>Feature sequence0001 2322 373 gene locus_tag LOCUS_00010 2322 373 CDS product RiPP maturation radical SAM protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_00010 4746 2731 gene locus_tag LOCUS_00020 4746 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 7665 5044 gene locus_tag LOCUS_00030 7665 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 10117 8078 gene locus_tag LOCUS_00040 10117 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 11857 10409 gene locus_tag LOCUS_00050 11857 10409 CDS product radical SAM/SPASM domain Clo7bot peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948312.1 protein_id gnl|my_center|LOCUS_00050 14383 12980 gene locus_tag LOCUS_00060 14383 12980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 14483 15130 gene locus_tag LOCUS_00070 14483 15130 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140806.1 protein_id gnl|my_center|LOCUS_00070 16054 15557 gene locus_tag LOCUS_00080 16054 15557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 16650 17036 gene locus_tag LOCUS_00090 16650 17036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 17143 17721 gene locus_tag LOCUS_00100 17143 17721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 17738 19249 gene locus_tag LOCUS_00110 17738 19249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 19399 20001 gene locus_tag LOCUS_00120 19399 20001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00120 19994 20512 gene locus_tag LOCUS_00130 19994 20512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00130 20808 21398 gene locus_tag LOCUS_00140 20808 21398 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 protein_id gnl|my_center|LOCUS_00140 21588 21406 gene locus_tag LOCUS_00150 21588 21406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 22015 21683 gene locus_tag LOCUS_00160 22015 21683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_00160 22242 22012 gene locus_tag LOCUS_00170 22242 22012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_00170 22996 23709 gene locus_tag LOCUS_00180 22996 23709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24646 24014 gene locus_tag LOCUS_00190 24646 24014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 25008 25160 gene locus_tag LOCUS_00200 25008 25160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 25600 25896 gene locus_tag LOCUS_00210 25600 25896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25914 26231 gene locus_tag LOCUS_00220 25914 26231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26802 26554 gene locus_tag LOCUS_00230 26802 26554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00230 28539 27145 gene locus_tag LOCUS_00240 28539 27145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121734.1 protein_id gnl|my_center|LOCUS_00240 29543 28575 gene locus_tag LOCUS_00250 29543 28575 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142351.1 protein_id gnl|my_center|LOCUS_00250 29785 30609 gene locus_tag LOCUS_00260 29785 30609 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259169.1 protein_id gnl|my_center|LOCUS_00260 32014 31535 gene locus_tag LOCUS_00270 32014 31535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32326 33474 gene locus_tag LOCUS_00280 32326 33474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 34655 33570 gene locus_tag LOCUS_00290 34655 33570 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121735.1 protein_id gnl|my_center|LOCUS_00290 35229 35669 gene locus_tag LOCUS_00300 35229 35669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 37425 35821 gene locus_tag LOCUS_00310 37425 35821 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_00310 38093 37647 gene locus_tag LOCUS_00320 38093 37647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 39081 38458 gene locus_tag LOCUS_00330 39081 38458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 40120 39455 gene locus_tag LOCUS_00340 40120 39455 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_00340 40363 41769 gene locus_tag LOCUS_00350 40363 41769 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM0 protein_id gnl|my_center|LOCUS_00350 42094 42378 gene locus_tag LOCUS_00360 42094 42378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 43364 42792 gene locus_tag LOCUS_00370 43364 42792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 44361 44062 gene locus_tag LOCUS_00380 gene pchB 44361 44062 CDS product isochorismate-pyruvate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762840.1 protein_id gnl|my_center|LOCUS_00380 44857 44465 gene locus_tag LOCUS_00390 44857 44465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45051 44827 gene locus_tag LOCUS_00400 45051 44827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 46571 45252 gene locus_tag LOCUS_00410 gene sbcD 46571 45252 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHI2 protein_id gnl|my_center|LOCUS_00410 47393 46659 gene locus_tag LOCUS_00420 gene cysH 47393 46659 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK35 protein_id gnl|my_center|LOCUS_00420 47827 48099 gene locus_tag LOCUS_00430 47827 48099 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 protein_id gnl|my_center|LOCUS_00430 48832 48218 gene locus_tag LOCUS_00440 48832 48218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 49390 48971 gene locus_tag LOCUS_00450 49390 48971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 52288 49691 gene locus_tag LOCUS_00460 52288 49691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 53844 53404 gene locus_tag LOCUS_00470 53844 53404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 53996 54265 gene locus_tag LOCUS_00480 53996 54265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 56252 54663 gene locus_tag LOCUS_00490 56252 54663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 57166 56366 gene locus_tag LOCUS_00500 57166 56366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 57457 57714 gene locus_tag LOCUS_00510 57457 57714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 58593 57823 gene locus_tag LOCUS_00520 58593 57823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125038.1 protein_id gnl|my_center|LOCUS_00520 58968 60143 gene locus_tag LOCUS_00530 58968 60143 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257745.1 protein_id gnl|my_center|LOCUS_00530 60140 60823 gene locus_tag LOCUS_00540 60140 60823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_00540 60951 61568 gene locus_tag LOCUS_00550 60951 61568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_00550 61653 61976 gene locus_tag LOCUS_00560 61653 61976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 62258 62079 gene locus_tag LOCUS_00570 62258 62079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055918.1 protein_id gnl|my_center|LOCUS_00570 64584 62461 gene locus_tag LOCUS_00580 64584 62461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 65230 64889 gene locus_tag LOCUS_00590 65230 64889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142925.1 protein_id gnl|my_center|LOCUS_00590 65581 65234 gene locus_tag LOCUS_00600 65581 65234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142926.1 protein_id gnl|my_center|LOCUS_00600 65944 65723 gene locus_tag LOCUS_00610 65944 65723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 66466 66203 gene locus_tag LOCUS_00620 66466 66203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 >Feature sequence0002 381 598 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctctacttggggagaccccaagacc 2367 1327 gene locus_tag LOCUS_00630 2367 1327 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103696.1 protein_id gnl|my_center|LOCUS_00630 3368 2655 gene locus_tag LOCUS_00640 3368 2655 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259459.1 protein_id gnl|my_center|LOCUS_00640 5041 4157 gene locus_tag LOCUS_00650 5041 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 6191 5076 gene locus_tag LOCUS_00660 6191 5076 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_00660 8535 7441 gene locus_tag LOCUS_00670 gene rfaG 8535 7441 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476096.1 protein_id gnl|my_center|LOCUS_00670 9495 8590 gene locus_tag LOCUS_00680 9495 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 9801 9601 gene locus_tag LOCUS_00690 9801 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 10245 10093 gene locus_tag LOCUS_00700 10245 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 11615 10536 gene locus_tag LOCUS_00710 11615 10536 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088720.1 protein_id gnl|my_center|LOCUS_00710 12382 11600 gene locus_tag LOCUS_00720 gene ddhA 12382 11600 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976066.1 protein_id gnl|my_center|LOCUS_00720 14344 12422 gene locus_tag LOCUS_00730 14344 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045934.1 protein_id gnl|my_center|LOCUS_00730 15096 14341 gene locus_tag LOCUS_00740 15096 14341 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937648.1 protein_id gnl|my_center|LOCUS_00740 16057 15149 gene locus_tag LOCUS_00750 16057 15149 CDS product NDP-sugar dehydratase or epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_00750 16986 16069 gene locus_tag LOCUS_00760 16986 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 18172 17405 gene locus_tag LOCUS_00770 gene hpcH 18172 17405 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_00770 18813 18169 gene locus_tag LOCUS_00780 18813 18169 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 protein_id gnl|my_center|LOCUS_00780 19567 18824 gene locus_tag LOCUS_00790 19567 18824 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924398.1 protein_id gnl|my_center|LOCUS_00790 20464 19694 gene locus_tag LOCUS_00800 20464 19694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 21326 20457 gene locus_tag LOCUS_00810 21326 20457 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_00810 22323 21340 gene locus_tag LOCUS_00820 gene serA 22323 21340 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675255.1 protein_id gnl|my_center|LOCUS_00820 23621 22446 gene locus_tag LOCUS_00830 23621 22446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 24346 23618 gene locus_tag LOCUS_00840 gene neuA 24346 23618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_00840 24972 24337 gene locus_tag LOCUS_00850 24972 24337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 26140 25001 gene locus_tag LOCUS_00860 26140 25001 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932823.1 protein_id gnl|my_center|LOCUS_00860 26907 26164 gene locus_tag LOCUS_00870 26907 26164 CDS product SnoK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_00870 28008 26962 gene locus_tag LOCUS_00880 28008 26962 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_00880 28649 28008 gene locus_tag LOCUS_00890 28649 28008 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869453.1 protein_id gnl|my_center|LOCUS_00890 29715 28642 gene locus_tag LOCUS_00900 gene neuB 29715 28642 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261003.1 protein_id gnl|my_center|LOCUS_00900 30886 29717 gene locus_tag LOCUS_00910 30886 29717 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403378.1 protein_id gnl|my_center|LOCUS_00910 32058 30883 gene locus_tag LOCUS_00920 32058 30883 CDS product perosamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403377.1 protein_id gnl|my_center|LOCUS_00920 33070 32072 gene locus_tag LOCUS_00930 gene wcaG 33070 32072 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600889.1 protein_id gnl|my_center|LOCUS_00930 33518 33276 gene locus_tag LOCUS_00940 33518 33276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 34529 33822 gene locus_tag LOCUS_00950 gene gcd1 34529 33822 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774263.1 protein_id gnl|my_center|LOCUS_00950 35716 34529 gene locus_tag LOCUS_00960 gene rfaE 35716 34529 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5T5 protein_id gnl|my_center|LOCUS_00960 35681 35860 gene locus_tag LOCUS_00970 35681 35860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 36952 36167 gene locus_tag LOCUS_00980 36952 36167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 37696 37484 gene locus_tag LOCUS_00990 37696 37484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 39563 38424 gene locus_tag LOCUS_01000 39563 38424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 40097 39573 gene locus_tag LOCUS_01010 40097 39573 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088863.1 protein_id gnl|my_center|LOCUS_01010 40506 40171 gene locus_tag LOCUS_01020 40506 40171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 41621 40569 gene locus_tag LOCUS_01030 41621 40569 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771829.1 protein_id gnl|my_center|LOCUS_01030 42557 41628 gene locus_tag LOCUS_01040 42557 41628 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 protein_id gnl|my_center|LOCUS_01040 43744 42620 gene locus_tag LOCUS_01050 43744 42620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088177.1 protein_id gnl|my_center|LOCUS_01050 44845 43745 gene locus_tag LOCUS_01060 44845 43745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088176.1 protein_id gnl|my_center|LOCUS_01060 45867 44875 gene locus_tag LOCUS_01070 gene wcaG 45867 44875 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067556.1 protein_id gnl|my_center|LOCUS_01070 46908 45931 gene locus_tag LOCUS_01080 gene wcaG 46908 45931 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646256.1 protein_id gnl|my_center|LOCUS_01080 47510 46923 gene locus_tag LOCUS_01090 gene gmhA 47510 46923 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884059.1 protein_id gnl|my_center|LOCUS_01090 48217 47645 gene locus_tag LOCUS_01100 gene wcbN 48217 47645 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R80 protein_id gnl|my_center|LOCUS_01100 49936 48254 gene locus_tag LOCUS_01110 49936 48254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_01110 51670 50456 gene locus_tag LOCUS_01120 51670 50456 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_01120 52666 51746 gene locus_tag LOCUS_01130 52666 51746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 >Feature sequence0003 1332 145 gene locus_tag LOCUS_01140 1332 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 2521 1610 gene locus_tag LOCUS_01150 2521 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 3935 2811 gene locus_tag LOCUS_01160 3935 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 4633 3959 gene locus_tag LOCUS_01170 4633 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104212.1 protein_id gnl|my_center|LOCUS_01170 5036 5147 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtcttggggtctccccaagt 7020 5296 gene locus_tag LOCUS_01180 7020 5296 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 protein_id gnl|my_center|LOCUS_01180 9114 7783 gene locus_tag LOCUS_01190 9114 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 9312 9530 gene locus_tag LOCUS_01200 9312 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 9900 10598 gene locus_tag LOCUS_01210 9900 10598 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002094113.1 protein_id gnl|my_center|LOCUS_01210 10928 10707 gene locus_tag LOCUS_01220 10928 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 11566 11132 gene locus_tag LOCUS_01230 11566 11132 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141707.1 protein_id gnl|my_center|LOCUS_01230 11865 11563 gene locus_tag LOCUS_01240 11865 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 12124 11927 gene locus_tag LOCUS_01250 12124 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 13142 12114 gene locus_tag LOCUS_01260 13142 12114 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870286.1 protein_id gnl|my_center|LOCUS_01260 14798 13437 gene locus_tag LOCUS_01270 14798 13437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 15638 15000 gene locus_tag LOCUS_01280 15638 15000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 16281 16039 gene locus_tag LOCUS_01290 16281 16039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 16547 16311 gene locus_tag LOCUS_01300 16547 16311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 16779 16588 gene locus_tag LOCUS_01310 16779 16588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 16999 17229 gene locus_tag LOCUS_01320 16999 17229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_01320 17226 17558 gene locus_tag LOCUS_01330 17226 17558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_01330 17798 17977 gene locus_tag LOCUS_01340 17798 17977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 18111 18425 gene locus_tag LOCUS_01350 18111 18425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 19603 18815 gene locus_tag LOCUS_01360 19603 18815 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_01360 20451 19600 gene locus_tag LOCUS_01370 20451 19600 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_01370 22476 24434 gene locus_tag LOCUS_01380 22476 24434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 25150 25725 gene locus_tag LOCUS_01390 25150 25725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 25740 26531 gene locus_tag LOCUS_01400 25740 26531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 26908 27636 gene locus_tag LOCUS_01410 gene purC 26908 27636 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIT5 protein_id gnl|my_center|LOCUS_01410 28470 30407 gene locus_tag LOCUS_01420 28470 30407 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057626.1 protein_id gnl|my_center|LOCUS_01420 30407 31474 gene locus_tag LOCUS_01430 30407 31474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 31484 32020 gene locus_tag LOCUS_01440 gene fabZ 31484 32020 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TV98 protein_id gnl|my_center|LOCUS_01440 32467 33291 gene locus_tag LOCUS_01450 gene lpxA 32467 33291 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI00 protein_id gnl|my_center|LOCUS_01450 33288 34517 gene locus_tag LOCUS_01460 gene lpxB 33288 34517 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056176.1 protein_id gnl|my_center|LOCUS_01460 34963 36303 gene locus_tag LOCUS_01470 34963 36303 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y936 protein_id gnl|my_center|LOCUS_01470 36864 37190 gene locus_tag LOCUS_01480 36864 37190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144163.1 protein_id gnl|my_center|LOCUS_01480 37305 39098 gene locus_tag LOCUS_01490 37305 39098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058075.1 protein_id gnl|my_center|LOCUS_01490 39183 39908 gene locus_tag LOCUS_01500 39183 39908 CDS product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_01500 40093 40965 gene locus_tag LOCUS_01510 40093 40965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 41943 41380 gene locus_tag LOCUS_01520 41943 41380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 42316 43812 gene locus_tag LOCUS_01530 42316 43812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 44155 45486 gene locus_tag LOCUS_01540 44155 45486 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090344.1 protein_id gnl|my_center|LOCUS_01540 >Feature sequence0004 401 1375 gene locus_tag LOCUS_01550 gene ycf39 401 1375 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056703.1 protein_id gnl|my_center|LOCUS_01550 1523 2443 gene locus_tag LOCUS_01560 gene nadK1 1523 2443 CDS product NAD kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK1 protein_id gnl|my_center|LOCUS_01560 2955 4037 gene locus_tag LOCUS_01570 2955 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 4265 4768 gene locus_tag LOCUS_01580 4265 4768 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055910.1 protein_id gnl|my_center|LOCUS_01580 5125 6450 gene locus_tag LOCUS_01590 5125 6450 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058123.1 protein_id gnl|my_center|LOCUS_01590 6499 7092 gene locus_tag LOCUS_01600 6499 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 7303 9564 gene locus_tag LOCUS_01610 7303 9564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 9716 11959 gene locus_tag LOCUS_01620 9716 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01620 12716 11979 gene locus_tag LOCUS_01630 12716 11979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01630 13293 13823 gene locus_tag LOCUS_01640 13293 13823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 13888 15018 gene locus_tag LOCUS_01650 13888 15018 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056169.1 protein_id gnl|my_center|LOCUS_01650 17241 15256 gene locus_tag LOCUS_01660 17241 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 18698 17898 gene locus_tag LOCUS_01670 18698 17898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_01670 20090 19053 gene locus_tag LOCUS_01680 gene miaA 20090 19053 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM5 protein_id gnl|my_center|LOCUS_01680 20348 25168 gene locus_tag LOCUS_01690 20348 25168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 26110 25256 gene locus_tag LOCUS_01700 26110 25256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142464.1 protein_id gnl|my_center|LOCUS_01700 26256 28424 gene locus_tag LOCUS_01710 26256 28424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 28748 29422 gene locus_tag LOCUS_01720 28748 29422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_01720 29694 30131 gene locus_tag LOCUS_01730 29694 30131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 30493 33939 gene locus_tag LOCUS_01740 30493 33939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 34517 35536 gene locus_tag LOCUS_01750 34517 35536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 35816 36520 gene locus_tag LOCUS_01760 35816 36520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 36465 36683 gene locus_tag LOCUS_01770 36465 36683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 36794 37630 gene locus_tag LOCUS_01780 36794 37630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 37811 38452 gene locus_tag LOCUS_01790 37811 38452 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_01790 38692 39696 gene locus_tag LOCUS_01800 gene cas1 38692 39696 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEP2 protein_id gnl|my_center|LOCUS_01800 39798 40070 gene locus_tag LOCUS_01810 gene cas2 39798 40070 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDC5 protein_id gnl|my_center|LOCUS_01810 40384 42372 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcaatgagcataaatccctatgagggattgaaac >Feature sequence0005 549 1406 gene locus_tag LOCUS_01820 549 1406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057314.1 protein_id gnl|my_center|LOCUS_01820 1830 3548 gene locus_tag LOCUS_01830 1830 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 4510 3926 gene locus_tag LOCUS_01840 4510 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 4863 4531 gene locus_tag LOCUS_01850 4863 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 5814 5143 gene locus_tag LOCUS_01860 5814 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 6731 6213 gene locus_tag LOCUS_01870 gene isiB 6731 6213 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNU5 protein_id gnl|my_center|LOCUS_01870 8363 7335 gene locus_tag LOCUS_01880 gene isiA 8363 7335 CDS product iron stress-induced chlorophyll-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK20 protein_id gnl|my_center|LOCUS_01880 8925 9860 gene locus_tag LOCUS_01890 gene argF 8925 9860 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJW4 protein_id gnl|my_center|LOCUS_01890 10230 10439 gene locus_tag LOCUS_01900 10230 10439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 10499 11017 gene locus_tag LOCUS_01910 10499 11017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 11070 11441 gene locus_tag LOCUS_01920 11070 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 12625 11774 gene locus_tag LOCUS_01930 12625 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 13734 12616 gene locus_tag LOCUS_01940 13734 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 15125 14466 gene locus_tag LOCUS_01950 15125 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 15646 15122 gene locus_tag LOCUS_01960 15646 15122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 16127 16056 gene locus_tag LOCUS_t00010 16127 16056 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17046 16168 gene locus_tag LOCUS_01970 17046 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 18153 17458 gene locus_tag LOCUS_01980 18153 17458 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873009.1 protein_id gnl|my_center|LOCUS_01980 18440 19813 gene locus_tag LOCUS_01990 18440 19813 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 protein_id gnl|my_center|LOCUS_01990 22595 20211 gene locus_tag LOCUS_02000 22595 20211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 23568 24332 gene locus_tag LOCUS_02010 23568 24332 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_02010 24981 25439 gene locus_tag LOCUS_02020 24981 25439 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_02020 25840 27096 gene locus_tag LOCUS_02030 25840 27096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 27253 28299 gene locus_tag LOCUS_02040 27253 28299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056254.1 protein_id gnl|my_center|LOCUS_02040 28978 29691 gene locus_tag LOCUS_02050 28978 29691 CDS product aldehyde decarbonylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB4 protein_id gnl|my_center|LOCUS_02050 30076 31185 gene locus_tag LOCUS_02060 30076 31185 CDS product long-chain acyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057152.1 protein_id gnl|my_center|LOCUS_02060 31290 32273 gene locus_tag LOCUS_02070 gene accA 31290 32273 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB6 protein_id gnl|my_center|LOCUS_02070 32589 32822 gene locus_tag LOCUS_02080 32589 32822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 32804 33010 gene locus_tag LOCUS_02090 32804 33010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 33187 33924 gene locus_tag LOCUS_02100 gene folE 33187 33924 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB8 protein_id gnl|my_center|LOCUS_02100 34696 34055 gene locus_tag LOCUS_02110 gene trpF 34696 34055 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP3 protein_id gnl|my_center|LOCUS_02110 34838 35113 gene locus_tag LOCUS_02120 gene psaK 34838 35113 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A425 protein_id gnl|my_center|LOCUS_02120 36242 35469 gene locus_tag LOCUS_02130 36242 35469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 protein_id gnl|my_center|LOCUS_02130 38494 37535 gene locus_tag LOCUS_02140 38494 37535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 40867 38642 gene locus_tag LOCUS_02150 40867 38642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056918.1 protein_id gnl|my_center|LOCUS_02150 >Feature sequence0006 1275 58 gene locus_tag LOCUS_02160 1275 58 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_02160 2937 1279 gene locus_tag LOCUS_02170 2937 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 3768 5474 gene locus_tag LOCUS_02180 3768 5474 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_02180 5951 6556 gene locus_tag LOCUS_02190 gene ureG 5951 6556 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ4 protein_id gnl|my_center|LOCUS_02190 6734 8005 gene locus_tag LOCUS_02200 6734 8005 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_02200 8137 9303 gene locus_tag LOCUS_02210 8137 9303 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056963.1 protein_id gnl|my_center|LOCUS_02210 9505 10680 gene locus_tag LOCUS_02220 9505 10680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_02220 11213 12346 gene locus_tag LOCUS_02230 11213 12346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 12526 13263 gene locus_tag LOCUS_02240 12526 13263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_02240 13532 13347 gene locus_tag LOCUS_02250 13532 13347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 13777 13484 gene locus_tag LOCUS_02260 13777 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 14288 15202 gene locus_tag LOCUS_02270 14288 15202 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258307.1 protein_id gnl|my_center|LOCUS_02270 15239 15424 gene locus_tag LOCUS_02280 15239 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 15550 16491 gene locus_tag LOCUS_02290 gene ceo 15550 16491 CDS product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZ59 protein_id gnl|my_center|LOCUS_02290 16533 17243 gene locus_tag LOCUS_02300 16533 17243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 17260 18615 gene locus_tag LOCUS_02310 17260 18615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 19691 18966 gene locus_tag LOCUS_02320 19691 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 20143 19709 gene locus_tag LOCUS_02330 20143 19709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 21920 20187 gene locus_tag LOCUS_02340 gene pyrG 21920 20187 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT7 protein_id gnl|my_center|LOCUS_02340 22353 22120 gene locus_tag LOCUS_02350 22353 22120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 25029 22522 gene locus_tag LOCUS_02360 gene recG 25029 22522 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW6 protein_id gnl|my_center|LOCUS_02360 26076 25165 gene locus_tag LOCUS_02370 26076 25165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 26882 26226 gene locus_tag LOCUS_02380 26882 26226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 27836 26991 gene locus_tag LOCUS_02390 gene rpsB 27836 26991 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA2 protein_id gnl|my_center|LOCUS_02390 29441 28500 gene locus_tag LOCUS_02400 29441 28500 CDS product glycosly transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056836.1 protein_id gnl|my_center|LOCUS_02400 29977 29714 gene locus_tag LOCUS_02410 29977 29714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 31467 30253 gene locus_tag LOCUS_02420 gene ddeI 31467 30253 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H720 protein_id gnl|my_center|LOCUS_02420 32825 31587 gene locus_tag LOCUS_02430 32825 31587 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776584.1 protein_id gnl|my_center|LOCUS_02430 33856 34197 gene locus_tag LOCUS_02440 33856 34197 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 protein_id gnl|my_center|LOCUS_02440 35505 34621 gene locus_tag LOCUS_02450 35505 34621 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141460.1 protein_id gnl|my_center|LOCUS_02450 36432 35653 gene locus_tag LOCUS_02460 36432 35653 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057622.1 protein_id gnl|my_center|LOCUS_02460 38213 36567 gene locus_tag LOCUS_02470 gene ilvB 38213 36567 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057661.1 protein_id gnl|my_center|LOCUS_02470 39946 38579 gene locus_tag LOCUS_02480 39946 38579 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence0007 1135 383 gene locus_tag LOCUS_02490 1135 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 3641 1371 gene locus_tag LOCUS_02500 3641 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 4588 4854 gene locus_tag LOCUS_02510 4588 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02510 4785 5090 gene locus_tag LOCUS_02520 4785 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02520 5144 5392 gene locus_tag LOCUS_02530 5144 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02530 6077 6847 gene locus_tag LOCUS_02540 6077 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 8598 7288 gene locus_tag LOCUS_02550 8598 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 10088 9075 gene locus_tag LOCUS_02560 10088 9075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 11723 10092 gene locus_tag LOCUS_02570 11723 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 13125 12085 gene locus_tag LOCUS_02580 13125 12085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 13716 13285 gene locus_tag LOCUS_02590 13716 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 14710 13820 gene locus_tag LOCUS_02600 14710 13820 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_02600 15678 14707 gene locus_tag LOCUS_02610 15678 14707 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_02610 16538 15897 gene locus_tag LOCUS_02620 16538 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 18153 16690 gene locus_tag LOCUS_02630 18153 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 19663 18272 gene locus_tag LOCUS_02640 19663 18272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 20348 19827 gene locus_tag LOCUS_02650 20348 19827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 20928 21386 gene locus_tag LOCUS_02660 20928 21386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_02660 21713 22243 gene locus_tag LOCUS_02670 gene cysC 21713 22243 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN99 protein_id gnl|my_center|LOCUS_02670 22785 23270 gene locus_tag LOCUS_02680 22785 23270 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266947.1 protein_id gnl|my_center|LOCUS_02680 23782 25047 gene locus_tag LOCUS_02690 23782 25047 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525367.1 protein_id gnl|my_center|LOCUS_02690 25565 27025 gene locus_tag LOCUS_02700 25565 27025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 29075 27852 gene locus_tag LOCUS_02710 gene glgC 29075 27852 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057127.1 protein_id gnl|my_center|LOCUS_02710 33566 29307 gene locus_tag LOCUS_02720 33566 29307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 36197 34542 gene locus_tag LOCUS_02730 36197 34542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 39782 36534 gene locus_tag LOCUS_02740 39782 36534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 >Feature sequence0008 2784 319 gene locus_tag LOCUS_02750 2784 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2962 3195 gene locus_tag LOCUS_02760 2962 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 3208 3414 gene locus_tag LOCUS_02770 3208 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 4051 4275 gene locus_tag LOCUS_02780 4051 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 4342 4554 gene locus_tag LOCUS_02790 4342 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 5060 4728 gene locus_tag LOCUS_02800 5060 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 5463 5152 gene locus_tag LOCUS_02810 5463 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 5572 5441 gene locus_tag LOCUS_02820 5572 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 5683 5898 gene locus_tag LOCUS_02830 5683 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 6243 6034 gene locus_tag LOCUS_02840 6243 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 7707 6598 gene locus_tag LOCUS_02850 7707 6598 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81H80 protein_id gnl|my_center|LOCUS_02850 7998 8249 gene locus_tag LOCUS_02860 7998 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 8864 8529 gene locus_tag LOCUS_02870 gene rbcS 8864 8529 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057344.1 protein_id gnl|my_center|LOCUS_02870 9293 8895 gene locus_tag LOCUS_02880 gene rbcX 9293 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142154.1 protein_id gnl|my_center|LOCUS_02880 10755 9340 gene locus_tag LOCUS_02890 gene cbbL 10755 9340 CDS product ribulose bisphosphate carboxylase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIM7 protein_id gnl|my_center|LOCUS_02890 12339 11443 gene locus_tag LOCUS_02900 12339 11443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 14555 12609 gene locus_tag LOCUS_02910 gene ccmM 14555 12609 CDS product carbon dioxide concentrating mechanism protein CcmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142091.1 protein_id gnl|my_center|LOCUS_02910 14961 14659 gene locus_tag LOCUS_02920 gene ccmL 14961 14659 CDS product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_02920 15358 14975 gene locus_tag LOCUS_02930 gene ccmK1 15358 14975 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_02930 15972 15661 gene locus_tag LOCUS_02940 gene ccmK2 15972 15661 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056791.1 protein_id gnl|my_center|LOCUS_02940 17433 19160 gene locus_tag LOCUS_02950 gene ndhF4 17433 19160 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057958.1 protein_id gnl|my_center|LOCUS_02950 19487 21025 gene locus_tag LOCUS_02960 gene ndhD4 19487 21025 CDS product NAD(P)H-quinone oxidoreductase subunit D4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057959.1 protein_id gnl|my_center|LOCUS_02960 21410 22540 gene locus_tag LOCUS_02970 gene cupB 21410 22540 CDS product carbon dioxide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142079.1 protein_id gnl|my_center|LOCUS_02970 22929 23858 gene locus_tag LOCUS_02980 22929 23858 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057872.1 protein_id gnl|my_center|LOCUS_02980 25676 23871 gene locus_tag LOCUS_02990 25676 23871 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_02990 27358 25877 gene locus_tag LOCUS_03000 gene kmo 27358 25877 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD3 protein_id gnl|my_center|LOCUS_03000 27661 28653 gene locus_tag LOCUS_03010 27661 28653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 28666 29229 gene locus_tag LOCUS_03020 28666 29229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 30599 29274 gene locus_tag LOCUS_03030 30599 29274 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_03030 32361 31072 gene locus_tag LOCUS_03040 32361 31072 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_03040 33246 33851 gene locus_tag LOCUS_03050 33246 33851 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056727.1 protein_id gnl|my_center|LOCUS_03050 35286 34144 gene locus_tag LOCUS_03060 gene hemH 35286 34144 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGU6 protein_id gnl|my_center|LOCUS_03060 35418 36041 gene locus_tag LOCUS_03070 35418 36041 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057443.1 protein_id gnl|my_center|LOCUS_03070 37545 38720 gene locus_tag LOCUS_03080 37545 38720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence0009 447 647 gene locus_tag LOCUS_03090 447 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 3306 760 gene locus_tag LOCUS_03100 3306 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 4393 5262 gene locus_tag LOCUS_03110 4393 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 5607 5804 gene locus_tag LOCUS_03120 5607 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 6472 6047 gene locus_tag LOCUS_03130 6472 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 7401 6472 gene locus_tag LOCUS_03140 7401 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 8008 7523 gene locus_tag LOCUS_03150 8008 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 8718 8008 gene locus_tag LOCUS_03160 8718 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 9332 9105 gene locus_tag LOCUS_03170 9332 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 10042 9332 gene locus_tag LOCUS_03180 10042 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 11046 10354 gene locus_tag LOCUS_03190 11046 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 11745 11194 gene locus_tag LOCUS_03200 11745 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140946.1 protein_id gnl|my_center|LOCUS_03200 12023 11790 gene locus_tag LOCUS_03210 12023 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 12115 13527 gene locus_tag LOCUS_03220 12115 13527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 14315 14680 gene locus_tag LOCUS_03230 14315 14680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 15627 15040 gene locus_tag LOCUS_03240 15627 15040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 16174 15662 gene locus_tag LOCUS_03250 16174 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 16449 16186 gene locus_tag LOCUS_03260 16449 16186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 16454 16705 gene locus_tag LOCUS_03270 16454 16705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 18292 16697 gene locus_tag LOCUS_03280 18292 16697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 18834 18313 gene locus_tag LOCUS_03290 18834 18313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 19371 18907 gene locus_tag LOCUS_03300 19371 18907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 19619 19368 gene locus_tag LOCUS_03310 19619 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 20788 19628 gene locus_tag LOCUS_03320 20788 19628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 21157 21939 gene locus_tag LOCUS_03330 21157 21939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 22091 22552 gene locus_tag LOCUS_03340 22091 22552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144145.1 protein_id gnl|my_center|LOCUS_03340 23166 22576 gene locus_tag LOCUS_03350 23166 22576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_03350 24195 23242 gene locus_tag LOCUS_03360 24195 23242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 24294 24944 gene locus_tag LOCUS_03370 24294 24944 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967752.1 protein_id gnl|my_center|LOCUS_03370 25635 25045 gene locus_tag LOCUS_03380 25635 25045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_03380 27223 25754 gene locus_tag LOCUS_03390 gene crtH 27223 25754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 protein_id gnl|my_center|LOCUS_03390 27505 28026 gene locus_tag LOCUS_03400 gene ilvH 27505 28026 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 protein_id gnl|my_center|LOCUS_03400 28034 28735 gene locus_tag LOCUS_03410 28034 28735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 30273 29080 gene locus_tag LOCUS_03420 30273 29080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_03420 31489 30776 gene locus_tag LOCUS_03430 31489 30776 CDS product riboflavin deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143523.1 protein_id gnl|my_center|LOCUS_03430 32232 33074 gene locus_tag LOCUS_03440 32232 33074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 33212 33883 gene locus_tag LOCUS_03450 33212 33883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 35879 34566 gene locus_tag LOCUS_03460 35879 34566 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_03460 >Feature sequence0010 525 301 gene locus_tag LOCUS_03470 525 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 2175 1528 gene locus_tag LOCUS_03480 2175 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 2932 3711 gene locus_tag LOCUS_03490 2932 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 4074 4982 gene locus_tag LOCUS_03500 4074 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 5000 6637 gene locus_tag LOCUS_03510 5000 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 7852 6875 gene locus_tag LOCUS_03520 gene secF 7852 6875 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB9 protein_id gnl|my_center|LOCUS_03520 9285 7870 gene locus_tag LOCUS_03530 gene secD 9285 7870 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB8 protein_id gnl|my_center|LOCUS_03530 10282 9299 gene locus_tag LOCUS_03540 10282 9299 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_03540 10558 10358 gene locus_tag LOCUS_03550 10558 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 11548 11697 gene locus_tag LOCUS_03560 11548 11697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 11852 13489 gene locus_tag LOCUS_03570 11852 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 14371 14216 gene locus_tag LOCUS_03580 14371 14216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 14553 15362 gene locus_tag LOCUS_03590 14553 15362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_03590 16558 15578 gene locus_tag LOCUS_03600 16558 15578 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_03600 18366 16717 gene locus_tag LOCUS_03610 18366 16717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 20084 18399 gene locus_tag LOCUS_03620 20084 18399 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_03620 20576 22345 gene locus_tag LOCUS_03630 gene ggt 20576 22345 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595130.1 protein_id gnl|my_center|LOCUS_03630 22967 25891 gene locus_tag LOCUS_03640 gene gcvP 22967 25891 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 protein_id gnl|my_center|LOCUS_03640 26020 26592 gene locus_tag LOCUS_03650 26020 26592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_03650 26760 26981 gene locus_tag LOCUS_03660 26760 26981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 27070 27609 gene locus_tag LOCUS_03670 27070 27609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 28494 27745 gene locus_tag LOCUS_03680 28494 27745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 29542 28478 gene locus_tag LOCUS_03690 29542 28478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035321.1 protein_id gnl|my_center|LOCUS_03690 30283 29738 gene locus_tag LOCUS_03700 30283 29738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 31603 30626 gene locus_tag LOCUS_03710 31603 30626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 32631 31915 gene locus_tag LOCUS_03720 32631 31915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 33514 32858 gene locus_tag LOCUS_03730 33514 32858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 34167 34934 gene locus_tag LOCUS_03740 34167 34934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 >Feature sequence0011 1948 227 gene locus_tag LOCUS_03750 1948 227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056078.1 protein_id gnl|my_center|LOCUS_03750 2689 3540 gene locus_tag LOCUS_03760 2689 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3889 4191 gene locus_tag LOCUS_03770 3889 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144391.1 protein_id gnl|my_center|LOCUS_03770 4552 5940 gene locus_tag LOCUS_03780 4552 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 6497 6285 gene locus_tag LOCUS_03790 6497 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 6736 7053 gene locus_tag LOCUS_03800 6736 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 7040 7456 gene locus_tag LOCUS_03810 7040 7456 CDS product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_03810 7981 7670 gene locus_tag LOCUS_03820 7981 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 10105 8225 gene locus_tag LOCUS_03830 10105 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 11286 10159 gene locus_tag LOCUS_03840 11286 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 14785 11372 gene locus_tag LOCUS_03850 14785 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 17389 14807 gene locus_tag LOCUS_03860 17389 14807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 17908 18414 gene locus_tag LOCUS_03870 17908 18414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 19514 18627 gene locus_tag LOCUS_03880 19514 18627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143123.1 protein_id gnl|my_center|LOCUS_03880 20314 20652 gene locus_tag LOCUS_03890 20314 20652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 20643 21023 gene locus_tag LOCUS_03900 20643 21023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 21833 21300 gene locus_tag LOCUS_03910 21833 21300 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_03910 22708 26706 gene locus_tag LOCUS_03920 gene chlH 22708 26706 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056126.1 protein_id gnl|my_center|LOCUS_03920 27155 26913 gene locus_tag LOCUS_03930 27155 26913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 33164 28050 gene locus_tag LOCUS_03940 33164 28050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 33860 34393 gene locus_tag LOCUS_03950 33860 34393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence0012 645 800 gene locus_tag LOCUS_03960 645 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 1314 2039 gene locus_tag LOCUS_03970 1314 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142118.1 protein_id gnl|my_center|LOCUS_03970 2765 2301 gene locus_tag LOCUS_03980 2765 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056684.1 protein_id gnl|my_center|LOCUS_03980 3697 3041 gene locus_tag LOCUS_03990 3697 3041 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056716.1 protein_id gnl|my_center|LOCUS_03990 3812 5254 gene locus_tag LOCUS_04000 3812 5254 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056715.1 protein_id gnl|my_center|LOCUS_04000 6542 5586 gene locus_tag LOCUS_04010 6542 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 7657 6545 gene locus_tag LOCUS_04020 7657 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_04020 8880 7654 gene locus_tag LOCUS_04030 8880 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_04030 9321 9644 gene locus_tag LOCUS_04040 9321 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 9886 10806 gene locus_tag LOCUS_04050 9886 10806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 11368 12498 gene locus_tag LOCUS_04060 11368 12498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 12784 12590 gene locus_tag LOCUS_04070 12784 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 13053 13934 gene locus_tag LOCUS_04080 13053 13934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 14170 16689 gene locus_tag LOCUS_04090 14170 16689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 16959 16747 gene locus_tag LOCUS_04100 16959 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 17621 17133 gene locus_tag LOCUS_04110 17621 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 18191 21622 gene locus_tag LOCUS_04120 gene ileS 18191 21622 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI7 protein_id gnl|my_center|LOCUS_04120 22232 22477 gene locus_tag LOCUS_04130 22232 22477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 22583 22822 gene locus_tag LOCUS_04140 22583 22822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 22853 23317 gene locus_tag LOCUS_04150 22853 23317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 23620 25128 gene locus_tag LOCUS_04160 23620 25128 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924694.1 protein_id gnl|my_center|LOCUS_04160 25537 25821 gene locus_tag LOCUS_04170 25537 25821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 25790 26077 gene locus_tag LOCUS_04180 25790 26077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 26253 27626 gene locus_tag LOCUS_04190 26253 27626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_04190 27626 28105 gene locus_tag LOCUS_04200 27626 28105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258560.1 protein_id gnl|my_center|LOCUS_04200 29377 28499 gene locus_tag LOCUS_04210 gene folP 29377 28499 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ9 protein_id gnl|my_center|LOCUS_04210 30170 29445 gene locus_tag LOCUS_04220 gene tpiA 30170 29445 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA0 protein_id gnl|my_center|LOCUS_04220 30922 31764 gene locus_tag LOCUS_04230 30922 31764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057453.