon_start 1 locus_tag LOCUS_54580 CDS 2415..2846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54590 CDS complement(3193..5877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54600 sequence554 source 1..5994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(692..1762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057667.1 transl_table 11 codon_start 1 locus_tag LOCUS_54610 CDS complement(2449..4128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54620 CDS complement(4153..4758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057324.1 transl_table 11 codon_start 1 locus_tag LOCUS_54630 CDS complement(5224..5811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54640 sequence555 source 1..5966 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(237..1637) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 transl_table 11 codon_start 1 locus_tag LOCUS_54650 CDS 2137..4116 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 transl_table 11 codon_start 1 locus_tag LOCUS_54660 CDS complement(4323..5435) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531761.1 transl_table 11 codon_start 1 locus_tag LOCUS_54670 sequence556 source 1..5966 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 343..1041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104212.1 transl_table 11 codon_start 1 locus_tag LOCUS_54680 CDS 1190..2284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54690 CDS 2559..3470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54700 CDS 3542..4711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54710 CDS 4908..5945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54720 sequence557 source 1..5959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 981..1439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 transl_table 11 codon_start 1 locus_tag LOCUS_54730 CDS complement(1457..2356) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 transl_table 11 codon_start 1 locus_tag LOCUS_54740 CDS complement(2362..2751) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKN7 transl_table 11 codon_start 1 locus_tag LOCUS_54750 gene panD CDS complement(2828..3349) product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR2 transl_table 11 codon_start 1 locus_tag LOCUS_54760 gene ppa CDS complement(5208..5477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54770 sequence558 source 1..5919 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 79..2463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54780 CDS complement(2646..2831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54790 CDS 2895..4511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54800 CDS 4686..5129 product swarming motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145139.1 transl_table 11 codon_start 1 locus_tag LOCUS_54810 gene ybiA CDS complement(5142..5738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54820 sequence559 source 1..5913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(329..2950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54830 CDS complement(2964..3512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54840 CDS 3920..4606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54850 CDS complement(4697..5854) product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 transl_table 11 codon_start 1 locus_tag LOCUS_54860 sequence560 source 1..5897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 48..1685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54870 CDS 1937..4492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54880 CDS complement(5132..5821) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208278.1 transl_table 11 codon_start 1 locus_tag LOCUS_54890 gene erd13 sequence561 source 1..5891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(268..780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54900 CDS complement(1178..2059) product 4-hydroxybenzoate solanesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFU6 transl_table 11 codon_start 1 locus_tag LOCUS_54910 gene ubiA CDS 2346..3983 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057517.1 transl_table 11 codon_start 1 locus_tag LOCUS_54920 gene ppx CDS 4260..4541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54930 CDS complement(4617..5390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405233.1 transl_table 11 codon_start 1 locus_tag LOCUS_54940 sequence562 source 1..5889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 181..2949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54950 CDS complement(3012..3380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54960 CDS complement(3680..5020) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057458.1 transl_table 11 codon_start 1 locus_tag LOCUS_54970 sequence563 source 1..5877 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(512..2737) product bacteriocin cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681955.1 transl_table 11 codon_start 1 locus_tag LOCUS_54980 CDS complement(3128..3505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54990 CDS 4233..4904 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 transl_table 11 codon_start 1 locus_tag LOCUS_55000 sequence564 source 1..5840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(233..2443) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057683.1 transl_table 11 codon_start 1 locus_tag LOCUS_55010 sequence565 source 1..5839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(257..1048) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084036.1 transl_table 11 codon_start 1 locus_tag LOCUS_55020 CDS complement(1413..1919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55030 CDS complement(2355..3458) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 transl_table 11 codon_start 1 locus_tag LOCUS_55040 CDS 3520..3684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55050 sequence566 source 1..5819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(968..1054) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(1128..2057) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125164.1 transl_table 11 codon_start 1 locus_tag LOCUS_55060 CDS 2141..2302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55070 CDS 2315..3289 product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 transl_table 11 codon_start 1 locus_tag LOCUS_55080 gene nadA CDS 3934..4116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55090 CDS 4113..4406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55100 CDS complement(4565..5500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55110 sequence567 source 1..5794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 385..1041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55120 CDS complement(1130..1909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 transl_table 11 codon_start 1 locus_tag LOCUS_55130 CDS complement(1986..3164) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056956.1 transl_table 11 codon_start 1 locus_tag LOCUS_55140 CDS 3216..3698 product IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057219.1 transl_table 11 codon_start 1 locus_tag LOCUS_55150 CDS complement(3772..4827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55160 CDS complement(4888..5451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55170 sequence568 source 1..5787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 225..1190 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 transl_table 11 codon_start 1 locus_tag LOCUS_55180 CDS 1245..2867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55190 CDS 2864..3823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55200 sequence569 source 1..5787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 159..1037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704432.1 transl_table 11 codon_start 1 locus_tag LOCUS_55210 CDS complement(1325..2647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55220 CDS 2800..5355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55230 sequence570 source 1..5786 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 109..582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55240 CDS 1166..1657 product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 transl_table 11 codon_start 1 locus_tag LOCUS_55250 CDS complement(1617..3533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55260 CDS complement(3938..5542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55270 sequence571 source 1..5781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1010 product manganese ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143301.1 transl_table 11 codon_start 1 locus_tag LOCUS_55280 CDS complement(1540..1731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55290 CDS 1798..3402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55300 CDS complement(4312..5748) product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 transl_table 11 codon_start 1 locus_tag LOCUS_55310 sequence572 source 1..5780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 173..1165 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055863.1 transl_table 11 codon_start 1 locus_tag LOCUS_55320 gene ycf81 CDS complement(1997..2797) product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140079.1 transl_table 11 codon_start 1 locus_tag LOCUS_55330 CDS complement(3009..3305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55340 CDS complement(3878..4264) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017671.1 transl_table 11 codon_start 1 locus_tag LOCUS_55350 CDS complement(4386..5633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 transl_table 11 codon_start 1 locus_tag LOCUS_55360 sequence573 source 1..5749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 516..800 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058100.1 transl_table 11 codon_start 1 locus_tag LOCUS_55370 CDS 826..1902 product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058099.1 transl_table 11 codon_start 1 locus_tag LOCUS_55380 CDS 2102..3541 product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 transl_table 11 codon_start 1 locus_tag LOCUS_55390 gene merA1 CDS complement(3714..5540) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058156.1 transl_table 11 codon_start 1 locus_tag LOCUS_55400 gene ycf55 sequence574 source 1..5701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(208..1233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141411.1 transl_table 11 codon_start 1 locus_tag LOCUS_55410 CDS complement(1230..3416) product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141412.1 transl_table 11 codon_start 1 locus_tag LOCUS_55420 CDS complement(3419..3835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141413.1 transl_table 11 codon_start 1 locus_tag LOCUS_55430 CDS 4173..5141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55440 sequence575 source 1..5690 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 183..2933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55450 CDS 2982..3863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55460 CDS 3860..5059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55470 sequence576 source 1..5677 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(378..752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55480 CDS complement(745..990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55490 CDS 1140..1361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55500 CDS complement(1452..2057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 transl_table 11 codon_start 1 locus_tag LOCUS_55510 CDS 2250..2666 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767723.1 transl_table 11 codon_start 1 locus_tag LOCUS_55520 CDS complement(2755..3099) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 transl_table 11 codon_start 1 locus_tag LOCUS_55530 CDS complement(3132..3710) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140673.1 transl_table 11 codon_start 1 locus_tag LOCUS_55540 CDS 3754..4245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140674.1 transl_table 11 codon_start 1 locus_tag LOCUS_55550 CDS 4377..4757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55560 sequence577 source 1..5666 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 385..2079 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056078.1 transl_table 11 codon_start 1 locus_tag LOCUS_55570 CDS 2302..3999 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056078.1 transl_table 11 codon_start 1 locus_tag LOCUS_55580 CDS complement(4339..4743) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141388.1 transl_table 11 codon_start 1 locus_tag LOCUS_55590 CDS complement(4744..5379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 transl_table 11 codon_start 1 locus_tag LOCUS_55600 sequence578 source 1..5652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1125..1733) product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCB5 transl_table 11 codon_start 1 locus_tag LOCUS_55610 gene tsf CDS complement(2003..3436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55620 tRNA complement(3789..3862) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(3934..4020) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(4312..4384) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(4592..4816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55630 CDS complement(4890..5279) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM25 transl_table 11 codon_start 1 locus_tag LOCUS_55640 gene rplL tRNA complement(5396..5469) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 sequence579 source 1..5560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55650 CDS complement(1156..1947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55660 CDS complement(2493..2672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55670 CDS 3038..3970 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP3 transl_table 11 codon_start 1 locus_tag LOCUS_55680 CDS complement(4442..5212) product phycobilisome rod-core linker polypeptide CpcG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50040 transl_table 11 codon_start 1 locus_tag LOCUS_55690 gene cpcG2 sequence580 source 1..5558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(515..1384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 transl_table 11 codon_start 1 locus_tag LOCUS_55700 CDS complement(1605..2540) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 transl_table 11 codon_start 1 locus_tag LOCUS_55710 CDS complement(3235..3582) product DOPA 4,5-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738577.1 transl_table 11 codon_start 1 locus_tag LOCUS_55720 CDS complement(3904..5553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55730 sequence581 source 1..5549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 245..3094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55740 CDS 3300..3494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55750 CDS 4073..4465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55760 CDS complement(4760..5215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55770 sequence582 source 1..5539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1334..1663 product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL6 transl_table 11 codon_start 1 locus_tag LOCUS_55780 CDS complement(1660..2781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 transl_table 11 codon_start 1 locus_tag LOCUS_55790 CDS complement(2911..3678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058307.1 transl_table 11 codon_start 1 locus_tag LOCUS_55800 CDS complement(4020..4748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55810 sequence583 source 