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence0013 5981 426 gene locus_tag LOCUS_04240 5981 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 6676 6233 gene locus_tag LOCUS_04250 6676 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 7248 6748 gene locus_tag LOCUS_04260 7248 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 16084 7775 gene locus_tag LOCUS_04270 16084 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 18585 16117 gene locus_tag LOCUS_04280 18585 16117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 27988 18629 gene locus_tag LOCUS_04290 27988 18629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 28638 29579 gene locus_tag LOCUS_04300 28638 29579 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E346 protein_id gnl|my_center|LOCUS_04300 30541 29780 gene locus_tag LOCUS_04310 30541 29780 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597670.1 protein_id gnl|my_center|LOCUS_04310 31375 30752 gene locus_tag LOCUS_04320 31375 30752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 >Feature sequence0014 804 94 gene locus_tag LOCUS_04330 804 94 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_04330 1161 1805 gene locus_tag LOCUS_04340 gene hisG 1161 1805 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD9 protein_id gnl|my_center|LOCUS_04340 2057 2866 gene locus_tag LOCUS_04350 2057 2866 CDS product S-adenosyl-L-methionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQ31 protein_id gnl|my_center|LOCUS_04350 3273 4097 gene locus_tag LOCUS_04360 3273 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 4333 4986 gene locus_tag LOCUS_04370 4333 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5488 5135 gene locus_tag LOCUS_04380 5488 5135 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_04380 6377 5817 gene locus_tag LOCUS_04390 gene accB 6377 5817 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057135.1 protein_id gnl|my_center|LOCUS_04390 7183 6605 gene locus_tag LOCUS_04400 gene efp 7183 6605 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD3 protein_id gnl|my_center|LOCUS_04400 8022 9170 gene locus_tag LOCUS_04410 8022 9170 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 protein_id gnl|my_center|LOCUS_04410 9362 9655 gene locus_tag LOCUS_04420 9362 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 10108 11169 gene locus_tag LOCUS_04430 gene thiL 10108 11169 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGF1 protein_id gnl|my_center|LOCUS_04430 12250 11234 gene locus_tag LOCUS_04440 gene gap1 12250 11234 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN83 protein_id gnl|my_center|LOCUS_04440 13622 15154 gene locus_tag LOCUS_04450 gene murC 13622 15154 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV5 protein_id gnl|my_center|LOCUS_04450 15254 16234 gene locus_tag LOCUS_04460 gene murB 15254 16234 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV6 protein_id gnl|my_center|LOCUS_04460 16664 16969 gene locus_tag LOCUS_04470 16664 16969 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKX6 protein_id gnl|my_center|LOCUS_04470 17300 17770 gene locus_tag LOCUS_04480 17300 17770 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_04480 18121 19002 gene locus_tag LOCUS_04490 18121 19002 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141338.1 protein_id gnl|my_center|LOCUS_04490 19209 21284 gene locus_tag LOCUS_04500 19209 21284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 22206 22280 gene locus_tag LOCUS_t00020 22206 22280 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 22646 22719 gene locus_tag LOCUS_t00030 22646 22719 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 22805 23260 gene locus_tag LOCUS_04510 22805 23260 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_04510 23675 25108 gene locus_tag LOCUS_04520 23675 25108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 25219 25545 gene locus_tag LOCUS_04530 25219 25545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 26318 26965 gene locus_tag LOCUS_04540 26318 26965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 27214 28101 gene locus_tag LOCUS_04550 27214 28101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 28302 28571 gene locus_tag LOCUS_04560 28302 28571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 28804 29262 gene locus_tag LOCUS_04570 28804 29262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_04570 30754 30329 gene locus_tag LOCUS_04580 30754 30329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 31611 30922 gene locus_tag LOCUS_04590 31611 30922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence0015 645 187 gene locus_tag LOCUS_04600 gene ndhN 645 187 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJU2 protein_id gnl|my_center|LOCUS_04600 1709 2389 gene locus_tag LOCUS_04610 gene rplC 1709 2389 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN1 protein_id gnl|my_center|LOCUS_04610 2408 3040 gene locus_tag LOCUS_04620 gene rplD 2408 3040 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN0 protein_id gnl|my_center|LOCUS_04620 3033 3341 gene locus_tag LOCUS_04630 gene rplW 3033 3341 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM9 protein_id gnl|my_center|LOCUS_04630 3426 4289 gene locus_tag LOCUS_04640 gene rplB 3426 4289 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM8 protein_id gnl|my_center|LOCUS_04640 4383 4661 gene locus_tag LOCUS_04650 gene rpsS 4383 4661 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM7 protein_id gnl|my_center|LOCUS_04650 4758 5114 gene locus_tag LOCUS_04660 gene rplV 4758 5114 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM6 protein_id gnl|my_center|LOCUS_04660 5176 5907 gene locus_tag LOCUS_04670 gene rpsC 5176 5907 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59187 protein_id gnl|my_center|LOCUS_04670 5958 6377 gene locus_tag LOCUS_04680 gene rplP 5958 6377 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM5 protein_id gnl|my_center|LOCUS_04680 6381 6662 gene locus_tag LOCUS_04690 6381 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 6686 6943 gene locus_tag LOCUS_04700 gene rpsQ 6686 6943 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM3 protein_id gnl|my_center|LOCUS_04700 6966 7331 gene locus_tag LOCUS_04710 gene rplN 6966 7331 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM2 protein_id gnl|my_center|LOCUS_04710 7331 7684 gene locus_tag LOCUS_04720 gene rplX 7331 7684 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM1 protein_id gnl|my_center|LOCUS_04720 7790 8335 gene locus_tag LOCUS_04730 gene rplE 7790 8335 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM0 protein_id gnl|my_center|LOCUS_04730 8359 8760 gene locus_tag LOCUS_04740 gene rpsH 8359 8760 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML9 protein_id gnl|my_center|LOCUS_04740 8854 9393 gene locus_tag LOCUS_04750 gene rplF 8854 9393 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML8 protein_id gnl|my_center|LOCUS_04750 9397 9759 gene locus_tag LOCUS_04760 gene rplR 9397 9759 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML7 protein_id gnl|my_center|LOCUS_04760 9856 10383 gene locus_tag LOCUS_04770 gene rpsE 9856 10383 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59126 protein_id gnl|my_center|LOCUS_04770 10417 10878 gene locus_tag LOCUS_04780 gene rplO 10417 10878 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML6 protein_id gnl|my_center|LOCUS_04780 11057 12313 gene locus_tag LOCUS_04790 gene secY 11057 12313 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML5 protein_id gnl|my_center|LOCUS_04790 12316 12870 gene locus_tag LOCUS_04800 gene adk 12316 12870 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5P5 protein_id gnl|my_center|LOCUS_04800 13015 13239 gene locus_tag LOCUS_04810 gene infA 13015 13239 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML3 protein_id gnl|my_center|LOCUS_04810 13555 13938 gene locus_tag LOCUS_04820 gene rpsM 13555 13938 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML1 protein_id gnl|my_center|LOCUS_04820 14088 14420 gene locus_tag LOCUS_04830 gene rpsK 14088 14420 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59379 protein_id gnl|my_center|LOCUS_04830 14585 15529 gene locus_tag LOCUS_04840 gene rpoA 14585 15529 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFF5 protein_id gnl|my_center|LOCUS_04840 15664 16014 gene locus_tag LOCUS_04850 gene rplQ 15664 16014 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK9 protein_id gnl|my_center|LOCUS_04850 16081 16902 gene locus_tag LOCUS_04860 gene truA 16081 16902 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM6 protein_id gnl|my_center|LOCUS_04860 16978 17433 gene locus_tag LOCUS_04870 gene rplM 16978 17433 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK8 protein_id gnl|my_center|LOCUS_04870 17433 17846 gene locus_tag LOCUS_04880 gene rpsI 17433 17846 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK7 protein_id gnl|my_center|LOCUS_04880 17998 18231 gene locus_tag LOCUS_04890 gene rpmE 17998 18231 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9Y9 protein_id gnl|my_center|LOCUS_04890 18380 19489 gene locus_tag LOCUS_04900 gene prfA 18380 19489 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMG9 protein_id gnl|my_center|LOCUS_04900 20173 20655 gene locus_tag LOCUS_04910 20173 20655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 21422 21246 gene locus_tag LOCUS_04920 21422 21246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 22196 21588 gene locus_tag LOCUS_04930 gene rplY 22196 21588 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNL2 protein_id gnl|my_center|LOCUS_04930 23930 22590 gene locus_tag LOCUS_04940 gene purA 23930 22590 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG2 protein_id gnl|my_center|LOCUS_04940 24196 24975 gene locus_tag LOCUS_04950 24196 24975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 25298 25369 gene locus_tag LOCUS_t00040 25298 25369 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 26980 25556 gene locus_tag LOCUS_04960 26980 25556 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_04960 28182 27688 gene locus_tag LOCUS_04970 gene purE 28182 27688 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB0 protein_id gnl|my_center|LOCUS_04970 28260 29459 gene locus_tag LOCUS_04980 28260 29459 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH66 protein_id gnl|my_center|LOCUS_04980 30076 30762 gene locus_tag LOCUS_04990 gene chlM 30076 30762 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056304.1 protein_id gnl|my_center|LOCUS_04990 >Feature sequence0016 1434 208 gene locus_tag LOCUS_05000 1434 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05000 1611 1838 gene locus_tag LOCUS_05010 1611 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 3879 2533 gene locus_tag LOCUS_05020 3879 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 4310 4095 gene locus_tag LOCUS_05030 4310 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 6541 4625 gene locus_tag LOCUS_05040 6541 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 8036 6627 gene locus_tag LOCUS_05050 8036 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 23176 8342 gene locus_tag LOCUS_05060 23176 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 23815 23378 gene locus_tag LOCUS_05070 23815 23378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 25875 24949 gene locus_tag LOCUS_05080 25875 24949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 26393 27532 gene locus_tag LOCUS_05090 gene gcvT 26393 27532 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFJ5 protein_id gnl|my_center|LOCUS_05090 28131 30020 gene locus_tag LOCUS_05100 gene ftsH 28131 30020 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG5 protein_id gnl|my_center|LOCUS_05100 >Feature sequence0017 1696 545 gene locus_tag LOCUS_05110 1696 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 2319 2927 gene locus_tag LOCUS_05120 2319 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3013 3163 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq catgtaggggcgaacggccgtt 3446 4657 gene locus_tag LOCUS_05130 3446 4657 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558755.1 protein_id gnl|my_center|LOCUS_05130 5272 5541 gene locus_tag LOCUS_05140 5272 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5538 5843 gene locus_tag LOCUS_05150 5538 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 6252 6560 gene locus_tag LOCUS_05160 6252 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 6624 7715 gene locus_tag LOCUS_05170 gene hemB 6624 7715 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_05170 7875 9008 gene locus_tag LOCUS_05180 7875 9008 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_05180 9125 9763 gene locus_tag LOCUS_05190 gene folE 9125 9763 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB8 protein_id gnl|my_center|LOCUS_05190 10969 10034 gene locus_tag LOCUS_05200 gene glcK 10969 10034 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_05200 11625 10969 gene locus_tag LOCUS_05210 11625 10969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 12790 11627 gene locus_tag LOCUS_05220 12790 11627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_05220 13331 13140 gene locus_tag LOCUS_05230 13331 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 13556 13341 gene locus_tag LOCUS_05240 13556 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 13950 13777 gene locus_tag LOCUS_05250 13950 13777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 15063 14086 gene locus_tag LOCUS_05260 15063 14086 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058242.1 protein_id gnl|my_center|LOCUS_05260 15730 15257 gene locus_tag LOCUS_05270 15730 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056055.1 protein_id gnl|my_center|LOCUS_05270 16329 17276 gene locus_tag LOCUS_05280 gene uppP 16329 17276 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG92 protein_id gnl|my_center|LOCUS_05280 19566 17629 gene locus_tag LOCUS_05290 19566 17629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 19906 20196 gene locus_tag LOCUS_05300 19906 20196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 20340 20594 gene locus_tag LOCUS_05310 20340 20594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05310 20958 22385 gene locus_tag LOCUS_05320 20958 22385 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391765.1 protein_id gnl|my_center|LOCUS_05320 22624 22836 gene locus_tag LOCUS_05330 22624 22836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 23165 24910 gene locus_tag LOCUS_05340 23165 24910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 25616 25092 gene locus_tag LOCUS_05350 25616 25092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057284.1 protein_id gnl|my_center|LOCUS_05350 26722 25919 gene locus_tag LOCUS_05360 26722 25919 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_05360 28026 27079 gene locus_tag LOCUS_05370 28026 27079 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056905.1 protein_id gnl|my_center|LOCUS_05370 28880 28248 gene locus_tag LOCUS_05380 gene lipA 28880 28248 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 protein_id gnl|my_center|LOCUS_05380 >Feature sequence0018 360 58 gene locus_tag LOCUS_05390 360 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 2041 467 gene locus_tag LOCUS_05400 2041 467 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 protein_id gnl|my_center|LOCUS_05400 2174 2401 gene locus_tag LOCUS_05410 2174 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 2701 3090 gene locus_tag LOCUS_05420 2701 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057308.1 protein_id gnl|my_center|LOCUS_05420 3658 3981 gene locus_tag LOCUS_05430 3658 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 4335 4883 gene locus_tag LOCUS_05440 4335 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 protein_id gnl|my_center|LOCUS_05440 5027 5764 gene locus_tag LOCUS_05450 5027 5764 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392686.1 protein_id gnl|my_center|LOCUS_05450 6656 5859 gene locus_tag LOCUS_05460 6656 5859 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 protein_id gnl|my_center|LOCUS_05460 8538 8792 gene locus_tag LOCUS_05470 8538 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 18256 9266 gene locus_tag LOCUS_05480 18256 9266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 19719 20711 gene locus_tag LOCUS_05490 19719 20711 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056558.1 protein_id gnl|my_center|LOCUS_05490 22741 21539 gene locus_tag LOCUS_05500 gene ydcM 22741 21539 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_05500 26331 23251 gene locus_tag LOCUS_05510 26331 23251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 28126 26903 gene locus_tag LOCUS_05520 28126 26903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 >Feature sequence0019 395 1768 gene locus_tag LOCUS_05530 395 1768 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP5 protein_id gnl|my_center|LOCUS_05530 2001 2612 gene locus_tag LOCUS_05540 gene nadD 2001 2612 CDS product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 protein_id gnl|my_center|LOCUS_05540 2671 3348 gene locus_tag LOCUS_05550 2671 3348 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 protein_id gnl|my_center|LOCUS_05550 3466 5178 gene locus_tag LOCUS_05560 gene nadE 3466 5178 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_05560 5233 5643 gene locus_tag LOCUS_05570 5233 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140979.1 protein_id gnl|my_center|LOCUS_05570 5830 6237 gene locus_tag LOCUS_05580 5830 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 6332 6511 gene locus_tag LOCUS_05590 6332 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 6580 6909 gene locus_tag LOCUS_05600 6580 6909 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250944.1 protein_id gnl|my_center|LOCUS_05600 7783 8076 gene locus_tag LOCUS_05610 7783 8076 CDS product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_05610 8107 8415 gene locus_tag LOCUS_05620 8107 8415 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939018.1 protein_id gnl|my_center|LOCUS_05620 10103 8841 gene locus_tag LOCUS_05630 10103 8841 CDS product serine protease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_05630 10865 10119 gene locus_tag LOCUS_05640 10865 10119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024073.1 protein_id gnl|my_center|LOCUS_05640 11789 10950 gene locus_tag LOCUS_05650 11789 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143597.1 protein_id gnl|my_center|LOCUS_05650 12300 11932 gene locus_tag LOCUS_05660 12300 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 13161 13907 gene locus_tag LOCUS_05670 13161 13907 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_05670 14338 16581 gene locus_tag LOCUS_05680 14338 16581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 16780 17682 gene locus_tag LOCUS_05690 gene rps1 16780 17682 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 protein_id gnl|my_center|LOCUS_05690 19273 18122 gene locus_tag LOCUS_05700 19273 18122 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871189.1 protein_id gnl|my_center|LOCUS_05700 19914 20327 gene locus_tag LOCUS_05710 19914 20327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 20315 20650 gene locus_tag LOCUS_05720 20315 20650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 20809 21228 gene locus_tag LOCUS_05730 20809 21228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 21216 21551 gene locus_tag LOCUS_05740 21216 21551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 21966 21790 gene locus_tag LOCUS_05750 21966 21790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 22220 22038 gene locus_tag LOCUS_05760 22220 22038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 22423 22205 gene locus_tag LOCUS_05770 22423 22205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 23241 24209 gene locus_tag LOCUS_05780 23241 24209 CDS product N-acylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_05780 24749 25471 gene locus_tag LOCUS_05790 24749 25471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_05790 25757 26575 gene locus_tag LOCUS_05800 25757 26575 CDS product TIGR00268 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057083.1 protein_id gnl|my_center|LOCUS_05800 27316 26939 gene locus_tag LOCUS_05810 27316 26939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 28078 28259 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtcttggggtctccccaagtagag >Feature sequence0020 784 1017 gene locus_tag LOCUS_05820 784 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1233 1418 gene locus_tag LOCUS_05830 1233 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05830 1432 1764 gene locus_tag LOCUS_05840 1432 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05840 2071 3105 gene locus_tag LOCUS_05850 2071 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 3092 3331 gene locus_tag LOCUS_05860 3092 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 4901 3552 gene locus_tag LOCUS_05870 4901 3552 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056302.1 protein_id gnl|my_center|LOCUS_05870 5264 5929 gene locus_tag LOCUS_05880 5264 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 7219 6101 gene locus_tag LOCUS_05890 7219 6101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119520.1 protein_id gnl|my_center|LOCUS_05890 8445 7240 gene locus_tag LOCUS_05900 8445 7240 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140489.1 protein_id gnl|my_center|LOCUS_05900 8816 10357 gene locus_tag LOCUS_05910 8816 10357 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_05910 11376 10534 gene locus_tag LOCUS_05920 11376 10534 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_05920 11656 11729 gene locus_tag LOCUS_t00050 11656 11729 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13323 12412 gene locus_tag LOCUS_05930 13323 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 14504 14809 gene locus_tag LOCUS_05940 gene ycf49 14504 14809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 protein_id gnl|my_center|LOCUS_05940 14838 15125 gene locus_tag LOCUS_05950 14838 15125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144013.1 protein_id gnl|my_center|LOCUS_05950 18182 15603 gene locus_tag LOCUS_05960 18182 15603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 19903 19445 gene locus_tag LOCUS_05970 19903 19445 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM1 protein_id gnl|my_center|LOCUS_05970 21297 20146 gene locus_tag LOCUS_05980 21297 20146 CDS product putative glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_05980 24212 21552 gene locus_tag LOCUS_05990 24212 21552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143241.1 protein_id gnl|my_center|LOCUS_05990 24823 24209 gene locus_tag LOCUS_06000 24823 24209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 25449 24850 gene locus_tag LOCUS_06010 25449 24850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 26888 25539 gene locus_tag LOCUS_06020 gene dnaB 26888 25539 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA9 protein_id gnl|my_center|LOCUS_06020 27671 27213 gene locus_tag LOCUS_06030 gene rplI 27671 27213 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9J9 protein_id gnl|my_center|LOCUS_06030 >Feature sequence0021 1179 4340 gene locus_tag LOCUS_06040 1179 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 6798 4720 gene locus_tag LOCUS_06050 6798 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 8328 6934 gene locus_tag LOCUS_06060 8328 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 9298 9071 gene locus_tag LOCUS_06070 9298 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 10285 10043 gene locus_tag LOCUS_06080 10285 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 10415 11773 gene locus_tag LOCUS_06090 10415 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 11694 11876 gene locus_tag LOCUS_06100 11694 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 15064 12098 gene locus_tag LOCUS_06110 gene polA 15064 12098 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125386.1 protein_id gnl|my_center|LOCUS_06110 15550 16119 gene locus_tag LOCUS_06120 15550 16119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 16550 16260 gene locus_tag LOCUS_06130 16550 16260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141164.1 protein_id gnl|my_center|LOCUS_06130 17843 16995 gene locus_tag LOCUS_06140 17843 16995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_06140 18618 19160 gene locus_tag LOCUS_06150 18618 19160 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031802.1 protein_id gnl|my_center|LOCUS_06150 19541 20710 gene locus_tag LOCUS_06160 19541 20710 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889545.1 protein_id gnl|my_center|LOCUS_06160 21443 20883 gene locus_tag LOCUS_06170 21443 20883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140173.1 protein_id gnl|my_center|LOCUS_06170 22444 21449 gene locus_tag LOCUS_06180 22444 21449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 23520 22444 gene locus_tag LOCUS_06190 23520 22444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190961.1 protein_id gnl|my_center|LOCUS_06190 24183 23692 gene locus_tag LOCUS_06200 24183 23692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 25533 24406 gene locus_tag LOCUS_06210 25533 24406 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 protein_id gnl|my_center|LOCUS_06210 26036 26326 gene locus_tag LOCUS_06220 26036 26326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869621.1 protein_id gnl|my_center|LOCUS_06220 26319 26660 gene locus_tag LOCUS_06230 26319 26660 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_06230 26932 27222 gene locus_tag LOCUS_06240 26932 27222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 >Feature sequence0022 445 260 gene locus_tag LOCUS_06250 445 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 683 456 gene locus_tag LOCUS_06260 683 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1173 823 gene locus_tag LOCUS_06270 1173 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056501.1 protein_id gnl|my_center|LOCUS_06270 1731 1907 gene locus_tag LOCUS_06280 1731 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 2723 2067 gene locus_tag LOCUS_06290 2723 2067 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228166.1 protein_id gnl|my_center|LOCUS_06290 3244 2729 gene locus_tag LOCUS_06300 3244 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06300 4461 3508 gene locus_tag LOCUS_06310 gene speE 4461 3508 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Z7 protein_id gnl|my_center|LOCUS_06310 5203 4736 gene locus_tag LOCUS_06320 5203 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 8310 6652 gene locus_tag LOCUS_06330 8310 6652 CDS product competence protein ComE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058172.1 protein_id gnl|my_center|LOCUS_06330 9338 9739 gene locus_tag LOCUS_06340 9338 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057706.1 protein_id gnl|my_center|LOCUS_06340 10470 11366 gene locus_tag LOCUS_06350 10470 11366 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227777.1 protein_id gnl|my_center|LOCUS_06350 11451 11524 gene locus_tag LOCUS_t00060 11451 11524 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12307 11732 gene locus_tag LOCUS_06360 12307 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 13372 13019 gene locus_tag LOCUS_06370 13372 13019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 13851 15656 gene locus_tag LOCUS_06380 13851 15656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 15678 17183 gene locus_tag LOCUS_06390 15678 17183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 17222 19690 gene locus_tag LOCUS_06400 17222 19690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 19777 20553 gene locus_tag LOCUS_06410 19777 20553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 23767 20819 gene locus_tag LOCUS_06420 23767 20819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 24719 25027 gene locus_tag LOCUS_06430 24719 25027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 25290 25616 gene locus_tag LOCUS_06440 25290 25616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 26517 26954 gene locus_tag LOCUS_06450 26517 26954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 26975 27199 gene locus_tag LOCUS_06460 26975 27199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 27206 27511 gene locus_tag LOCUS_06470 27206 27511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence0023 613 317 gene locus_tag LOCUS_06480 613 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057100.1 protein_id gnl|my_center|LOCUS_06480 1036 743 gene locus_tag LOCUS_06490 gene clpS 1036 743 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJY3 protein_id gnl|my_center|LOCUS_06490 2348 1335 gene locus_tag LOCUS_06500 gene dnaJ 2348 1335 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057983.1 protein_id gnl|my_center|LOCUS_06500 4758 2506 gene locus_tag LOCUS_06510 gene dnaK3 4758 2506 CDS product chaperone protein dnaK3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH10 protein_id gnl|my_center|LOCUS_06510 6085 5720 gene locus_tag LOCUS_06520 6085 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 6800 6585 gene locus_tag LOCUS_06530 6800 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 7051 7236 gene locus_tag LOCUS_06540 7051 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 8033 9403 gene locus_tag LOCUS_06550 gene pds 8033 9403 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124322.1 protein_id gnl|my_center|LOCUS_06550 9711 10640 gene locus_tag LOCUS_06560 gene pys 9711 10640 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057400.1 protein_id gnl|my_center|LOCUS_06560 11654 11202 gene locus_tag LOCUS_06570 11654 11202 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057352.1 protein_id gnl|my_center|LOCUS_06570 14736 12985 gene locus_tag LOCUS_06580 14736 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 14777 14926 gene locus_tag LOCUS_06590 14777 14926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 17424 15790 gene locus_tag LOCUS_06600 gene prfC 17424 15790 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGV7 protein_id gnl|my_center|LOCUS_06600 17813 18361 gene locus_tag LOCUS_06610 gene rfbC-2 17813 18361 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_06610 18430 19305 gene locus_tag LOCUS_06620 gene rfbD 18430 19305 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 protein_id gnl|my_center|LOCUS_06620 19539 20612 gene locus_tag LOCUS_06630 gene rfbA 19539 20612 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_06630 20900 22018 gene locus_tag LOCUS_06640 20900 22018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 22005 22562 gene locus_tag LOCUS_06650 22005 22562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 22893 23771 gene locus_tag LOCUS_06660 22893 23771 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_06660 24288 24019 gene locus_tag LOCUS_06670 24288 24019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence0024 583 6768 gene locus_tag LOCUS_06680 583 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 8334 6925 gene locus_tag LOCUS_06690 8334 6925 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058123.1 protein_id gnl|my_center|LOCUS_06690 8845 10299 gene locus_tag LOCUS_06700 8845 10299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 10953 10405 gene locus_tag LOCUS_06710 gene kptA 10953 10405 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW7 protein_id gnl|my_center|LOCUS_06710 12425 11217 gene locus_tag LOCUS_06720 12425 11217 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140500.1 protein_id gnl|my_center|LOCUS_06720 13674 13000 gene locus_tag LOCUS_06730 13674 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 14400 13729 gene locus_tag LOCUS_06740 14400 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 15242 14400 gene locus_tag LOCUS_06750 15242 14400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 16613 15942 gene locus_tag LOCUS_06760 16613 15942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 17253 17005 gene locus_tag LOCUS_06770 17253 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 18102 17260 gene locus_tag LOCUS_06780 18102 17260 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG84 protein_id gnl|my_center|LOCUS_06780 18772 18086 gene locus_tag LOCUS_06790 18772 18086 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058272.1 protein_id gnl|my_center|LOCUS_06790 18923 19084 gene locus_tag LOCUS_06800 18923 19084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 19848 19549 gene locus_tag LOCUS_06810 19848 19549 CDS product cobalt ABC transporter substrate-binding protein CbiN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812269.1 protein_id gnl|my_center|LOCUS_06810 20804 20055 gene locus_tag LOCUS_06820 gene cbiM 20804 20055 CDS product cobalt transport protein CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFD3 protein_id gnl|my_center|LOCUS_06820 21679 23925 gene locus_tag LOCUS_06830 21679 23925 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_06830 24288 24776 gene locus_tag LOCUS_06840 24288 24776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 25327 25620 gene locus_tag LOCUS_06850 25327 25620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 26166 26474 gene locus_tag LOCUS_06860 26166 26474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 26610 26801 gene locus_tag LOCUS_06870 26610 26801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 26920 27111 gene locus_tag LOCUS_06880 26920 27111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence0025 120 992 gene locus_tag LOCUS_06890 120 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057926.1 protein_id gnl|my_center|LOCUS_06890 1603 1205 gene locus_tag LOCUS_06900 1603 1205 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390954.1 protein_id gnl|my_center|LOCUS_06900 2505 2068 gene locus_tag LOCUS_06910 2505 2068 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975235.1 protein_id gnl|my_center|LOCUS_06910 2639 5239 gene locus_tag LOCUS_06920 gene gyrA 2639 5239 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIY2 protein_id gnl|my_center|LOCUS_06920 8516 6366 gene locus_tag LOCUS_06930 8516 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 9277 10479 gene locus_tag LOCUS_06940 9277 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 11729 10980 gene locus_tag LOCUS_06950 11729 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 13218 12133 gene locus_tag LOCUS_06960 13218 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 14004 13399 gene locus_tag LOCUS_06970 14004 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 14509 14258 gene locus_tag LOCUS_06980 14509 14258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 15780 15034 gene locus_tag LOCUS_06990 15780 15034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 17542 16007 gene locus_tag LOCUS_07000 17542 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 18097 17543 gene locus_tag LOCUS_07010 18097 17543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 20252 18702 gene locus_tag LOCUS_07020 20252 18702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 22254 20443 gene locus_tag LOCUS_07030 22254 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 22871 22530 gene locus_tag LOCUS_07040 22871 22530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 23417 25642 gene locus_tag LOCUS_07050 23417 25642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142717.1 protein_id gnl|my_center|LOCUS_07050 26389 25883 gene locus_tag LOCUS_07060 26389 25883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence0026 879 613 gene locus_tag LOCUS_07070 879 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056560.1 protein_id gnl|my_center|LOCUS_07070 1297 1890 gene locus_tag LOCUS_07080 1297 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057789.1 protein_id gnl|my_center|LOCUS_07080 1924 2703 gene locus_tag LOCUS_07090 gene panB 1924 2703 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM44 protein_id gnl|my_center|LOCUS_07090 3449 2763 gene locus_tag LOCUS_07100 3449 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 4694 3498 gene locus_tag LOCUS_07110 gene dapL 4694 3498 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GT3 protein_id gnl|my_center|LOCUS_07110 5541 5062 gene locus_tag LOCUS_07120 5541 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 6836 6075 gene locus_tag LOCUS_07130 6836 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 8707 7634 gene locus_tag LOCUS_07140 8707 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 9527 9030 gene locus_tag LOCUS_07150 gene yncA 9527 9030 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226552.1 protein_id gnl|my_center|LOCUS_07150 10900 9842 gene locus_tag LOCUS_07160 10900 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 11081 10878 gene locus_tag LOCUS_07170 11081 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 12101 11094 gene locus_tag LOCUS_07180 12101 11094 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141174.1 protein_id gnl|my_center|LOCUS_07180 13189 12422 gene locus_tag LOCUS_07190 13189 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 14550 13339 gene locus_tag LOCUS_07200 14550 13339 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 protein_id gnl|my_center|LOCUS_07200 14841 14967 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcttggggtctccccaagtagagcaa 15241 15600 gene locus_tag LOCUS_07210 15241 15600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 15600 16025 gene locus_tag LOCUS_07220 15600 16025 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_07220 17293 16163 gene locus_tag LOCUS_07230 17293 16163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 18110 17625 gene locus_tag LOCUS_07240 18110 17625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 18448 18122 gene locus_tag LOCUS_07250 18448 18122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 19207 21276 gene locus_tag LOCUS_07260 19207 21276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 protein_id gnl|my_center|LOCUS_07260 22113 21586 gene locus_tag LOCUS_07270 22113 21586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 23525 22113 gene locus_tag LOCUS_07280 23525 22113 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938166.1 protein_id gnl|my_center|LOCUS_07280 24052 23651 gene locus_tag LOCUS_07290 24052 23651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 25303 24602 gene locus_tag LOCUS_07300 25303 24602 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263640.1 protein_id gnl|my_center|LOCUS_07300 25545 25868 gene locus_tag LOCUS_07310 25545 25868 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888244.1 protein_id gnl|my_center|LOCUS_07310 25938 26486 gene locus_tag LOCUS_07320 25938 26486 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947704.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence0027 922 662 gene locus_tag LOCUS_07330 922 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1252 1094 gene locus_tag LOCUS_07340 1252 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1743 1255 gene locus_tag LOCUS_07350 1743 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 2100 1879 gene locus_tag LOCUS_07360 2100 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 5746 2396 gene locus_tag LOCUS_07370 5746 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056863.1 protein_id gnl|my_center|LOCUS_07370 8299 6389 gene locus_tag LOCUS_07380 8299 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 11671 8606 gene locus_tag LOCUS_07390 11671 8606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 13948 11867 gene locus_tag LOCUS_07400 13948 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 14151 13945 gene locus_tag LOCUS_07410 14151 13945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 14399 14187 gene locus_tag LOCUS_07420 14399 14187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 18177 14392 gene locus_tag LOCUS_07430 18177 14392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 20311 18815 gene locus_tag LOCUS_07440 20311 18815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104215.1 protein_id gnl|my_center|LOCUS_07440 21136 20588 gene locus_tag LOCUS_07450 21136 20588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 21973 21227 gene locus_tag LOCUS_07460 21973 21227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 23000 21978 gene locus_tag LOCUS_07470 23000 21978 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104216.1 protein_id gnl|my_center|LOCUS_07470 23274 22990 gene locus_tag LOCUS_07480 23274 22990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 24606 23653 gene locus_tag LOCUS_07490 24606 23653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 26057 25011 gene locus_tag LOCUS_07500 26057 25011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence0028 776 952 gene locus_tag LOCUS_07510 776 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 1474 3660 gene locus_tag LOCUS_07520 1474 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_07520 4222 6855 gene locus_tag LOCUS_07530 4222 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 6910 9117 gene locus_tag LOCUS_07540 6910 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_07540 9388 10476 gene locus_tag LOCUS_07550 9388 10476 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887674.1 protein_id gnl|my_center|LOCUS_07550 12567 12331 gene locus_tag LOCUS_07560 12567 12331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 13406 12942 gene locus_tag LOCUS_07570 13406 12942 CDS product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_07570 14386 15987 gene locus_tag LOCUS_07580 14386 15987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 16781 17941 gene locus_tag LOCUS_07590 16781 17941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_07590 19206 17995 gene locus_tag LOCUS_07600 gene rlmN 19206 17995 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG98 protein_id gnl|my_center|LOCUS_07600 19294 20193 gene locus_tag LOCUS_07610 gene lgt 19294 20193 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH03 protein_id gnl|my_center|LOCUS_07610 20294 21130 gene locus_tag LOCUS_07620 gene cobM 20294 21130 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141377.1 protein_id gnl|my_center|LOCUS_07620 21179 21550 gene locus_tag LOCUS_07630 21179 21550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143557.1 protein_id gnl|my_center|LOCUS_07630 21708 22187 gene locus_tag LOCUS_07640 21708 22187 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125105.1 protein_id gnl|my_center|LOCUS_07640 22443 22793 gene locus_tag LOCUS_07650 22443 22793 CDS product phenylpyruvate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125356.1 protein_id gnl|my_center|LOCUS_07650 24090 25124 gene locus_tag LOCUS_07660 24090 25124 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057568.1 protein_id gnl|my_center|LOCUS_07660 26097 25159 gene locus_tag LOCUS_07670 26097 25159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence0029 839 2212 gene locus_tag LOCUS_07680 839 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 2534 3934 gene locus_tag LOCUS_07690 gene mgtE 2534 3934 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9N7 protein_id gnl|my_center|LOCUS_07690 3978 5600 gene locus_tag LOCUS_07700 3978 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 6643 5825 gene locus_tag LOCUS_07710 6643 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 7417 7124 gene locus_tag LOCUS_07720 7417 7124 CDS product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_07720 7774 7421 gene locus_tag LOCUS_07730 7774 7421 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403413.1 protein_id gnl|my_center|LOCUS_07730 8319 8026 gene locus_tag LOCUS_07740 8319 8026 CDS product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_07740 8838 8605 gene locus_tag LOCUS_07750 8838 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 10736 9321 gene locus_tag LOCUS_07760 gene pntB 10736 9321 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 protein_id gnl|my_center|LOCUS_07760 11026 10733 gene locus_tag LOCUS_07770 11026 10733 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_07770 12412 11261 gene locus_tag LOCUS_07780 gene pntA 12412 11261 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_07780 13998 14585 gene locus_tag LOCUS_07790 13998 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 protein_id gnl|my_center|LOCUS_07790 15152 15562 gene locus_tag LOCUS_07800 15152 15562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07800 15552 15944 gene locus_tag LOCUS_07810 15552 15944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07810 16488 17633 gene locus_tag LOCUS_07820 gene yidC 16488 17633 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL96 protein_id gnl|my_center|LOCUS_07820 17633 18115 gene locus_tag LOCUS_07830 17633 18115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142229.1 protein_id gnl|my_center|LOCUS_07830 18224 18733 gene locus_tag LOCUS_07840 18224 18733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055932.1 protein_id gnl|my_center|LOCUS_07840 19180 20694 gene locus_tag LOCUS_07850 gene ycf46 19180 20694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_07850 20726 21157 gene locus_tag LOCUS_07860 20726 21157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 21597 23180 gene locus_tag LOCUS_07870 21597 23180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 24747 23425 gene locus_tag LOCUS_07880 24747 23425 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104216.1 protein_id gnl|my_center|LOCUS_07880 24876 25085 gene locus_tag LOCUS_07890 24876 25085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 25331 25128 gene locus_tag LOCUS_07900 25331 25128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 26141 25737 gene locus_tag LOCUS_07910 26141 25737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence0030 283 447 gene locus_tag LOCUS_07920 283 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1363 2211 gene locus_tag LOCUS_07930 1363 2211 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085765.1 protein_id gnl|my_center|LOCUS_07930 2346 3887 gene locus_tag LOCUS_07940 2346 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 5199 4141 gene locus_tag LOCUS_07950 gene argC 5199 4141 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59312 protein_id gnl|my_center|LOCUS_07950 5625 7313 gene locus_tag LOCUS_07960 gene ribA 5625 7313 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI64 protein_id gnl|my_center|LOCUS_07960 7993 10176 gene locus_tag LOCUS_07970 7993 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142199.1 protein_id gnl|my_center|LOCUS_07970 11030 10362 gene locus_tag LOCUS_07980 11030 10362 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_07980 11589 11221 gene locus_tag LOCUS_07990 gene petJ 11589 11221 CDS product cytochrome c6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJC6 protein_id gnl|my_center|LOCUS_07990 12657 12148 gene locus_tag LOCUS_08000 gene psbV2 12657 12148 CDS product cytochrome c-550-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE2 protein_id gnl|my_center|LOCUS_08000 13529 13041 gene locus_tag LOCUS_08010 gene psbV 13529 13041 CDS product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A386 protein_id gnl|my_center|LOCUS_08010 13893 13696 gene locus_tag LOCUS_08020 13893 13696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057126.1 protein_id gnl|my_center|LOCUS_08020 15036 14116 gene locus_tag LOCUS_08030 gene accD 15036 14116 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE7 protein_id gnl|my_center|LOCUS_08030 15521 15666 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggtctccccaagtagagca 16250 16771 gene locus_tag LOCUS_08040 gene ycf3 16250 16771 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ6 protein_id gnl|my_center|LOCUS_08040 16881 17174 gene locus_tag LOCUS_08050 gene gatC 16881 17174 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG91 protein_id gnl|my_center|LOCUS_08050 18642 21827 gene locus_tag LOCUS_08060 18642 21827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 22316 25618 gene locus_tag LOCUS_08070 22316 25618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence0031 925 593 gene locus_tag LOCUS_08080 925 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 991 2166 gene locus_tag LOCUS_08090 991 2166 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_08090 2179 2952 gene locus_tag LOCUS_08100 2179 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 3130 2927 gene locus_tag LOCUS_08110 3130 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 3817 3491 gene locus_tag LOCUS_08120 3817 3491 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZQ7 protein_id gnl|my_center|LOCUS_08120 4105 5328 gene locus_tag LOCUS_08130 4105 5328 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065100.1 protein_id gnl|my_center|LOCUS_08130 7490 5394 gene locus_tag LOCUS_08140 7490 5394 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058113.1 protein_id gnl|my_center|LOCUS_08140 8954 8571 gene locus_tag LOCUS_08150 8954 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 9298 11502 gene locus_tag LOCUS_08160 9298 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 11499 12242 gene locus_tag LOCUS_08170 11499 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 13332 12874 gene locus_tag LOCUS_08180 13332 12874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 14163 13357 gene locus_tag LOCUS_08190 gene minD 14163 13357 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE2 protein_id gnl|my_center|LOCUS_08190 14857 14696 gene locus_tag LOCUS_08200 14857 14696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 15670 16980 gene locus_tag LOCUS_08210 15670 16980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537316.1 protein_id gnl|my_center|LOCUS_08210 16985 18304 gene locus_tag LOCUS_08220 16985 18304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 18372 19241 gene locus_tag LOCUS_08230 18372 19241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 19563 20432 gene locus_tag LOCUS_08240 19563 20432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 20438 21229 gene locus_tag LOCUS_08250 20438 21229 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 protein_id gnl|my_center|LOCUS_08250 21238 22821 gene locus_tag LOCUS_08260 21238 22821 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031534.1 protein_id gnl|my_center|LOCUS_08260 22818 23777 gene locus_tag LOCUS_08270 22818 23777 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_08270 24206 25177 gene locus_tag LOCUS_08280 24206 25177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence0032 1741 464 gene locus_tag LOCUS_08290 1741 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 3426 4118 gene locus_tag LOCUS_08300 3426 4118 CDS product phthiotriol/phenolphthiotriol dimycocerosates methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TXK3 protein_id gnl|my_center|LOCUS_08300 4147 6417 gene locus_tag LOCUS_08310 4147 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 6814 6743 gene locus_tag LOCUS_t00070 6814 6743 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7804 6881 gene locus_tag LOCUS_08320 7804 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142558.1 protein_id gnl|my_center|LOCUS_08320 8081 8563 gene locus_tag LOCUS_08330 8081 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 9062 8688 gene locus_tag LOCUS_08340 9062 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 9439 9062 gene locus_tag LOCUS_08350 9439 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 10186 9575 gene locus_tag LOCUS_08360 10186 9575 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143257.1 protein_id gnl|my_center|LOCUS_08360 12776 10758 gene locus_tag LOCUS_08370 12776 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 14239 13253 gene locus_tag LOCUS_08380 14239 13253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 15221 14700 gene locus_tag LOCUS_08390 15221 14700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 15418 15239 gene locus_tag LOCUS_08400 15418 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 15795 15406 gene locus_tag LOCUS_08410 15795 15406 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_08410 16082 15792 gene locus_tag LOCUS_08420 16082 15792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 16594 16238 gene locus_tag LOCUS_08430 16594 16238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 16932 20525 gene locus_tag LOCUS_08440 16932 20525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 20729 21529 gene locus_tag LOCUS_08450 20729 21529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 21596 22390 gene locus_tag LOCUS_08460 21596 22390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 23169 23519 gene locus_tag LOCUS_08470 23169 23519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 24410 24075 gene locus_tag LOCUS_08480 24410 24075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 24681 25292 gene locus_tag LOCUS_08490 24681 25292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence0033 804 304 gene locus_tag LOCUS_08500 804 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1068 2576 gene locus_tag LOCUS_08510 1068 2576 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058059.1 protein_id gnl|my_center|LOCUS_08510 3123 4763 gene locus_tag LOCUS_08520 3123 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142439.1 protein_id gnl|my_center|LOCUS_08520 6359 5226 gene locus_tag LOCUS_08530 6359 5226 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_08530 7918 6767 gene locus_tag LOCUS_08540 7918 6767 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_08540 9581 10357 gene locus_tag LOCUS_08550 9581 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 11087 11278 gene locus_tag LOCUS_08560 11087 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 11318 11713 gene locus_tag LOCUS_08570 11318 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 11759 14134 gene locus_tag LOCUS_08580 11759 14134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 17187 15826 gene locus_tag LOCUS_08590 17187 15826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 18581 18700 gene locus_tag LOCUS_08600 18581 18700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 19322 20755 gene locus_tag LOCUS_08610 19322 20755 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_08610 21510 21025 gene locus_tag LOCUS_08620 21510 21025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 23043 21628 gene locus_tag LOCUS_08630 23043 21628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_08630 24245 23475 gene locus_tag LOCUS_08640 24245 23475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence0034 175 1716 gene locus_tag LOCUS_08650 gene glpK 175 1716 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJT1 protein_id gnl|my_center|LOCUS_08650 2153 1713 gene locus_tag LOCUS_08660 2153 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2633 3010 gene locus_tag LOCUS_08670 2633 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 2982 3347 gene locus_tag LOCUS_08680 2982 3347 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI95 protein_id gnl|my_center|LOCUS_08680 3875 3678 gene locus_tag LOCUS_08690 3875 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 4349 3999 gene locus_tag LOCUS_08700 4349 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 5114 4467 gene locus_tag LOCUS_08710 5114 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 5770 5498 gene locus_tag LOCUS_08720 5770 5498 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125708.1 protein_id gnl|my_center|LOCUS_08720 6098 6439 gene locus_tag LOCUS_08730 gene petJ 6098 6439 CDS product cytochrome c6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X9 protein_id gnl|my_center|LOCUS_08730 9277 6683 gene locus_tag LOCUS_08740 9277 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 10410 10156 gene locus_tag LOCUS_08750 10410 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 10616 10894 gene locus_tag LOCUS_08760 10616 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 16497 11341 gene locus_tag LOCUS_08770 16497 11341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 16638 17093 gene locus_tag LOCUS_08780 16638 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 17104 18732 gene locus_tag LOCUS_08790 17104 18732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 19970 21175 gene locus_tag LOCUS_08800 19970 21175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057682.1 protein_id gnl|my_center|LOCUS_08800 21441 21902 gene locus_tag LOCUS_08810 21441 21902 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_08810 21918 22823 gene locus_tag LOCUS_08820 gene rimK 21918 22823 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ2 protein_id gnl|my_center|LOCUS_08820 23689 25110 gene locus_tag LOCUS_08830 23689 25110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence0035 752 357 gene locus_tag LOCUS_08840 752 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1138 770 gene locus_tag LOCUS_08850 1138 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1612 1220 gene locus_tag LOCUS_08860 1612 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1952 2512 gene locus_tag LOCUS_08870 1952 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_08870 2496 3113 gene locus_tag LOCUS_08880 2496 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 3786 6065 gene locus_tag LOCUS_08890 3786 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 6150 7016 gene locus_tag LOCUS_08900 6150 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142570.1 protein_id gnl|my_center|LOCUS_08900 8000 7134 gene locus_tag LOCUS_08910 8000 7134 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_08910 8789 8166 gene locus_tag LOCUS_08920 8789 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 10071 8782 gene locus_tag LOCUS_08930 10071 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_08930 11084 10863 gene locus_tag LOCUS_08940 11084 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 11354 11563 gene locus_tag LOCUS_08950 11354 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 11796 13016 gene locus_tag LOCUS_08960 11796 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 12992 13996 gene locus_tag LOCUS_08970 12992 13996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 14483 14121 gene locus_tag LOCUS_08980 14483 14121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 15585 14740 gene locus_tag LOCUS_08990 15585 14740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 17575 15923 gene locus_tag LOCUS_09000 17575 15923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 17797 18177 gene locus_tag LOCUS_09010 17797 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 19191 18250 gene locus_tag LOCUS_09020 19191 18250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 22293 19672 gene locus_tag LOCUS_09030 22293 19672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 24491 22611 gene locus_tag LOCUS_09040 gene ilvG 24491 22611 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence0036 1533 3092 gene locus_tag LOCUS_09050 1533 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 3127 3732 gene locus_tag LOCUS_09060 3127 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141514.1 protein_id gnl|my_center|LOCUS_09060 3831 4697 gene locus_tag LOCUS_09070 3831 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141513.1 protein_id gnl|my_center|LOCUS_09070 4727 6295 gene locus_tag LOCUS_09080 4727 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141449.1 protein_id gnl|my_center|LOCUS_09080 6631 6843 gene locus_tag LOCUS_09090 6631 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 protein_id gnl|my_center|LOCUS_09090 8166 8543 gene locus_tag LOCUS_09100 8166 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057900.1 protein_id gnl|my_center|LOCUS_09100 8825 9721 gene locus_tag LOCUS_09110 8825 9721 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057901.1 protein_id gnl|my_center|LOCUS_09110 10664 9966 gene locus_tag LOCUS_09120 10664 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 11144 10923 gene locus_tag LOCUS_09130 11144 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 11135 13678 gene locus_tag LOCUS_09140 11135 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 15344 14025 gene locus_tag LOCUS_09150 15344 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 16354 15719 gene locus_tag LOCUS_09160 16354 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 17027 17224 gene locus_tag LOCUS_09170 17027 17224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 17485 17733 gene locus_tag LOCUS_09180 17485 17733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 17924 18508 gene locus_tag LOCUS_09190 17924 18508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 19649 18471 gene locus_tag LOCUS_09200 gene thrC 19649 18471 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJJ6 protein_id gnl|my_center|LOCUS_09200 20128 20343 gene locus_tag LOCUS_09210 20128 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 20499 20593 gene locus_tag LOCUS_t00080 20499 20593 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21066 22124 gene locus_tag LOCUS_09220 gene desA 21066 22124 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_09220 23144 24577 gene locus_tag LOCUS_09230 23144 24577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 24462 24749 gene locus_tag LOCUS_09240 24462 24749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence0037 34 501 gene locus_tag LOCUS_09250 34 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 654 1439 gene locus_tag LOCUS_09260 654 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 2754 1675 gene locus_tag LOCUS_09270 gene fbaA 2754 1675 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056231.1 protein_id gnl|my_center|LOCUS_09270 3562 6210 gene locus_tag LOCUS_09280 3562 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 9847 7844 gene locus_tag LOCUS_09290 9847 7844 CDS product L-ascorbate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971066.1 protein_id gnl|my_center|LOCUS_09290 12566 10713 gene locus_tag LOCUS_09300 gene loxA 12566 10713 CDS product arachidonate 15-lipoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G8 protein_id gnl|my_center|LOCUS_09300 14706 12817 gene locus_tag LOCUS_09310 gene loxA 14706 12817 CDS product arachidonate 15-lipoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G8 protein_id gnl|my_center|LOCUS_09310 16945 15047 gene locus_tag LOCUS_09320 16945 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 17322 17095 gene locus_tag LOCUS_09330 17322 17095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 18755 20413 gene locus_tag LOCUS_09340 18755 20413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 20461 21408 gene locus_tag LOCUS_09350 20461 21408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 21679 22413 gene locus_tag LOCUS_09360 21679 22413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546171.1 protein_id gnl|my_center|LOCUS_09360 22512 22646 gene locus_tag LOCUS_09370 22512 22646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 23671 22889 gene locus_tag LOCUS_09380 23671 22889 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104931.1 protein_id gnl|my_center|LOCUS_09380 24340 23753 gene locus_tag LOCUS_09390 24340 23753 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086782.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence0038 933 112 gene locus_tag LOCUS_09400 933 112 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_09400 5105 1446 gene locus_tag LOCUS_09410 5105 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 5841 6275 gene locus_tag LOCUS_09420 5841 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 8106 6505 gene locus_tag LOCUS_09430 8106 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 8366 9331 gene locus_tag LOCUS_09440 8366 9331 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403316.1 protein_id gnl|my_center|LOCUS_09440 9366 10940 gene locus_tag LOCUS_09450 9366 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701838.1 protein_id gnl|my_center|LOCUS_09450 12029 14698 gene locus_tag LOCUS_09460 12029 14698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 14870 15763 gene locus_tag LOCUS_09470 14870 15763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 15962 16660 gene locus_tag LOCUS_09480 15962 16660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_09480 17766 16822 gene locus_tag LOCUS_09490 17766 16822 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_09490 18138 20042 gene locus_tag LOCUS_09500 gene dxs 18138 20042 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL74 protein_id gnl|my_center|LOCUS_09500 20384 20112 gene locus_tag LOCUS_09510 20384 20112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 20566 20381 gene locus_tag LOCUS_09520 20566 20381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 20961 20554 gene locus_tag LOCUS_09530 20961 20554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence0039 2009 669 gene locus_tag LOCUS_09540 2009 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 3258 2956 gene locus_tag LOCUS_09550 3258 2956 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_09550 4289 3567 gene locus_tag LOCUS_09560 4289 3567 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X8E6 protein_id gnl|my_center|LOCUS_09560 8461 4538 gene locus_tag LOCUS_09570 8461 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 11950 9509 gene locus_tag LOCUS_09580 11950 9509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 12734 14620 gene locus_tag LOCUS_09590 gene nirA 12734 14620 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_09590 14648 15424 gene locus_tag LOCUS_09600 14648 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 15690 16331 gene locus_tag LOCUS_09610 15690 16331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 16769 18289 gene locus_tag LOCUS_09620 gene crnA 16769 18289 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_09620 19308 21458 gene locus_tag LOCUS_09630 gene narB 19308 21458 CDS product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057195.1 protein_id gnl|my_center|LOCUS_09630 21606 22037 gene locus_tag LOCUS_09640 21606 22037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 protein_id gnl|my_center|LOCUS_09640 22064 22564 gene locus_tag LOCUS_09650 22064 22564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 protein_id gnl|my_center|LOCUS_09650 22572 23024 gene locus_tag LOCUS_09660 22572 23024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence0040 317 1225 gene locus_tag LOCUS_09670 317 1225 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_09670 2688 5477 gene locus_tag LOCUS_09680 2688 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403224.1 protein_id gnl|my_center|LOCUS_09680 5890 7362 gene locus_tag LOCUS_09690 5890 7362 CDS product membrane-bound O-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578213.1 protein_id gnl|my_center|LOCUS_09690 8397 10106 gene locus_tag LOCUS_09700 8397 10106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 protein_id gnl|my_center|LOCUS_09700 10485 10805 gene locus_tag LOCUS_09710 10485 10805 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143672.1 protein_id gnl|my_center|LOCUS_09710 11228 11635 gene locus_tag LOCUS_09720 11228 11635 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143244.1 protein_id gnl|my_center|LOCUS_09720 12160 11912 gene locus_tag LOCUS_09730 gene ycf34 12160 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 protein_id gnl|my_center|LOCUS_09730 12250 13590 gene locus_tag LOCUS_09740 12250 13590 CDS product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056562.1 protein_id gnl|my_center|LOCUS_09740 13661 14143 gene locus_tag LOCUS_09750 gene tadA 13661 14143 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLR8 protein_id gnl|my_center|LOCUS_09750 14201 14506 gene locus_tag LOCUS_09760 14201 14506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 14658 15428 gene locus_tag LOCUS_09770 14658 15428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058307.1 protein_id gnl|my_center|LOCUS_09770 16282 15626 gene locus_tag LOCUS_09780 16282 15626 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143792.1 protein_id gnl|my_center|LOCUS_09780 17486 16953 gene locus_tag LOCUS_09790 gene def 17486 16953 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P934 protein_id gnl|my_center|LOCUS_09790 18616 17615 gene locus_tag LOCUS_09800 18616 17615 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_09800 19581 20876 gene locus_tag LOCUS_09810 19581 20876 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259590.1 protein_id gnl|my_center|LOCUS_09810 20860 21921 gene locus_tag LOCUS_09820 20860 21921 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987008.1 protein_id gnl|my_center|LOCUS_09820 21918 23612 gene locus_tag LOCUS_09830 21918 23612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence0041 538 1554 gene locus_tag LOCUS_09840 gene chlG 538 1554 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057379.1 protein_id gnl|my_center|LOCUS_09840 1974 4610 gene locus_tag LOCUS_09850 1974 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4811 5020 gene locus_tag LOCUS_09860 4811 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 5903 9331 gene locus_tag LOCUS_09870 5903 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 9351 13208 gene locus_tag LOCUS_09880 9351 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 14863 13487 gene locus_tag LOCUS_09890 gene sun 14863 13487 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB2 protein_id gnl|my_center|LOCUS_09890 16032 15250 gene locus_tag LOCUS_09900 16032 15250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 16534 16464 gene locus_tag LOCUS_t00090 16534 16464 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17089 16817 gene locus_tag LOCUS_09910 17089 16817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 17251 19383 gene locus_tag LOCUS_09920 17251 19383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056981.1 protein_id gnl|my_center|LOCUS_09920 20056 20499 gene locus_tag LOCUS_09930 20056 20499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 22091 20607 gene locus_tag LOCUS_09940 22091 20607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 22230 23336 gene locus_tag LOCUS_09950 22230 23336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057388.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence0042 2565 517 gene locus_tag LOCUS_09960 2565 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056794.1 protein_id gnl|my_center|LOCUS_09960 3794 3063 gene locus_tag LOCUS_09970 3794 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 4478 5614 gene locus_tag LOCUS_09980 gene tilS 4478 5614 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIH2 protein_id gnl|my_center|LOCUS_09980 7297 5645 gene locus_tag LOCUS_09990 7297 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 8653 9906 gene locus_tag LOCUS_10000 8653 9906 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056200.1 protein_id gnl|my_center|LOCUS_10000 11264 11641 gene locus_tag LOCUS_10010 11264 11641 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_10010 11646 12167 gene locus_tag LOCUS_10020 gene cheW 11646 12167 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056202.1 protein_id gnl|my_center|LOCUS_10020 12333 15800 gene locus_tag LOCUS_10030 12333 15800 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056203.1 protein_id gnl|my_center|LOCUS_10030 16410 21305 gene locus_tag LOCUS_10040 16410 21305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 22304 21630 gene locus_tag LOCUS_10050 gene ykoG 22304 21630 CDS product putative transcriptional regulatory protein YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34903 protein_id gnl|my_center|LOCUS_10050 23569 23693 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttggggtctccccaagtagagc >Feature sequence0043 480 4970 gene locus_tag LOCUS_10060 480 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 5793 7721 gene locus_tag LOCUS_10070 5793 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 7863 8168 gene locus_tag LOCUS_10080 7863 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 8462 8947 gene locus_tag LOCUS_10090 8462 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 9414 9145 gene locus_tag LOCUS_10100 gene psaK 9414 9145 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125081.1 protein_id gnl|my_center|LOCUS_10100 9561 9743 gene locus_tag LOCUS_10110 9561 9743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 10452 11723 gene locus_tag LOCUS_10120 10452 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404780.1 protein_id gnl|my_center|LOCUS_10120 11720 12304 gene locus_tag LOCUS_10130 11720 12304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 16418 12522 gene locus_tag LOCUS_10140 16418 12522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 16643 16909 gene locus_tag LOCUS_10150 16643 16909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 20101 17060 gene locus_tag LOCUS_10160 20101 17060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 21599 20364 gene locus_tag LOCUS_10170 gene dnaN 21599 20364 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VEL1 protein_id gnl|my_center|LOCUS_10170 23451 22057 gene locus_tag LOCUS_10180 gene dnaA 23451 22057 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL93 protein_id gnl|my_center|LOCUS_10180 >Feature sequence0044 26 1876 gene locus_tag LOCUS_10190 26 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2421 4082 gene locus_tag LOCUS_10200 2421 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 5097 4279 gene locus_tag LOCUS_10210 5097 4279 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256575.1 protein_id gnl|my_center|LOCUS_10210 5422 6165 gene locus_tag LOCUS_10220 5422 6165 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_10220 6281 7636 gene locus_tag LOCUS_10230 6281 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 8112 8894 gene locus_tag LOCUS_10240 8112 8894 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_10240 10286 9255 gene locus_tag LOCUS_10250 10286 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 19812 10765 gene locus_tag LOCUS_10260 19812 10765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 20098 20277 gene locus_tag LOCUS_10270 20098 20277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 21622 20606 gene locus_tag LOCUS_10280 21622 20606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 22881 21790 gene locus_tag LOCUS_10290 gene hppD 22881 21790 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404122.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence0045 144 626 gene locus_tag LOCUS_10300 144 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2533 1064 gene locus_tag LOCUS_10310 2533 1064 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258284.1 protein_id gnl|my_center|LOCUS_10310 3587 2925 gene locus_tag LOCUS_10320 3587 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143006.1 protein_id gnl|my_center|LOCUS_10320 4206 3982 gene locus_tag LOCUS_10330 4206 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 5629 4472 gene locus_tag LOCUS_10340 5629 4472 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141486.1 protein_id gnl|my_center|LOCUS_10340 7424 6354 gene locus_tag LOCUS_10350 7424 6354 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA4 protein_id gnl|my_center|LOCUS_10350 7850 8902 gene locus_tag LOCUS_10360 gene hemF 7850 8902 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL15 protein_id gnl|my_center|LOCUS_10360 8952 9317 gene locus_tag LOCUS_10370 gene rsbV 8952 9317 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D91 protein_id gnl|my_center|LOCUS_10370 9758 10471 gene locus_tag LOCUS_10380 gene thf1 9758 10471 CDS product protein Thf1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJT8 protein_id gnl|my_center|LOCUS_10380 11207 10494 gene locus_tag LOCUS_10390 11207 10494 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055917.1 protein_id gnl|my_center|LOCUS_10390 11407 12369 gene locus_tag LOCUS_10400 11407 12369 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_10400 12702 14036 gene locus_tag LOCUS_10410 12702 14036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039073.1 protein_id gnl|my_center|LOCUS_10410 14522 14785 gene locus_tag LOCUS_10420 14522 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 14782 15180 gene locus_tag LOCUS_10430 14782 15180 CDS product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_10430 15582 16175 gene locus_tag LOCUS_10440 15582 16175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390294.1 protein_id gnl|my_center|LOCUS_10440 16159 16443 gene locus_tag LOCUS_10450 16159 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 16541 16987 gene locus_tag LOCUS_10460 16541 16987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 17000 17623 gene locus_tag LOCUS_10470 17000 17623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 18983 17778 gene locus_tag LOCUS_10480 18983 17778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 22511 20946 gene locus_tag LOCUS_10490 22511 20946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence0046 441 725 gene locus_tag LOCUS_10500 441 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2590 1256 gene locus_tag LOCUS_10510 2590 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 6159 3742 gene locus_tag LOCUS_10520 6159 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056048.1 protein_id gnl|my_center|LOCUS_10520 6675 6271 gene locus_tag LOCUS_10530 gene mvpA 6675 6271 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IV79 protein_id gnl|my_center|LOCUS_10530 6983 6687 gene locus_tag LOCUS_10540 6983 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 7203 7421 gene locus_tag LOCUS_10550 7203 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 8086 7592 gene locus_tag LOCUS_10560 8086 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 8804 8271 gene locus_tag LOCUS_10570 8804 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 9390 8824 gene locus_tag LOCUS_10580 9390 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 10778 9393 gene locus_tag LOCUS_10590 10778 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_10590 11382 11122 gene locus_tag LOCUS_10600 11382 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 11569 11417 gene locus_tag LOCUS_10610 11569 11417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 11947 13185 gene locus_tag LOCUS_10620 11947 13185 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8B3 protein_id gnl|my_center|LOCUS_10620 13435 13719 gene locus_tag LOCUS_10630 13435 13719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 13716 14138 gene locus_tag LOCUS_10640 13716 14138 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_10640 16056 14587 gene locus_tag LOCUS_10650 gene pepA 16056 14587 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI46 protein_id gnl|my_center|LOCUS_10650 16307 16501 gene locus_tag LOCUS_10660 16307 16501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 17066 16455 gene locus_tag LOCUS_10670 17066 16455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 17952 18746 gene locus_tag LOCUS_10680 17952 18746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 19103 20887 gene locus_tag LOCUS_10690 19103 20887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 21344 21015 gene locus_tag LOCUS_10700 21344 21015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 23188 21944 gene locus_tag LOCUS_10710 gene codA 23188 21944 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986588.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence0047 2500 2204 gene locus_tag LOCUS_10720 2500 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2673 3680 gene locus_tag LOCUS_10730 2673 3680 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67751 protein_id gnl|my_center|LOCUS_10730 3766 3936 gene locus_tag LOCUS_10740 3766 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 5579 4008 gene locus_tag LOCUS_10750 5579 4008 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918659.1 protein_id gnl|my_center|LOCUS_10750 6556 6080 gene locus_tag LOCUS_10760 6556 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 7449 6724 gene locus_tag LOCUS_10770 7449 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876699.1 protein_id gnl|my_center|LOCUS_10770 8232 8486 gene locus_tag LOCUS_10780 8232 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 12575 8577 gene locus_tag LOCUS_10790 12575 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 14005 19416 gene locus_tag LOCUS_10800 14005 19416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 20582 21904 gene locus_tag LOCUS_10810 20582 21904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 22171 22593 gene locus_tag LOCUS_10820 22171 22593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence0048 913 1332 gene locus_tag LOCUS_10830 913 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1311 1826 gene locus_tag LOCUS_10840 1311 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1962 2915 gene locus_tag LOCUS_10850 1962 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3361 4992 gene locus_tag LOCUS_10860 gene hflX 3361 4992 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDU0 protein_id gnl|my_center|LOCUS_10860 5711 6460 gene locus_tag LOCUS_10870 5711 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 6753 7007 gene locus_tag LOCUS_10880 6753 7007 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 protein_id gnl|my_center|LOCUS_10880 7115 7318 gene locus_tag LOCUS_10890 7115 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 7442 15079 gene locus_tag LOCUS_10900 7442 15079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 15421 16398 gene locus_tag LOCUS_10910 gene gshB 15421 16398 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKF1 protein_id gnl|my_center|LOCUS_10910 16673 17836 gene locus_tag LOCUS_10920 16673 17836 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144332.1 protein_id gnl|my_center|LOCUS_10920 18158 18526 gene locus_tag LOCUS_10930 18158 18526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 18640 19005 gene locus_tag LOCUS_10940 18640 19005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 19476 19865 gene locus_tag LOCUS_10950 19476 19865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 19885 20151 gene locus_tag LOCUS_10960 19885 20151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 20623 22119 gene locus_tag LOCUS_10970 20623 22119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 protein_id gnl|my_center|LOCUS_10970 <23339 22398 gene locus_tag LOCUS_10980 <23339 22398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021382.1:peptide transporter >Feature sequence0049 1588 635 gene locus_tag LOCUS_10990 gene thrB 1588 635 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI27 protein_id gnl|my_center|LOCUS_10990 2674 2540 gene locus_tag LOCUS_11000 2674 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 4911 3664 gene locus_tag LOCUS_11010 4911 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057921.1 protein_id gnl|my_center|LOCUS_11010 5265 5543 gene locus_tag LOCUS_11020 5265 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_11020 5530 5817 gene locus_tag LOCUS_11030 5530 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 6314 8527 gene locus_tag LOCUS_11040 6314 8527 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057683.1 protein_id gnl|my_center|LOCUS_11040 9141 10430 gene locus_tag LOCUS_11050 9141 10430 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_11050 10435 11100 gene locus_tag LOCUS_11060 10435 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_11060 12188 11682 gene locus_tag LOCUS_11070 12188 11682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 12730 12527 gene locus_tag LOCUS_11080 12730 12527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 13077 15089 gene locus_tag LOCUS_11090 13077 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 15188 16162 gene locus_tag LOCUS_11100 15188 16162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 16166 16630 gene locus_tag LOCUS_11110 16166 16630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 16608 18038 gene locus_tag LOCUS_11120 16608 18038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 20209 21135 gene locus_tag LOCUS_11130 20209 21135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 22685 21606 gene locus_tag LOCUS_11140 22685 21606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141680.