1..5537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(967..1782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55820 CDS 2056..4467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55830 CDS complement(4460..4879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55840 CDS complement(5086..5259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55850 sequence584 source 1..5524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 163..1458 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 transl_table 11 codon_start 1 locus_tag LOCUS_55860 CDS 1753..2835 product N-acetylmuramic acid/N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ML3 transl_table 11 codon_start 1 locus_tag LOCUS_55870 gene murK CDS 3074..5164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55880 sequence585 source 1..5515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(130..1077) product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079950.1 transl_table 11 codon_start 1 locus_tag LOCUS_55890 CDS complement(1658..3955) product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143682.1 transl_table 11 codon_start 1 locus_tag LOCUS_55900 CDS complement(4430..5359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55910 sequence586 source 1..5497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 468..1733 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056941.1 transl_table 11 codon_start 1 locus_tag LOCUS_55920 CDS complement(1844..2560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056083.1 transl_table 11 codon_start 1 locus_tag LOCUS_55930 CDS complement(2727..3206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056683.1 transl_table 11 codon_start 1 locus_tag LOCUS_55940 CDS 3406..5247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55950 sequence587 source 1..5497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 477..773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55960 CDS 826..1635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55970 CDS complement(1788..2201) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 transl_table 11 codon_start 1 locus_tag LOCUS_55980 CDS complement(2204..2584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55990 CDS 2816..3238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56000 CDS 3242..3658 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 transl_table 11 codon_start 1 locus_tag LOCUS_56010 CDS complement(3676..4071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56020 CDS complement(4155..4370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56030 sequence588 source 1..5493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 219..434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56040 CDS 1233..1544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143670.1 transl_table 11 codon_start 1 locus_tag LOCUS_56050 CDS complement(1869..2270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56060 CDS complement(2760..3011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56070 note possible pseudo, frameshifted CDS complement(3080..4729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056997.1 transl_table 11 codon_start 1 locus_tag LOCUS_56080 sequence589 source 1..5485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(638..1336) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682086.1 transl_table 11 codon_start 1 locus_tag LOCUS_56090 CDS complement(1707..5399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56100 sequence590 source 1..5474 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(151..1356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56110 CDS complement(1508..1894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56120 CDS 2090..2320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56130 CDS complement(3106..5019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56140 sequence591 source 1..5473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56150 CDS 1479..2105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144095.1 transl_table 11 codon_start 1 locus_tag LOCUS_56160 CDS complement(2150..2509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022115.1 transl_table 11 codon_start 1 locus_tag LOCUS_56170 CDS complement(2586..2783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56180 tRNA complement(2989..3062) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(3299..3370) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(3404..3477) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(3485..3559) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(3770..3845) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(3851..3927) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(3935..4007) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(4093..4167) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 4167..4328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56190 tRNA complement(4382..4458) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(4459..4545) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(4551..4637) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(4642..4716) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(4720..4792) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(4841..4914) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(4971..5047) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 sequence592 source 1..5471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1287 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000660215.1:proton glutamate symport protein locus_tag LOCUS_56200 CDS 1381..2694 product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 transl_table 11 codon_start 1 locus_tag LOCUS_56210 gene gltP CDS complement(2911..3195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56220 sequence593 source 1..5470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..509 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194622.1:phosphohydrolase locus_tag LOCUS_56230 CDS 693..1562 product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NG35 transl_table 11 codon_start 1 locus_tag LOCUS_56240 gene phnJ CDS 1785..2555 product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091781.1 transl_table 11 codon_start 1 locus_tag LOCUS_56250 CDS 2566..2760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56260 CDS 2816..3556 product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209287.1 transl_table 11 codon_start 1 locus_tag LOCUS_56270 gene phnL CDS 3569..3742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56280 CDS 3876..5009 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403601.1 transl_table 11 codon_start 1 locus_tag LOCUS_56290 sequence594 source 1..5410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1665..4319 product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR4 transl_table 11 codon_start 1 locus_tag LOCUS_56300 gene topA CDS 4875..5015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56310 sequence595 source 1..5407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 247..825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56320 CDS complement(1034..1723) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933646.1 transl_table 11 codon_start 1 locus_tag LOCUS_56330 CDS complement(1898..2344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56340 CDS complement(2627..3802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141800.1 transl_table 11 codon_start 1 locus_tag LOCUS_56350 CDS complement(3873..4265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56360 CDS 4426..5280 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056762.1 transl_table 11 codon_start 1 locus_tag LOCUS_56370 sequence596 source 1..5393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(88..354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56380 CDS complement(743..1480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56390 CDS complement(1619..1996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56400 CDS complement(2052..2297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56410 CDS complement(2328..2690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56420 CDS 3418..5340 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889030.1 transl_table 11 codon_start 1 locus_tag LOCUS_56430 sequence597 source 1..5386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 930..3158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 transl_table 11 codon_start 1 locus_tag LOCUS_56440 CDS 3177..4127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56450 sequence598 source 1..5375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 917..2473 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 transl_table 11 codon_start 1 locus_tag LOCUS_56460 CDS 2535..3119 product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 transl_table 11 codon_start 1 locus_tag LOCUS_56470 CDS 3116..3376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56480 CDS complement(3566..3796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56490 CDS complement(3973..4602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56500 sequence599 source 1..5361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 487..729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56510 CDS 686..1651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56520 CDS 1695..3032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56530 CDS 3096..3761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56540 CDS 3827..4150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56550 CDS 4123..4986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56560 sequence600 source 1..5359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 220..1728 product myeloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143588.1 transl_table 11 codon_start 1 locus_tag LOCUS_56570 CDS complement(1864..2277) product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528493.1 transl_table 11 codon_start 1 locus_tag LOCUS_56580 CDS 2252..2470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56590 CDS complement(2578..3333) product UDP-N-acetyl-D-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 transl_table 11 codon_start 1 locus_tag LOCUS_56600 CDS complement(3330..4514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089044.1 transl_table 11 codon_start 1 locus_tag LOCUS_56610 CDS complement(4653..4910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56620 sequence601 source 1..5331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 261..2066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56630 CDS 2258..2569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56640 CDS complement(2964..3203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56650 CDS 3694..4227 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE5 transl_table 11 codon_start 1 locus_tag LOCUS_56660 sequence602 source 1..5330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 715..2652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56670 CDS complement(2730..5072) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG65 transl_table 11 codon_start 1 locus_tag LOCUS_56680 gene pcrA sequence603 source 1..5305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(262..1452) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525367.1 transl_table 11 codon_start 1 locus_tag LOCUS_56690 CDS complement(1463..1945) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106290.1 transl_table 11 codon_start 1 locus_tag LOCUS_56700 CDS complement(2070..4526) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088902.1 transl_table 11 codon_start 1 locus_tag LOCUS_56710 tRNA 5067..5139 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 sequence604 source 1..5302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(376..1707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56720 CDS complement(1737..2198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56730 CDS 2774..4942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56740 sequence605 source 1..5302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 927..2414 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057032.1 transl_table 11 codon_start 1 locus_tag LOCUS_56750 CDS 2545..2928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56760 CDS complement(2996..4222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 transl_table 11 codon_start 1 locus_tag LOCUS_56770 CDS 4699..5199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56780 sequence606 source 1..5302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(494..2962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56790 CDS 4280..5029 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPE7 transl_table 11 codon_start 1 locus_tag LOCUS_56800 gene uppS sequence607 source 1..5300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(973..3003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56810 CDS complement(3174..4085) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 transl_table 11 codon_start 1 locus_tag LOCUS_56820 sequence608 source 1..5293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(731..907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56830 CDS complement(924..2504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057727.1 transl_table 11 codon_start 1 locus_tag LOCUS_56840 CDS complement(2981..3646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56850 CDS complement(3759..5114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56860 sequence609 source 1..5290 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(319..810) product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A386 transl_table 11 codon_start 1 locus_tag LOCUS_56870 gene psbV CDS 1683..2759 product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141699.1 transl_table 11 codon_start 1 locus_tag LOCUS_56880 CDS 3025..4635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56890 sequence610 source 1..5274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1759..2373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56900 CDS complement(2614..3003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56910 CDS 3444..4967 product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJT1 transl_table 11 codon_start 1 locus_tag LOCUS_56920 gene glpK sequence611 source 1..5274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(275..514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56930 CDS complement(516..938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56940 CDS 1270..3426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56950 CDS 3671..5074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56960 sequence612 source 1..5274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence613 source 1..5235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(573..1262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56970 CDS complement(1799..4078) product inter-alpha-trypsin inhibitor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122418.1 transl_table 11 codon_start 1 locus_tag LOCUS_56980 tRNA complement(4731..4808) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(4836..4910) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(4911..4984) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 sequence614 source 1..5216 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(609..1589) product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 transl_table 11 codon_start 1 locus_tag LOCUS_56990 CDS complement(2296..3417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57000 CDS complement(3761..4744) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 transl_table 11 codon_start 1 locus_tag LOCUS_57010 sequence615 source 