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence0050 1203 619 gene locus_tag LOCUS_11150 1203 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1234 1833 gene locus_tag LOCUS_11160 gene cpcT2 1234 1833 CDS product chromophore lyase CpcT/CpeT 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLE2 protein_id gnl|my_center|LOCUS_11160 2673 1834 gene locus_tag LOCUS_11170 2673 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057503.1 protein_id gnl|my_center|LOCUS_11170 3819 2746 gene locus_tag LOCUS_11180 3819 2746 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141944.1 protein_id gnl|my_center|LOCUS_11180 4457 6247 gene locus_tag LOCUS_11190 4457 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 6654 7625 gene locus_tag LOCUS_11200 6654 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 protein_id gnl|my_center|LOCUS_11200 8094 9932 gene locus_tag LOCUS_11210 8094 9932 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_11210 9940 10899 gene locus_tag LOCUS_11220 9940 10899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 10907 11797 gene locus_tag LOCUS_11230 10907 11797 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389217.1 protein_id gnl|my_center|LOCUS_11230 12043 12975 gene locus_tag LOCUS_11240 12043 12975 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388576.1 protein_id gnl|my_center|LOCUS_11240 13426 13707 gene locus_tag LOCUS_11250 13426 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 13721 14158 gene locus_tag LOCUS_11260 13721 14158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388577.1 protein_id gnl|my_center|LOCUS_11260 14831 14670 gene locus_tag LOCUS_11270 14831 14670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11270 14974 14828 gene locus_tag LOCUS_11280 14974 14828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 16134 16319 gene locus_tag LOCUS_11290 16134 16319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 16484 18247 gene locus_tag LOCUS_11300 16484 18247 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_11300 18281 19930 gene locus_tag LOCUS_11310 18281 19930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056235.1 protein_id gnl|my_center|LOCUS_11310 21540 20299 gene locus_tag LOCUS_11320 21540 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 21861 21613 gene locus_tag LOCUS_11330 21861 21613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 22408 22178 gene locus_tag LOCUS_11340 22408 22178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 22879 22664 gene locus_tag LOCUS_11350 22879 22664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence0051 163 612 gene locus_tag LOCUS_11360 163 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 752 1507 gene locus_tag LOCUS_11370 752 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1697 2959 gene locus_tag LOCUS_11380 1697 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2949 3773 gene locus_tag LOCUS_11390 2949 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 4870 3779 gene locus_tag LOCUS_11400 4870 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 4988 5227 gene locus_tag LOCUS_11410 4988 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 5290 10230 gene locus_tag LOCUS_11420 5290 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 10242 10766 gene locus_tag LOCUS_11430 10242 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 10756 12141 gene locus_tag LOCUS_11440 10756 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 12185 12562 gene locus_tag LOCUS_11450 gene ypjD 12185 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42979 protein_id gnl|my_center|LOCUS_11450 13395 12826 gene locus_tag LOCUS_11460 13395 12826 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251105.1 protein_id gnl|my_center|LOCUS_11460 13732 13388 gene locus_tag LOCUS_11470 13732 13388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 15612 13981 gene locus_tag LOCUS_11480 gene groL 15612 13981 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD4 protein_id gnl|my_center|LOCUS_11480 16028 15717 gene locus_tag LOCUS_11490 gene groS 16028 15717 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TV92 protein_id gnl|my_center|LOCUS_11490 16519 17079 gene locus_tag LOCUS_11500 16519 17079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 17297 17043 gene locus_tag LOCUS_11510 17297 17043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 17846 18493 gene locus_tag LOCUS_11520 17846 18493 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 protein_id gnl|my_center|LOCUS_11520 20120 20593 gene locus_tag LOCUS_11530 20120 20593 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 protein_id gnl|my_center|LOCUS_11530 20949 22559 gene locus_tag LOCUS_11540 gene leuA 20949 22559 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ32 protein_id gnl|my_center|LOCUS_11540 >Feature sequence0052 1200 2540 gene locus_tag LOCUS_11550 1200 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3064 4731 gene locus_tag LOCUS_11560 gene glpA 3064 4731 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_11560 4895 5734 gene locus_tag LOCUS_11570 4895 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 6031 6792 gene locus_tag LOCUS_11580 6031 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 6800 7825 gene locus_tag LOCUS_11590 6800 7825 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_11590 8143 10002 gene locus_tag LOCUS_11600 8143 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965497.1 protein_id gnl|my_center|LOCUS_11600 10014 10253 gene locus_tag LOCUS_11610 10014 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 10654 11184 gene locus_tag LOCUS_11620 10654 11184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 11360 12520 gene locus_tag LOCUS_11630 11360 12520 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_11630 12731 13135 gene locus_tag LOCUS_11640 12731 13135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 13138 13449 gene locus_tag LOCUS_11650 13138 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 13974 14258 gene locus_tag LOCUS_11660 gene purS 13974 14258 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG9 protein_id gnl|my_center|LOCUS_11660 14255 14956 gene locus_tag LOCUS_11670 gene purQ 14255 14956 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL01 protein_id gnl|my_center|LOCUS_11670 15204 16082 gene locus_tag LOCUS_11680 15204 16082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056085.1 protein_id gnl|my_center|LOCUS_11680 16530 17066 gene locus_tag LOCUS_11690 gene msrA 16530 17066 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066219.1 protein_id gnl|my_center|LOCUS_11690 17361 17143 gene locus_tag LOCUS_11700 17361 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 17470 18657 gene locus_tag LOCUS_11710 gene ndbB 17470 18657 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056978.1 protein_id gnl|my_center|LOCUS_11710 18952 19605 gene locus_tag LOCUS_11720 18952 19605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056977.1 protein_id gnl|my_center|LOCUS_11720 19587 19832 gene locus_tag LOCUS_11730 19587 19832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 20039 21892 gene locus_tag LOCUS_11740 20039 21892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence0053 1314 748 gene locus_tag LOCUS_11750 1314 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1498 1325 gene locus_tag LOCUS_11760 1498 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 3874 2162 gene locus_tag LOCUS_11770 3874 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 5439 3886 gene locus_tag LOCUS_11780 5439 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 6629 5679 gene locus_tag LOCUS_11790 6629 5679 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_11790 6993 8771 gene locus_tag LOCUS_11800 6993 8771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 8787 9083 gene locus_tag LOCUS_11810 8787 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 9215 9508 gene locus_tag LOCUS_11820 9215 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085796.1 protein_id gnl|my_center|LOCUS_11820 9531 9845 gene locus_tag LOCUS_11830 9531 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 10106 10300 gene locus_tag LOCUS_11840 10106 10300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 10553 10744 gene locus_tag LOCUS_11850 10553 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 10880 11089 gene locus_tag LOCUS_11860 10880 11089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 11358 11146 gene locus_tag LOCUS_11870 11358 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 11603 13072 gene locus_tag LOCUS_11880 11603 13072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 13369 13094 gene locus_tag LOCUS_11890 13369 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 13620 13474 gene locus_tag LOCUS_11900 13620 13474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 14129 15076 gene locus_tag LOCUS_11910 14129 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 15073 17337 gene locus_tag LOCUS_11920 15073 17337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 17357 18667 gene locus_tag LOCUS_11930 17357 18667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 19264 18998 gene locus_tag LOCUS_11940 19264 18998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 19476 19267 gene locus_tag LOCUS_11950 19476 19267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 19803 21143 gene locus_tag LOCUS_11960 gene miaB 19803 21143 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB2 protein_id gnl|my_center|LOCUS_11960 >Feature sequence0054 1599 3287 gene locus_tag LOCUS_11970 1599 3287 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_11970 4102 3527 gene locus_tag LOCUS_11980 4102 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4811 4374 gene locus_tag LOCUS_11990 gene queF 4811 4374 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA3 protein_id gnl|my_center|LOCUS_11990 5144 5743 gene locus_tag LOCUS_12000 5144 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 5947 6300 gene locus_tag LOCUS_12010 5947 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 7595 7209 gene locus_tag LOCUS_12020 7595 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140146.1 protein_id gnl|my_center|LOCUS_12020 7892 9415 gene locus_tag LOCUS_12030 7892 9415 CDS product carboxypeptidase Taq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_12030 9945 12365 gene locus_tag LOCUS_12040 9945 12365 CDS product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056890.1 protein_id gnl|my_center|LOCUS_12040 12891 12424 gene locus_tag LOCUS_12050 12891 12424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 16681 13604 gene locus_tag LOCUS_12060 16681 13604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 18592 18059 gene locus_tag LOCUS_12070 gene infC 18592 18059 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIG8 protein_id gnl|my_center|LOCUS_12070 19604 21496 gene locus_tag LOCUS_12080 19604 21496 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056106.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence0055 11 179 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttggggtctccccaagtagagc 779 1651 gene locus_tag LOCUS_12090 779 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2989 5592 gene locus_tag LOCUS_12100 2989 5592 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_12100 6144 6869 gene locus_tag LOCUS_12110 6144 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 6876 7388 gene locus_tag LOCUS_12120 6876 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 7995 7672 gene locus_tag LOCUS_12130 7995 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 8118 8303 gene locus_tag LOCUS_12140 8118 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 8671 11286 gene locus_tag LOCUS_12150 8671 11286 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412557.1 protein_id gnl|my_center|LOCUS_12150 11621 12031 gene locus_tag LOCUS_12160 gene cytM 11621 12031 CDS product cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058261.1 protein_id gnl|my_center|LOCUS_12160 14276 12186 gene locus_tag LOCUS_12170 14276 12186 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_12170 14549 14734 gene locus_tag LOCUS_12180 14549 14734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 15316 15801 gene locus_tag LOCUS_12190 15316 15801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 17243 16512 gene locus_tag LOCUS_12200 17243 16512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 19563 17704 gene locus_tag LOCUS_12210 19563 17704 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056407.1 protein_id gnl|my_center|LOCUS_12210 19751 20257 gene locus_tag LOCUS_12220 gene atsA 19751 20257 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973688.1 protein_id gnl|my_center|LOCUS_12220 20969 20487 gene locus_tag LOCUS_12230 20969 20487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 21676 21104 gene locus_tag LOCUS_12240 21676 21104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence0056 959 549 gene locus_tag LOCUS_12250 959 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1284 1084 gene locus_tag LOCUS_12260 1284 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 2725 1862 gene locus_tag LOCUS_12270 2725 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3691 3762 gene locus_tag LOCUS_t00100 3691 3762 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4242 5321 gene locus_tag LOCUS_12280 4242 5321 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_12280 5753 5547 gene locus_tag LOCUS_12290 5753 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057172.1 protein_id gnl|my_center|LOCUS_12290 6700 6119 gene locus_tag LOCUS_12300 gene ispF 6700 6119 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC4 protein_id gnl|my_center|LOCUS_12300 7121 7369 gene locus_tag LOCUS_12310 7121 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 7891 7679 gene locus_tag LOCUS_12320 7891 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 8270 8470 gene locus_tag LOCUS_12330 8270 8470 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140229.1 protein_id gnl|my_center|LOCUS_12330 10694 8817 gene locus_tag LOCUS_12340 10694 8817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056770.1 protein_id gnl|my_center|LOCUS_12340 11384 12577 gene locus_tag LOCUS_12350 11384 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 13008 13988 gene locus_tag LOCUS_12360 gene yedY 13008 13988 CDS product mononuclear molybdenum enzyme YedY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_12360 14333 14599 gene locus_tag LOCUS_12370 14333 14599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 14866 15111 gene locus_tag LOCUS_12380 14866 15111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 15243 15635 gene locus_tag LOCUS_12390 15243 15635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 17939 16134 gene locus_tag LOCUS_12400 17939 16134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 18366 18154 gene locus_tag LOCUS_12410 18366 18154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 19362 18817 gene locus_tag LOCUS_12420 19362 18817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057421.1 protein_id gnl|my_center|LOCUS_12420 19961 19638 gene locus_tag LOCUS_12430 19961 19638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140556.1 protein_id gnl|my_center|LOCUS_12430 20347 21954 gene locus_tag LOCUS_12440 20347 21954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence0057 301 723 gene locus_tag LOCUS_12450 301 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 726 1148 gene locus_tag LOCUS_12460 726 1148 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_12460 2255 1224 gene locus_tag LOCUS_12470 2255 1224 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTQ8 protein_id gnl|my_center|LOCUS_12470 2794 3063 gene locus_tag LOCUS_12480 gene rpsO 2794 3063 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJL5 protein_id gnl|my_center|LOCUS_12480 3079 3576 gene locus_tag LOCUS_12490 3079 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 3806 4867 gene locus_tag LOCUS_12500 gene ccmA 3806 4867 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_12500 6341 5253 gene locus_tag LOCUS_12510 6341 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 8058 6925 gene locus_tag LOCUS_12520 8058 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 8342 8740 gene locus_tag LOCUS_12530 8342 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 8733 9095 gene locus_tag LOCUS_12540 8733 9095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 9684 9436 gene locus_tag LOCUS_12550 9684 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 9901 9653 gene locus_tag LOCUS_12560 9901 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 10149 9898 gene locus_tag LOCUS_12570 10149 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 10732 11226 gene locus_tag LOCUS_12580 10732 11226 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878622.1 protein_id gnl|my_center|LOCUS_12580 12260 11310 gene locus_tag LOCUS_12590 gene atpG 12260 11310 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLU1 protein_id gnl|my_center|LOCUS_12590 13943 12426 gene locus_tag LOCUS_12600 gene atpA 13943 12426 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP3 protein_id gnl|my_center|LOCUS_12600 14625 14074 gene locus_tag LOCUS_12610 gene atpH 14625 14074 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP4 protein_id gnl|my_center|LOCUS_12610 15149 14622 gene locus_tag LOCUS_12620 gene atpF 15149 14622 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP5 protein_id gnl|my_center|LOCUS_12620 15724 15239 gene locus_tag LOCUS_12630 gene atpG 15724 15239 CDS product ATP synthase subunit b' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP6 protein_id gnl|my_center|LOCUS_12630 16185 15940 gene locus_tag LOCUS_12640 gene atpE 16185 15940 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP7 protein_id gnl|my_center|LOCUS_12640 17079 16333 gene locus_tag LOCUS_12650 gene atpB 17079 16333 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP8 protein_id gnl|my_center|LOCUS_12650 17574 17128 gene locus_tag LOCUS_12660 gene atp1 17574 17128 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056284.1 protein_id gnl|my_center|LOCUS_12660 18226 18387 gene locus_tag LOCUS_12670 18226 18387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 18532 18792 gene locus_tag LOCUS_12680 18532 18792 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_12680 18932 19261 gene locus_tag LOCUS_12690 gene ycf64 18932 19261 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI5 protein_id gnl|my_center|LOCUS_12690 20894 20322 gene locus_tag LOCUS_12700 20894 20322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 20893 21885 gene locus_tag LOCUS_12710 gene pyrB 20893 21885 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM4 protein_id gnl|my_center|LOCUS_12710 >Feature sequence0058 768 310 gene locus_tag LOCUS_12720 768 310 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142874.1 protein_id gnl|my_center|LOCUS_12720 1154 768 gene locus_tag LOCUS_12730 gene ycf35 1154 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_12730 1238 1361 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctctacttggggagaccccaagacc 1644 1435 gene locus_tag LOCUS_12740 1644 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057972.1 protein_id gnl|my_center|LOCUS_12740 2301 2089 gene locus_tag LOCUS_12750 2301 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 2528 3547 gene locus_tag LOCUS_12760 2528 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140531.1 protein_id gnl|my_center|LOCUS_12760 4487 3783 gene locus_tag LOCUS_12770 4487 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4688 5017 gene locus_tag LOCUS_12780 4688 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 5077 5463 gene locus_tag LOCUS_12790 5077 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 5666 6907 gene locus_tag LOCUS_12800 5666 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 7210 8286 gene locus_tag LOCUS_12810 7210 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 8496 9452 gene locus_tag LOCUS_12820 8496 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412408.1 protein_id gnl|my_center|LOCUS_12820 9670 10791 gene locus_tag LOCUS_12830 9670 10791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412408.1 protein_id gnl|my_center|LOCUS_12830 11436 11002 gene locus_tag LOCUS_12840 11436 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 12069 11437 gene locus_tag LOCUS_12850 12069 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 12902 12411 gene locus_tag LOCUS_12860 12902 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 19014 13234 gene locus_tag LOCUS_12870 19014 13234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 20591 19467 gene locus_tag LOCUS_12880 20591 19467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 21205 21765 gene locus_tag LOCUS_12890 21205 21765 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226509.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence0059 2770 434 gene locus_tag LOCUS_12900 2770 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 4184 2865 gene locus_tag LOCUS_12910 4184 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 7359 4462 gene locus_tag LOCUS_12920 7359 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 8101 7373 gene locus_tag LOCUS_12930 8101 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057555.1 protein_id gnl|my_center|LOCUS_12930 11336 8706 gene locus_tag LOCUS_12940 11336 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 13788 11446 gene locus_tag LOCUS_12950 13788 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 14724 14888 gene locus_tag LOCUS_12960 14724 14888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 17677 15674 gene locus_tag LOCUS_12970 17677 15674 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS5 protein_id gnl|my_center|LOCUS_12970 19184 17928 gene locus_tag LOCUS_12980 19184 17928 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS4 protein_id gnl|my_center|LOCUS_12980 19498 19241 gene locus_tag LOCUS_12990 gene acp 19498 19241 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI72 protein_id gnl|my_center|LOCUS_12990 20397 21302 gene locus_tag LOCUS_13000 20397 21302 CDS product heterodisulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056823.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence0060 243 482 gene locus_tag LOCUS_13010 243 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 917 618 gene locus_tag LOCUS_13020 917 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1122 1397 gene locus_tag LOCUS_13030 1122 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1421 1669 gene locus_tag LOCUS_13040 1421 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1936 6816 gene locus_tag LOCUS_13050 1936 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 7082 6837 gene locus_tag LOCUS_13060 7082 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 7662 7093 gene locus_tag LOCUS_13070 7662 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 7915 7670 gene locus_tag LOCUS_13080 7915 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 8848 8171 gene locus_tag LOCUS_13090 8848 8171 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195593.1 protein_id gnl|my_center|LOCUS_13090 9204 9773 gene locus_tag LOCUS_13100 9204 9773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140313.1 protein_id gnl|my_center|LOCUS_13100 10082 10324 gene locus_tag LOCUS_13110 10082 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_13110 10357 10632 gene locus_tag LOCUS_13120 10357 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 10629 10997 gene locus_tag LOCUS_13130 10629 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 13959 11245 gene locus_tag LOCUS_13140 gene dnaE 13959 11245 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHA3 protein_id gnl|my_center|LOCUS_13140 14610 14143 gene locus_tag LOCUS_13150 14610 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 protein_id gnl|my_center|LOCUS_13150 15164 14946 gene locus_tag LOCUS_13160 15164 14946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 16210 15173 gene locus_tag LOCUS_13170 16210 15173 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI38 protein_id gnl|my_center|LOCUS_13170 16789 17367 gene locus_tag LOCUS_13180 16789 17367 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057894.1 protein_id gnl|my_center|LOCUS_13180 18216 17869 gene locus_tag LOCUS_13190 18216 17869 CDS product mRNA-degrading endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_13190 18452 18210 gene locus_tag LOCUS_13200 18452 18210 CDS product multidrug transporter MatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392534.1 protein_id gnl|my_center|LOCUS_13200 19190 19405 gene locus_tag LOCUS_13210 gene rpsR 19190 19405 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH98 protein_id gnl|my_center|LOCUS_13210 19613 21631 gene locus_tag LOCUS_13220 19613 21631 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence0061 2419 251 gene locus_tag LOCUS_13230 2419 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 3109 5004 gene locus_tag LOCUS_13240 3109 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 5023 5883 gene locus_tag LOCUS_13250 5023 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 6174 5968 gene locus_tag LOCUS_13260 6174 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 6969 7427 gene locus_tag LOCUS_13270 6969 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 9149 7767 gene locus_tag LOCUS_13280 9149 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 10054 9668 gene locus_tag LOCUS_13290 10054 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 16021 10829 gene locus_tag LOCUS_13300 16021 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 16452 17801 gene locus_tag LOCUS_13310 16452 17801 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141145.1 protein_id gnl|my_center|LOCUS_13310 18234 18548 gene locus_tag LOCUS_13320 18234 18548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13320 18610 19674 gene locus_tag LOCUS_13330 18610 19674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 19891 21480 gene locus_tag LOCUS_13340 19891 21480 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057444.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence0062 125 1816 gene locus_tag LOCUS_13350 125 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 2010 2252 gene locus_tag LOCUS_13360 2010 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3603 2398 gene locus_tag LOCUS_13370 3603 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 5557 4151 gene locus_tag LOCUS_13380 5557 4151 CDS product sodium:glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056889.1 protein_id gnl|my_center|LOCUS_13380 6123 5899 gene locus_tag LOCUS_13390 6123 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 8229 6325 gene locus_tag LOCUS_13400 8229 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 11964 8272 gene locus_tag LOCUS_13410 11964 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 14573 11961 gene locus_tag LOCUS_13420 14573 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 16743 14599 gene locus_tag LOCUS_13430 16743 14599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 19770 17065 gene locus_tag LOCUS_13440 gene mutS 19770 17065 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGS4 protein_id gnl|my_center|LOCUS_13440 20339 19944 gene locus_tag LOCUS_13450 20339 19944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 20595 20362 gene locus_tag LOCUS_13460 20595 20362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence0063 538 1923 gene locus_tag LOCUS_13470 538 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3132 2308 gene locus_tag LOCUS_13480 gene psbO 3132 2308 CDS product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A431 protein_id gnl|my_center|LOCUS_13480 3911 4234 gene locus_tag LOCUS_13490 3911 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 5776 4442 gene locus_tag LOCUS_13500 5776 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 6551 8008 gene locus_tag LOCUS_13510 6551 8008 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057360.1 protein_id gnl|my_center|LOCUS_13510 8087 8662 gene locus_tag LOCUS_13520 8087 8662 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHZ6 protein_id gnl|my_center|LOCUS_13520 9100 8762 gene locus_tag LOCUS_13530 gene glnB 9100 8762 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 protein_id gnl|my_center|LOCUS_13530 10154 10558 gene locus_tag LOCUS_13540 10154 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 11848 12306 gene locus_tag LOCUS_13550 11848 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 13348 12536 gene locus_tag LOCUS_13560 gene sigF 13348 12536 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_13560 14820 17087 gene locus_tag LOCUS_13570 14820 17087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 17970 17368 gene locus_tag LOCUS_13580 17970 17368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 18552 21224 gene locus_tag LOCUS_13590 18552 21224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 21337 21600 gene locus_tag LOCUS_13600 21337 21600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence0064 512 670 gene locus_tag LOCUS_13610 512 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1286 774 gene locus_tag LOCUS_13620 1286 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1600 1289 gene locus_tag LOCUS_13630 1600 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1880 2104 gene locus_tag LOCUS_13640 1880 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_13640 2504 2292 gene locus_tag LOCUS_13650 2504 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 2781 3137 gene locus_tag LOCUS_13660 2781 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 3150 3377 gene locus_tag LOCUS_13670 3150 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 4082 3717 gene locus_tag LOCUS_13680 4082 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 5152 4910 gene locus_tag LOCUS_13690 5152 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 6428 5268 gene locus_tag LOCUS_13700 gene xseA 6428 5268 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW4 protein_id gnl|my_center|LOCUS_13700 6830 7924 gene locus_tag LOCUS_13710 gene recA 6830 7924 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9V8 protein_id gnl|my_center|LOCUS_13710 9223 8552 gene locus_tag LOCUS_13720 9223 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_13720 11144 9654 gene locus_tag LOCUS_13730 gene glcD 11144 9654 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_13730 12455 11403 gene locus_tag LOCUS_13740 12455 11403 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X28 protein_id gnl|my_center|LOCUS_13740 13009 12770 gene locus_tag LOCUS_13750 13009 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 14918 14043 gene locus_tag LOCUS_13760 14918 14043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 15309 15079 gene locus_tag LOCUS_13770 15309 15079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 17340 17789 gene locus_tag LOCUS_13780 17340 17789 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057301.1 protein_id gnl|my_center|LOCUS_13780 18803 18489 gene locus_tag LOCUS_13790 18803 18489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 18885 19349 gene locus_tag LOCUS_13800 18885 19349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 19745 21133 gene locus_tag LOCUS_13810 gene asnS 19745 21133 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG51 protein_id gnl|my_center|LOCUS_13810 >Feature sequence0065 1194 169 gene locus_tag LOCUS_13820 1194 169 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056599.1 protein_id gnl|my_center|LOCUS_13820 2118 1504 gene locus_tag LOCUS_13830 2118 1504 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 protein_id gnl|my_center|LOCUS_13830 3980 2376 gene locus_tag LOCUS_13840 gene metG 3980 2376 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59081 protein_id gnl|my_center|LOCUS_13840 5628 6350 gene locus_tag LOCUS_13850 5628 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142238.1 protein_id gnl|my_center|LOCUS_13850 7899 6589 gene locus_tag LOCUS_13860 7899 6589 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727466.1 protein_id gnl|my_center|LOCUS_13860 9254 8325 gene locus_tag LOCUS_13870 9254 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056269.1 protein_id gnl|my_center|LOCUS_13870 10827 9976 gene locus_tag LOCUS_13880 10827 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 12115 11012 gene locus_tag LOCUS_13890 12115 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 14002 12485 gene locus_tag LOCUS_13900 14002 12485 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940879.1 protein_id gnl|my_center|LOCUS_13900 15447 14230 gene locus_tag LOCUS_13910 15447 14230 CDS product CDP-4-keto-6-deoxy-D-glucose-3-dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_13910 17493 15448 gene locus_tag LOCUS_13920 gene bkdA 17493 15448 CDS product 2-oxoisovalerate dehydrogenase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228884.1 protein_id gnl|my_center|LOCUS_13920 18436 17486 gene locus_tag LOCUS_13930 gene fcl 18436 17486 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 protein_id gnl|my_center|LOCUS_13930 19510 18443 gene locus_tag LOCUS_13940 19510 18443 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_13940 20023 19547 gene locus_tag LOCUS_13950 20023 19547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 20784 20122 gene locus_tag LOCUS_13960 20784 20122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 21373 20768 gene locus_tag LOCUS_13970 21373 20768 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND7 protein_id gnl|my_center|LOCUS_13970 >Feature sequence0066 3144 1474 gene locus_tag LOCUS_13980 3144 1474 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_13980 4781 3552 gene locus_tag LOCUS_13990 4781 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057902.1 protein_id gnl|my_center|LOCUS_13990 8255 5883 gene locus_tag LOCUS_14000 8255 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 8411 8653 gene locus_tag LOCUS_14010 8411 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 8724 9755 gene locus_tag LOCUS_14020 gene pdhA 8724 9755 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ3 protein_id gnl|my_center|LOCUS_14020 11509 10145 gene locus_tag LOCUS_14030 11509 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 14766 11893 gene locus_tag LOCUS_14040 14766 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 15682 14963 gene locus_tag LOCUS_14050 15682 14963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887691.1 protein_id gnl|my_center|LOCUS_14050 18316 19740 gene locus_tag LOCUS_14060 18316 19740 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_14060 19950 21125 gene locus_tag LOCUS_14070 19950 21125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 21154 21342 gene locus_tag LOCUS_14080 21154 21342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence0067 1649 390 gene locus_tag LOCUS_14090 1649 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2298 3554 gene locus_tag LOCUS_14100 2298 3554 CDS product sucrose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143828.1 protein_id gnl|my_center|LOCUS_14100 4534 3860 gene locus_tag LOCUS_14110 4534 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 5549 4833 gene locus_tag LOCUS_14120 5549 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 6420 5731 gene locus_tag LOCUS_14130 6420 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 7123 6629 gene locus_tag LOCUS_14140 7123 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 7322 7603 gene locus_tag LOCUS_14150 7322 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 7755 8363 gene locus_tag LOCUS_14160 7755 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 8532 9746 gene locus_tag LOCUS_14170 8532 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 protein_id gnl|my_center|LOCUS_14170 10583 9849 gene locus_tag LOCUS_14180 gene comB 10583 9849 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS5 protein_id gnl|my_center|LOCUS_14180 11073 11243 gene locus_tag LOCUS_14190 11073 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 11370 11828 gene locus_tag LOCUS_14200 11370 11828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 12339 12617 gene locus_tag LOCUS_14210 12339 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 13063 14562 gene locus_tag LOCUS_14220 13063 14562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 17736 15061 gene locus_tag LOCUS_14230 17736 15061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 17977 19734 gene locus_tag LOCUS_14240 gene argS 17977 19734 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKN4 protein_id gnl|my_center|LOCUS_14240 20732 19872 gene locus_tag LOCUS_14250 20732 19872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence0068 347 1447 gene locus_tag LOCUS_14260 347 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935873.1 protein_id gnl|my_center|LOCUS_14260 3182 1707 gene locus_tag LOCUS_14270 3182 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4016 3477 gene locus_tag LOCUS_14280 4016 3477 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812293.1 protein_id gnl|my_center|LOCUS_14280 4293 4021 gene locus_tag LOCUS_14290 4293 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 4495 5394 gene locus_tag LOCUS_14300 4495 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5429 7687 gene locus_tag LOCUS_14310 5429 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 7696 8424 gene locus_tag LOCUS_14320 7696 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 8421 9692 gene locus_tag LOCUS_14330 8421 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 9689 10114 gene locus_tag LOCUS_14340 9689 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 10150 11286 gene locus_tag LOCUS_14350 10150 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 11310 12209 gene locus_tag LOCUS_14360 11310 12209 CDS product CRISPR-associated RAMP protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258158.1 protein_id gnl|my_center|LOCUS_14360 12244 13179 gene locus_tag LOCUS_14370 12244 13179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258159.1 protein_id gnl|my_center|LOCUS_14370 13176 13613 gene locus_tag LOCUS_14380 13176 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 13610 14614 gene locus_tag LOCUS_14390 13610 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 14616 15140 gene locus_tag LOCUS_14400 14616 15140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 15466 15684 gene locus_tag LOCUS_14410 15466 15684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 15677 16111 gene locus_tag LOCUS_14420 15677 16111 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140252.1 protein_id gnl|my_center|LOCUS_14420 17430 16252 gene locus_tag LOCUS_14430 17430 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 17659 17883 gene locus_tag LOCUS_14440 17659 17883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 18582 18181 gene locus_tag LOCUS_14450 18582 18181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 19333 20037 gene locus_tag LOCUS_14460 19333 20037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 20402 20208 gene locus_tag LOCUS_14470 20402 20208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence0069 3662 192 gene locus_tag LOCUS_14480 3662 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 5051 4302 gene locus_tag LOCUS_14490 5051 4302 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532962.1 protein_id gnl|my_center|LOCUS_14490 5703 5395 gene locus_tag LOCUS_14500 5703 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 6294 5977 gene locus_tag LOCUS_14510 6294 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 6568 6269 gene locus_tag LOCUS_14520 6568 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 7248 6988 gene locus_tag LOCUS_14530 7248 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 7688 7338 gene locus_tag LOCUS_14540 7688 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 14451 8194 gene locus_tag LOCUS_14550 14451 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 14800 15219 gene locus_tag LOCUS_14560 14800 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 15207 15542 gene locus_tag LOCUS_14570 15207 15542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 16149 15700 gene locus_tag LOCUS_14580 16149 15700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 16357 16130 gene locus_tag LOCUS_14590 16357 16130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 18064 16712 gene locus_tag LOCUS_14600 18064 16712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 18589 18188 gene locus_tag LOCUS_14610 18589 18188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056075.1 protein_id gnl|my_center|LOCUS_14610 19083 18742 gene locus_tag LOCUS_14620 19083 18742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 19334 19083 gene locus_tag LOCUS_14630 19334 19083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 20770 19472 gene locus_tag LOCUS_14640 gene cupA 20770 19472 CDS product carbon dioxide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141007.