1..5208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 789..1850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57020 CDS 1877..2914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57030 sequence616 source 1..5205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 243..1079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57040 CDS 1089..1691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056109.1 transl_table 11 codon_start 1 locus_tag LOCUS_57050 CDS complement(1820..2164) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143941.1 transl_table 11 codon_start 1 locus_tag LOCUS_57060 CDS complement(2234..2752) product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057135.1 transl_table 11 codon_start 1 locus_tag LOCUS_57070 gene accB CDS complement(2887..3477) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD3 transl_table 11 codon_start 1 locus_tag LOCUS_57080 gene efp CDS complement(3669..4358) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ1 transl_table 11 codon_start 1 locus_tag LOCUS_57090 gene purN CDS complement(4370..5050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57100 sequence617 source 1..5203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(95..652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57110 CDS complement(721..3795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57120 CDS 4256..4639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57130 sequence618 source 1..5162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 148..1185 product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG6 transl_table 11 codon_start 1 locus_tag LOCUS_57140 CDS 1624..2817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57150 CDS 2909..3781 product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG4 transl_table 11 codon_start 1 locus_tag LOCUS_57160 CDS 3862..4641 product phosphate import ATP-binding protein PstB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG3 transl_table 11 codon_start 1 locus_tag LOCUS_57170 gene pstB2 sequence619 source 1..5141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..1228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57180 CDS complement(1354..2076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141964.1 transl_table 11 codon_start 1 locus_tag LOCUS_57190 CDS 2492..3577 product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 transl_table 11 codon_start 1 locus_tag LOCUS_57200 CDS 3728..4261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57210 sequence620 source 1..5132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(155..730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 transl_table 11 codon_start 1 locus_tag LOCUS_57220 CDS complement(925..1527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57230 CDS complement(1994..3952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57240 CDS complement(3977..4996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57250 sequence621 source 1..5099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 227..2227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57260 CDS 2442..3956 product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528010.1 transl_table 11 codon_start 1 locus_tag LOCUS_57270 CDS 4522..4854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57280 CDS 4865..5053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57290 sequence622 source 1..5095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1671..3077 product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210399.1 transl_table 11 codon_start 1 locus_tag LOCUS_57300 CDS 3192..4595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57310 sequence623 source 1..5082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..850) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056725.1 transl_table 11 codon_start 1 locus_tag LOCUS_57320 CDS complement(865..1827) product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI7 transl_table 11 codon_start 1 locus_tag LOCUS_57330 gene cysK CDS complement(2543..2983) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056354.1 transl_table 11 codon_start 1 locus_tag LOCUS_57340 CDS complement(3193..4992) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 transl_table 11 codon_start 1 locus_tag LOCUS_57350 sequence624 source 1..5060 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2829..4310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142959.1 transl_table 11 codon_start 1 locus_tag LOCUS_57360 CDS complement(4316..4783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57370 sequence625 source 1..5057 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(128..1357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57380 CDS complement(1350..1895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57390 CDS complement(1936..2469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57400 CDS complement(2524..3129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57410 CDS 3212..3799 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545597.1 transl_table 11 codon_start 1 locus_tag LOCUS_57420 CDS 4472..4636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57430 sequence626 source 1..5046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(368..910) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853140.1 transl_table 11 codon_start 1 locus_tag LOCUS_57440 CDS complement(2068..3432) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM9 transl_table 11 codon_start 1 locus_tag LOCUS_57450 gene murF CDS complement(4085..4528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071088.1 transl_table 11 codon_start 1 locus_tag LOCUS_57460 sequence627 source 1..5039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1044 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865294.1:sugar ABC transporter ATP-binding protein locus_tag LOCUS_57470 CDS complement(1201..2379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57480 CDS 2742..3314 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMK6 transl_table 11 codon_start 1 locus_tag LOCUS_57490 CDS complement(3539..4066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57500 sequence628 source 1..5033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 490..1230 product phycobilisome rod-core linker polypeptide CpcG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50040 transl_table 11 codon_start 1 locus_tag LOCUS_57510 gene cpcG2 CDS 1433..2602 product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 transl_table 11 codon_start 1 locus_tag LOCUS_57520 CDS 2982..3638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57530 CDS complement(3998..4732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57540 sequence629 source 1..5032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 431..2545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056358.1 transl_table 11 codon_start 1 locus_tag LOCUS_57550 CDS 2990..3439 product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057428.1 transl_table 11 codon_start 1 locus_tag LOCUS_57560 CDS complement(3604..4611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57570 sequence630 source 1..5031 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 93..1214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57580 sequence631 source 1..5029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 262..1335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57590 CDS complement(1602..2285) product phosphoribosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984864.1 transl_table 11 codon_start 1 locus_tag LOCUS_57600 CDS 2507..3184 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142403.1 transl_table 11 codon_start 1 locus_tag LOCUS_57610 CDS complement(3332..4159) product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ4 transl_table 11 codon_start 1 locus_tag LOCUS_57620 gene map sequence632 source 1..4981 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 494..913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57630 CDS 999..1484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57640 CDS 1889..2134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57650 CDS 2633..3250 product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 transl_table 11 codon_start 1 locus_tag LOCUS_57660 CDS complement(3453..4958) product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 transl_table 11 codon_start 1 locus_tag LOCUS_57670 sequence633 source 1..4976 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 456..1292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057340.1 transl_table 11 codon_start 1 locus_tag LOCUS_57680 CDS 1289..1468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57690 CDS complement(1516..4806) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 transl_table 11 codon_start 1 locus_tag LOCUS_57700 sequence634 source 1..4963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 48..372 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccatccctattagggataaggggtttgtaaag CDS complement(900..1505) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392433.1 transl_table 11 codon_start 1 locus_tag LOCUS_57710 CDS complement(2253..4646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 transl_table 11 codon_start 1 locus_tag LOCUS_57720 sequence635 source 1..4960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57730 CDS 871..4074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57740 sequence636 source 1..4960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(319..651) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140011.1 transl_table 11 codon_start 1 locus_tag LOCUS_57750 CDS complement(684..1895) product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 transl_table 11 codon_start 1 locus_tag LOCUS_57760 CDS complement(1954..3162) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057886.1 transl_table 11 codon_start 1 locus_tag LOCUS_57770 gene gldA CDS 3813..4184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57780 CDS complement(4293..4817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056935.1 transl_table 11 codon_start 1 locus_tag LOCUS_57790 gene ycf51 sequence637 source 1..4944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 633..1775 product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBB3 transl_table 11 codon_start 1 locus_tag LOCUS_57800 gene purT CDS 1992..2486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57810 CDS 2687..3496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57820 CDS 3658..4536 product 2-hydroxy-6-oxohepta-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143319.1 transl_table 11 codon_start 1 locus_tag LOCUS_57830 sequence638 source 1..4929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 319..1371 product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A861 transl_table 11 codon_start 1 locus_tag LOCUS_57840 CDS 1355..2395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 transl_table 11 codon_start 1 locus_tag LOCUS_57850 sequence639 source 1..4912 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..1520 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 transl_table 11 codon_start 1 locus_tag LOCUS_57860 CDS complement(1831..2205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57870 CDS complement(2880..4268) product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141145.1 transl_table 11 codon_start 1 locus_tag LOCUS_57880 sequence640 source 1..4903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 165..1832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57890 CDS 2762..4768 product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057481.1 transl_table 11 codon_start 1 locus_tag LOCUS_57900 sequence641 source 1..4879 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 743..1678 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057801.1 transl_table 11 codon_start 1 locus_tag LOCUS_57910 CDS 1801..2340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056693.1 transl_table 11 codon_start 1 locus_tag LOCUS_57920 CDS complement(3336..4007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57930 CDS 4634..4783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57940 sequence642 source 1..4874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1267..1701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57950 CDS 1834..2283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57960 CDS 2716..3156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57970 CDS 3153..4814 product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391043.1 transl_table 11 codon_start 1 locus_tag LOCUS_57980 sequence643 source 1..4861 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2407..2610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57990 CDS complement(2939..4255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58000 sequence644 source 1..4823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 670..1701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58010 CDS 1940..2740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58020 CDS 2740..4437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58030 sequence645 source 1..4799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58040 CDS 1333..1992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58050 CDS 2175..4607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58060 sequence646 source 1..4762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(75..1535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58070 CDS 2095..3618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58080 misc_feature complement(3982..>4762) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807926.1:mechanosensitive ion channel protein locus_tag LOCUS_58090 sequence647 source 1..4759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 374..922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58100 CDS complement(1067..1702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58110 CDS complement(1911..2834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758610.1 transl_table 11 codon_start 1 locus_tag LOCUS_58120 gene iunH CDS 3203..3586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097228.1 transl_table 11 codon_start 1 locus_tag LOCUS_58130 CDS complement(3986..4579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58140 sequence648 source 1..4758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(618..1457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58150 CDS complement(1965..3653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057472.1 transl_table 11 codon_start 1 locus_tag LOCUS_58160 sequence649 source 1..4756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 532..1716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58170 CDS 1845..2837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58180 CDS 3296..4459 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGU6 transl_table 11 codon_start 1 locus_tag LOCUS_58190 gene hemH sequence650 source 1..4751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 517..1230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58200 CDS 1255..2283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58210 CDS 2291..3091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58220 sequence651 source 1..4737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 207..509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58230 CDS 805..1311 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257806.1 transl_table 11 codon_start 1 locus_tag LOCUS_58240 CDS complement(1646..2650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58250 CDS 2841..4394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58260 sequence652 source 1..4736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(511..1461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 transl_table 11 codon_start 1 locus_tag LOCUS_58270 CDS 1713..3197 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141482.1 transl_table 11 codon_start 1 locus_tag LOCUS_58280 CDS 3575..4369 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 transl_table 11 codon_start 1 locus_tag LOCUS_58290 sequence653 source 1..4735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 815..1549 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK35 transl_table 11 codon_start 1 locus_tag LOCUS_58300 gene cysH CDS complement(1704..1853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58310 CDS complement(2028..4691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58320 sequence654 source 1..4735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 120..653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58330 CDS complement(833..1156) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056468.1 transl_table 11 codon_start 1 locus_tag LOCUS_58340 CDS complement(1313..2335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58350 CDS complement(2362..3249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58360 CDS complement(3388..4080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58370 tRNA 4329..4404 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 sequence655 source 1..4733 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(127..1164) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 transl_table 11 codon_start 1 locus_tag LOCUS_58380 gene uge CDS complement(1175..2455) product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768856.1 transl_table 11 codon_start 1 locus_tag LOCUS_58390 misc_feature complement(2754..