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence0070 986 198 gene locus_tag LOCUS_14650 986 198 CDS product nucleoside-diphosphate-sugar pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966337.1 protein_id gnl|my_center|LOCUS_14650 2038 1100 gene locus_tag LOCUS_14660 2038 1100 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_14660 3291 2128 gene locus_tag LOCUS_14670 3291 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4873 3551 gene locus_tag LOCUS_14680 gene xapH 4873 3551 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_14680 6221 4932 gene locus_tag LOCUS_14690 6221 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 7081 6257 gene locus_tag LOCUS_14700 gene xapG 7081 6257 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D15 protein_id gnl|my_center|LOCUS_14700 8344 7544 gene locus_tag LOCUS_14710 8344 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 8842 8531 gene locus_tag LOCUS_14720 8842 8531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142926.1 protein_id gnl|my_center|LOCUS_14720 11748 8959 gene locus_tag LOCUS_14730 11748 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 12637 12443 gene locus_tag LOCUS_14740 12637 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 12890 12687 gene locus_tag LOCUS_14750 12890 12687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 15014 13017 gene locus_tag LOCUS_14760 15014 13017 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816805.1 protein_id gnl|my_center|LOCUS_14760 16010 15147 gene locus_tag LOCUS_14770 16010 15147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 16045 16308 gene locus_tag LOCUS_14780 16045 16308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14780 16313 16552 gene locus_tag LOCUS_14790 16313 16552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence0071 106 804 gene locus_tag LOCUS_14800 gene lipB 106 804 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKM7 protein_id gnl|my_center|LOCUS_14800 1311 898 gene locus_tag LOCUS_14810 gene vapC 1311 898 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EUB2 protein_id gnl|my_center|LOCUS_14810 1613 1311 gene locus_tag LOCUS_14820 1613 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 2384 1770 gene locus_tag LOCUS_14830 2384 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 5235 2707 gene locus_tag LOCUS_14840 5235 2707 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143331.1 protein_id gnl|my_center|LOCUS_14840 5514 5696 gene locus_tag LOCUS_14850 5514 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 5782 6603 gene locus_tag LOCUS_14860 5782 6603 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056899.1 protein_id gnl|my_center|LOCUS_14860 8938 7766 gene locus_tag LOCUS_14870 gene sigA 8938 7766 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL79 protein_id gnl|my_center|LOCUS_14870 11241 10999 gene locus_tag LOCUS_14880 11241 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 11613 12200 gene locus_tag LOCUS_14890 11613 12200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 12876 13082 gene locus_tag LOCUS_14900 12876 13082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 13564 17097 gene locus_tag LOCUS_14910 gene mfd 13564 17097 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA7 protein_id gnl|my_center|LOCUS_14910 13781 13689 gene locus_tag LOCUS_t00110 13781 13689 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 17780 18319 gene locus_tag LOCUS_14920 17780 18319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 18848 19546 gene locus_tag LOCUS_14930 18848 19546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 19633 20175 gene locus_tag LOCUS_14940 19633 20175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence0072 866 417 gene locus_tag LOCUS_14950 866 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695998.1 protein_id gnl|my_center|LOCUS_14950 1165 1007 gene locus_tag LOCUS_14960 1165 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1607 1359 gene locus_tag LOCUS_14970 1607 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 3369 1774 gene locus_tag LOCUS_14980 3369 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 3795 4013 gene locus_tag LOCUS_14990 3795 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 4700 5818 gene locus_tag LOCUS_15000 gene ndhA 4700 5818 CDS product NAD(P)H-quinone oxidoreductase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL32 protein_id gnl|my_center|LOCUS_15000 6017 6601 gene locus_tag LOCUS_15010 gene ndhI 6017 6601 CDS product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL31 protein_id gnl|my_center|LOCUS_15010 6690 7307 gene locus_tag LOCUS_15020 gene ndhG 6690 7307 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 protein_id gnl|my_center|LOCUS_15020 7576 7887 gene locus_tag LOCUS_15030 gene ndhE 7576 7887 CDS product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL29 protein_id gnl|my_center|LOCUS_15030 8963 9904 gene locus_tag LOCUS_15040 gene nadK2 8963 9904 CDS product NAD kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RR32 protein_id gnl|my_center|LOCUS_15040 12170 11058 gene locus_tag LOCUS_15050 12170 11058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057332.1 protein_id gnl|my_center|LOCUS_15050 13880 12339 gene locus_tag LOCUS_15060 13880 12339 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 protein_id gnl|my_center|LOCUS_15060 15162 14155 gene locus_tag LOCUS_15070 15162 14155 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385771.1 protein_id gnl|my_center|LOCUS_15070 16365 15760 gene locus_tag LOCUS_15080 16365 15760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 16823 16575 gene locus_tag LOCUS_15090 16823 16575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 17092 17640 gene locus_tag LOCUS_15100 gene dpsA 17092 17640 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056462.1 protein_id gnl|my_center|LOCUS_15100 18346 18852 gene locus_tag LOCUS_15110 gene fur 18346 18852 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055903.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence0073 3173 909 gene locus_tag LOCUS_15120 gene psaA 3173 909 CDS product photosystem I P700 chlorophyll a apoprotein A1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A405 protein_id gnl|my_center|LOCUS_15120 3897 5570 gene locus_tag LOCUS_15130 3897 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6123 5665 gene locus_tag LOCUS_15140 6123 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144145.1 protein_id gnl|my_center|LOCUS_15140 6715 6368 gene locus_tag LOCUS_15150 6715 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 7012 7581 gene locus_tag LOCUS_15160 7012 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 8696 7593 gene locus_tag LOCUS_15170 8696 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 8881 10386 gene locus_tag LOCUS_15180 8881 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140390.1 protein_id gnl|my_center|LOCUS_15180 10753 11214 gene locus_tag LOCUS_15190 gene crcB 10753 11214 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QE1 protein_id gnl|my_center|LOCUS_15190 11393 11653 gene locus_tag LOCUS_15200 11393 11653 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 protein_id gnl|my_center|LOCUS_15200 12713 12117 gene locus_tag LOCUS_15210 gene cpcT 12713 12117 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH04 protein_id gnl|my_center|LOCUS_15210 13492 14010 gene locus_tag LOCUS_15220 gene cpcB 13492 14010 CDS product C-phycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50033 protein_id gnl|my_center|LOCUS_15220 14160 14648 gene locus_tag LOCUS_15230 gene cpcA 14160 14648 CDS product C-phycocyanin alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50032 protein_id gnl|my_center|LOCUS_15230 14823 15653 gene locus_tag LOCUS_15240 gene cpcE 14823 15653 CDS product phycocyanobilin lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50037 protein_id gnl|my_center|LOCUS_15240 15673 16317 gene locus_tag LOCUS_15250 gene cpcF 15673 16317 CDS product phycocyanobilin lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50038 protein_id gnl|my_center|LOCUS_15250 16467 16769 gene locus_tag LOCUS_15260 16467 16769 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932932.1 protein_id gnl|my_center|LOCUS_15260 17452 17150 gene locus_tag LOCUS_15270 17452 17150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 17849 17568 gene locus_tag LOCUS_15280 17849 17568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 18058 18261 gene locus_tag LOCUS_15290 18058 18261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 18585 19682 gene locus_tag LOCUS_15300 18585 19682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence0074 551 120 gene locus_tag LOCUS_15310 551 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1465 953 gene locus_tag LOCUS_15320 1465 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1964 2674 gene locus_tag LOCUS_15330 gene queC 1964 2674 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI59 protein_id gnl|my_center|LOCUS_15330 3214 2909 gene locus_tag LOCUS_15340 3214 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 10679 3825 gene locus_tag LOCUS_15350 10679 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 11586 12188 gene locus_tag LOCUS_15360 11586 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 12886 12575 gene locus_tag LOCUS_15370 12886 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 13133 13561 gene locus_tag LOCUS_15380 13133 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142480.1 protein_id gnl|my_center|LOCUS_15380 13944 14765 gene locus_tag LOCUS_15390 13944 14765 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_15390 15752 14889 gene locus_tag LOCUS_15400 15752 14889 CDS product type II restriction endonuclease NgoMIV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951140.1 protein_id gnl|my_center|LOCUS_15400 16921 15749 gene locus_tag LOCUS_15410 gene ddeI 16921 15749 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H720 protein_id gnl|my_center|LOCUS_15410 17333 18331 gene locus_tag LOCUS_15420 17333 18331 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143100.1 protein_id gnl|my_center|LOCUS_15420 18319 20049 gene locus_tag LOCUS_15430 18319 20049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence0075 588 1871 gene locus_tag LOCUS_15440 588 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2101 4107 gene locus_tag LOCUS_15450 2101 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 4104 5393 gene locus_tag LOCUS_15460 4104 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 6210 5758 gene locus_tag LOCUS_15470 6210 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 7857 6604 gene locus_tag LOCUS_15480 7857 6604 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_15480 8503 8225 gene locus_tag LOCUS_15490 8503 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141694.1 protein_id gnl|my_center|LOCUS_15490 9148 9813 gene locus_tag LOCUS_15500 gene cobO 9148 9813 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056120.1 protein_id gnl|my_center|LOCUS_15500 10819 10145 gene locus_tag LOCUS_15510 10819 10145 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057508.1 protein_id gnl|my_center|LOCUS_15510 11939 10971 gene locus_tag LOCUS_15520 11939 10971 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057358.1 protein_id gnl|my_center|LOCUS_15520 13188 15899 gene locus_tag LOCUS_15530 13188 15899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 15925 17082 gene locus_tag LOCUS_15540 15925 17082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 19841 17436 gene locus_tag LOCUS_15550 19841 17436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence0076 184 600 gene locus_tag LOCUS_15560 184 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1476 2339 gene locus_tag LOCUS_15570 1476 2339 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085765.1 protein_id gnl|my_center|LOCUS_15570 3209 2742 gene locus_tag LOCUS_15580 gene smpB 3209 2742 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM0 protein_id gnl|my_center|LOCUS_15580 4265 3450 gene locus_tag LOCUS_15590 4265 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4672 4854 gene locus_tag LOCUS_15600 4672 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 6159 5419 gene locus_tag LOCUS_15610 6159 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 protein_id gnl|my_center|LOCUS_15610 6230 6946 gene locus_tag LOCUS_15620 6230 6946 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_15620 7883 9064 gene locus_tag LOCUS_15630 gene cheB 7883 9064 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBT0 protein_id gnl|my_center|LOCUS_15630 9857 9468 gene locus_tag LOCUS_15640 9857 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_15640 10440 10204 gene locus_tag LOCUS_15650 10440 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 10610 10386 gene locus_tag LOCUS_15660 10610 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 12772 12407 gene locus_tag LOCUS_15670 12772 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 13301 13119 gene locus_tag LOCUS_15680 13301 13119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 13755 13516 gene locus_tag LOCUS_15690 13755 13516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 14029 14310 gene locus_tag LOCUS_15700 14029 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 15923 15585 gene locus_tag LOCUS_15710 15923 15585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 16227 15895 gene locus_tag LOCUS_15720 16227 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_15720 16820 16554 gene locus_tag LOCUS_15730 16820 16554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 17118 16804 gene locus_tag LOCUS_15740 17118 16804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 17363 19405 gene locus_tag LOCUS_15750 gene chlD 17363 19405 CDS product Mg-protoporphyrin IX chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ18 protein_id gnl|my_center|LOCUS_15750 >Feature sequence0077 3307 548 gene locus_tag LOCUS_15760 3307 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 3888 3649 gene locus_tag LOCUS_15770 3888 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4916 4227 gene locus_tag LOCUS_15780 4916 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5321 5704 gene locus_tag LOCUS_15790 5321 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 5712 5999 gene locus_tag LOCUS_15800 5712 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 5987 6163 gene locus_tag LOCUS_15810 5987 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 6634 6377 gene locus_tag LOCUS_15820 6634 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 6900 6634 gene locus_tag LOCUS_15830 6900 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 8440 7244 gene locus_tag LOCUS_15840 gene dxr 8440 7244 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK30 protein_id gnl|my_center|LOCUS_15840 8743 8504 gene locus_tag LOCUS_15850 8743 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 8929 9000 gene locus_tag LOCUS_t00120 8929 9000 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10709 9234 gene locus_tag LOCUS_15860 10709 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055916.1 protein_id gnl|my_center|LOCUS_15860 10985 11770 gene locus_tag LOCUS_15870 10985 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_15870 13112 11889 gene locus_tag LOCUS_15880 13112 11889 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144027.1 protein_id gnl|my_center|LOCUS_15880 14014 13220 gene locus_tag LOCUS_15890 14014 13220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 15146 14007 gene locus_tag LOCUS_15900 15146 14007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 16444 15659 gene locus_tag LOCUS_15910 16444 15659 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 protein_id gnl|my_center|LOCUS_15910 19524 16813 gene locus_tag LOCUS_15920 19524 16813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence0078 1058 171 gene locus_tag LOCUS_15930 1058 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1149 2996 gene locus_tag LOCUS_15940 1149 2996 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942368.1 protein_id gnl|my_center|LOCUS_15940 3975 3043 gene locus_tag LOCUS_15950 gene gpsA 3975 3043 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF59 protein_id gnl|my_center|LOCUS_15950 4908 4039 gene locus_tag LOCUS_15960 gene lipA1 4908 4039 CDS product lipoyl synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL83 protein_id gnl|my_center|LOCUS_15960 4995 5068 gene locus_tag LOCUS_t00130 4995 5068 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5630 6385 gene locus_tag LOCUS_15970 5630 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 6408 7316 gene locus_tag LOCUS_15980 gene prmC 6408 7316 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHV7 protein_id gnl|my_center|LOCUS_15980 7358 7582 gene locus_tag LOCUS_15990 7358 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 8104 8709 gene locus_tag LOCUS_16000 8104 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057957.1 protein_id gnl|my_center|LOCUS_16000 8951 9868 gene locus_tag LOCUS_16010 8951 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 10292 9819 gene locus_tag LOCUS_16020 gene ycf52 10292 9819 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140110.1 protein_id gnl|my_center|LOCUS_16020 12200 11214 gene locus_tag LOCUS_16030 gene hemB 12200 11214 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND78 protein_id gnl|my_center|LOCUS_16030 12733 12464 gene locus_tag LOCUS_16040 gene rpmA 12733 12464 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NME2 protein_id gnl|my_center|LOCUS_16040 13432 13031 gene locus_tag LOCUS_16050 gene rplU 13432 13031 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMF1 protein_id gnl|my_center|LOCUS_16050 13982 13653 gene locus_tag LOCUS_16060 gene rpsF 13982 13653 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNH7 protein_id gnl|my_center|LOCUS_16060 14603 15391 gene locus_tag LOCUS_16070 14603 15391 CDS product 5-oxo-1,2,5-tricarboxylic-3-penten acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057118.1 protein_id gnl|my_center|LOCUS_16070 16173 15697 gene locus_tag LOCUS_16080 gene ycf60 16173 15697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056916.1 protein_id gnl|my_center|LOCUS_16080 16491 16303 gene locus_tag LOCUS_16090 16491 16303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 17128 16616 gene locus_tag LOCUS_16100 gene ycf60 17128 16616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056916.1 protein_id gnl|my_center|LOCUS_16100 17959 17762 gene locus_tag LOCUS_16110 17959 17762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057807.1 protein_id gnl|my_center|LOCUS_16110 18291 19574 gene locus_tag LOCUS_16120 gene glyA 18291 19574 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH33 protein_id gnl|my_center|LOCUS_16120 >Feature sequence0079 1555 536 gene locus_tag LOCUS_16130 1555 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 2441 1680 gene locus_tag LOCUS_16140 2441 1680 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_16140 2765 3211 gene locus_tag LOCUS_16150 2765 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 4435 3191 gene locus_tag LOCUS_16160 4435 3191 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 protein_id gnl|my_center|LOCUS_16160 5775 4570 gene locus_tag LOCUS_16170 5775 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 6092 7129 gene locus_tag LOCUS_16180 6092 7129 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526891.1 protein_id gnl|my_center|LOCUS_16180 8489 7578 gene locus_tag LOCUS_16190 8489 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 9404 8493 gene locus_tag LOCUS_16200 9404 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 10490 9444 gene locus_tag LOCUS_16210 10490 9444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 10924 10523 gene locus_tag LOCUS_16220 10924 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 12309 11206 gene locus_tag LOCUS_16230 12309 11206 CDS product bactoprenol glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920729.1 protein_id gnl|my_center|LOCUS_16230 14228 12474 gene locus_tag LOCUS_16240 14228 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 15232 14285 gene locus_tag LOCUS_16250 15232 14285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 16320 15229 gene locus_tag LOCUS_16260 gene perA 16320 15229 CDS product GDP-perosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DBF3 protein_id gnl|my_center|LOCUS_16260 16736 16362 gene locus_tag LOCUS_16270 16736 16362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 18220 17531 gene locus_tag LOCUS_16280 18220 17531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728496.1 protein_id gnl|my_center|LOCUS_16280 18423 19385 gene locus_tag LOCUS_16290 18423 19385 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence0080 574 392 gene locus_tag LOCUS_16300 574 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 2903 840 gene locus_tag LOCUS_16310 2903 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3945 4583 gene locus_tag LOCUS_16320 3945 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 4997 6181 gene locus_tag LOCUS_16330 gene sasA 4997 6181 CDS product adaptive-response sensory-kinase SasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMT2 protein_id gnl|my_center|LOCUS_16330 8089 6527 gene locus_tag LOCUS_16340 8089 6527 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_16340 8569 8904 gene locus_tag LOCUS_16350 8569 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 9508 9894 gene locus_tag LOCUS_16360 9508 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16360 10252 10061 gene locus_tag LOCUS_16370 10252 10061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 10534 13053 gene locus_tag LOCUS_16380 10534 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 13388 13660 gene locus_tag LOCUS_16390 13388 13660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 13974 15758 gene locus_tag LOCUS_16400 13974 15758 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_16400 16460 15957 gene locus_tag LOCUS_16410 16460 15957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 16944 17390 gene locus_tag LOCUS_16420 16944 17390 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 protein_id gnl|my_center|LOCUS_16420 18573 17929 gene locus_tag LOCUS_16430 18573 17929 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705571.1 protein_id gnl|my_center|LOCUS_16430 19305 18829 gene locus_tag LOCUS_16440 19305 18829 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence0081 839 2200 gene locus_tag LOCUS_16450 gene der 839 2200 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI1 protein_id gnl|my_center|LOCUS_16450 2577 3581 gene locus_tag LOCUS_16460 2577 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056139.1 protein_id gnl|my_center|LOCUS_16460 4556 4822 gene locus_tag LOCUS_16470 4556 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057448.1 protein_id gnl|my_center|LOCUS_16470 4945 5688 gene locus_tag LOCUS_16480 4945 5688 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056880.1 protein_id gnl|my_center|LOCUS_16480 6349 6990 gene locus_tag LOCUS_16490 gene sepF 6349 6990 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK7 protein_id gnl|my_center|LOCUS_16490 7176 7961 gene locus_tag LOCUS_16500 gene proC 7176 7961 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMR1 protein_id gnl|my_center|LOCUS_16500 8088 9125 gene locus_tag LOCUS_16510 8088 9125 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027205.1 protein_id gnl|my_center|LOCUS_16510 10072 9398 gene locus_tag LOCUS_16520 gene plsY 10072 9398 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNE0 protein_id gnl|my_center|LOCUS_16520 10153 11028 gene locus_tag LOCUS_16530 gene rbsK 10153 11028 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230843.1 protein_id gnl|my_center|LOCUS_16530 11641 11871 gene locus_tag LOCUS_16540 11641 11871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 13021 12341 gene locus_tag LOCUS_16550 13021 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 16124 14205 gene locus_tag LOCUS_16560 16124 14205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence0082 260 583 gene locus_tag LOCUS_16570 260 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 850 1980 gene locus_tag LOCUS_16580 850 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1970 2512 gene locus_tag LOCUS_16590 1970 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3052 3324 gene locus_tag LOCUS_16600 3052 3324 CDS product antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391712.1 protein_id gnl|my_center|LOCUS_16600 3343 3528 gene locus_tag LOCUS_16610 3343 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4846 3722 gene locus_tag LOCUS_16620 4846 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 6277 5117 gene locus_tag LOCUS_16630 6277 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 10020 6754 gene locus_tag LOCUS_16640 10020 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 11405 10347 gene locus_tag LOCUS_16650 11405 10347 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8J4 protein_id gnl|my_center|LOCUS_16650 11811 12215 gene locus_tag LOCUS_16660 11811 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975642.1 protein_id gnl|my_center|LOCUS_16660 12469 13206 gene locus_tag LOCUS_16670 12469 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 13357 14175 gene locus_tag LOCUS_16680 13357 14175 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_16680 14228 14389 gene locus_tag LOCUS_16690 gene rd 14228 14389 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AL94 protein_id gnl|my_center|LOCUS_16690 15329 14604 gene locus_tag LOCUS_16700 15329 14604 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_16700 15543 16487 gene locus_tag LOCUS_16710 15543 16487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 16648 19329 gene locus_tag LOCUS_16720 16648 19329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence0083 83 895 gene locus_tag LOCUS_16730 gene yhdJ 83 895 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XF74 protein_id gnl|my_center|LOCUS_16730 965 1195 gene locus_tag LOCUS_16740 965 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1192 2622 gene locus_tag LOCUS_16750 1192 2622 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903305.1 protein_id gnl|my_center|LOCUS_16750 4512 2854 gene locus_tag LOCUS_16760 4512 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 4762 5709 gene locus_tag LOCUS_16770 4762 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057461.1 protein_id gnl|my_center|LOCUS_16770 6545 7588 gene locus_tag LOCUS_16780 6545 7588 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_16780 7762 9138 gene locus_tag LOCUS_16790 gene glmU 7762 9138 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLT5 protein_id gnl|my_center|LOCUS_16790 9373 10266 gene locus_tag LOCUS_16800 9373 10266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 10811 10332 gene locus_tag LOCUS_16810 10811 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 11084 12805 gene locus_tag LOCUS_16820 11084 12805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 13167 12970 gene locus_tag LOCUS_16830 13167 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 13323 13174 gene locus_tag LOCUS_16840 13323 13174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 13425 13922 gene locus_tag LOCUS_16850 13425 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 14009 15028 gene locus_tag LOCUS_16860 14009 15028 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG6 protein_id gnl|my_center|LOCUS_16860 15414 16922 gene locus_tag LOCUS_16870 15414 16922 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 protein_id gnl|my_center|LOCUS_16870 18783 18250 gene locus_tag LOCUS_16880 18783 18250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence0084 386 84 gene locus_tag LOCUS_16890 386 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 926 756 gene locus_tag LOCUS_16900 926 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057753.1 protein_id gnl|my_center|LOCUS_16900 3966 1333 gene locus_tag LOCUS_16910 gene topA 3966 1333 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR4 protein_id gnl|my_center|LOCUS_16910 4899 5675 gene locus_tag LOCUS_16920 4899 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 6050 8557 gene locus_tag LOCUS_16930 6050 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 8572 9135 gene locus_tag LOCUS_16940 8572 9135 CDS product oxetanocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248969.1 protein_id gnl|my_center|LOCUS_16940 10617 9727 gene locus_tag LOCUS_16950 gene tas 10617 9727 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125344.1 protein_id gnl|my_center|LOCUS_16950 11809 11069 gene locus_tag LOCUS_16960 11809 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 12086 12808 gene locus_tag LOCUS_16970 12086 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 protein_id gnl|my_center|LOCUS_16970 13064 13480 gene locus_tag LOCUS_16980 13064 13480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 13938 14420 gene locus_tag LOCUS_16990 13938 14420 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_16990 16141 15380 gene locus_tag LOCUS_17000 16141 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 17252 18709 gene locus_tag LOCUS_17010 17252 18709 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600173.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence0085 1556 186 gene locus_tag LOCUS_17020 1556 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_17020 2593 1760 gene locus_tag LOCUS_17030 2593 1760 CDS product 3-ketodihydrosphingosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706792.1 protein_id gnl|my_center|LOCUS_17030 4567 2909 gene locus_tag LOCUS_17040 4567 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 7214 5442 gene locus_tag LOCUS_17050 7214 5442 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205581.1 protein_id gnl|my_center|LOCUS_17050 9098 7248 gene locus_tag LOCUS_17060 9098 7248 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_17060 9683 10777 gene locus_tag LOCUS_17070 9683 10777 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141720.1 protein_id gnl|my_center|LOCUS_17070 11193 11801 gene locus_tag LOCUS_17080 11193 11801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 13493 12135 gene locus_tag LOCUS_17090 gene glcF 13493 12135 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCA7 protein_id gnl|my_center|LOCUS_17090 14925 13642 gene locus_tag LOCUS_17100 gene glcE 14925 13642 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143064.1 protein_id gnl|my_center|LOCUS_17100 15380 16024 gene locus_tag LOCUS_17110 gene tmk 15380 16024 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHA4 protein_id gnl|my_center|LOCUS_17110 16682 16227 gene locus_tag LOCUS_17120 16682 16227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 17482 16739 gene locus_tag LOCUS_17130 17482 16739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence0086 291 434 gene locus_tag LOCUS_17140 291 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 718 1623 gene locus_tag LOCUS_17150 718 1623 CDS product putative aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72208 protein_id gnl|my_center|LOCUS_17150 1940 1740 gene locus_tag LOCUS_17160 1940 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530089.1 protein_id gnl|my_center|LOCUS_17160 2297 2497 gene locus_tag LOCUS_17170 2297 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2498 2758 gene locus_tag LOCUS_17180 2498 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_17180 2962 3333 gene locus_tag LOCUS_17190 2962 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 3342 3785 gene locus_tag LOCUS_17200 3342 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 4189 3989 gene locus_tag LOCUS_17210 4189 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530089.1 protein_id gnl|my_center|LOCUS_17210 8840 4698 gene locus_tag LOCUS_17220 8840 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 10225 8861 gene locus_tag LOCUS_17230 10225 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 11585 10677 gene locus_tag LOCUS_17240 11585 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 12861 11929 gene locus_tag LOCUS_17250 12861 11929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 14549 16675 gene locus_tag LOCUS_17260 14549 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 16781 16888 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acttggggagaccccaagacc 17214 17921 gene locus_tag LOCUS_17270 17214 17921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 protein_id gnl|my_center|LOCUS_17270 18055 17900 gene locus_tag LOCUS_17280 18055 17900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence0087 822 205 gene locus_tag LOCUS_17290 822 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1786 1181 gene locus_tag LOCUS_17300 1786 1181 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529397.1 protein_id gnl|my_center|LOCUS_17300 2584 1982 gene locus_tag LOCUS_17310 2584 1982 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 protein_id gnl|my_center|LOCUS_17310 2840 3421 gene locus_tag LOCUS_17320 2840 3421 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532391.1 protein_id gnl|my_center|LOCUS_17320 3786 5282 gene locus_tag LOCUS_17330 3786 5282 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548475.1 protein_id gnl|my_center|LOCUS_17330 7466 5493 gene locus_tag LOCUS_17340 gene cyaA 7466 5493 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947053.1 protein_id gnl|my_center|LOCUS_17340 9274 7763 gene locus_tag LOCUS_17350 9274 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 10235 9678 gene locus_tag LOCUS_17360 gene recR 10235 9678 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGV8 protein_id gnl|my_center|LOCUS_17360 11297 10641 gene locus_tag LOCUS_17370 gene nblB 11297 10641 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141257.1 protein_id gnl|my_center|LOCUS_17370 11383 11961 gene locus_tag LOCUS_17380 11383 11961 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141254.1 protein_id gnl|my_center|LOCUS_17380 12417 12905 gene locus_tag LOCUS_17390 12417 12905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141996.1 protein_id gnl|my_center|LOCUS_17390 13528 13058 gene locus_tag LOCUS_17400 13528 13058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 14238 16988 gene locus_tag LOCUS_17410 14238 16988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 17614 17162 gene locus_tag LOCUS_17420 17614 17162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 protein_id gnl|my_center|LOCUS_17420 18003 17740 gene locus_tag LOCUS_17430 18003 17740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence0088 489 761 gene locus_tag LOCUS_17440 489 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 761 1216 gene locus_tag LOCUS_17450 761 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 3744 1522 gene locus_tag LOCUS_17460 3744 1522 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229107.1 protein_id gnl|my_center|LOCUS_17460 4233 4045 gene locus_tag LOCUS_17470 4233 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 5221 4703 gene locus_tag LOCUS_17480 5221 4703 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056346.1 protein_id gnl|my_center|LOCUS_17480 6428 5406 gene locus_tag LOCUS_17490 6428 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141130.1 protein_id gnl|my_center|LOCUS_17490 7072 6572 gene locus_tag LOCUS_17500 7072 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057704.1 protein_id gnl|my_center|LOCUS_17500 7859 7386 gene locus_tag LOCUS_17510 7859 7386 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI8 protein_id gnl|my_center|LOCUS_17510 9207 8233 gene locus_tag LOCUS_17520 9207 8233 CDS product endonuclease/exonuclease/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532618.1 protein_id gnl|my_center|LOCUS_17520 9471 9635 gene locus_tag LOCUS_17530 9471 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 9598 10506 gene locus_tag LOCUS_17540 9598 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 10506 11399 gene locus_tag LOCUS_17550 10506 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 12463 11537 gene locus_tag LOCUS_17560 12463 11537 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459306.1 protein_id gnl|my_center|LOCUS_17560 12861 13115 gene locus_tag LOCUS_17570 12861 13115 CDS product sugar transporter SemiSWEET inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G85 protein_id gnl|my_center|LOCUS_17570 13181 14797 gene locus_tag LOCUS_17580 13181 14797 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 protein_id gnl|my_center|LOCUS_17580 15041 15469 gene locus_tag LOCUS_17590 15041 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 15716 15946 gene locus_tag LOCUS_17600 15716 15946 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143465.1 protein_id gnl|my_center|LOCUS_17600 17005 16088 gene locus_tag LOCUS_17610 17005 16088 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_17610 17550 17933 gene locus_tag LOCUS_17620 17550 17933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence0089 298 651 gene locus_tag LOCUS_17630 298 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 721 1287 gene locus_tag LOCUS_17640 721 1287 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 protein_id gnl|my_center|LOCUS_17640 1736 3367 gene locus_tag LOCUS_17650 1736 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635999.1 protein_id gnl|my_center|LOCUS_17650 3742 3563 gene locus_tag LOCUS_17660 3742 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4924 3923 gene locus_tag LOCUS_17670 4924 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 5263 6114 gene locus_tag LOCUS_17680 5263 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 6444 7589 gene locus_tag LOCUS_17690 6444 7589 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140060.1 protein_id gnl|my_center|LOCUS_17690 8147 8539 gene locus_tag LOCUS_17700 8147 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 9083 8895 gene locus_tag LOCUS_17710 9083 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 9799 9083 gene locus_tag LOCUS_17720 9799 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 10248 9820 gene locus_tag LOCUS_17730 10248 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 11690 10959 gene locus_tag LOCUS_17740 11690 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 12345 11914 gene locus_tag LOCUS_17750 12345 11914 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143722.1 protein_id gnl|my_center|LOCUS_17750 12648 13361 gene locus_tag LOCUS_17760 12648 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 13932 13618 gene locus_tag LOCUS_17770 13932 13618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 14281 13937 gene locus_tag LOCUS_17780 14281 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 14387 14617 gene locus_tag LOCUS_17790 14387 14617 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_17790 14970 15188 gene locus_tag LOCUS_17800 14970 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 15172 15501 gene locus_tag LOCUS_17810 15172 15501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 15806 16120 gene locus_tag LOCUS_17820 15806 16120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 16117 16290 gene locus_tag LOCUS_17830 16117 16290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 16966 16334 gene locus_tag LOCUS_17840 16966 16334 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875926.1 protein_id gnl|my_center|LOCUS_17840 17018 17707 gene locus_tag LOCUS_17850 gene tal 17018 17707 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66520 protein_id gnl|my_center|LOCUS_17850 >Feature sequence0090 724 83 gene locus_tag LOCUS_17860 724 83 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_17860 2520 715 gene locus_tag LOCUS_17870 2520 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2975 2538 gene locus_tag LOCUS_17880 2975 2538 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_17880 4053 3688 gene locus_tag LOCUS_17890 4053 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_17890 4533 4081 gene locus_tag LOCUS_17900 4533 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 5837 4674 gene locus_tag LOCUS_17910 5837 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 7087 5939 gene locus_tag LOCUS_17920 7087 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 7815 7159 gene locus_tag LOCUS_17930 7815 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 8404 7841 gene locus_tag LOCUS_17940 8404 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 8738 8526 gene locus_tag LOCUS_17950 8738 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 8976 9194 gene locus_tag LOCUS_17960 8976 9194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 9473 9895 gene locus_tag LOCUS_17970 9473 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_17970 9966 11168 gene locus_tag LOCUS_17980 9966 11168 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057854.1 protein_id gnl|my_center|LOCUS_17980 12275 11436 gene locus_tag LOCUS_17990 12275 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 14171 13359 gene locus_tag LOCUS_18000 14171 13359 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_18000 15886 14438 gene locus_tag LOCUS_18010 15886 14438 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141482.1 protein_id gnl|my_center|LOCUS_18010 16938 16618 gene locus_tag LOCUS_18020 16938 16618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 protein_id gnl|my_center|LOCUS_18020 17406 17071 gene locus_tag LOCUS_18030 17406 17071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057537.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence0091 1262 312 gene locus_tag LOCUS_18040 1262 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1753 2019 gene locus_tag LOCUS_18050 1753 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 2107 2721 gene locus_tag LOCUS_18060 2107 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2952 2725 gene locus_tag LOCUS_18070 2952 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 3906 3715 gene locus_tag LOCUS_18080 3906 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 3984 4487 gene locus_tag LOCUS_18090 3984 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4747 5667 gene locus_tag LOCUS_18100 4747 5667 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 protein_id gnl|my_center|LOCUS_18100 5916 6110 gene locus_tag LOCUS_18110 5916 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546452.1 protein_id gnl|my_center|LOCUS_18110 6944 6246 gene locus_tag LOCUS_18120 6944 6246 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056725.1 protein_id gnl|my_center|LOCUS_18120 7222 7962 gene locus_tag LOCUS_18130 7222 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 8287 9195 gene locus_tag LOCUS_18140 8287 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 9927 11078 gene locus_tag LOCUS_18150 gene jmjD5 9927 11078 CDS product aspartate beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207486.1 protein_id gnl|my_center|LOCUS_18150 11101 12048 gene locus_tag LOCUS_18160 11101 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 12582 14492 gene locus_tag LOCUS_18170 12582 14492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 16562 16209 gene locus_tag LOCUS_18180 16562 16209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 16741 16556 gene locus_tag LOCUS_18190 16741 16556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 16810 17235 gene locus_tag LOCUS_18200 16810 17235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 17808 17371 gene locus_tag LOCUS_18210 17808 17371 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056354.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence0092 670 281 gene locus_tag LOCUS_18220 670 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 4026 763 gene locus_tag LOCUS_18230 4026 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 4964 4455 gene locus_tag LOCUS_18240 4964 4455 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_18240 7378 5024 gene locus_tag LOCUS_18250 7378 5024 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_18250 10343 7977 gene locus_tag LOCUS_18260 10343 7977 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_18260 11287 10682 gene locus_tag LOCUS_18270 11287 10682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 12425 11397 gene locus_tag LOCUS_18280 12425 11397 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390730.1 protein_id gnl|my_center|LOCUS_18280 13980 12889 gene locus_tag LOCUS_18290 gene ambD 13980 12889 CDS product protein AmbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113096.1 protein_id gnl|my_center|LOCUS_18290 15809 14685 gene locus_tag LOCUS_18300 15809 14685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 17577 16261 gene locus_tag LOCUS_18310 gene opuE 17577 16261 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence0093 351 181 gene locus_tag LOCUS_18320 351 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1693 335 gene locus_tag LOCUS_18330 1693 335 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_18330 1874 2902 gene locus_tag LOCUS_18340 gene pyrC 1874 2902 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJJ9 protein_id gnl|my_center|LOCUS_18340 3332 3964 gene locus_tag LOCUS_18350 3332 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 4775 5005 gene locus_tag LOCUS_18360 4775 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 5050 6411 gene locus_tag LOCUS_18370 5050 6411 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_18370 6479 6865 gene locus_tag LOCUS_18380 6479 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18380 6888 7280 gene locus_tag LOCUS_18390 6888 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 7863 8534 gene locus_tag LOCUS_18400 7863 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 9251 9742 gene locus_tag LOCUS_18410 9251 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 10198 12393 gene locus_tag LOCUS_18420 10198 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331345.1 protein_id gnl|my_center|LOCUS_18420 13308 12589 gene locus_tag LOCUS_18430 13308 12589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 13789 15150 gene locus_tag LOCUS_18440 13789 15150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 15589 15260 gene locus_tag LOCUS_18450 15589 15260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 16086 16442 gene locus_tag LOCUS_18460 16086 16442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021920.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence0094 428 1912 gene locus_tag LOCUS_18470 gene gatB 428 1912 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC4 protein_id gnl|my_center|LOCUS_18470 2367 2295 gene locus_tag LOCUS_t00140 2367 2295 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3096 2710 gene locus_tag LOCUS_18480 3096 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 3500 6487 gene locus_tag LOCUS_18490 3500 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 6617 6895 gene locus_tag LOCUS_18500 6617 6895 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_18500 6914 7063 gene locus_tag LOCUS_18510 6914 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 9560 8187 gene locus_tag LOCUS_18520 9560 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 9708 9517 gene locus_tag LOCUS_18530 9708 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 10248 11771 gene locus_tag LOCUS_18540 10248 11771 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_18540 12475 12762 gene locus_tag LOCUS_18550 12475 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 13604 14071 gene locus_tag LOCUS_18560 gene ndk 13604 14071 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM56 protein_id gnl|my_center|LOCUS_18560 15030 14245 gene locus_tag LOCUS_18570 15030 14245 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 protein_id gnl|my_center|LOCUS_18570 15792 16265 gene locus_tag LOCUS_18580 15792 16265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 16915 16262 gene locus_tag LOCUS_18590 16915 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence0095 514 179 gene locus_tag LOCUS_18600 514 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 915 502 gene locus_tag LOCUS_18610 915 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2307 1678 gene locus_tag LOCUS_18620 2307 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3373 2318 gene locus_tag LOCUS_18630 3373 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 4567 3380 gene locus_tag LOCUS_18640 4567 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 5717 4677 gene locus_tag LOCUS_18650 5717 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 6905 5724 gene locus_tag LOCUS_18660 6905 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 12959 7257 gene locus_tag LOCUS_18670 12959 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 13600 15006 gene locus_tag LOCUS_18680 13600 15006 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_18680 15015 15614 gene locus_tag LOCUS_18690 15015 15614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 15833 16081 gene locus_tag LOCUS_18700 15833 16081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 16471 16259 gene locus_tag LOCUS_18710 16471 16259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 16655 16476 gene locus_tag LOCUS_18720 16655 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 16942 16655 gene locus_tag LOCUS_18730 16942 16655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 17277 17092 gene locus_tag LOCUS_18740 17277 17092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence0096 520 1905 gene locus_tag LOCUS_18750 520 1905 CDS product putative bicarbonate transporter, IctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058082.1 protein_id gnl|my_center|LOCUS_18750 2652 4565 gene locus_tag LOCUS_18760 2652 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 5740 5525 gene locus_tag LOCUS_18770 5740 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 6296 7741 gene locus_tag LOCUS_18780 6296 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_18780 8522 11959 gene locus_tag LOCUS_18790 8522 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 12328 14910 gene locus_tag LOCUS_18800 12328 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 15591 17348 gene locus_tag LOCUS_18810 15591 17348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence0097 2270 1470 gene locus_tag LOCUS_18820 2270 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 3330 2590 gene locus_tag LOCUS_18830 3330 2590 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_18830 4861 7014 gene locus_tag LOCUS_18840 4861 7014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 8307 7363 gene locus_tag LOCUS_18850 gene murK 8307 7363 CDS product N-acetylmuramic acid/N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ML3 protein_id gnl|my_center|LOCUS_18850 8999 11596 gene locus_tag LOCUS_18860 8999 11596 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_18860 13136 12345 gene locus_tag LOCUS_18870 gene tagA 13136 12345 CDS product acetyl-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 protein_id gnl|my_center|LOCUS_18870 13902 13642 gene locus_tag LOCUS_18880 13902 13642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 14840 15328 gene locus_tag LOCUS_18890 14840 15328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 17369 15987 gene locus_tag LOCUS_18900 gene psbC 17369 15987 CDS product photosystem II CP43 reaction center protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF8 protein_id gnl|my_center|LOCUS_18900 >Feature sequence0098 9132 10022 gene locus_tag LOCUS_18910 9132 10022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 10377 10634 gene locus_tag LOCUS_18920 10377 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 11310 12005 gene locus_tag LOCUS_18930 11310 12005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 12395 12147 gene locus_tag LOCUS_18940 12395 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 13056 12592 gene locus_tag LOCUS_18950 13056 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 13273 13058 gene locus_tag LOCUS_18960 13273 13058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 13675 13517 gene locus_tag LOCUS_18970 13675 13517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 13920 13663 gene locus_tag LOCUS_18980 13920 13663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 14555 15109 gene locus_tag LOCUS_18990 14555 15109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144066.1 protein_id gnl|my_center|LOCUS_18990 15394 15972 gene locus_tag LOCUS_19000 15394 15972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 17182 16106 gene locus_tag LOCUS_19010 gene trpD 17182 16106 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI76 protein_id gnl|my_center|LOCUS_19010 >Feature sequence0099 2282 576 gene locus_tag LOCUS_19020 2282 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 3219 4304 gene locus_tag LOCUS_19030 3219 4304 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_19030 4746 6257 gene locus_tag LOCUS_19040 gene glmM 4746 6257 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI20 protein_id gnl|my_center|LOCUS_19040 6678 8348 gene locus_tag LOCUS_19050 6678 8348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 8601 9593 gene locus_tag LOCUS_19060 8601 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 9868 11043 gene locus_tag LOCUS_19070 9868 11043 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_19070 11353 12525 gene locus_tag LOCUS_19080 11353 12525 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345307.1 protein_id gnl|my_center|LOCUS_19080 14037 15170 gene locus_tag LOCUS_19090 14037 15170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989410.1 protein_id gnl|my_center|LOCUS_19090 16472 15420 gene locus_tag LOCUS_19100 16472 15420 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057982.1 protein_id gnl|my_center|LOCUS_19100 16552 17496 gene locus_tag LOCUS_19110 16552 17496 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence0100 353 2515 gene locus_tag LOCUS_19120 353 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2674 3561 gene locus_tag LOCUS_19130 2674 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 3793 4791 gene locus_tag LOCUS_19140 3793 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 4939 5853 gene locus_tag LOCUS_19150 4939 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 5899 6804 gene locus_tag LOCUS_19160 5899 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 7456 7926 gene locus_tag LOCUS_19170 7456 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 8750 8496 gene locus_tag LOCUS_19180 8750 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19180 9091 8747 gene locus_tag LOCUS_19190 9091 8747 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402966.1 protein_id gnl|my_center|LOCUS_19190 9637 9302 gene locus_tag LOCUS_19200 9637 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 10041 9607 gene locus_tag LOCUS_19210 10041 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 12076 11447 gene locus_tag LOCUS_19220 12076 11447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 13075 12848 gene locus_tag LOCUS_19230 13075 12848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 14121 15242 gene locus_tag LOCUS_19240 14121 15242 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXY8 protein_id gnl|my_center|LOCUS_19240 >Feature sequence0101 1097 372 gene locus_tag LOCUS_19250 1097 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2787 1876 gene locus_tag LOCUS_19260 2787 1876 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_19260 4223 3276 gene locus_tag LOCUS_19270 gene ribF 4223 3276 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM6 protein_id gnl|my_center|LOCUS_19270 4210 4401 gene locus_tag LOCUS_19280 4210 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 5483 4695 gene locus_tag LOCUS_19290 5483 4695 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_19290 7126 7587 gene locus_tag LOCUS_19300 7126 7587 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 protein_id gnl|my_center|LOCUS_19300 7710 8747 gene locus_tag LOCUS_19310 gene cobD 7710 8747 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE1 protein_id gnl|my_center|LOCUS_19310 9165 9701 gene locus_tag LOCUS_19320 gene pyrR 9165 9701 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ7 protein_id gnl|my_center|LOCUS_19320 10014 11078 gene locus_tag LOCUS_19330 gene fni 10014 11078 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ26 protein_id gnl|my_center|LOCUS_19330 11225 13054 gene locus_tag LOCUS_19340 11225 13054 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_19340 13540 13917 gene locus_tag LOCUS_19350 13540 13917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 14248 14024 gene locus_tag LOCUS_19360 14248 14024 CDS product DUF4926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403415.1 protein_id gnl|my_center|LOCUS_19360 14403 14756 gene locus_tag LOCUS_19370 14403 14756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 14946 15113 gene locus_tag LOCUS_19380 14946 15113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19380 15336 15127 gene locus_tag LOCUS_19390 15336 15127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 15509 15678 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgcggtcttggggtctccccaagt 16533 15817 gene locus_tag LOCUS_19400 16533 15817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_19400 17036 17332 gene locus_tag LOCUS_19410 17036 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence0102 319 1188 gene locus_tag LOCUS_19420 319 1188 CDS product helix-turn-helix domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056458.1 protein_id gnl|my_center|LOCUS_19420 1433 2098 gene locus_tag LOCUS_19430 1433 2098 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 protein_id gnl|my_center|LOCUS_19430 2790 2374 gene locus_tag LOCUS_19440 2790 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 4205 3834 gene locus_tag LOCUS_19450 4205 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 5226 4858 gene locus_tag LOCUS_19460 5226 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 6234 5572 gene locus_tag LOCUS_19470 6234 5572 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_19470 6917 6528 gene locus_tag LOCUS_19480 6917 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 9374 7851 gene locus_tag LOCUS_19490 9374 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_19490 10396 9713 gene locus_tag LOCUS_19500 10396 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055926.1 protein_id gnl|my_center|LOCUS_19500 11249 12976 gene locus_tag LOCUS_19510 11249 12976 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 protein_id gnl|my_center|LOCUS_19510 13915 13544 gene locus_tag LOCUS_19520 13915 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 14415 14846 gene locus_tag LOCUS_19530 14415 14846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 protein_id gnl|my_center|LOCUS_19530 15994 16146 gene locus_tag LOCUS_19540 15994 16146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 16959 17306 gene locus_tag LOCUS_19550 16959 17306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence0103 555 1388 gene locus_tag LOCUS_19560 555 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 1935 1378 gene locus_tag LOCUS_19570 1935 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 4152 3154 gene locus_tag LOCUS_19580 4152 3154 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUG2 protein_id gnl|my_center|LOCUS_19580 4353 4862 gene locus_tag LOCUS_19590 4353 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 5772 5308 gene locus_tag LOCUS_19600 5772 5308 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140032.1 protein_id gnl|my_center|LOCUS_19600 6435 8054 gene locus_tag LOCUS_19610 6435 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056580.1 protein_id gnl|my_center|LOCUS_19610 8269 9393 gene locus_tag LOCUS_19620 8269 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 10842 9988 gene locus_tag LOCUS_19630 10842 9988 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS4 protein_id gnl|my_center|LOCUS_19630 11338 10928 gene locus_tag LOCUS_19640 11338 10928 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 protein_id gnl|my_center|LOCUS_19640 11517 12722 gene locus_tag LOCUS_19650 gene pgk 11517 12722 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDZ4 protein_id gnl|my_center|LOCUS_19650 13821 13135 gene locus_tag LOCUS_19660 13821 13135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 15634 13925 gene locus_tag LOCUS_19670 15634 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 16573 15914 gene locus_tag LOCUS_19680 16573 15914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence0104 2935 44 gene locus_tag LOCUS_19690 2935 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3604 2987 gene locus_tag LOCUS_19700 3604 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_19700 4141 5808 gene locus_tag LOCUS_19710 4141 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 6569 7144 gene locus_tag LOCUS_19720 6569 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 7306 7899 gene locus_tag LOCUS_19730 7306 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 8246 7983 gene locus_tag LOCUS_19740 8246 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 9568 8780 gene locus_tag LOCUS_19750 9568 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205364.1 protein_id gnl|my_center|LOCUS_19750 10206 12689 gene locus_tag LOCUS_19760 10206 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 13927 12971 gene locus_tag LOCUS_19770 13927 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 14549 15307 gene locus_tag LOCUS_19780 14549 15307 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_19780 16739 15474 gene locus_tag LOCUS_19790 16739 15474 CDS product sucrose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143828.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence0105 672 980 gene locus_tag LOCUS_19800 672 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 1076 1426 gene locus_tag LOCUS_19810 1076 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 1525 2040 gene locus_tag LOCUS_19820 1525 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057414.1 protein_id gnl|my_center|LOCUS_19820 2652 4556 gene locus_tag LOCUS_19830 2652 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 4747 4844 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cacaccctacaccctacac 5136 5588 gene locus_tag LOCUS_19840 gene rimP 5136 5588 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHL1 protein_id gnl|my_center|LOCUS_19840 5720 6964 gene locus_tag LOCUS_19850 gene nusA 5720 6964 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHL2 protein_id gnl|my_center|LOCUS_19850 7924 8373 gene locus_tag LOCUS_19860 7924 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 8459 11566 gene locus_tag LOCUS_19870 gene infB 8459 11566 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK04 protein_id gnl|my_center|LOCUS_19870 12624 12355 gene locus_tag LOCUS_19880 12624 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 12854 13777 gene locus_tag LOCUS_19890 gene murQ 12854 13777 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ1 protein_id gnl|my_center|LOCUS_19890 15662 14184 gene locus_tag LOCUS_19900 15662 14184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 16937 15867 gene locus_tag LOCUS_19910 gene aroF 16937 15867 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN07 protein_id gnl|my_center|LOCUS_19910 >Feature sequence0106 697 374 gene locus_tag LOCUS_19920 697 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057677.1 protein_id gnl|my_center|LOCUS_19920 1323 1057 gene locus_tag LOCUS_19930 1323 1057 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_19930 1574 1320 gene locus_tag LOCUS_19940 1574 1320 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XYW8 protein_id gnl|my_center|LOCUS_19940 2038 1898 gene locus_tag LOCUS_19950 2038 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2249 2028 gene locus_tag LOCUS_19960 2249 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2502 2765 gene locus_tag LOCUS_19970 2502 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 3079 2834 gene locus_tag LOCUS_19980 3079 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3413 3012 gene locus_tag LOCUS_19990 3413 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 4456 3512 gene locus_tag LOCUS_20000 gene ispE 4456 3512 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ1 protein_id gnl|my_center|LOCUS_20000 5310 4483 gene locus_tag LOCUS_20010 gene rsmA 5310 4483 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59157 protein_id gnl|my_center|LOCUS_20010 6232 5543 gene locus_tag LOCUS_20020 6232 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 6982 6467 gene locus_tag LOCUS_20030 6982 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 8259 7021 gene locus_tag LOCUS_20040 8259 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 10508 8559 gene locus_tag LOCUS_20050 10508 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 12004 10763 gene locus_tag LOCUS_20060 12004 10763 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_20060 13608 12307 gene locus_tag LOCUS_20070 13608 12307 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_20070 14519 15121 gene locus_tag LOCUS_20080 gene clpP1 14519 15121 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI2 protein_id gnl|my_center|LOCUS_20080 16624 15575 gene locus_tag LOCUS_20090 16624 15575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence0107 4429 1841 gene locus_tag LOCUS_20100 gene gyrA 4429 1841 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ59 protein_id gnl|my_center|LOCUS_20100 5117 6031 gene locus_tag LOCUS_20110 5117 6031 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 protein_id gnl|my_center|LOCUS_20110 7206 6058 gene locus_tag LOCUS_20120 7206 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_20120 8121 11003 gene locus_tag LOCUS_20130 8121 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 12104 11493 gene locus_tag LOCUS_20140 12104 11493 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC5 protein_id gnl|my_center|LOCUS_20140 12980 12438 gene locus_tag LOCUS_20150 gene psbP 12980 12438 CDS product photosystem II oxygen-evolving complex 23K protein PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 protein_id gnl|my_center|LOCUS_20150 14137 13493 gene locus_tag LOCUS_20160 14137 13493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 14844 16841 gene locus_tag LOCUS_20170 gene speA 14844 16841 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY6 protein_id gnl|my_center|LOCUS_20170 >Feature sequence0108 666 875 gene locus_tag LOCUS_20180 666 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1610 1071 gene locus_tag LOCUS_20190 1610 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2467 2682 gene locus_tag LOCUS_20200 2467 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3855 3076 gene locus_tag LOCUS_20210 3855 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 9275 4401 gene locus_tag LOCUS_20220 9275 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 10669 9413 gene locus_tag LOCUS_20230 10669 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 12513 10870 gene locus_tag LOCUS_20240 12513 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 13786 13307 gene locus_tag LOCUS_20250 13786 13307 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249869.1 protein_id gnl|my_center|LOCUS_20250 14141 13899 gene locus_tag LOCUS_20260 14141 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 15353 16846 gene locus_tag LOCUS_20270 15353 16846 CDS product lignostilbene alpha-beta-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055870.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence0109 310 1176 gene locus_tag LOCUS_20280 310 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1553 1783 gene locus_tag LOCUS_20290 1553 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2010 2432 gene locus_tag LOCUS_20300 2010 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 5508 2824 gene locus_tag LOCUS_20310 5508 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 6584 5505 gene locus_tag LOCUS_20320 6584 5505 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 protein_id gnl|my_center|LOCUS_20320 7970 6606 gene locus_tag LOCUS_20330 7970 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 8265 8047 gene locus_tag LOCUS_20340 8265 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 10756 8570 gene locus_tag LOCUS_20350 10756 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 11693 11439 gene locus_tag LOCUS_20360 11693 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 12127 11783 gene locus_tag LOCUS_20370 12127 11783 CDS product mRNA interferase PemK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214977.1 protein_id gnl|my_center|LOCUS_20370 12350 12120 gene locus_tag LOCUS_20380 12350 12120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 12869 16612 gene locus_tag LOCUS_20390 12869 16612 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022279.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence0110 203 1513 gene locus_tag LOCUS_20400 203 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1979 1818 gene locus_tag LOCUS_20410 1979 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 3449 3703 gene locus_tag LOCUS_20420 3449 3703 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_20420 4394 4182 gene locus_tag LOCUS_20430 4394 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 4624 4472 gene locus_tag LOCUS_20440 4624 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 5333 4920 gene locus_tag LOCUS_20450 5333 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 5988 6176 gene locus_tag LOCUS_20460 5988 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 8314 6641 gene locus_tag LOCUS_20470 8314 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 9921 8884 gene locus_tag LOCUS_20480 9921 8884 CDS product Appr-1-p processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_20480 10168 12054 gene locus_tag LOCUS_20490 10168 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 12574 15159 gene locus_tag LOCUS_20500 12574 15159 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205467.1 protein_id gnl|my_center|LOCUS_20500 15641 16213 gene locus_tag LOCUS_20510 15641 16213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143381.1 protein_id gnl|my_center|LOCUS_20510 16418 16654 gene locus_tag LOCUS_20520 16418 16654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence0111 1339 1539 gene locus_tag LOCUS_20530 1339 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 1532 1717 gene locus_tag LOCUS_20540 1532 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143955.1 protein_id gnl|my_center|LOCUS_20540 3641 1749 gene locus_tag LOCUS_20550 3641 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 5868 5410 gene locus_tag LOCUS_20560 5868 5410 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141571.1 protein_id gnl|my_center|LOCUS_20560 6965 6246 gene locus_tag LOCUS_20570 6965 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143841.1 protein_id gnl|my_center|LOCUS_20570 7031 7339 gene locus_tag LOCUS_20580 7031 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 10809 8887 gene locus_tag LOCUS_20590 10809 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 12191 11796 gene locus_tag LOCUS_20600 12191 11796 CDS product UPF0332 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X095 protein_id gnl|my_center|LOCUS_20600 12565 12188 gene locus_tag LOCUS_20610 12565 12188 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402966.1 protein_id gnl|my_center|LOCUS_20610 14816 12840 gene locus_tag LOCUS_20620 14816 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 15181 16521 gene locus_tag LOCUS_20630 gene folC 15181 16521 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056045.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence0112 855 541 gene locus_tag LOCUS_20640 855 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 854 991 gene locus_tag LOCUS_20650 854 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 5365 2255 gene locus_tag LOCUS_20660 5365 2255 CDS product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJM9 protein_id gnl|my_center|LOCUS_20660 6116 6427 gene locus_tag LOCUS_20670 6116 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 6593 6769 gene locus_tag LOCUS_20680 6593 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 7031 6756 gene locus_tag LOCUS_20690 7031 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 7760 7407 gene locus_tag LOCUS_20700 7760 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 8113 7775 gene locus_tag LOCUS_20710 8113 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 14756 8547 gene locus_tag LOCUS_20720 14756 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence0113 877 1194 gene locus_tag LOCUS_20730 877 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1294 2220 gene locus_tag LOCUS_20740 1294 2220 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057997.1 protein_id gnl|my_center|LOCUS_20740 2466 3053 gene locus_tag LOCUS_20750 2466 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 3207 3986 gene locus_tag LOCUS_20760 3207 3986 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_20760 4993 7308 gene locus_tag LOCUS_20770 4993 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_20770 9139 8666 gene locus_tag LOCUS_20780 9139 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 9438 11273 gene locus_tag LOCUS_20790 gene ycf45 9438 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 protein_id gnl|my_center|LOCUS_20790 11803 12039 gene locus_tag LOCUS_20800 11803 12039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_20800 12213 12389 gene locus_tag LOCUS_20810 12213 12389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 13454 13047 gene locus_tag LOCUS_20820 13454 13047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence0114 864 295 gene locus_tag LOCUS_20830 864 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2140 1016 gene locus_tag LOCUS_20840 2140 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 3969 2626 gene locus_tag LOCUS_20850 3969 2626 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071020.1 protein_id gnl|my_center|LOCUS_20850 6114 4171 gene locus_tag LOCUS_20860 6114 4171 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 protein_id gnl|my_center|LOCUS_20860 7347 8588 gene locus_tag LOCUS_20870 gene argJ 7347 8588 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN4 protein_id gnl|my_center|LOCUS_20870 8908 9150 gene locus_tag LOCUS_20880 8908 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 10407 9154 gene locus_tag LOCUS_20890 10407 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 11723 12487 gene locus_tag LOCUS_20900 gene rnc 11723 12487 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH89 protein_id gnl|my_center|LOCUS_20900 12836 13111 gene locus_tag LOCUS_20910 12836 13111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 13137 13976 gene locus_tag LOCUS_20920 13137 13976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 15098 14061 gene locus_tag LOCUS_20930 15098 14061 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_20930 16133 15504 gene locus_tag LOCUS_20940 16133 15504 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence0115 647 3166 gene locus_tag LOCUS_20950 647 3166 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU0 protein_id gnl|my_center|LOCUS_20950 3494 3631 gene locus_tag LOCUS_20960 3494 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 3759 3878 gene locus_tag LOCUS_20970 3759 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 4313 5362 gene locus_tag LOCUS_20980 4313 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 5658 6434 gene locus_tag LOCUS_20990 5658 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 6491 7177 gene locus_tag LOCUS_21000 6491 7177 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG61 protein_id gnl|my_center|LOCUS_21000 9001 7352 gene locus_tag LOCUS_21010 9001 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 10992 9184 gene locus_tag LOCUS_21020 10992 9184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 12001 11345 gene locus_tag LOCUS_21030 12001 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 14378 12435 gene locus_tag LOCUS_21040 14378 12435 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058113.1 protein_id gnl|my_center|LOCUS_21040 15675 14686 gene locus_tag LOCUS_21050 15675 14686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 15783 15932 gene locus_tag LOCUS_21060 15783 15932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence0116 920 2815 gene locus_tag LOCUS_21070 920 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 3920 3309 gene locus_tag LOCUS_21080 3920 3309 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_21080 4231 4734 gene locus_tag LOCUS_21090 4231 4734 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141270.1 protein_id gnl|my_center|LOCUS_21090 5045 6538 gene locus_tag LOCUS_21100 gene aldA 5045 6538 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_21100 6611 6979 gene locus_tag LOCUS_21110 6611 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701719.1 protein_id gnl|my_center|LOCUS_21110 7334 7600 gene locus_tag LOCUS_21120 7334 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 7623 8513 gene locus_tag LOCUS_21130 7623 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 8811 9557 gene locus_tag LOCUS_21140 gene dltE 8811 9557 CDS product putative oxidoreductase DltE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39577 protein_id gnl|my_center|LOCUS_21140 9596 10147 gene locus_tag LOCUS_21150 9596 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 10363 11040 gene locus_tag LOCUS_21160 10363 11040 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022855.1 protein_id gnl|my_center|LOCUS_21160 12579 12298 gene locus_tag LOCUS_21170 12579 12298 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532246.1 protein_id gnl|my_center|LOCUS_21170 12842 12576 gene locus_tag LOCUS_21180 12842 12576 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071642.1 protein_id gnl|my_center|LOCUS_21180 13019 13627 gene locus_tag LOCUS_21190 13019 13627 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 protein_id gnl|my_center|LOCUS_21190 15011 16252 gene locus_tag LOCUS_21200 15011 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence0117 720 1205 gene locus_tag LOCUS_21210 720 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1511 2230 gene locus_tag LOCUS_21220 1511 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 13058 2343 gene locus_tag LOCUS_21230 13058 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 13310 13534 gene locus_tag LOCUS_21240 13310 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21240 14643 15908 gene locus_tag LOCUS_21250 14643 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence0118 2653 551 gene locus_tag LOCUS_21260 2653 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 3449 6100 gene locus_tag LOCUS_21270 3449 6100 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144168.1 protein_id gnl|my_center|LOCUS_21270 6555 7895 gene locus_tag LOCUS_21280 gene lysA 6555 7895 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67262 protein_id gnl|my_center|LOCUS_21280 7899 8063 gene locus_tag LOCUS_21290 7899 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 8073 8477 gene locus_tag LOCUS_21300 8073 8477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21300 8505 9776 gene locus_tag LOCUS_21310 8505 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 9944 11023 gene locus_tag LOCUS_21320 9944 11023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 11050 11997 gene locus_tag LOCUS_21330 gene ceo 11050 11997 CDS product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZ59 protein_id gnl|my_center|LOCUS_21330 12045 12797 gene locus_tag LOCUS_21340 12045 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 12829 13785 gene locus_tag LOCUS_21350 12829 13785 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006668.1 protein_id gnl|my_center|LOCUS_21350 13807 14496 gene locus_tag LOCUS_21360 13807 14496 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_21360 14680 14519 gene locus_tag LOCUS_21370 14680 14519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 14818 15378 gene locus_tag LOCUS_21380 14818 15378 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_21380 15849 15625 gene locus_tag LOCUS_21390 15849 15625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence0119 1703 384 gene locus_tag LOCUS_21400 1703 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056607.1 protein_id gnl|my_center|LOCUS_21400 2302 1916 gene locus_tag LOCUS_21410 2302 1916 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958096.1 protein_id gnl|my_center|LOCUS_21410 2671 2438 gene locus_tag LOCUS_21420 2671 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 4312 3218 gene locus_tag LOCUS_21430 4312 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 6738 5449 gene locus_tag LOCUS_21440 6738 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 10054 7871 gene locus_tag LOCUS_21450 10054 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 11008 11949 gene locus_tag LOCUS_21460 11008 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 12942 12406 gene locus_tag LOCUS_21470 12942 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 16070 14121 gene locus_tag LOCUS_21480 gene cobJ 16070 14121 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057147.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence0120 1322 300 gene locus_tag LOCUS_21490 1322 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1407 1622 gene locus_tag LOCUS_21500 1407 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2159 3628 gene locus_tag LOCUS_21510 2159 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 4023 4616 gene locus_tag LOCUS_21520 4023 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 5181 10322 gene locus_tag LOCUS_21530 5181 10322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 10468 11532 gene locus_tag LOCUS_21540 gene proX 10468 11532 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418240.1 protein_id gnl|my_center|LOCUS_21540 13355 11829 gene locus_tag LOCUS_21550 13355 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 14203 13955 gene locus_tag LOCUS_21560 14203 13955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 14555 16204 gene locus_tag LOCUS_21570 14555 16204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence0121 1669 356 gene locus_tag LOCUS_21580 1669 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057293.1 protein_id gnl|my_center|LOCUS_21580 2336 1992 gene locus_tag LOCUS_21590 2336 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 2671 2435 gene locus_tag LOCUS_21600 2671 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 3747 2905 gene locus_tag LOCUS_21610 3747 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143111.1 protein_id gnl|my_center|LOCUS_21610 4000 4956 gene locus_tag LOCUS_21620 4000 4956 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_21620 5362 6408 gene locus_tag LOCUS_21630 5362 6408 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975419.1 protein_id gnl|my_center|LOCUS_21630 6905 8455 gene locus_tag LOCUS_21640 6905 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057727.1 protein_id gnl|my_center|LOCUS_21640 9105 9461 gene locus_tag LOCUS_21650 9105 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 protein_id gnl|my_center|LOCUS_21650 9569 10195 gene locus_tag LOCUS_21660 9569 10195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 11283 10423 gene locus_tag LOCUS_21670 11283 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 12431 11652 gene locus_tag LOCUS_21680 12431 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 12963 15545 gene locus_tag LOCUS_21690 12963 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 16110 15763 gene locus_tag LOCUS_21700 16110 15763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence0122 1487 303 gene locus_tag LOCUS_21710 1487 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2433 1765 gene locus_tag LOCUS_21720 2433 1765 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 protein_id gnl|my_center|LOCUS_21720 2892 4328 gene locus_tag LOCUS_21730 2892 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 4681 5337 gene locus_tag LOCUS_21740 4681 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 9365 5868 gene locus_tag LOCUS_21750 9365 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 10099 11391 gene locus_tag LOCUS_21760 10099 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143531.1 protein_id gnl|my_center|LOCUS_21760 11565 13841 gene locus_tag LOCUS_21770 11565 13841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 14335 15087 gene locus_tag LOCUS_21780 14335 15087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 <16164 15315 gene locus_tag LOCUS_21790 <16164 15315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NN18:UPF0061 protein >Feature sequence0123 2421 67 gene locus_tag LOCUS_21800 2421 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 3013 2816 gene locus_tag LOCUS_21810 3013 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 4287 3265 gene locus_tag LOCUS_21820 4287 3265 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK75 protein_id gnl|my_center|LOCUS_21820 4761 5765 gene locus_tag LOCUS_21830 4761 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 7227 6532 gene locus_tag LOCUS_21840 7227 6532 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404693.1 protein_id gnl|my_center|LOCUS_21840 10130 7545 gene locus_tag LOCUS_21850 10130 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 10672 10809 gene locus_tag LOCUS_21860 10672 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 10889 12343 gene locus_tag LOCUS_21870 gene ffh 10889 12343 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHI6 protein_id gnl|my_center|LOCUS_21870 12537 12827 gene locus_tag LOCUS_21880 12537 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 12834 13229 gene locus_tag LOCUS_21890 12834 13229 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055894.1 protein_id gnl|my_center|LOCUS_21890 13560 14513 gene locus_tag LOCUS_21900 13560 14513 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 protein_id gnl|my_center|LOCUS_21900 14999 14682 gene locus_tag LOCUS_21910 14999 14682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 15307 15014 gene locus_tag LOCUS_21920 15307 15014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_21920 15620 15955 gene locus_tag LOCUS_21930 15620 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence0124 1840 80 gene locus_tag LOCUS_21940 1840 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 3311 2445 gene locus_tag LOCUS_21950 3311 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 3561 6119 gene locus_tag LOCUS_21960 3561 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 7210 7962 gene locus_tag LOCUS_21970 7210 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 7959 10973 gene locus_tag LOCUS_21980 7959 10973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 11163 13388 gene locus_tag LOCUS_21990 11163 13388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 13785 14138 gene locus_tag LOCUS_22000 13785 14138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 14953 14192 gene locus_tag LOCUS_22010 14953 14192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22010 >Feature sequence0125 2777 1860 gene locus_tag LOCUS_22020 2777 1860 CDS product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_22020 4777 3335 gene locus_tag LOCUS_22030 4777 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 6006 5002 gene locus_tag LOCUS_22040 6006 5002 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 protein_id gnl|my_center|LOCUS_22040 6482 7084 gene locus_tag LOCUS_22050 6482 7084 CDS product IS607 family transposase ISTko1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_22050 7627 8442 gene locus_tag LOCUS_22060 7627 8442 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 protein_id gnl|my_center|LOCUS_22060 8728 9111 gene locus_tag LOCUS_22070 gene aroH 8728 9111 CDS product chorismate mutase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHZ0 protein_id gnl|my_center|LOCUS_22070 9354 10493 gene locus_tag LOCUS_22080 gene hemE 9354 10493 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBL3 protein_id gnl|my_center|LOCUS_22080 10775 11968 gene locus_tag LOCUS_22090 10775 11968 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 protein_id gnl|my_center|LOCUS_22090 12049 12933 gene locus_tag LOCUS_22100 12049 12933 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257980.1 protein_id gnl|my_center|LOCUS_22100 13037 13345 gene locus_tag LOCUS_22110 13037 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 13516 13770 gene locus_tag LOCUS_22120 13516 13770 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVR9 protein_id gnl|my_center|LOCUS_22120 14722 15828 gene locus_tag LOCUS_22130 gene aroB 14722 15828 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS3 protein_id gnl|my_center|LOCUS_22130 >Feature sequence0126 848 2734 gene locus_tag LOCUS_22140 gene ftsH 848 2734 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW7 protein_id gnl|my_center|LOCUS_22140 3424 3218 gene locus_tag LOCUS_22150 3424 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 3866 3603 gene locus_tag LOCUS_22160 3866 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 4689 4174 gene locus_tag LOCUS_22170 4689 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 5015 4743 gene locus_tag LOCUS_22180 5015 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 5296 5063 gene locus_tag LOCUS_22190 5296 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 6268 5408 gene locus_tag LOCUS_22200 6268 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 6629 6420 gene locus_tag LOCUS_22210 6629 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 7237 6629 gene locus_tag LOCUS_22220 7237 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 7719 7234 gene locus_tag LOCUS_22230 7719 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 8444 7881 gene locus_tag LOCUS_22240 8444 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_22240 11676 8548 gene locus_tag LOCUS_22250 11676 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 12110 11880 gene locus_tag LOCUS_22260 12110 11880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 12868 12284 gene locus_tag LOCUS_22270 12868 12284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 13846 14589 gene locus_tag LOCUS_22280 13846 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 15034 15405 gene locus_tag LOCUS_22290 15034 15405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence0127 2173 407 gene locus_tag LOCUS_22300 gene rnj 2173 407 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK3 protein_id gnl|my_center|LOCUS_22300 3714 2815 gene locus_tag LOCUS_22310 gene dapA 3714 2815 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK4 protein_id gnl|my_center|LOCUS_22310 4056 4280 gene locus_tag LOCUS_22320 4056 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 5320 4277 gene locus_tag LOCUS_22330 gene asd 5320 4277 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP2 protein_id gnl|my_center|LOCUS_22330 6352 6525 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cccgaaggaatttagcggttggtaggg 6793 8220 gene locus_tag LOCUS_22340 gene tig 6793 8220 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDP0 protein_id gnl|my_center|LOCUS_22340 8889 9452 gene locus_tag LOCUS_22350 gene clpP1 8889 9452 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI2 protein_id gnl|my_center|LOCUS_22350 9559 10899 gene locus_tag LOCUS_22360 gene clpX 9559 10899 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDN9 protein_id gnl|my_center|LOCUS_22360 11007 11891 gene locus_tag LOCUS_22370 11007 11891 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_22370 13073 12099 gene locus_tag LOCUS_22380 13073 12099 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_22380 13395 14714 gene locus_tag LOCUS_22390 gene purB 13395 14714 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW4 protein_id gnl|my_center|LOCUS_22390 15565 14999 gene locus_tag LOCUS_22400 gene terD 15565 14999 CDS product stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439494.