>4733) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056091.1:asparagine synthetase B locus_tag LOCUS_58400 sequence656 source 1..4721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 87..1136 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG48 transl_table 11 codon_start 1 locus_tag LOCUS_58410 gene gap1 CDS 1271..2701 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0P8 transl_table 11 codon_start 1 locus_tag LOCUS_58420 CDS complement(2660..2941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58430 CDS 3161..4162 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL7 transl_table 11 codon_start 1 locus_tag LOCUS_58440 gene tal sequence657 source 1..4715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3049 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268607.1:non-ribosomal peptide synthetase locus_tag LOCUS_58450 CDS 3102..4382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58460 sequence658 source 1..4710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(990..2870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58470 CDS complement(3006..3713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58480 sequence659 source 1..4696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 569..1327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58490 CDS 1343..2167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58500 CDS 2157..3062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58510 sequence660 source 1..4688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(33..1229) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 transl_table 11 codon_start 1 locus_tag LOCUS_58520 CDS 2174..3469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056607.1 transl_table 11 codon_start 1 locus_tag LOCUS_58530 CDS complement(3582..4685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58540 sequence661 source 1..4682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 197..373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58550 CDS complement(486..2591) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 transl_table 11 codon_start 1 locus_tag LOCUS_58560 CDS complement(2697..4418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58570 sequence662 source 1..4679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 38..649 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 transl_table 11 codon_start 1 locus_tag LOCUS_58580 CDS complement(770..1213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58590 CDS 1467..2120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58600 CDS 2140..3480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58610 CDS 3587..4063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58620 sequence663 source 1..4659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 352..2709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58630 CDS complement(2930..4342) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 transl_table 11 codon_start 1 locus_tag LOCUS_58640 sequence664 source 1..4645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1423..2031) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59134 transl_table 11 codon_start 1 locus_tag LOCUS_58650 gene rpsD CDS 2244..2891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58660 CDS 3895..4542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58670 sequence665 source 1..4638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(184..1746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58680 CDS 2033..2596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58690 CDS 2736..4205 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858205.1 transl_table 11 codon_start 1 locus_tag LOCUS_58700 sequence666 source 1..4634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 192..863 product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057487.1 transl_table 11 codon_start 1 locus_tag LOCUS_58710 gene ntcA CDS 1339..2808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 transl_table 11 codon_start 1 locus_tag LOCUS_58720 CDS 3016..3450 product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL47 transl_table 11 codon_start 1 locus_tag LOCUS_58730 CDS complement(4085..4348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058048.1 transl_table 11 codon_start 1 locus_tag LOCUS_58740 sequence667 source 1..4629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58750 CDS 767..4465 product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388379.1 transl_table 11 codon_start 1 locus_tag LOCUS_58760 gene bchH sequence668 source 1..4618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..1012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58770 CDS 1310..2236 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKN5 transl_table 11 codon_start 1 locus_tag LOCUS_58780 gene rbsK CDS 2500..3768 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477214.1 transl_table 11 codon_start 1 locus_tag LOCUS_58790 sequence669 source 1..4614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(351..1787) product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN18 transl_table 11 codon_start 1 locus_tag LOCUS_58800 CDS complement(1918..3042) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593063.1 transl_table 11 codon_start 1 locus_tag LOCUS_58810 CDS complement(3058..4413) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674116.1 transl_table 11 codon_start 1 locus_tag LOCUS_58820 sequence670 source 1..4614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(421..630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58830 CDS complement(1268..1414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58840 CDS complement(2084..2290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58850 CDS complement(2646..3911) product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 transl_table 11 codon_start 1 locus_tag LOCUS_58860 CDS complement(4042..4494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58870 sequence671 source 1..4601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(268..1038) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA5 transl_table 11 codon_start 1 locus_tag LOCUS_58880 gene hisA CDS complement(1130..1420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058117.1 transl_table 11 codon_start 1 locus_tag LOCUS_58890 CDS complement(1558..1902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 transl_table 11 codon_start 1 locus_tag LOCUS_58900 gene ycf49 CDS 2107..3144 product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140747.1 transl_table 11 codon_start 1 locus_tag LOCUS_58910 CDS 3376..4545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58920 sequence672 source 1..4596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(43..564) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 transl_table 11 codon_start 1 locus_tag LOCUS_58930 CDS 1919..4255 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057047.1 transl_table 11 codon_start 1 locus_tag LOCUS_58940 sequence673 source 1..4592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 203..1195 product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884030.1 transl_table 11 codon_start 1 locus_tag LOCUS_58950 CDS 1324..2739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58960 CDS 2906..3886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58970 sequence674 source 1..4566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001153181.1:histidine kinase locus_tag LOCUS_58980 CDS 552..1208 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 transl_table 11 codon_start 1 locus_tag LOCUS_58990 CDS complement(1348..2091) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142844.1 transl_table 11 codon_start 1 locus_tag LOCUS_59000 CDS 2338..3102 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 transl_table 11 codon_start 1 locus_tag LOCUS_59010 CDS 3403..3981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59020 sequence675 source 1..4551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(211..2262) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058192.1 transl_table 11 codon_start 1 locus_tag LOCUS_59030 gene fus CDS 2879..3754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59040 CDS 3854..4426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59050 sequence676 source 1..4512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(579..1574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59060 CDS complement(1696..2904) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 transl_table 11 codon_start 1 locus_tag LOCUS_59070 misc_feature complement(3224..>4512) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142580.1:peptidase M16 locus_tag LOCUS_59080 sequence677 source 1..4507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 179..1567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59090 CDS 1648..2304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59100 CDS complement(2489..3172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59110 misc_feature complement(3829..>4507) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405072.1:signal peptide peptidase SppA locus_tag LOCUS_59120 sequence678 source 1..4483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(425..730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141253.1 transl_table 11 codon_start 1 locus_tag LOCUS_59130 CDS 925..1599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707254.1 transl_table 11 codon_start 1 locus_tag LOCUS_59140 sequence679 source 1..4475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 360..731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174341.1 transl_table 11 codon_start 1 locus_tag LOCUS_59150 CDS 1061..2320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59160 CDS 3506..4423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59170 sequence680 source 1..4470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(374..3829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59180 sequence681 source 1..4465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(216..824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59190 CDS 1127..2605 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729439.1 transl_table 11 codon_start 1 locus_tag LOCUS_59200 CDS 2732..4207 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403192.1 transl_table 11 codon_start 1 locus_tag LOCUS_59210 sequence682 source 1..4440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2572 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E2W3:histidine kinase locus_tag LOCUS_59220 CDS complement(2775..3353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59230 sequence683 source 1..4419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 92..907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59240 CDS complement(1302..2189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228704.1 transl_table 11 codon_start 1 locus_tag LOCUS_59250 CDS complement(2557..4281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59260 sequence684 source 1..4415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(567..1550) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057297.1 transl_table 11 codon_start 1 locus_tag LOCUS_59270 CDS complement(1701..2210) product phycobilisome core component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 transl_table 11 codon_start 1 locus_tag LOCUS_59280 gene apcF CDS 2615..4030 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ7 transl_table 11 codon_start 1 locus_tag LOCUS_59290 gene glnA CDS complement(4143..4343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59300 sequence685 source 1..4378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(196..1890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59310 CDS complement(1890..2690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59320 CDS complement(2698..3726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59330 sequence686 source 1..4372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142405.1 transl_table 11 codon_start 1 locus_tag LOCUS_59340 CDS complement(887..1456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 transl_table 11 codon_start 1 locus_tag LOCUS_59350 CDS complement(1471..1605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59360 CDS complement(1675..2040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59370 note possible pseudo, internal stop codon CDS complement(2541..2993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59380 CDS 3016..4290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59390 sequence687 source 1..4371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..772 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056208.1:membrane protein locus_tag LOCUS_59400 CDS complement(1544..2323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933406.1 transl_table 11 codon_start 1 locus_tag LOCUS_59410 CDS complement(2359..3777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59420 sequence688 source 1..4356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(748..1164) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143722.1 transl_table 11 codon_start 1 locus_tag LOCUS_59430 CDS 1529..2101 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066604.1 transl_table 11 codon_start 1 locus_tag LOCUS_59440 CDS 2242..3249 product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142928.1 transl_table 11 codon_start 1 locus_tag LOCUS_59450 sequence689 source 1..4330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence690 source 1..4329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 152..2713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59460 CDS complement(2815..4104) product tyrosine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883602.1 transl_table 11 codon_start 1 locus_tag LOCUS_59470 gene tyrP_2 sequence691 source 1..4306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(349..741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59480 CDS complement(936..1310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59490 CDS complement(1476..2885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59500 CDS complement(3038..3334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59510 CDS 3640..3831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59520 CDS 3978..4241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59530 sequence692 source 1..4273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 280..1575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59540 CDS 1817..2560 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 transl_table 11 codon_start 1 locus_tag LOCUS_59550 CDS 2624..3583 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 transl_table 11 codon_start 1 locus_tag LOCUS_59560 CDS 3763..4131 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531148.1 transl_table 11 codon_start 1 locus_tag LOCUS_59570 sequence693 source 1..4265 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(288..1142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057340.1 transl_table 11 codon_start 1 locus_tag LOCUS_59580 CDS complement(1505..3136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59590 CDS complement(3151..3996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59600 sequence694 source 1..4256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 844..1575 product pyrroloquinoline-quinone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYN5 transl_table 11 codon_start 1 locus_tag LOCUS_59610 gene pqqC CDS 1575..1853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59620 CDS 2002..3111 product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYN3 transl_table 11 codon_start 1 locus_tag LOCUS_59630 gene pqqE CDS complement(3079..3315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59640 sequence695 source 1..4252 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 800..1225 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 transl_table 11 codon_start 1 locus_tag LOCUS_59650 CDS 1262..2128 product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057550.1 transl_table 11 codon_start 1 locus_tag LOCUS_59660 gene nadC CDS 2189..2662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59670 CDS complement(2681..3232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 transl_table 11 codon_start 1 locus_tag LOCUS_59680 sequence696 source 1..4234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 197..2380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59690 note possible pseudo, internal stop codon sequence697 source 1..4226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..778 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986456.1:HIT family protein locus_tag LOCUS_59700 CDS complement(1021..1209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59710 note possible pseudo, internal stop codon CDS complement(1429..2112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702036.1 transl_table 11 codon_start 1 locus_tag LOCUS_59720 CDS 2232..3950 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMV6 transl_table 11 codon_start 1 locus_tag LOCUS_59730 gene ureC sequence698 source 1..4226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1294..3960) product chaperone protein ClpB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG71 transl_table 11 codon_start 1 locus_tag LOCUS_59740 gene clpB2 sequence699 source 1..4221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 97..3261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59750 sequence700 source 1..4219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence701 source 1..4217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(750..1898) product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 transl_table 11 codon_start 1 locus_tag LOCUS_59760 CDS complement(2344..3921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59770 sequence702 source 1..4175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(324..1691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59780 CDS complement(1826..2161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59790 CDS complement(2173..3999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142038.1 transl_table 11 codon_start 1 locus_tag LOCUS_59800 sequence703 source 1..4170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 239..1147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z8X8 transl_table 11 codon_start 1 locus_tag LOCUS_59810 CDS complement(1419..2891) product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI46 transl_table 11 codon_start 1 locus_tag LOCUS_59820 gene pepA CDS complement(3424..3762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59830 sequence704 source 1..4168 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1370..1540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59840 CDS 1714..3153 product Zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY9 transl_table 11 codon_start 1 locus_tag LOCUS_59850 gene crtQ CDS 3231..3680 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 transl_table 11 codon_start 1 locus_tag LOCUS_59860 CDS complement(3706..3945) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141646.1 transl_table 11 codon_start 1 locus_tag LOCUS_59870 sequence705 source 1..4159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 148..1344 product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67781 transl_table 11 codon_start 1 locus_tag LOCUS_59880 gene aspC CDS 1465..1908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125638.1 transl_table 11 codon_start 1 locus_tag LOCUS_59890 CDS 2073..3959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59900 sequence706 source 1..4157 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(961..3984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59910 sequence707 source 1..4152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(166..441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59920 CDS 1306..2421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140792.1 transl_table 11 codon_start 1 locus_tag LOCUS_59930 CDS complement(2532..3173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59940 tRNA 3397..3469 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 sequence708 source 1..4138 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(22..2370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59950 sequence709 source 1..4132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(273..1373) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258191.1 transl_table 11 codon_start 1 locus_tag LOCUS_59960 CDS complement(1599..2354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59970 CDS complement(2548..2949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59980 CDS complement(2924..3679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59990 sequence710 source 1..4123 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(301..429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60000 CDS 498..704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60010 CDS 786..977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60020 CDS 1046..1366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60030 CDS complement(1637..2047) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064873.1 transl_table 11 codon_start 1 locus_tag LOCUS_60040 CDS 2127..3317 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 transl_table 11 codon_start 1 locus_tag LOCUS_60050 CDS 3383..3601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60060 sequence711 source 1..4111 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1304..1783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60070 CDS complement(2353..3057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141492.1 transl_table 11 codon_start 1 locus_tag LOCUS_60080 CDS complement(3228..3707) product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057304.1 transl_table 11 codon_start 1 locus_tag LOCUS_60090 sequence712 source 1..4109 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 508..1281 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056208.1 transl_table 11 codon_start 1 locus_tag LOCUS_60100 CDS complement(1641..2420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933406.1 transl_table 11 codon_start 1 locus_tag LOCUS_60110 CDS complement(2456..2731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60120 CDS complement(2670..3863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60130 sequence713 source 1..4102 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1285 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259387.1:glycosyl transferase family 1 locus_tag LOCUS_60140 CDS complement(1712..2416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60150 CDS complement(2416..3819) product Spo0A activation inhibitor soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057235.1 transl_table 11 codon_start 1 locus_tag LOCUS_60160 sequence714 source 1..4101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(258..1004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60170 CDS 2239..2514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60180 CDS complement(2788..3963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60190 sequence715 source 1..4099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2285..3646 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258395.1 transl_table 11 codon_start 1 locus_tag LOCUS_60200 sequence716 source 1..4091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 254..643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60210 CDS complement(867..1334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 transl_table 11 codon_start 1 locus_tag LOCUS_60220 CDS 1613..1849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60230 misc_feature complement(1892..>4091) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057195.1:nitrate reductase catalytic subunit locus_tag LOCUS_60240 sequence717 source 1..4080 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(60..479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60250 CDS complement(521..1207) product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056304.1 transl_table 11 codon_start 1 locus_tag LOCUS_60260 gene chlM CDS complement(1480..2925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058239.1 transl_table 11 codon_start 1 locus_tag LOCUS_60270 CDS complement(3030..3818) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056183.1 transl_table 11 codon_start 1 locus_tag LOCUS_60280 sequence718 source 1..4077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3193..3882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60290 sequence719 source 1..4041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(217..1134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406215.1 transl_table 11 codon_start 1 locus_tag LOCUS_60300 CDS complement(1113..1451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60310 misc_feature complement(2101..>4041) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228876.1:copper-translocating P-type ATPase locus_tag LOCUS_60320 sequence720 source 1..4028 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(380..2908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60330 sequence721 source 1..4025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(309..932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60340 CDS 1004..1804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 transl_table 11 codon_start 1 locus_tag LOCUS_60350 CDS complement(1833..3326) product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257297.1 transl_table 11 codon_start 1 locus_tag LOCUS_60360 CDS 3491..4012 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142676.1 transl_table 11 codon_start 1 locus_tag LOCUS_60370 sequence722 source 1..4021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence723 source 1..4006 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..2341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 transl_table 11 codon_start 1 locus_tag LOCUS_60380 CDS complement(2648..3832) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957841.1 transl_table 11 codon_start 1 locus_tag LOCUS_60390 sequence724 source 1..3977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(487..2208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60400 CDS complement(2290..2919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60410 CDS 3171..3428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60420 CDS 3488..3670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60430 CDS complement(3683..3901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60440 sequence725 source 1..3977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1076..3703) product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL06 transl_table 11 codon_start 1 locus_tag LOCUS_60450 sequence726 source 1..3959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 480..2306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142038.1 transl_table 11 codon_start 1 locus_tag LOCUS_60460 CDS 2318..2644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60470 sequence727 source 1..3932 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(44..889) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168864.1 transl_table 11 codon_start 1 locus_tag LOCUS_60480 CDS 1281..1475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60490 CDS 1540..3816 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 transl_table 11 codon_start 1 locus_tag LOCUS_60500 sequence728 source 1..3915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 284..1831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60510 note possible pseudo, frameshifted CDS 1818..1973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60520 CDS complement(2666..3067) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 transl_table 11 codon_start 1 locus_tag LOCUS_60530 CDS complement(3055..3276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60540 sequence729 source 1..3891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 165..1049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60550 CDS complement(1264..2022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60560 CDS complement(2620..3393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60570 sequence730 source 1..3876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 812..3718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60580 sequence731 source 1..3871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 879..1775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141312.1 transl_table 11 codon_start 1 locus_tag LOCUS_60590 CDS complement(1811..2725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 transl_table 11 codon_start 1 locus_tag LOCUS_60600 CDS 3022..3369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60610 sequence732 source 1..3869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(310..483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60620 note possible pseudo, frameshifted CDS complement(527..955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60630 note possible pseudo, frameshifted CDS 1064..3637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60640 sequence733 source 1..3844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 398..613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60650 CDS complement(776..1543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60660 CDS complement(1878..2300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60670 CDS complement(2346..3755) product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB2 transl_table 11 codon_start 1 locus_tag LOCUS_60680 gene sun