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence0128 932 336 gene locus_tag LOCUS_22410 932 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056251.1 protein_id gnl|my_center|LOCUS_22410 1423 1350 gene locus_tag LOCUS_t00150 1423 1350 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1680 2042 gene locus_tag LOCUS_22420 1680 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2064 3635 gene locus_tag LOCUS_22430 2064 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 4043 5476 gene locus_tag LOCUS_22440 4043 5476 CDS product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056712.1 protein_id gnl|my_center|LOCUS_22440 6463 5600 gene locus_tag LOCUS_22450 6463 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 7737 6457 gene locus_tag LOCUS_22460 7737 6457 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141151.1 protein_id gnl|my_center|LOCUS_22460 7921 8823 gene locus_tag LOCUS_22470 gene trpC 7921 8823 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL01 protein_id gnl|my_center|LOCUS_22470 9101 9367 gene locus_tag LOCUS_22480 9101 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142550.1 protein_id gnl|my_center|LOCUS_22480 9485 10636 gene locus_tag LOCUS_22490 9485 10636 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057305.1 protein_id gnl|my_center|LOCUS_22490 11155 10940 gene locus_tag LOCUS_22500 11155 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058211.1 protein_id gnl|my_center|LOCUS_22500 12585 13544 gene locus_tag LOCUS_22510 12585 13544 CDS product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057563.1 protein_id gnl|my_center|LOCUS_22510 13834 15243 gene locus_tag LOCUS_22520 13834 15243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence0129 390 770 gene locus_tag LOCUS_22530 gene trxM2 390 770 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH72 protein_id gnl|my_center|LOCUS_22530 1154 3154 gene locus_tag LOCUS_22540 gene ndhF1 1154 3154 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056567.1 protein_id gnl|my_center|LOCUS_22540 3263 4837 gene locus_tag LOCUS_22550 gene ndhD1 3263 4837 CDS product NAD(P)H-quinone oxidoreductase chain 4 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY0 protein_id gnl|my_center|LOCUS_22550 5808 7310 gene locus_tag LOCUS_22560 5808 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 8187 7486 gene locus_tag LOCUS_22570 8187 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 9636 9860 gene locus_tag LOCUS_22580 gene ftrV 9636 9860 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057357.1 protein_id gnl|my_center|LOCUS_22580 10206 9982 gene locus_tag LOCUS_22590 10206 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 11406 10648 gene locus_tag LOCUS_22600 11406 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 12821 11655 gene locus_tag LOCUS_22610 12821 11655 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 protein_id gnl|my_center|LOCUS_22610 13581 12868 gene locus_tag LOCUS_22620 13581 12868 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMH9 protein_id gnl|my_center|LOCUS_22620 14521 13955 gene locus_tag LOCUS_22630 gene ycf4 14521 13955 CDS product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ41 protein_id gnl|my_center|LOCUS_22630 >Feature sequence0130 422 862 gene locus_tag LOCUS_22640 422 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 1701 1072 gene locus_tag LOCUS_22650 1701 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105321.1 protein_id gnl|my_center|LOCUS_22650 2963 1698 gene locus_tag LOCUS_22660 2963 1698 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_22660 3112 3615 gene locus_tag LOCUS_22670 3112 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 4000 6132 gene locus_tag LOCUS_22680 gene ligA 4000 6132 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK2 protein_id gnl|my_center|LOCUS_22680 6733 9639 gene locus_tag LOCUS_22690 6733 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 9976 11748 gene locus_tag LOCUS_22700 9976 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 13035 11968 gene locus_tag LOCUS_22710 13035 11968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 13199 13313 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtcttggggtctccccaagtaga 13807 15738 gene locus_tag LOCUS_22720 gene dnaK2 13807 15738 CDS product chaperone protein dnaK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI58 protein_id gnl|my_center|LOCUS_22720 >Feature sequence0131 977 132 gene locus_tag LOCUS_22730 977 132 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_22730 1873 983 gene locus_tag LOCUS_22740 1873 983 CDS product phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258724.1 protein_id gnl|my_center|LOCUS_22740 2684 2217 gene locus_tag LOCUS_22750 2684 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 4425 2890 gene locus_tag LOCUS_22760 gene trpE 4425 2890 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057509.1 protein_id gnl|my_center|LOCUS_22760 5000 4572 gene locus_tag LOCUS_22770 gene psaD 5000 4572 CDS product photosystem I protein PsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125882.1 protein_id gnl|my_center|LOCUS_22770 5367 5176 gene locus_tag LOCUS_22780 5367 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 7721 5676 gene locus_tag LOCUS_22790 gene sir 7721 5676 CDS product sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056194.1 protein_id gnl|my_center|LOCUS_22790 8103 9062 gene locus_tag LOCUS_22800 8103 9062 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143278.1 protein_id gnl|my_center|LOCUS_22800 9365 10183 gene locus_tag LOCUS_22810 9365 10183 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_22810 11154 12797 gene locus_tag LOCUS_22820 11154 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 13702 13037 gene locus_tag LOCUS_22830 13702 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 14952 15827 gene locus_tag LOCUS_22840 14952 15827 CDS product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence0132 1421 57 gene locus_tag LOCUS_22850 1421 57 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_22850 2542 1772 gene locus_tag LOCUS_22860 2542 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2983 3192 gene locus_tag LOCUS_22870 2983 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 4016 4231 gene locus_tag LOCUS_22880 4016 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 5838 4228 gene locus_tag LOCUS_22890 5838 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 7524 6157 gene locus_tag LOCUS_22900 7524 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 8050 9429 gene locus_tag LOCUS_22910 8050 9429 CDS product carotenoid cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 protein_id gnl|my_center|LOCUS_22910 10624 9956 gene locus_tag LOCUS_22920 10624 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 10966 10625 gene locus_tag LOCUS_22930 10966 10625 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123225.1 protein_id gnl|my_center|LOCUS_22930 11280 11642 gene locus_tag LOCUS_22940 11280 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 11703 12392 gene locus_tag LOCUS_22950 11703 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 12575 12874 gene locus_tag LOCUS_22960 12575 12874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 13180 14169 gene locus_tag LOCUS_22970 13180 14169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 14517 15614 gene locus_tag LOCUS_22980 14517 15614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence0133 1859 1143 gene locus_tag LOCUS_22990 1859 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 2371 2514 gene locus_tag LOCUS_23000 gene hli4 2371 2514 CDS product high light inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 protein_id gnl|my_center|LOCUS_23000 2647 2790 gene locus_tag LOCUS_23010 gene hli4 2647 2790 CDS product high light inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 protein_id gnl|my_center|LOCUS_23010 3017 3340 gene locus_tag LOCUS_23020 3017 3340 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_23020 3615 3791 gene locus_tag LOCUS_23030 3615 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 3848 4918 gene locus_tag LOCUS_23040 3848 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056519.1 protein_id gnl|my_center|LOCUS_23040 5012 5611 gene locus_tag LOCUS_23050 5012 5611 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056337.1 protein_id gnl|my_center|LOCUS_23050 6403 5795 gene locus_tag LOCUS_23060 gene purN 6403 5795 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ1 protein_id gnl|my_center|LOCUS_23060 6971 7150 gene locus_tag LOCUS_23070 6971 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 7215 7793 gene locus_tag LOCUS_23080 7215 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_23080 8698 9969 gene locus_tag LOCUS_23090 8698 9969 CDS product serpin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022227.1 protein_id gnl|my_center|LOCUS_23090 10188 12401 gene locus_tag LOCUS_23100 10188 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 13960 14670 gene locus_tag LOCUS_23110 13960 14670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 14783 15448 gene locus_tag LOCUS_23120 14783 15448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence0134 672 472 gene locus_tag LOCUS_23130 672 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 1166 2701 gene locus_tag LOCUS_23140 1166 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2706 3557 gene locus_tag LOCUS_23150 2706 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 3623 4870 gene locus_tag LOCUS_23160 3623 4870 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142460.1 protein_id gnl|my_center|LOCUS_23160 4929 5852 gene locus_tag LOCUS_23170 4929 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 6045 7325 gene locus_tag LOCUS_23180 6045 7325 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_23180 7435 8418 gene locus_tag LOCUS_23190 7435 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 8553 9812 gene locus_tag LOCUS_23200 gene hfsI 8553 9812 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918387.1 protein_id gnl|my_center|LOCUS_23200 10137 10982 gene locus_tag LOCUS_23210 10137 10982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_23210 11670 11452 gene locus_tag LOCUS_23220 11670 11452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 11801 13351 gene locus_tag LOCUS_23230 11801 13351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 13808 13470 gene locus_tag LOCUS_23240 13808 13470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 14559 14263 gene locus_tag LOCUS_23250 14559 14263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 15053 14793 gene locus_tag LOCUS_23260 15053 14793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23260 >Feature sequence0135 284 877 gene locus_tag LOCUS_23270 gene leuD 284 877 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_23270 1663 1941 gene locus_tag LOCUS_23280 1663 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 1928 2377 gene locus_tag LOCUS_23290 1928 2377 CDS product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_23290 5091 2923 gene locus_tag LOCUS_23300 5091 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 5415 5609 gene locus_tag LOCUS_23310 5415 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 7496 6909 gene locus_tag LOCUS_23320 7496 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 7802 7981 gene locus_tag LOCUS_23330 7802 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 9660 8398 gene locus_tag LOCUS_23340 gene nifS 9660 8398 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH91 protein_id gnl|my_center|LOCUS_23340 11222 9873 gene locus_tag LOCUS_23350 11222 9873 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 protein_id gnl|my_center|LOCUS_23350 12010 11222 gene locus_tag LOCUS_23360 12010 11222 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_23360 13695 12256 gene locus_tag LOCUS_23370 gene ycf24 13695 12256 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_23370 14196 13834 gene locus_tag LOCUS_23380 gene ftrC 14196 13834 CDS product ferredoxin-thioredoxin reductase, catalytic chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK3 protein_id gnl|my_center|LOCUS_23380 14502 15152 gene locus_tag LOCUS_23390 14502 15152 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056342.1 protein_id gnl|my_center|LOCUS_23390 15228 15485 gene locus_tag LOCUS_23400 15228 15485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence0136 1741 1406 gene locus_tag LOCUS_23410 1741 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 1969 9018 gene locus_tag LOCUS_23420 1969 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence0137 766 311 gene locus_tag LOCUS_23430 766 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143940.1 protein_id gnl|my_center|LOCUS_23430 1796 867 gene locus_tag LOCUS_23440 1796 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 2943 2401 gene locus_tag LOCUS_23450 2943 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 3968 3789 gene locus_tag LOCUS_23460 3968 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 6144 3949 gene locus_tag LOCUS_23470 6144 3949 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687775.1 protein_id gnl|my_center|LOCUS_23470 6616 6125 gene locus_tag LOCUS_23480 6616 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 7389 7036 gene locus_tag LOCUS_23490 7389 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 7961 7386 gene locus_tag LOCUS_23500 gene sigH 7961 7386 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056172.1 protein_id gnl|my_center|LOCUS_23500 8565 9437 gene locus_tag LOCUS_23510 8565 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 protein_id gnl|my_center|LOCUS_23510 10277 9789 gene locus_tag LOCUS_23520 10277 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 10483 14346 gene locus_tag LOCUS_23530 10483 14346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 14769 15257 gene locus_tag LOCUS_23540 14769 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence0138 1096 779 gene locus_tag LOCUS_23550 gene rpsJ 1096 779 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA06 protein_id gnl|my_center|LOCUS_23550 2467 1238 gene locus_tag LOCUS_23560 gene tufA 2467 1238 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50064 protein_id gnl|my_center|LOCUS_23560 4570 2495 gene locus_tag LOCUS_23570 gene fusA 4570 2495 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI43 protein_id gnl|my_center|LOCUS_23570 5505 5035 gene locus_tag LOCUS_23580 gene rpsG 5505 5035 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI44 protein_id gnl|my_center|LOCUS_23580 6172 5801 gene locus_tag LOCUS_23590 gene rpsL 6172 5801 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59168 protein_id gnl|my_center|LOCUS_23590 6688 6353 gene locus_tag LOCUS_23600 gene ycf57 6688 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142103.1 protein_id gnl|my_center|LOCUS_23600 7831 7415 gene locus_tag LOCUS_23610 7831 7415 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142135.1 protein_id gnl|my_center|LOCUS_23610 9013 13515 gene locus_tag LOCUS_23620 gene gltB 9013 13515 CDS product glutamate synthase, large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_661305.1 protein_id gnl|my_center|LOCUS_23620 13832 14449 gene locus_tag LOCUS_23630 13832 14449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 14656 15039 gene locus_tag LOCUS_23640 14656 15039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 15340 15167 gene locus_tag LOCUS_23650 15340 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence0139 253 708 gene locus_tag LOCUS_23660 253 708 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_23660 2379 1375 gene locus_tag LOCUS_23670 2379 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 3676 3005 gene locus_tag LOCUS_23680 3676 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 4247 3780 gene locus_tag LOCUS_23690 4247 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056063.1 protein_id gnl|my_center|LOCUS_23690 5642 4710 gene locus_tag LOCUS_23700 5642 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056124.1 protein_id gnl|my_center|LOCUS_23700 7316 6066 gene locus_tag LOCUS_23710 gene ctpA 7316 6066 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 protein_id gnl|my_center|LOCUS_23710 7543 8211 gene locus_tag LOCUS_23720 gene petB 7543 8211 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8M7 protein_id gnl|my_center|LOCUS_23720 8313 8795 gene locus_tag LOCUS_23730 gene petD 8313 8795 CDS product cytochrome b6-f complex subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N3 protein_id gnl|my_center|LOCUS_23730 9252 10403 gene locus_tag LOCUS_23740 9252 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 10438 10827 gene locus_tag LOCUS_23750 10438 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057511.1 protein_id gnl|my_center|LOCUS_23750 11450 11019 gene locus_tag LOCUS_23760 11450 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 12010 12618 gene locus_tag LOCUS_23770 gene tpx 12010 12618 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 protein_id gnl|my_center|LOCUS_23770 12673 13278 gene locus_tag LOCUS_23780 12673 13278 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057129.1 protein_id gnl|my_center|LOCUS_23780 14679 13663 gene locus_tag LOCUS_23790 gene dnaJ 14679 13663 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence0140 538 1740 gene locus_tag LOCUS_23800 gene argG 538 1740 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY7 protein_id gnl|my_center|LOCUS_23800 2573 1944 gene locus_tag LOCUS_23810 2573 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2692 2871 gene locus_tag LOCUS_23820 2692 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 4447 3161 gene locus_tag LOCUS_23830 4447 3161 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056420.1 protein_id gnl|my_center|LOCUS_23830 7438 5315 gene locus_tag LOCUS_23840 7438 5315 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056777.1 protein_id gnl|my_center|LOCUS_23840 8380 9579 gene locus_tag LOCUS_23850 8380 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 9833 10327 gene locus_tag LOCUS_23860 9833 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_23860 10612 11850 gene locus_tag LOCUS_23870 10612 11850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144202.1 protein_id gnl|my_center|LOCUS_23870 12415 11993 gene locus_tag LOCUS_23880 12415 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 15137 14112 gene locus_tag LOCUS_23890 15137 14112 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence0141 241 1023 gene locus_tag LOCUS_23900 241 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 3720 2302 gene locus_tag LOCUS_23910 3720 2302 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 protein_id gnl|my_center|LOCUS_23910 4593 4973 gene locus_tag LOCUS_23920 4593 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057860.1 protein_id gnl|my_center|LOCUS_23920 5914 7032 gene locus_tag LOCUS_23930 5914 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057861.1 protein_id gnl|my_center|LOCUS_23930 8389 7352 gene locus_tag LOCUS_23940 8389 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057198.1 protein_id gnl|my_center|LOCUS_23940 9568 8633 gene locus_tag LOCUS_23950 gene ntcB 9568 8633 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057199.1 protein_id gnl|my_center|LOCUS_23950 11590 9914 gene locus_tag LOCUS_23960 11590 9914 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_23960 13901 12258 gene locus_tag LOCUS_23970 13901 12258 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_23970 14513 14298 gene locus_tag LOCUS_23980 14513 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence0142 1374 43 gene locus_tag LOCUS_23990 1374 43 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919616.1 protein_id gnl|my_center|LOCUS_23990 2564 1911 gene locus_tag LOCUS_24000 2564 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 4206 2956 gene locus_tag LOCUS_24010 4206 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 5301 4321 gene locus_tag LOCUS_24020 gene ctaB 5301 4321 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHQ2 protein_id gnl|my_center|LOCUS_24020 6305 5487 gene locus_tag LOCUS_24030 6305 5487 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 protein_id gnl|my_center|LOCUS_24030 6973 8037 gene locus_tag LOCUS_24040 gene ctaC 6973 8037 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE8 protein_id gnl|my_center|LOCUS_24040 8230 9906 gene locus_tag LOCUS_24050 gene ctaD 8230 9906 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIM0 protein_id gnl|my_center|LOCUS_24050 10197 10817 gene locus_tag LOCUS_24060 gene ctaE 10197 10817 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_24060 11366 11617 gene locus_tag LOCUS_24070 11366 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 11637 12038 gene locus_tag LOCUS_24080 11637 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 12557 12231 gene locus_tag LOCUS_24090 12557 12231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 12807 12550 gene locus_tag LOCUS_24100 gene parD-4 12807 12550 CDS product antitoxin protein parD-4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265886.1 protein_id gnl|my_center|LOCUS_24100 13292 12906 gene locus_tag LOCUS_24110 13292 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 13700 13476 gene locus_tag LOCUS_24120 13700 13476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24120 14064 13768 gene locus_tag LOCUS_24130 14064 13768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 14960 14625 gene locus_tag LOCUS_24140 14960 14625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141134.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence0143 327 2054 gene locus_tag LOCUS_24150 327 2054 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_24150 2946 3413 gene locus_tag LOCUS_24160 2946 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 3417 4877 gene locus_tag LOCUS_24170 3417 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 5143 6357 gene locus_tag LOCUS_24180 5143 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 6707 7657 gene locus_tag LOCUS_24190 6707 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 8165 10972 gene locus_tag LOCUS_24200 gene secA 8165 10972 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHU4 protein_id gnl|my_center|LOCUS_24200 11334 12308 gene locus_tag LOCUS_24210 11334 12308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 12437 13171 gene locus_tag LOCUS_24220 12437 13171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 13183 13680 gene locus_tag LOCUS_24230 13183 13680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 13928 15073 gene locus_tag LOCUS_24240 gene pyrD 13928 15073 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB7 protein_id gnl|my_center|LOCUS_24240 >Feature sequence0144 826 2424 gene locus_tag LOCUS_24250 826 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 2935 7320 gene locus_tag LOCUS_24260 2935 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 7596 8180 gene locus_tag LOCUS_24270 7596 8180 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL51 protein_id gnl|my_center|LOCUS_24270 8584 10854 gene locus_tag LOCUS_24280 8584 10854 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256758.1 protein_id gnl|my_center|LOCUS_24280 11956 11207 gene locus_tag LOCUS_24290 11956 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142983.1 protein_id gnl|my_center|LOCUS_24290 12924 12046 gene locus_tag LOCUS_24300 12924 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142983.1 protein_id gnl|my_center|LOCUS_24300 13349 13978 gene locus_tag LOCUS_24310 13349 13978 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056907.1 protein_id gnl|my_center|LOCUS_24310 14720 14043 gene locus_tag LOCUS_24320 14720 14043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056056.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence0145 277 349 gene locus_tag LOCUS_t00160 277 349 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2321 744 gene locus_tag LOCUS_24330 gene kaiC 2321 744 CDS product circadian clock protein kinase KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V60 protein_id gnl|my_center|LOCUS_24330 2717 2403 gene locus_tag LOCUS_24340 gene kaiB 2717 2403 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V61 protein_id gnl|my_center|LOCUS_24340 3655 2804 gene locus_tag LOCUS_24350 gene kaiA 3655 2804 CDS product circadian clock protein KaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V62 protein_id gnl|my_center|LOCUS_24350 4302 7685 gene locus_tag LOCUS_24360 4302 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 7873 8532 gene locus_tag LOCUS_24370 7873 8532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141492.1 protein_id gnl|my_center|LOCUS_24370 8895 9644 gene locus_tag LOCUS_24380 8895 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141492.1 protein_id gnl|my_center|LOCUS_24380 10544 9834 gene locus_tag LOCUS_24390 gene rpe 10544 9834 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE8 protein_id gnl|my_center|LOCUS_24390 10646 12307 gene locus_tag LOCUS_24400 10646 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 12304 12852 gene locus_tag LOCUS_24410 12304 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 13447 14751 gene locus_tag LOCUS_24420 13447 14751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058187.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence0146 3781 497 gene locus_tag LOCUS_24430 3781 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 5360 4899 gene locus_tag LOCUS_24440 5360 4899 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706386.1 protein_id gnl|my_center|LOCUS_24440 5633 6514 gene locus_tag LOCUS_24450 5633 6514 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y840 protein_id gnl|my_center|LOCUS_24450 7848 6904 gene locus_tag LOCUS_24460 7848 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 8176 9429 gene locus_tag LOCUS_24470 8176 9429 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH31 protein_id gnl|my_center|LOCUS_24470 9693 9830 gene locus_tag LOCUS_24480 9693 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 9836 10309 gene locus_tag LOCUS_24490 gene aroQ 9836 10309 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ7 protein_id gnl|my_center|LOCUS_24490 11762 10938 gene locus_tag LOCUS_24500 gene mtnP 11762 10938 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE4 protein_id gnl|my_center|LOCUS_24500 13034 13990 gene locus_tag LOCUS_24510 13034 13990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 14334 14534 gene locus_tag LOCUS_24520 14334 14534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence0147 1755 154 gene locus_tag LOCUS_24530 1755 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2767 2576 gene locus_tag LOCUS_24540 2767 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2964 2743 gene locus_tag LOCUS_24550 2964 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24550 3245 2961 gene locus_tag LOCUS_24560 3245 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 3754 6894 gene locus_tag LOCUS_24570 3754 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 7203 8420 gene locus_tag LOCUS_24580 7203 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 8420 9325 gene locus_tag LOCUS_24590 8420 9325 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_24590 9892 10419 gene locus_tag LOCUS_24600 9892 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 10424 12262 gene locus_tag LOCUS_24610 10424 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 12658 12362 gene locus_tag LOCUS_24620 12658 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 12876 14804 gene locus_tag LOCUS_24630 12876 14804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence0148 1429 383 gene locus_tag LOCUS_24640 1429 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 1837 2073 gene locus_tag LOCUS_24650 1837 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 2252 2392 gene locus_tag LOCUS_24660 2252 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2509 2874 gene locus_tag LOCUS_24670 2509 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 3893 3051 gene locus_tag LOCUS_24680 3893 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 6727 4022 gene locus_tag LOCUS_24690 6727 4022 CDS product CRISPR-associated helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229077.1 protein_id gnl|my_center|LOCUS_24690 7544 6732 gene locus_tag LOCUS_24700 7544 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 8420 7548 gene locus_tag LOCUS_24710 8420 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229079.1 protein_id gnl|my_center|LOCUS_24710 10978 8423 gene locus_tag LOCUS_24720 10978 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229080.1 protein_id gnl|my_center|LOCUS_24720 11187 10975 gene locus_tag LOCUS_24730 11187 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_24730 11451 11251 gene locus_tag LOCUS_24740 11451 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 11550 12416 gene locus_tag LOCUS_24750 11550 12416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 12882 12646 gene locus_tag LOCUS_24760 12882 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 14850 13114 gene locus_tag LOCUS_24770 14850 13114 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085637.1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence0149 85 4923 gene locus_tag LOCUS_24780 85 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 5002 5412 gene locus_tag LOCUS_24790 5002 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 5447 5794 gene locus_tag LOCUS_24800 5447 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 5971 9990 gene locus_tag LOCUS_24810 5971 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence0150 654 1001 gene locus_tag LOCUS_24820 654 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 988 1176 gene locus_tag LOCUS_24830 988 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 1173 1325 gene locus_tag LOCUS_24840 1173 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24840 1862 1458 gene locus_tag LOCUS_24850 1862 1458 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140846.1 protein_id gnl|my_center|LOCUS_24850 2104 1862 gene locus_tag LOCUS_24860 2104 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2347 4092 gene locus_tag LOCUS_24870 2347 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 5504 4320 gene locus_tag LOCUS_24880 5504 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 6082 5765 gene locus_tag LOCUS_24890 6082 5765 CDS product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_24890 9476 6363 gene locus_tag LOCUS_24900 9476 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 12953 9780 gene locus_tag LOCUS_24910 12953 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 13870 13286 gene locus_tag LOCUS_24920 13870 13286 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887596.1 protein_id gnl|my_center|LOCUS_24920 14222 13863 gene locus_tag LOCUS_24930 14222 13863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence0151 1042 905 gene locus_tag LOCUS_24940 1042 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1369 1635 gene locus_tag LOCUS_24950 1369 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 3228 2170 gene locus_tag LOCUS_24960 3228 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_24960 3921 3562 gene locus_tag LOCUS_24970 3921 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 5632 4205 gene locus_tag LOCUS_24980 5632 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 6989 5622 gene locus_tag LOCUS_24990 6989 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 7554 7739 gene locus_tag LOCUS_25000 7554 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 9291 8449 gene locus_tag LOCUS_25010 9291 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057312.1 protein_id gnl|my_center|LOCUS_25010 10063 9473 gene locus_tag LOCUS_25020 gene trpG 10063 9473 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 protein_id gnl|my_center|LOCUS_25020 10787 10251 gene locus_tag LOCUS_25030 10787 10251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 11381 10860 gene locus_tag LOCUS_25040 11381 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 11616 11392 gene locus_tag LOCUS_25050 11616 11392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 13136 12135 gene locus_tag LOCUS_25060 gene prfB 13136 12135 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VE10 protein_id gnl|my_center|LOCUS_25060 14386 13658 gene locus_tag LOCUS_25070 14386 13658 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056315.1 protein_id gnl|my_center|LOCUS_25070 >Feature sequence0152 535 308 gene locus_tag LOCUS_25080 535 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 1014 2114 gene locus_tag LOCUS_25090 gene aroC 1014 2114 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_25090 2415 3266 gene locus_tag LOCUS_25100 2415 3266 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_25100 3687 4655 gene locus_tag LOCUS_25110 gene cofG 3687 4655 CDS product FO synthase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR6 protein_id gnl|my_center|LOCUS_25110 4980 5300 gene locus_tag LOCUS_25120 4980 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 5297 5428 gene locus_tag LOCUS_25130 5297 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 5391 5645 gene locus_tag LOCUS_25140 5391 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142949.1 protein_id gnl|my_center|LOCUS_25140 6221 5685 gene locus_tag LOCUS_25150 6221 5685 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_25150 6493 6218 gene locus_tag LOCUS_25160 6493 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 6657 6857 gene locus_tag LOCUS_25170 6657 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 7771 6992 gene locus_tag LOCUS_25180 7771 6992 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185757.1 protein_id gnl|my_center|LOCUS_25180 7763 7933 gene locus_tag LOCUS_25190 7763 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 9175 8063 gene locus_tag LOCUS_25200 9175 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 10324 9191 gene locus_tag LOCUS_25210 10324 9191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 11427 10375 gene locus_tag LOCUS_25220 11427 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 13093 11474 gene locus_tag LOCUS_25230 13093 11474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 13680 13303 gene locus_tag LOCUS_25240 13680 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 14459 14704 gene locus_tag LOCUS_25250 14459 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence0153 498 932 gene locus_tag LOCUS_25260 498 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 1562 2266 gene locus_tag LOCUS_25270 1562 2266 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125719.1 protein_id gnl|my_center|LOCUS_25270 3035 3832 gene locus_tag LOCUS_25280 3035 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25280 3822 4817 gene locus_tag LOCUS_25290 3822 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25290 5116 5976 gene locus_tag LOCUS_25300 5116 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 6638 6027 gene locus_tag LOCUS_25310 6638 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_25310 6825 7709 gene locus_tag LOCUS_25320 6825 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 7945 10257 gene locus_tag LOCUS_25330 7945 10257 CDS product UDP-glucose-beta-D-glucan glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057632.1 protein_id gnl|my_center|LOCUS_25330 10651 11616 gene locus_tag LOCUS_25340 10651 11616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 11800 11991 gene locus_tag LOCUS_25350 11800 11991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 13655 12087 gene locus_tag LOCUS_25360 13655 12087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 >Feature sequence0154 579 2771 gene locus_tag LOCUS_25370 579 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 2938 4185 gene locus_tag LOCUS_25380 2938 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 5182 6381 gene locus_tag LOCUS_25390 5182 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 7374 6547 gene locus_tag LOCUS_25400 7374 6547 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056208.1 protein_id gnl|my_center|LOCUS_25400 8960 7887 gene locus_tag LOCUS_25410 8960 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_25410 10442 11578 gene locus_tag LOCUS_25420 10442 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 11771 11535 gene locus_tag LOCUS_25430 11771 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 12491 11823 gene locus_tag LOCUS_25440 gene nfi 12491 11823 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGM4 protein_id gnl|my_center|LOCUS_25440 12979 14232 gene locus_tag LOCUS_25450 12979 14232 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence0155 1640 1110 gene locus_tag LOCUS_25460 gene moaB 1640 1110 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34457 protein_id gnl|my_center|LOCUS_25460 2134 1799 gene locus_tag LOCUS_25470 gene psb28 2134 1799 CDS product photosystem II reaction center Psb28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ8 protein_id gnl|my_center|LOCUS_25470 3544 2504 gene locus_tag LOCUS_25480 3544 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057667.1 protein_id gnl|my_center|LOCUS_25480 3658 3840 gene locus_tag LOCUS_25490 3658 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 4390 4070 gene locus_tag LOCUS_25500 4390 4070 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NM87 protein_id gnl|my_center|LOCUS_25500 6392 5229 gene locus_tag LOCUS_25510 6392 5229 CDS product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_25510 6824 6633 gene locus_tag LOCUS_25520 6824 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 7070 6885 gene locus_tag LOCUS_25530 7070 6885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 7165 8205 gene locus_tag LOCUS_25540 7165 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 9161 9835 gene locus_tag LOCUS_25550 9161 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 11197 9803 gene locus_tag LOCUS_25560 11197 9803 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058184.1 protein_id gnl|my_center|LOCUS_25560 12206 11214 gene locus_tag LOCUS_25570 12206 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 13860 12979 gene locus_tag LOCUS_25580 gene bcpA 13860 12979 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808124.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence0156 3025 3903 gene locus_tag LOCUS_25590 3025 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3906 4682 gene locus_tag LOCUS_25600 3906 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 6073 5462 gene locus_tag LOCUS_25610 6073 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 protein_id gnl|my_center|LOCUS_25610 7343 9388 gene locus_tag LOCUS_25620 7343 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 10016 11767 gene locus_tag LOCUS_25630 10016 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 12858 11989 gene locus_tag LOCUS_25640 12858 11989 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGK9 protein_id gnl|my_center|LOCUS_25640 12949 14331 gene locus_tag LOCUS_25650 12949 14331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 >Feature sequence0157 1023 79 gene locus_tag LOCUS_25660 1023 79 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122378.1 protein_id gnl|my_center|LOCUS_25660 1509 1222 gene locus_tag LOCUS_25670 1509 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057416.1 protein_id gnl|my_center|LOCUS_25670 5903 1845 gene locus_tag LOCUS_25680 gene rpoC2 5903 1845 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL57 protein_id gnl|my_center|LOCUS_25680 8013 5995 gene locus_tag LOCUS_25690 gene rpoC1 8013 5995 CDS product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL56 protein_id gnl|my_center|LOCUS_25690 11511 8212 gene locus_tag LOCUS_25700 gene rpoB 11511 8212 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL55 protein_id gnl|my_center|LOCUS_25700 13020 12241 gene locus_tag LOCUS_25710 gene tatD 13020 12241 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN5 protein_id gnl|my_center|LOCUS_25710 13450 13145 gene locus_tag LOCUS_25720 gene rpsT 13450 13145 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN4 protein_id gnl|my_center|LOCUS_25720 >Feature sequence0158 383 162 gene locus_tag LOCUS_25730 383 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 850 404 gene locus_tag LOCUS_25740 850 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002249008.2 protein_id gnl|my_center|LOCUS_25740 1690 2232 gene locus_tag LOCUS_25750 1690 2232 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812293.1 protein_id gnl|my_center|LOCUS_25750 2519 2788 gene locus_tag LOCUS_25760 2519 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 4257 2803 gene locus_tag LOCUS_25770 4257 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 4580 4254 gene locus_tag LOCUS_25780 4580 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 11313 4591 gene locus_tag LOCUS_25790 11313 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 12533 11637 gene locus_tag LOCUS_25800 12533 11637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056523.1 protein_id gnl|my_center|LOCUS_25800 12841 14352 gene locus_tag LOCUS_25810 gene ilvA 12841 14352 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7U9 protein_id gnl|my_center|LOCUS_25810 >Feature sequence0159 662 471 gene locus_tag LOCUS_25820 662 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 876 2060 gene locus_tag LOCUS_25830 gene carA 876 2060 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU5 protein_id gnl|my_center|LOCUS_25830 2319 2675 gene locus_tag LOCUS_25840 2319 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2868 3314 gene locus_tag LOCUS_25850 2868 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 3724 4686 gene locus_tag LOCUS_25860 3724 4686 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056885.1 protein_id gnl|my_center|LOCUS_25860 4749 5036 gene locus_tag LOCUS_25870 4749 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057540.1 protein_id gnl|my_center|LOCUS_25870 5924 5088 gene locus_tag LOCUS_25880 5924 5088 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_25880 7546 6260 gene locus_tag LOCUS_25890 7546 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 9579 9325 gene locus_tag LOCUS_25900 9579 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 10309 9929 gene locus_tag LOCUS_25910 10309 9929 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_25910 10774 11064 gene locus_tag LOCUS_25920 10774 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_25920 11042 11290 gene locus_tag LOCUS_25930 11042 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 11800 11603 gene locus_tag LOCUS_25940 11800 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 12286 11996 gene locus_tag LOCUS_25950 12286 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 12745 14277 gene locus_tag LOCUS_25960 12745 14277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence0160 793 68 gene locus_tag LOCUS_25970 793 68 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056429.1 protein_id gnl|my_center|LOCUS_25970 1072 806 gene locus_tag LOCUS_25980 1072 806 CDS product UPF0367 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VE69 protein_id gnl|my_center|LOCUS_25980 1693 1920 gene locus_tag LOCUS_25990 gene rpoZ 1693 1920 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK60 protein_id gnl|my_center|LOCUS_25990 2024 2389 gene locus_tag LOCUS_26000 2024 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057286.1 protein_id gnl|my_center|LOCUS_26000 2440 2514 gene locus_tag LOCUS_t00170 2440 2514 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3165 2860 gene locus_tag LOCUS_26010 3165 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 3280 3495 gene locus_tag LOCUS_26020 3280 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 4033 5499 gene locus_tag LOCUS_26030 4033 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 5492 6193 gene locus_tag LOCUS_26040 5492 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 6398 6955 gene locus_tag LOCUS_26050 6398 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 7588 7223 gene locus_tag LOCUS_26060 7588 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 7902 7585 gene locus_tag LOCUS_26070 7902 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 8486 8833 gene locus_tag LOCUS_26080 8486 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 8853 10937 gene locus_tag LOCUS_26090 8853 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132365.1 protein_id gnl|my_center|LOCUS_26090 10937 11692 gene locus_tag LOCUS_26100 10937 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 12583 13464 gene locus_tag LOCUS_26110 12583 13464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 13907 13581 gene locus_tag LOCUS_26120 13907 13581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence0161 784 224 gene locus_tag LOCUS_26130 784 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 1377 958 gene locus_tag LOCUS_26140 1377 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 1683 1943 gene locus_tag LOCUS_26150 1683 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 3787 2555 gene locus_tag LOCUS_26160 3787 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 5054 4410 gene locus_tag LOCUS_26170 5054 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 5800 6189 gene locus_tag LOCUS_26180 5800 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055883.1 protein_id gnl|my_center|LOCUS_26180 7065 6397 gene locus_tag LOCUS_26190 7065 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058134.1 protein_id gnl|my_center|LOCUS_26190 7629 7165 gene locus_tag LOCUS_26200 7629 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 8018 7743 gene locus_tag LOCUS_26210 8018 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 8716 8015 gene locus_tag LOCUS_26220 8716 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058131.1 protein_id gnl|my_center|LOCUS_26220 10550 9198 gene locus_tag LOCUS_26230 10550 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 11540 10566 gene locus_tag LOCUS_26240 11540 10566 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028434.1 protein_id gnl|my_center|LOCUS_26240 12062 12418 gene locus_tag LOCUS_26250 gene ycf57 12062 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056711.1 protein_id gnl|my_center|LOCUS_26250 12553 12969 gene locus_tag LOCUS_26260 12553 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143379.1 protein_id gnl|my_center|LOCUS_26260 14157 13072 gene locus_tag LOCUS_26270 14157 13072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142156.