sequence734 source 1..3833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 335..3424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60690 sequence735 source 1..3830 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 318..596 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 transl_table 11 codon_start 1 locus_tag LOCUS_60700 CDS 1626..3179 product NAD(P)H-quinone oxidoreductase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR6 transl_table 11 codon_start 1 locus_tag LOCUS_60710 gene ndhB sequence736 source 1..3812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(239..1294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60720 note possible pseudo, frameshifted CDS complement(1284..3392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60730 note possible pseudo, frameshifted sequence737 source 1..3784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(210..983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60740 CDS complement(1277..2146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142150.1 transl_table 11 codon_start 1 locus_tag LOCUS_60750 sequence738 source 1..3783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1443..2072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60760 CDS 2098..3732 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 transl_table 11 codon_start 1 locus_tag LOCUS_60770 sequence739 source 1..3770 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 98..1915 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142666.1 transl_table 11 codon_start 1 locus_tag LOCUS_60780 CDS 2433..3413 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI29 transl_table 11 codon_start 1 locus_tag LOCUS_60790 gene speE sequence740 source 1..3768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 714..2561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143667.1 transl_table 11 codon_start 1 locus_tag LOCUS_60800 CDS complement(2576..3403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60810 sequence741 source 1..3759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 17..850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528056.1 transl_table 11 codon_start 1 locus_tag LOCUS_60820 CDS 854..2206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60830 sequence742 source 1..3758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(41..940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60840 CDS complement(1523..3424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60850 sequence743 source 1..3731 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 239..1711 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257475.1 transl_table 11 codon_start 1 locus_tag LOCUS_60860 CDS 1935..2579 product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMJ6 transl_table 11 codon_start 1 locus_tag LOCUS_60870 gene hisB CDS 2589..2963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60880 note possible pseudo, internal stop codon, frameshifted CDS 3029..3508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60890 note possible pseudo, internal stop codon, frameshifted sequence744 source 1..3727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1882 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268199.1:peptidase C39 note possible pseudo, internal stop codon locus_tag LOCUS_60900 CDS 2015..2173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60910 note possible pseudo, internal stop codon sequence745 source 1..3706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1023..1322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60920 CDS complement(1307..1495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60930 CDS complement(1566..3410) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW0 transl_table 11 codon_start 1 locus_tag LOCUS_60940 gene thrS sequence746 source 1..3696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 776..1108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60950 CDS 1816..3399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60960 sequence747 source 1..3692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 10..2244 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMY6 transl_table 11 codon_start 1 locus_tag LOCUS_60970 gene recD2 misc_feature complement(2263..>3692) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203018.1:N-6-adenine-methyltransferase locus_tag LOCUS_60980 sequence748 source 1..3672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 354..599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60990 CDS 580..1041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 transl_table 11 codon_start 1 locus_tag LOCUS_61000 CDS 1583..3004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 transl_table 11 codon_start 1 locus_tag LOCUS_61010 gene ycf46 CDS complement(3040..3387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61020 sequence749 source 1..3660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(16..579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61030 CDS complement(958..2304) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA9 transl_table 11 codon_start 1 locus_tag LOCUS_61040 gene dnaB CDS complement(2319..3050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61050 sequence750 source 1..3655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence751 source 1..3654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 365..712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61060 CDS 1101..3293 product bacteriocin cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681955.1 transl_table 11 codon_start 1 locus_tag LOCUS_61070 sequence752 source 1..3643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2099..2623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61080 sequence753 source 1..3611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 553..1191 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056166.1 transl_table 11 codon_start 1 locus_tag LOCUS_61090 CDS 1204..1980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61100 CDS complement(1997..2728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61110 sequence754 source 1..3609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(278..1678) product light-independent protochlorophyllide reductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH2 transl_table 11 codon_start 1 locus_tag LOCUS_61120 gene chlN CDS complement(1811..2581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61130 CDS complement(2616..3482) product light-independent protochlorophyllide reductase iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH0 transl_table 11 codon_start 1 locus_tag LOCUS_61140 gene chlL sequence755 source 1..3600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(336..1325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61150 CDS 1858..3552 product beta-carotene ketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140397.1 transl_table 11 codon_start 1 locus_tag LOCUS_61160 gene crtO sequence756 source 1..3577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(433..2013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61170 sequence757 source 1..3528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(387..1961) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 transl_table 11 codon_start 1 locus_tag LOCUS_61180 CDS complement(2214..2483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61190 sequence758 source 1..3501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 43..447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61200 CDS 1648..1821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61210 CDS 1913..2728 product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9K6 transl_table 11 codon_start 1 locus_tag LOCUS_61220 gene folE2 misc_feature complement(2891..>3501) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140589.1:transposase locus_tag LOCUS_61230 sequence759 source 1..3487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 345..1199 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD6 transl_table 11 codon_start 1 locus_tag LOCUS_61240 gene purU CDS complement(1312..2682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61250 sequence760 source 1..3474 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(988..1746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189279.1 transl_table 11 codon_start 1 locus_tag LOCUS_61260 CDS complement(2033..2740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189279.1 transl_table 11 codon_start 1 locus_tag LOCUS_61270 sequence761 source 1..3473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(653..796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61280 CDS complement(862..1518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61290 CDS 1756..2409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390294.1 transl_table 11 codon_start 1 locus_tag LOCUS_61300 CDS 2430..2849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61310 CDS 3190..3324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61320 sequence762 source 1..3473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..1507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61330 CDS complement(1504..2292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61340 CDS complement(2305..3165) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 transl_table 11 codon_start 1 locus_tag LOCUS_61350 sequence763 source 1..3461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 407..1225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61360 CDS 1218..1964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61370 CDS 1971..2606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61380 CDS complement(2641..3375) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 transl_table 11 codon_start 1 locus_tag LOCUS_61390 sequence764 source 1..3419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 37..1056 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104216.1 transl_table 11 codon_start 1 locus_tag LOCUS_61400 CDS 2514..3116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61410 sequence765 source 1..3412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence766 source 1..3404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(158..2533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61420 sequence767 source 1..3393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 419..1696 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP5 transl_table 11 codon_start 1 locus_tag LOCUS_61430 CDS 1930..2529 product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 transl_table 11 codon_start 1 locus_tag LOCUS_61440 gene nadD CDS 2490..3236 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 transl_table 11 codon_start 1 locus_tag LOCUS_61450 sequence768 source 1..3388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(805..1392) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D7W7 transl_table 11 codon_start 1 locus_tag LOCUS_61460 gene adk CDS 1739..2275 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143500.1 transl_table 11 codon_start 1 locus_tag LOCUS_61470 CDS 2675..3229 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM4 transl_table 11 codon_start 1 locus_tag LOCUS_61480 sequence769 source 1..3385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(220..345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61490 CDS 1233..1889 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 transl_table 11 codon_start 1 locus_tag LOCUS_61500 gene sigG CDS 2231..2833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61510 sequence770 source 1..3367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(504..2744) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMY6 transl_table 11 codon_start 1 locus_tag LOCUS_61520 gene recD2 CDS complement(2941..3240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61530 sequence771 source 1..3352 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1183..1551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61540 CDS complement(1548..1820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61550 CDS 2340..2624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61560 sequence772 source 1..3348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence773 source 1..3345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence774 source 1..3327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 307..1941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61570 CDS 1996..2898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61580 sequence775 source 1..3309 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 692..1384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61590 CDS complement(1693..3057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61600 sequence776 source 1..3307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 200..1909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057497.1 transl_table 11 codon_start 1 locus_tag LOCUS_61610 CDS 1937..2311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61620 sequence777 source 1..3300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence778 source 1..3294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..2728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61630 CDS complement(2845..3165) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 transl_table 11 codon_start 1 locus_tag LOCUS_61640 sequence779 source 1..3270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 979..3177 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058113.1 transl_table 11 codon_start 1 locus_tag LOCUS_61650 sequence780 source 1..3268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1517..2185) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089752.1 transl_table 11 codon_start 1 locus_tag LOCUS_61660 sequence781 source 1..3263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1033..2301 product sucrose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143828.1 transl_table 11 codon_start 1 locus_tag LOCUS_61670 sequence782 source 1..3254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 206..541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61680 CDS complement(650..3253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61690 sequence783 source 1..3249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2003 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208725.1:adhesin locus_tag LOCUS_61700 sequence784 source 1..3241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(673..3045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61710 sequence785 source 1..3232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 646..1086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61720 CDS complement(1448..1948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61730 sequence786 source 1..3219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(151..630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545799.1 transl_table 11 codon_start 1 locus_tag LOCUS_61740 CDS complement(972..1361) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLZ6 transl_table 11 codon_start 1 locus_tag LOCUS_61750 gene ureB CDS complement(1634..1936) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK85 transl_table 11 codon_start 1 locus_tag LOCUS_61760 gene ureA CDS complement(2026..2889) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF7 transl_table 11 codon_start 1 locus_tag LOCUS_61770 gene ureD sequence787 source 1..3215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(166..1092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61780 CDS complement(1096..2100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61790 CDS complement(2137..3108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61800 sequence788 source 1..3214 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(820..1488) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140026.1 transl_table 11 codon_start 1 locus_tag LOCUS_61810 CDS complement(1394..2821) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140027.1 transl_table 11 codon_start 1 locus_tag LOCUS_61820 CDS 2972..3133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61830 sequence789 source 1..3197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 76..399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140620.1 transl_table 11 codon_start 1 locus_tag LOCUS_61840 CDS 396..3104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140619.1 transl_table 11 codon_start 1 locus_tag LOCUS_61850 sequence790 source 1..3195 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(37..450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61860 CDS complement(482..814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61870 CDS complement(966..3080) product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT9 transl_table 11 codon_start 1 locus_tag LOCUS_61880 gene glgX sequence791 source 1..3182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(825..1358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61890 misc_feature complement(1893..>3182) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011126018.1:ligase locus_tag LOCUS_61900 sequence792 source 1..3175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..736 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706097.1:haloacid dehalogenase locus_tag LOCUS_61910 CDS complement(941..1411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61920 CDS complement(1628..2938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61930 sequence793 source 1..3166 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 7..687 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140746.1 transl_table 11 codon_start 1 locus_tag LOCUS_61940 CDS 856..2775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61950 sequence794 source 1..3165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence795 source 1..3163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(264..911) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 transl_table 11 codon_start 1 locus_tag LOCUS_61960 CDS complement(1373..2869) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59081 transl_table 11 codon_start 1 locus_tag LOCUS_61970 gene metG sequence796 source 1..3146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 199..507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61980 CDS 913..1992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61990 CDS 2212..2850 product tellurium resistance protein TerY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001388628.1 transl_table 11 codon_start 1 locus_tag LOCUS_62000 sequence797 source 1..3144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(79..921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62010 CDS complement(1231..2145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62020 sequence798 source 1..3107 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..1193) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YN8 transl_table 11 codon_start 1 locus_tag LOCUS_62030 CDS complement(1363..2850) product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124737.1 transl_table 11 codon_start 1 locus_tag LOCUS_62040 sequence799 source 1..3101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(95..391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531104.1 transl_table 11 codon_start 1 locus_tag LOCUS_62050 CDS complement(720..1202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62060 CDS 1399..3072 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031941.1 transl_table 11 codon_start 1 locus_tag LOCUS_62070 sequence800 source 1..3100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 314..2200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62080 sequence801 source 1..3059 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(298..888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057957.1 transl_table 11 codon_start 1 locus_tag LOCUS_62090 CDS complement(978..1892) product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHV7 transl_table 11 codon_start 1 locus_tag LOCUS_62100 gene prmC CDS complement(1921..2724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62110 sequence802 source 1..3057 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 704..2155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62120 CDS complement(2225..2932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62130 sequence803 source 1..3018 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..519 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119458.1:short-chain dehydrogenase locus_tag LOCUS_62140 CDS 813..2390 product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG7 transl_table 11 codon_start 1 locus_tag LOCUS_62150 sequence804 source 1..3012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence805 source 1..3004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..1144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62160 CDS complement(1180..1548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62170 CDS complement(1557..2666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62180 sequence806 source 1..3000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(417..1994) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 transl_table 11 codon_start 1 locus_tag LOCUS_62190 CDS 2291..2428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62200 sequence807 source 1..2999 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1218..1763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62210 CDS complement(2167..2844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62220 sequence808 source 1..2995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..2156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62230 misc_feature complement(2365..>2995) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946333.1:TVP38/TMEM64 family protein locus_tag LOCUS_62240 sequence809 source 1..2995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(468..2837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62250 sequence810 source 1..2991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..574 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261844.1:heme utilization protein HutZ locus_tag LOCUS_62260 CDS 910..1425 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNU5 transl_table 11 codon_start 1 locus_tag LOCUS_62270 gene isiB CDS 1602..2321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62280 sequence811 source 1..2985 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..996) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL64 transl_table 11 codon_start 1 locus_tag LOCUS_62290 gene fcl CDS complement(1367..2446) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 transl_table 11 codon_start 1 locus_tag LOCUS_62300 gene gmd sequence812 source 1..2980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..674) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL51 transl_table 11 codon_start 1 locus_tag LOCUS_62310 CDS 1063..2445 product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLZ2 transl_table 11 codon_start 1 locus_tag LOCUS_62320 gene thiC sequence813 source 1..2972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 863..2110 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140589.1 transl_table 11 codon_start 1 locus_tag LOCUS_62330 CDS complement(2448..2972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62340 sequence814 source 1..2966 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(103..537) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018151.1 transl_table 11 codon_start 1 locus_tag LOCUS_62350 CDS complement(779..1165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62360 CDS complement(1595..1756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62370 note possible pseudo, internal stop codon sequence815 source 1..2961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(367..606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058211.1 transl_table 11 codon_start 1 locus_tag LOCUS_62380 CDS complement(1085..1603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056117.1 transl_table 11 codon_start 1 locus_tag LOCUS_62390 CDS complement(1875..2561) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056116.1 transl_table 11 codon_start 1 locus_tag LOCUS_62400 sequence816 source 1..2957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..1269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62410 CDS complement(1297..1944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62420 sequence817 source 1..2952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(234..524) product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG91 transl_table 11 codon_start 1 locus_tag LOCUS_62430 gene gatC CDS complement(855..1376) product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ6 transl_table 11 codon_start 1 locus_tag LOCUS_62440 gene ycf3 CDS complement(1541..2227) product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 transl_table 11 codon_start 1 locus_tag LOCUS_62450 sequence818 source 1..2944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 847..1113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62460 CDS 1150..1413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62470 CDS complement(1475..1732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62480 CDS complement(1739..1981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62490 note possible pseudo, internal stop codon misc_feature complement(2027..>2944) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010714164.1:copper-translocating P-type ATPase note possible pseudo, internal stop codon locus_tag LOCUS_62500 sequence819 source 1..2944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 84..1445 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531469.1 transl_table 11 codon_start 1 locus_tag LOCUS_62510 CDS complement(1559..2707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62520 sequence820 source 1..2942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(6..1466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62530 CDS 2301..2468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62540 CDS 2662..2829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62550 sequence821 source 1..2892 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(912..1613) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582912.1 transl_table 11 codon_start 1 locus_tag LOCUS_62560 CDS complement(1651..2136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62570 CDS complement(2372..2842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62580 sequence822 source 1..2885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 173..1885 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 transl_table 11 codon_start 1 locus_tag LOCUS_62590 misc_feature complement(2285..>2885) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003594617.1:N-formylglutamate amidohydrolase locus_tag LOCUS_62600 sequence823 source 1..2882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 624..2864 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144195.1 transl_table 11 codon_start 1 locus_tag LOCUS_62610 sequence824 source 1..2879 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(114..1871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62620 sequence825 source 1..2862 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(140..487) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNH7 transl_table 11 codon_start 1 locus_tag LOCUS_62630 gene rpsF CDS 1148..1960 product 5-oxo-1,2,5-tricarboxylic-3-penten acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057118.1 transl_table 11 codon_start 1 locus_tag LOCUS_62640 CDS complement(1995..2471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056916.1 transl_table 11 codon_start 1 locus_tag LOCUS_62650 gene ycf60 CDS complement(2564..2761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057807.1 transl_table 11 codon_start 1 locus_tag LOCUS_62660 sequence826 source 1..2847 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 521..2170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62670 sequence827 source 1..2836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(447..983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62680 CDS complement(1389..2297) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 transl_table 11 codon_start 1 locus_tag LOCUS_62690 sequence828 source 1..2816 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(561..1208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62700 sequence829 source 1..2790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057211.1:methyltransferase locus_tag LOCUS_62710 CDS complement(2140..2355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62720 sequence830 source 1..2780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 239..1393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62730 CDS complement(1777..2664) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869811.1 transl_table 11 codon_start 1 locus_tag LOCUS_62740 sequence831 source 1..2779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 158..1123 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143025.1 transl_table 11 codon_start 1 locus_tag LOCUS_62750 CDS complement(1312..2481) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056176.1 transl_table 11 codon_start 1 locus_tag LOCUS_62760 gene lpxB sequence832 source 1..2742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(431..1555) product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIV3 transl_table 11 codon_start 1 locus_tag LOCUS_62770 gene rlmN misc_feature complement(1938..>2742) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546883.1:transposase locus_tag LOCUS_62780 sequence833 source 1..2719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(282..593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62790 CDS 686..1654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62800 sequence834 source 1..2700 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1482 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202347.1:mobilization protein locus_tag LOCUS_62810 sequence835 source 1..2681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1241..1450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62820 CDS complement(1523..2245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62830 sequence836 source 1..2679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence837 source 1..2674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1218..1913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62840 sequence838 source 1..2670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 66..1520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540305.1 transl_table 11 codon_start 1 locus_tag LOCUS_62850 misc_feature complement(1755..>2670) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001254816.1:N-acetylmuramoyl-L-alanine amidase locus_tag LOCUS_62860 sequence839 source 1..2667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(128..964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62870 CDS complement(1156..1635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62880 sequence840 source 1..2647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 70..2304 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMY6 transl_table 11 codon_start 1 locus_tag LOCUS_62890 gene recD2 sequence841 source 1..2643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence842 source 1..2579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(668..1078) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402975.1 transl_table 11 codon_start 1 locus_tag LOCUS_62900 CDS 1283..2431 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 transl_table 11 codon_start 1 locus_tag LOCUS_62910 sequence843 source 1..2536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 274..2442 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459225.1 transl_table 11 codon_start 1 locus_tag LOCUS_62920 sequence844 source 1..2510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 337..1305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62930 CDS 1329..1595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62940 CDS 1604..1828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62950 CDS 1973..2227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62960 CDS 2237..2413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62970 sequence845 source 1..2498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 306..2324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62980 sequence846 source 1..2484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(242..958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 transl_table 11 codon_start 1 locus_tag LOCUS_62990 CDS 1108..1248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63000 CDS 1466..2176 product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG61 transl_table 11 codon_start 1 locus_tag LOCUS_63010 sequence847 source 1..2420 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(485..898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63020 CDS complement(1140..1676) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640239.1 transl_table 11 codon_start 1 locus_tag LOCUS_63030 CDS complement(1857..2126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63040 sequence848 source 1..2401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 170..973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63050 sequence849 source 1..2382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(218..688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63060 CDS complement(868..1299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63070 sequence850 source 1..2379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(16..597) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141270.1 transl_table 11 codon_start 1 locus_tag LOCUS_63080 misc_feature complement(1008..>2379) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKN4:arginine--tRNA ligase locus_tag LOCUS_63090 sequence851 source 1..2366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 172..639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63100 sequence852 source 1..2336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1338 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118712.1:mechanosensitive ion channel protein MscS locus_tag LOCUS_63110 sequence853 source 1..2300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63120 CDS 709..1245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63130 CDS complement(1238..1684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63140 sequence854 source 1..2297 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence855 source 1..2294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(154..227) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS complement(457..990) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 transl_table 11 codon_start 1 locus_tag LOCUS_63150 gene ycf52 CDS complement(1326..1463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63160 CDS 1496..2215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057518.1 transl_table 11 codon_start 1 locus_tag LOCUS_63170 sequence856 source 1..2292 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(489..2186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63180 sequence857 source 1..2259 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(200..2008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 transl_table 11 codon_start 1 locus_tag LOCUS_63190 sequence858 source 1..2249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 594..2126 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266557.1 transl_table 11 codon_start 1 locus_tag LOCUS_63200 sequence859 source 1..2213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(423..1817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63210 sequence860 source 1..2200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 169..1161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63220 CDS complement(1216..1515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63230 sequence861 source 1..2187 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 964..1551 product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056745.1 transl_table 11 codon_start 1 locus_tag LOCUS_63240 sequence862 source 1..2181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 822..1514 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 transl_table 11 codon_start 1 locus_tag LOCUS_63250 sequence863 source 1..2177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence864 source 1..2171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 838..1587 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945820.1 transl_table 11 codon_start 1 locus_tag LOCUS_63260 CDS 1669..2094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63270 sequence865 source 1..2151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 305..1741 product alkaline invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 transl_table 11 codon_start 1 locus_tag LOCUS_63280 sequence866 source 1..2143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 58..756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63290 CDS 1168..1752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63300 sequence867 source 1..2139 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 314..880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144077.1 transl_table 11 codon_start 1 locus_tag LOCUS_63310 CDS 1494..2060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140313.1 transl_table 11 codon_start 1 locus_tag LOCUS_63320 sequence868 source 1..2113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 552..1895 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056295.1 transl_table 11 codon_start 1 locus_tag LOCUS_63330 gene ftsW sequence869 source 1..2108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(202..2094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63340 sequence870 source 1..2095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(298..1830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63350 sequence871 source 1..2084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(257..1513) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055970.1 transl_table 11 codon_start 1 locus_tag LOCUS_63360 gene nifS CDS complement(1750..2010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63370 sequence872 source 1..2056 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(695..1144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63380 CDS complement(1268..1531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63390 sequence873 source 1..2048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(217..627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63400 CDS complement(699..1463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143510.1 transl_table 11 codon_start 1 locus_tag LOCUS_63410 CDS complement(1562..1771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63420 sequence874 source 1..2022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(251..1114) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058215.1 transl_table 11 codon_start 1 locus_tag LOCUS_63430 CDS complement(1168..1920) product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056662.1 transl_table 11 codon_start 1 locus_tag LOCUS_63440 sequence875 source 1..2017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(89..271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63450 note possible pseudo, frameshifted CDS complement(237..503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63460 note possible pseudo, frameshifted CDS 572..1984 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 transl_table 11 codon_start 1 locus_tag LOCUS_63470 sequence876 source 1..2017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 282..923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63480 sequence877 source 1..2015 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence878 source 1..2003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence879 source 1..1987 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(850..>1987) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943650.1:glycosyl transferase locus_tag LOCUS_63490 sequence880 source 1..1985 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 426..1166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63500 sequence881 source 1..1931 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 155..535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055984.1 transl_table 11 codon_start 1 locus_tag LOCUS_63510 CDS complement(627..1766) product UPF0284 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGL0 transl_table 11 codon_start 1 locus_tag LOCUS_63520 sequence882 source 1..1913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 609..1625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63530 sequence883 source 1..1882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence884 source 1..1880 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 584..1639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63540 sequence885 source 1..1873 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(439..714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63550 sequence886 source 1..1869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..1347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63560 sequence887 source 1..1865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 190..1557 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141685.1 transl_table 11 codon_start 1 locus_tag LOCUS_63570 sequence888 source 1..1864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(168..>1864) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJY2:putative diflavin flavoprotein A 1 locus_tag LOCUS_63580 sequence889 source 1..1834 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(263..1525) product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK88 transl_table 11 codon_start 1 locus_tag LOCUS_63590 gene metK sequence890 source 1..1816 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(720..1088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63600 sequence891 source 1..1811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1030..1524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63610 sequence892 source 1..1799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 760..1722 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 transl_table 11 codon_start 1 locus_tag LOCUS_63620 sequence893 source 1..1782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 267..1577 product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140176.1 transl_table 11 codon_start 1 locus_tag LOCUS_63630 sequence894 source 1..1769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence895 source 1..1766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63640 CDS 1144..1608 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545148.1 transl_table 11 codon_start 1 locus_tag LOCUS_63650 sequence896 source 1..1760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(457..1599) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 transl_table 11 codon_start 1 locus_tag LOCUS_63660 sequence897 source 1..1732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(210..1271) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112631.1 transl_table 11 codon_start 1 locus_tag LOCUS_63670 sequence898 source 1..1713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 55..1365 product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHI2 transl_table 11 codon_start 1 locus_tag LOCUS_63680 gene sbcD sequence899 source 1..1711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 841..1674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63690 sequence900 source 1..1692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941205.1:bifunctional diguanylate cyclase/phosphodiesterase locus_tag LOCUS_63700 sequence901 source 1..1679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(295..1089) product UDP-N-acetyl-D-mannosaminuronic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057274.1 transl_table 11 codon_start 1 locus_tag LOCUS_63710 sequence902 source 1..1676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 261..1442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63720 sequence903 source 1..1663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(469..1497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63730 sequence904 source 1..1655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..997 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124678.1:integrase locus_tag LOCUS_63740 sequence905 source 1..1596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence906 source 1..1552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 314..1498 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 transl_table 11 codon_start 1 locus_tag LOCUS_63750 sequence907 source 1..1536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 175..537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63760 CDS 569..814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63770 CDS 901..1278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63780 sequence908 source 1..1511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 241..744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63790 CDS 827..1153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140620.1 transl_table 11 codon_start 1 locus_tag LOCUS_63800 sequence909 source 1..1486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence910 source 1..1404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 173..535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63810 CDS 566..811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63820 CDS 900..1277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63830 sequence911 source 1..1353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 179..1219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63840 sequence912 source 1..1307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(59..883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63850 sequence913 source 1..1204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 432..863 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812014.1 transl_table 11 codon_start 1 locus_tag LOCUS_63860 sequence914 source 1..1198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 507..824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140620.1 transl_table 11 codon_start 1 locus_tag LOCUS_63870 sequence915 source 1..1197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence916 source 1..1153 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 165..923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63880 sequence917 source 1..1146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 12..758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63890 sequence918 source 1..1050 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence919 source 1..1005 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@