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence0162 655 1026 gene locus_tag LOCUS_26280 655 1026 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKV4 protein_id gnl|my_center|LOCUS_26280 1007 1576 gene locus_tag LOCUS_26290 1007 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 1720 3054 gene locus_tag LOCUS_26300 1720 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 4155 3265 gene locus_tag LOCUS_26310 4155 3265 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRT3 protein_id gnl|my_center|LOCUS_26310 5152 4427 gene locus_tag LOCUS_26320 5152 4427 CDS product bifunctional dihydropteridine reductase/dihydrofolate reductase TmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172549.1 protein_id gnl|my_center|LOCUS_26320 6163 5168 gene locus_tag LOCUS_26330 6163 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 6858 6319 gene locus_tag LOCUS_26340 6858 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 7309 8349 gene locus_tag LOCUS_26350 7309 8349 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_26350 8626 9396 gene locus_tag LOCUS_26360 8626 9396 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_26360 9709 10533 gene locus_tag LOCUS_26370 9709 10533 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082921.1 protein_id gnl|my_center|LOCUS_26370 13943 10776 gene locus_tag LOCUS_26380 13943 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence0163 326 1525 gene locus_tag LOCUS_26390 326 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 1556 3310 gene locus_tag LOCUS_26400 gene asnB 1556 3310 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545305.1 protein_id gnl|my_center|LOCUS_26400 3470 3958 gene locus_tag LOCUS_26410 3470 3958 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_26410 4712 4894 gene locus_tag LOCUS_26420 4712 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 4966 9786 gene locus_tag LOCUS_26430 4966 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 10093 10902 gene locus_tag LOCUS_26440 10093 10902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 11974 12630 gene locus_tag LOCUS_26450 11974 12630 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_26450 12835 13425 gene locus_tag LOCUS_26460 12835 13425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 13931 13506 gene locus_tag LOCUS_26470 13931 13506 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056985.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence0164 1022 60 gene locus_tag LOCUS_26480 1022 60 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_26480 3180 2065 gene locus_tag LOCUS_26490 gene rtxC 3180 2065 CDS product dihydrorhizobitoxine desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084875.1 protein_id gnl|my_center|LOCUS_26490 3828 5201 gene locus_tag LOCUS_26500 3828 5201 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089836.1 protein_id gnl|my_center|LOCUS_26500 5258 7453 gene locus_tag LOCUS_26510 5258 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 7660 8271 gene locus_tag LOCUS_26520 7660 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387862.1 protein_id gnl|my_center|LOCUS_26520 8526 8897 gene locus_tag LOCUS_26530 8526 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975312.1 protein_id gnl|my_center|LOCUS_26530 10573 10731 gene locus_tag LOCUS_26540 10573 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 11188 13611 gene locus_tag LOCUS_26550 11188 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence0165 1000 3180 gene locus_tag LOCUS_26560 1000 3180 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412557.1 protein_id gnl|my_center|LOCUS_26560 3347 4864 gene locus_tag LOCUS_26570 3347 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900521.1 protein_id gnl|my_center|LOCUS_26570 6993 4915 gene locus_tag LOCUS_26580 6993 4915 CDS product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142193.1 protein_id gnl|my_center|LOCUS_26580 8402 7239 gene locus_tag LOCUS_26590 8402 7239 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768305.1 protein_id gnl|my_center|LOCUS_26590 9393 8536 gene locus_tag LOCUS_26600 9393 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 9956 9600 gene locus_tag LOCUS_26610 9956 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 11764 10730 gene locus_tag LOCUS_26620 11764 10730 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_26620 12799 11801 gene locus_tag LOCUS_26630 12799 11801 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142814.1 protein_id gnl|my_center|LOCUS_26630 13058 12849 gene locus_tag LOCUS_26640 13058 12849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 13217 13990 gene locus_tag LOCUS_26650 gene gloB 13217 13990 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence0166 1169 603 gene locus_tag LOCUS_26660 1169 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2139 1762 gene locus_tag LOCUS_26670 2139 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2531 4801 gene locus_tag LOCUS_26680 2531 4801 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056432.1 protein_id gnl|my_center|LOCUS_26680 5564 5130 gene locus_tag LOCUS_26690 5564 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 6134 7060 gene locus_tag LOCUS_26700 gene dpnIIA 6134 7060 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H7D1 protein_id gnl|my_center|LOCUS_26700 7259 8581 gene locus_tag LOCUS_26710 gene proA 7259 8581 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU1 protein_id gnl|my_center|LOCUS_26710 8900 9439 gene locus_tag LOCUS_26720 8900 9439 CDS product RNase III inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 protein_id gnl|my_center|LOCUS_26720 9766 9518 gene locus_tag LOCUS_26730 9766 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 10020 10802 gene locus_tag LOCUS_26740 10020 10802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_26740 11484 12221 gene locus_tag LOCUS_26750 gene ccdA 11484 12221 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055907.1 protein_id gnl|my_center|LOCUS_26750 12422 13828 gene locus_tag LOCUS_26760 gene ccsB 12422 13828 CDS product cytochrome c biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL16 protein_id gnl|my_center|LOCUS_26760 >Feature sequence0167 1614 865 gene locus_tag LOCUS_26770 1614 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 3207 2584 gene locus_tag LOCUS_26780 3207 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 3931 3608 gene locus_tag LOCUS_26790 3931 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056944.1 protein_id gnl|my_center|LOCUS_26790 6361 4208 gene locus_tag LOCUS_26800 6361 4208 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056292.1 protein_id gnl|my_center|LOCUS_26800 8025 6727 gene locus_tag LOCUS_26810 gene purD 8025 6727 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHV4 protein_id gnl|my_center|LOCUS_26810 9812 8370 gene locus_tag LOCUS_26820 gene phrA 9812 8370 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056280.1 protein_id gnl|my_center|LOCUS_26820 11155 10697 gene locus_tag LOCUS_26830 11155 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 11620 11384 gene locus_tag LOCUS_26840 11620 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 13325 12777 gene locus_tag LOCUS_26850 13325 12777 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056278.1 protein_id gnl|my_center|LOCUS_26850 13780 13586 gene locus_tag LOCUS_26860 13780 13586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence0168 194 3037 gene locus_tag LOCUS_26870 gene clpB2 194 3037 CDS product chaperone protein ClpB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG71 protein_id gnl|my_center|LOCUS_26870 3133 3948 gene locus_tag LOCUS_26880 3133 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 3972 4925 gene locus_tag LOCUS_26890 3972 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 4968 5918 gene locus_tag LOCUS_26900 4968 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 5938 6945 gene locus_tag LOCUS_26910 5938 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 7010 8272 gene locus_tag LOCUS_26920 7010 8272 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_26920 9775 8501 gene locus_tag LOCUS_26930 9775 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 11114 10209 gene locus_tag LOCUS_26940 11114 10209 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975608.1 protein_id gnl|my_center|LOCUS_26940 11493 13472 gene locus_tag LOCUS_26950 gene htpG 11493 13472 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence0169 3004 167 gene locus_tag LOCUS_26960 3004 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 3881 3372 gene locus_tag LOCUS_26970 gene cheW 3881 3372 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072185.1 protein_id gnl|my_center|LOCUS_26970 5703 4420 gene locus_tag LOCUS_26980 5703 4420 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058122.1 protein_id gnl|my_center|LOCUS_26980 6859 6086 gene locus_tag LOCUS_26990 6859 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 7826 9919 gene locus_tag LOCUS_27000 gene fusA2 7826 9919 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M30 protein_id gnl|my_center|LOCUS_27000 13362 10714 gene locus_tag LOCUS_27010 13362 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence0170 1072 3873 gene locus_tag LOCUS_27020 1072 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 5486 8659 gene locus_tag LOCUS_27030 5486 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 9836 10798 gene locus_tag LOCUS_27040 9836 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140054.1 protein_id gnl|my_center|LOCUS_27040 12163 12498 gene locus_tag LOCUS_27050 12163 12498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 13207 13923 gene locus_tag LOCUS_27060 13207 13923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27060 >Feature sequence0171 1710 328 gene locus_tag LOCUS_27070 1710 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 2320 3525 gene locus_tag LOCUS_27080 2320 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 3553 4620 gene locus_tag LOCUS_27090 3553 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 4885 5049 gene locus_tag LOCUS_27100 4885 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 5039 5323 gene locus_tag LOCUS_27110 5039 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 8342 5523 gene locus_tag LOCUS_27120 8342 5523 CDS product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056370.1 protein_id gnl|my_center|LOCUS_27120 8807 8995 gene locus_tag LOCUS_27130 gene psbZ 8807 8995 CDS product photosystem II reaction center protein Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHJ2 protein_id gnl|my_center|LOCUS_27130 9091 9648 gene locus_tag LOCUS_27140 gene ribH 9091 9648 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLS9 protein_id gnl|my_center|LOCUS_27140 9911 9982 gene locus_tag LOCUS_t00180 9911 9982 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13019 10074 gene locus_tag LOCUS_27150 13019 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 13342 13160 gene locus_tag LOCUS_27160 13342 13160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 13738 13418 gene locus_tag LOCUS_27170 13738 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence0172 2132 531 gene locus_tag LOCUS_27180 2132 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 2255 2830 gene locus_tag LOCUS_27190 2255 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 3329 4033 gene locus_tag LOCUS_27200 3329 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 5952 5080 gene locus_tag LOCUS_27210 5952 5080 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_27210 6301 7365 gene locus_tag LOCUS_27220 6301 7365 CDS product dinitrogenase reductase activating glycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123141.1 protein_id gnl|my_center|LOCUS_27220 8046 7855 gene locus_tag LOCUS_27230 8046 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 8030 9355 gene locus_tag LOCUS_27240 8030 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 9500 13078 gene locus_tag LOCUS_27250 9500 13078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence0173 4987 269 gene locus_tag LOCUS_27260 4987 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 7481 6168 gene locus_tag LOCUS_27270 7481 6168 CDS product modulator of DNA gyrase PmbA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 protein_id gnl|my_center|LOCUS_27270 8920 7961 gene locus_tag LOCUS_27280 8920 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056713.1 protein_id gnl|my_center|LOCUS_27280 9746 9333 gene locus_tag LOCUS_27290 9746 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 9951 10499 gene locus_tag LOCUS_27300 9951 10499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 11184 11951 gene locus_tag LOCUS_27310 11184 11951 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888F0 protein_id gnl|my_center|LOCUS_27310 12149 13573 gene locus_tag LOCUS_27320 12149 13573 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532721.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence0174 130 1242 gene locus_tag LOCUS_27330 130 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 1279 1722 gene locus_tag LOCUS_27340 1279 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 1801 2250 gene locus_tag LOCUS_27350 1801 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_27350 2505 2771 gene locus_tag LOCUS_27360 2505 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 3727 3179 gene locus_tag LOCUS_27370 3727 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 4949 3747 gene locus_tag LOCUS_27380 4949 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144239.1 protein_id gnl|my_center|LOCUS_27380 6775 5444 gene locus_tag LOCUS_27390 6775 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 9934 7376 gene locus_tag LOCUS_27400 gene leuS 9934 7376 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH61 protein_id gnl|my_center|LOCUS_27400 10208 10690 gene locus_tag LOCUS_27410 10208 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 10694 11899 gene locus_tag LOCUS_27420 10694 11899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 11902 12315 gene locus_tag LOCUS_27430 11902 12315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 12525 13037 gene locus_tag LOCUS_27440 12525 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 13031 13450 gene locus_tag LOCUS_27450 13031 13450 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877806.1 protein_id gnl|my_center|LOCUS_27450 >Feature sequence0175 6664 254 gene locus_tag LOCUS_27460 6664 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 7962 7168 gene locus_tag LOCUS_27470 7962 7168 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249459.1 protein_id gnl|my_center|LOCUS_27470 9022 8159 gene locus_tag LOCUS_27480 9022 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 11814 11113 gene locus_tag LOCUS_27490 11814 11113 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057817.1 protein_id gnl|my_center|LOCUS_27490 11886 12668 gene locus_tag LOCUS_27500 gene cobI 11886 12668 CDS product precorrin-2 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057289.1 protein_id gnl|my_center|LOCUS_27500 13172 12945 gene locus_tag LOCUS_27510 13172 12945 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021610.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence0176 1036 302 gene locus_tag LOCUS_27520 1036 302 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144148.1 protein_id gnl|my_center|LOCUS_27520 1876 2070 gene locus_tag LOCUS_27530 1876 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 3461 3781 gene locus_tag LOCUS_27540 3461 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 3782 5836 gene locus_tag LOCUS_27550 3782 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 6708 6271 gene locus_tag LOCUS_27560 6708 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 7016 10615 gene locus_tag LOCUS_27570 7016 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 11217 10633 gene locus_tag LOCUS_27580 11217 10633 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140132.1 protein_id gnl|my_center|LOCUS_27580 11465 11304 gene locus_tag LOCUS_27590 11465 11304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 13444 12026 gene locus_tag LOCUS_27600 13444 12026 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142768.1 protein_id gnl|my_center|LOCUS_27600 >Feature sequence0177 645 2675 gene locus_tag LOCUS_27610 645 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 4122 3283 gene locus_tag LOCUS_27620 4122 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 4722 6404 gene locus_tag LOCUS_27630 gene ilvD 4722 6404 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK13 protein_id gnl|my_center|LOCUS_27630 7550 6564 gene locus_tag LOCUS_27640 7550 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 10903 8246 gene locus_tag LOCUS_27650 10903 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 12456 11968 gene locus_tag LOCUS_27660 gene fcbC 12456 11968 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124513.1 protein_id gnl|my_center|LOCUS_27660 12667 13494 gene locus_tag LOCUS_27670 12667 13494 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057366.1 protein_id gnl|my_center|LOCUS_27670 >Feature sequence0178 8 135 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgctctacttggggagaccccaagac 957 367 gene locus_tag LOCUS_27680 957 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 1711 1016 gene locus_tag LOCUS_27690 1711 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 4102 2336 gene locus_tag LOCUS_27700 4102 2336 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057025.1 protein_id gnl|my_center|LOCUS_27700 4885 6015 gene locus_tag LOCUS_27710 gene potA 4885 6015 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBU2 protein_id gnl|my_center|LOCUS_27710 6057 6464 gene locus_tag LOCUS_27720 6057 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 6549 7670 gene locus_tag LOCUS_27730 gene potD 6549 7670 CDS product putative spermidine/putrescine ABC transporter, periplasmic transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269262.1 protein_id gnl|my_center|LOCUS_27730 8134 9069 gene locus_tag LOCUS_27740 gene potB 8134 9069 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_27740 9179 10024 gene locus_tag LOCUS_27750 9179 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 10661 11878 gene locus_tag LOCUS_27760 10661 11878 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141544.1 protein_id gnl|my_center|LOCUS_27760 13318 12122 gene locus_tag LOCUS_27770 13318 12122 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence0179 685 464 gene locus_tag LOCUS_27780 685 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 3005 1395 gene locus_tag LOCUS_27790 3005 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 5484 4249 gene locus_tag LOCUS_27800 gene metK 5484 4249 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK88 protein_id gnl|my_center|LOCUS_27800 6461 5724 gene locus_tag LOCUS_27810 6461 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057310.1 protein_id gnl|my_center|LOCUS_27810 7913 6675 gene locus_tag LOCUS_27820 gene rps1 7913 6675 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 protein_id gnl|my_center|LOCUS_27820 9900 9361 gene locus_tag LOCUS_27830 gene nrdR 9900 9361 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHT4 protein_id gnl|my_center|LOCUS_27830 11944 10421 gene locus_tag LOCUS_27840 gene psbB 11944 10421 CDS product photosystem II CP47 reaction center protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ1 protein_id gnl|my_center|LOCUS_27840 12536 12204 gene locus_tag LOCUS_27850 12536 12204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055877.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence0180 826 32 gene locus_tag LOCUS_27860 826 32 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057297.1 protein_id gnl|my_center|LOCUS_27860 1558 2055 gene locus_tag LOCUS_27870 1558 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2453 2653 gene locus_tag LOCUS_27880 2453 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 3483 2974 gene locus_tag LOCUS_27890 gene apcF 3483 2974 CDS product phycobilisome core component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 protein_id gnl|my_center|LOCUS_27890 4297 5718 gene locus_tag LOCUS_27900 gene glnA 4297 5718 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ7 protein_id gnl|my_center|LOCUS_27900 6088 5828 gene locus_tag LOCUS_27910 gene psaK 6088 5828 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A425 protein_id gnl|my_center|LOCUS_27910 7055 7693 gene locus_tag LOCUS_27920 7055 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 8390 7857 gene locus_tag LOCUS_27930 8390 7857 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709012.1 protein_id gnl|my_center|LOCUS_27930 9153 8695 gene locus_tag LOCUS_27940 9153 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 9998 9231 gene locus_tag LOCUS_27950 gene rutB 9998 9231 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EHB2 protein_id gnl|my_center|LOCUS_27950 10926 10489 gene locus_tag LOCUS_27960 10926 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 12462 11227 gene locus_tag LOCUS_27970 gene dapL 12462 11227 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH57 protein_id gnl|my_center|LOCUS_27970 13482 12721 gene locus_tag LOCUS_27980 13482 12721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence0181 1179 1436 gene locus_tag LOCUS_27990 1179 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 1439 1657 gene locus_tag LOCUS_28000 1439 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 2736 2380 gene locus_tag LOCUS_28010 2736 2380 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 protein_id gnl|my_center|LOCUS_28010 2836 4470 gene locus_tag LOCUS_28020 2836 4470 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056694.1 protein_id gnl|my_center|LOCUS_28020 4690 5184 gene locus_tag LOCUS_28030 4690 5184 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527197.1 protein_id gnl|my_center|LOCUS_28030 8728 5477 gene locus_tag LOCUS_28040 8728 5477 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 protein_id gnl|my_center|LOCUS_28040 10872 10069 gene locus_tag LOCUS_28050 10872 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 protein_id gnl|my_center|LOCUS_28050 12031 11054 gene locus_tag LOCUS_28060 12031 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 12545 12784 gene locus_tag LOCUS_28070 12545 12784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence0182 809 303 gene locus_tag LOCUS_28080 809 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 2424 1132 gene locus_tag LOCUS_28090 gene hemA 2424 1132 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI53 protein_id gnl|my_center|LOCUS_28090 3899 2865 gene locus_tag LOCUS_28100 3899 2865 CDS product D-fructose 1,6-bisphosphatase class 2/sedoheptulose 1,7-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE9 protein_id gnl|my_center|LOCUS_28100 4630 5454 gene locus_tag LOCUS_28110 4630 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 6162 6482 gene locus_tag LOCUS_28120 6162 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 7250 7894 gene locus_tag LOCUS_28130 gene trmB 7250 7894 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH6 protein_id gnl|my_center|LOCUS_28130 7969 8154 gene locus_tag LOCUS_28140 7969 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 8275 8727 gene locus_tag LOCUS_28150 8275 8727 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143422.1 protein_id gnl|my_center|LOCUS_28150 10267 8897 gene locus_tag LOCUS_28160 10267 8897 CDS product dolichyl-phosphate-mannose-protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 protein_id gnl|my_center|LOCUS_28160 11024 13285 gene locus_tag LOCUS_28170 11024 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence0183 1265 54 gene locus_tag LOCUS_28180 1265 54 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058298.1 protein_id gnl|my_center|LOCUS_28180 1414 1905 gene locus_tag LOCUS_28190 1414 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 4070 2028 gene locus_tag LOCUS_28200 4070 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 4951 4364 gene locus_tag LOCUS_28210 4951 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 6592 5000 gene locus_tag LOCUS_28220 gene speE 6592 5000 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD1 protein_id gnl|my_center|LOCUS_28220 6963 6781 gene locus_tag LOCUS_28230 6963 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 7484 7212 gene locus_tag LOCUS_28240 7484 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 9121 7709 gene locus_tag LOCUS_28250 gene rfaL 9121 7709 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126018.1 protein_id gnl|my_center|LOCUS_28250 9368 9625 gene locus_tag LOCUS_28260 9368 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 9591 9962 gene locus_tag LOCUS_28270 9591 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 10493 10843 gene locus_tag LOCUS_28280 10493 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057712.1 protein_id gnl|my_center|LOCUS_28280 11096 12616 gene locus_tag LOCUS_28290 11096 12616 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144273.1 protein_id gnl|my_center|LOCUS_28290 12760 13113 gene locus_tag LOCUS_28300 12760 13113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057714.1 protein_id gnl|my_center|LOCUS_28300 >Feature sequence0184 284 646 gene locus_tag LOCUS_28310 284 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 811 647 gene locus_tag LOCUS_28320 811 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 1125 805 gene locus_tag LOCUS_28330 1125 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1367 3079 gene locus_tag LOCUS_28340 gene spoIID 1367 3079 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125969.1 protein_id gnl|my_center|LOCUS_28340 3374 3901 gene locus_tag LOCUS_28350 3374 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 3879 4601 gene locus_tag LOCUS_28360 3879 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 5757 5458 gene locus_tag LOCUS_28370 gene fdx 5757 5458 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_28370 6252 5950 gene locus_tag LOCUS_28380 gene fdx 6252 5950 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_28380 6628 7599 gene locus_tag LOCUS_28390 gene bvdR 6628 7599 CDS product biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140852.1 protein_id gnl|my_center|LOCUS_28390 7963 8532 gene locus_tag LOCUS_28400 7963 8532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056409.1 protein_id gnl|my_center|LOCUS_28400 9937 8738 gene locus_tag LOCUS_28410 9937 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056681.1 protein_id gnl|my_center|LOCUS_28410 11185 11793 gene locus_tag LOCUS_28420 11185 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058121.1 protein_id gnl|my_center|LOCUS_28420 13078 11858 gene locus_tag LOCUS_28430 13078 11858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence0185 1574 459 gene locus_tag LOCUS_28440 1574 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056632.1 protein_id gnl|my_center|LOCUS_28440 2620 2030 gene locus_tag LOCUS_28450 2620 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056349.1 protein_id gnl|my_center|LOCUS_28450 4268 3147 gene locus_tag LOCUS_28460 gene pilC 4268 3147 CDS product pilus biosynthesis protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_28460 6069 4960 gene locus_tag LOCUS_28470 gene pilT 6069 4960 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_28470 8150 6201 gene locus_tag LOCUS_28480 gene pilB 8150 6201 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 protein_id gnl|my_center|LOCUS_28480 9137 9937 gene locus_tag LOCUS_28490 gene grpE 9137 9937 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB3 protein_id gnl|my_center|LOCUS_28490 10239 12092 gene locus_tag LOCUS_28500 gene dnaK1 10239 12092 CDS product chaperone protein dnaK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR6 protein_id gnl|my_center|LOCUS_28500 >Feature sequence0186 705 1829 gene locus_tag LOCUS_28510 705 1829 CDS product geranylgeranyl bacteriochlorophyll reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057244.1 protein_id gnl|my_center|LOCUS_28510 2547 2257 gene locus_tag LOCUS_28520 2547 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 2808 2551 gene locus_tag LOCUS_28530 2808 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3165 2986 gene locus_tag LOCUS_28540 3165 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 3558 3172 gene locus_tag LOCUS_28550 3558 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3932 3681 gene locus_tag LOCUS_28560 3932 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28560 4339 4025 gene locus_tag LOCUS_28570 4339 4025 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_28570 7643 4590 gene locus_tag LOCUS_28580 7643 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 10042 8117 gene locus_tag LOCUS_28590 10042 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 10573 11832 gene locus_tag LOCUS_28600 gene sucC 10573 11832 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45101 protein_id gnl|my_center|LOCUS_28600 12223 13152 gene locus_tag LOCUS_28610 gene sucD 12223 13152 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZP3 protein_id gnl|my_center|LOCUS_28610 >Feature sequence0187 937 386 gene locus_tag LOCUS_28620 937 386 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056635.1 protein_id gnl|my_center|LOCUS_28620 2815 1646 gene locus_tag LOCUS_28630 2815 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 5001 3277 gene locus_tag LOCUS_28640 5001 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 5360 6358 gene locus_tag LOCUS_28650 5360 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 7237 6833 gene locus_tag LOCUS_28660 7237 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 7454 7230 gene locus_tag LOCUS_28670 7454 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 7544 8125 gene locus_tag LOCUS_28680 7544 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 9463 8516 gene locus_tag LOCUS_28690 9463 8516 CDS product glycine/betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764515.1 protein_id gnl|my_center|LOCUS_28690 10640 9597 gene locus_tag LOCUS_28700 gene proX 10640 9597 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418240.1 protein_id gnl|my_center|LOCUS_28700 11721 10663 gene locus_tag LOCUS_28710 gene proX 11721 10663 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418240.1 protein_id gnl|my_center|LOCUS_28710 13082 11889 gene locus_tag LOCUS_28720 13082 11889 CDS product glycine/betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571116.1 protein_id gnl|my_center|LOCUS_28720 >Feature sequence0188 837 130 gene locus_tag LOCUS_28730 837 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877819.1 protein_id gnl|my_center|LOCUS_28730 2454 1051 gene locus_tag LOCUS_28740 2454 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_28740 6326 2670 gene locus_tag LOCUS_28750 6326 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 8790 6622 gene locus_tag LOCUS_28760 8790 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141408.1 protein_id gnl|my_center|LOCUS_28760 10765 8825 gene locus_tag LOCUS_28770 10765 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 13169 11181 gene locus_tag LOCUS_28780 13169 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 >Feature sequence0189 1001 2287 gene locus_tag LOCUS_28790 1001 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 2893 5064 gene locus_tag LOCUS_28800 2893 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 5291 6394 gene locus_tag LOCUS_28810 5291 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 6435 6752 gene locus_tag LOCUS_28820 6435 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 6978 8087 gene locus_tag LOCUS_28830 6978 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 10881 9355 gene locus_tag LOCUS_28840 gene chlB 10881 9355 CDS product light-independent protochlorophyllide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC6 protein_id gnl|my_center|LOCUS_28840 11937 11506 gene locus_tag LOCUS_28850 gene dut 11937 11506 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181Y7 protein_id gnl|my_center|LOCUS_28850 12940 12290 gene locus_tag LOCUS_28860 12940 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence0190 <1 6808 gene locus_tag LOCUS_28870 <1 6808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969687.1:hemolysin D 7238 7441 gene locus_tag LOCUS_28880 7238 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 7431 7610 gene locus_tag LOCUS_28890 7431 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 10032 8581 gene locus_tag LOCUS_28900 10032 8581 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058264.1 protein_id gnl|my_center|LOCUS_28900 11302 10301 gene locus_tag LOCUS_28910 gene ycf30 11302 10301 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 protein_id gnl|my_center|LOCUS_28910 11956 12669 gene locus_tag LOCUS_28920 11956 12669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056001.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence0191 103 1494 gene locus_tag LOCUS_28930 103 1494 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973242.1 protein_id gnl|my_center|LOCUS_28930 1818 3053 gene locus_tag LOCUS_28940 1818 3053 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 protein_id gnl|my_center|LOCUS_28940 5638 3650 gene locus_tag LOCUS_28950 5638 3650 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057278.1 protein_id gnl|my_center|LOCUS_28950 8456 6732 gene locus_tag LOCUS_28960 gene nadB 8456 6732 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGB1 protein_id gnl|my_center|LOCUS_28960 9911 9168 gene locus_tag LOCUS_28970 9911 9168 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259746.1 protein_id gnl|my_center|LOCUS_28970 10681 10346 gene locus_tag LOCUS_28980 10681 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 11085 10669 gene locus_tag LOCUS_28990 11085 10669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 12549 11365 gene locus_tag LOCUS_29000 12549 11365 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_29000 12822 12559 gene locus_tag LOCUS_29010 12822 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056812.1 protein_id gnl|my_center|LOCUS_29010 >Feature sequence0192 1753 299 gene locus_tag LOCUS_29020 1753 299 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_29020 2250 1774 gene locus_tag LOCUS_29030 2250 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 4289 2736 gene locus_tag LOCUS_29040 4289 2736 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_29040 5916 5632 gene locus_tag LOCUS_29050 5916 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 6122 5913 gene locus_tag LOCUS_29060 6122 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 6735 6241 gene locus_tag LOCUS_29070 6735 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 7068 7385 gene locus_tag LOCUS_29080 7068 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 7378 7797 gene locus_tag LOCUS_29090 7378 7797 CDS product nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 protein_id gnl|my_center|LOCUS_29090 7880 8080 gene locus_tag LOCUS_29100 7880 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 8628 8146 gene locus_tag LOCUS_29110 8628 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 9205 8771 gene locus_tag LOCUS_29120 9205 8771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407498.1 protein_id gnl|my_center|LOCUS_29120 11577 9910 gene locus_tag LOCUS_29130 11577 9910 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence0193 157 981 gene locus_tag LOCUS_29140 157 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056927.1 protein_id gnl|my_center|LOCUS_29140 2010 1327 gene locus_tag LOCUS_29150 gene rnc 2010 1327 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEW6 protein_id gnl|my_center|LOCUS_29150 3610 2375 gene locus_tag LOCUS_29160 3610 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 5018 4173 gene locus_tag LOCUS_29170 5018 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 5330 7954 gene locus_tag LOCUS_29180 5330 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 8795 8202 gene locus_tag LOCUS_29190 8795 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 10571 9780 gene locus_tag LOCUS_29200 10571 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 11575 12777 gene locus_tag LOCUS_29210 11575 12777 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143095.1 protein_id gnl|my_center|LOCUS_29210 >Feature sequence0194 1352 1729 gene locus_tag LOCUS_29220 1352 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 3549 2032 gene locus_tag LOCUS_29230 3549 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_29230 3566 3778 gene locus_tag LOCUS_29240 3566 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 4992 4360 gene locus_tag LOCUS_29250 4992 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 6458 5013 gene locus_tag LOCUS_29260 6458 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 7357 6890 gene locus_tag LOCUS_29270 7357 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 7635 12794 gene locus_tag LOCUS_29280 7635 12794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142241.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence0195 949 173 gene locus_tag LOCUS_29290 gene pyrF 949 173 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK22 protein_id gnl|my_center|LOCUS_29290 2264 1035 gene locus_tag LOCUS_29300 gene tyrS 2264 1035 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR1 protein_id gnl|my_center|LOCUS_29300 3017 4834 gene locus_tag LOCUS_29310 3017 4834 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055904.1 protein_id gnl|my_center|LOCUS_29310 5366 5043 gene locus_tag LOCUS_29320 5366 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057879.1 protein_id gnl|my_center|LOCUS_29320 6086 5514 gene locus_tag LOCUS_29330 6086 5514 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS3 protein_id gnl|my_center|LOCUS_29330 7787 6483 gene locus_tag LOCUS_29340 gene thrA 7787 6483 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM46 protein_id gnl|my_center|LOCUS_29340 9175 9858 gene locus_tag LOCUS_29350 9175 9858 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393986.1 protein_id gnl|my_center|LOCUS_29350 11017 10037 gene locus_tag LOCUS_29360 11017 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 11299 11069 gene locus_tag LOCUS_29370 11299 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 >Feature sequence0196 564 88 gene locus_tag LOCUS_29380 564 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056672.1 protein_id gnl|my_center|LOCUS_29380 1080 2618 gene locus_tag LOCUS_29390 1080 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 1717 1864 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtaagggggggttagggggggt 3041 4879 gene locus_tag LOCUS_29400 3041 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 5539 12300 gene locus_tag LOCUS_29410 5539 12300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 12344 12730 gene locus_tag LOCUS_29420 12344 12730 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546622.1 protein_id gnl|my_center|LOCUS_29420 >Feature sequence0197 925 119 gene locus_tag LOCUS_29430 925 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056104.1 protein_id gnl|my_center|LOCUS_29430 2222 1638 gene locus_tag LOCUS_29440 2222 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 3277 2267 gene locus_tag LOCUS_29450 3277 2267 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_29450 4022 4567 gene locus_tag LOCUS_29460 4022 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 4882 4598 gene locus_tag LOCUS_29470 4882 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 5266 5081 gene locus_tag LOCUS_29480 5266 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 5551 5270 gene locus_tag LOCUS_29490 5551 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 6230 5766 gene locus_tag LOCUS_29500 6230 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 6676 7308 gene locus_tag LOCUS_29510 6676 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 7574 7502 gene locus_tag LOCUS_t00190 7574 7502 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7743 8222 gene locus_tag LOCUS_29520 7743 8222 CDS product iron-sulfur cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056936.1 protein_id gnl|my_center|LOCUS_29520 8234 8758 gene locus_tag LOCUS_29530 8234 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 9071 10237 gene locus_tag LOCUS_29540 gene gldA 9071 10237 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057886.1 protein_id gnl|my_center|LOCUS_29540 11200 12540 gene locus_tag LOCUS_29550 11200 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 >Feature sequence0198 2132 2614 gene locus_tag LOCUS_29560 2132 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 2608 3096 gene locus_tag LOCUS_29570 2608 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 3645 3400 gene locus_tag LOCUS_29580 3645 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 3887 3726 gene locus_tag LOCUS_29590 3887 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29590 4247 4032 gene locus_tag LOCUS_29600 4247 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29600 4676 5161 gene locus_tag LOCUS_29610 4676 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 6577 5498 gene locus_tag LOCUS_29620 6577 5498 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_29620 6822 10505 gene locus_tag LOCUS_29630 gene smc 6822 10505 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAK1 protein_id gnl|my_center|LOCUS_29630 10578 11585 gene locus_tag LOCUS_29640 10578 11585 CDS product photosystem reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056697.1 protein_id gnl|my_center|LOCUS_29640 >Feature sequence0199 96 284 gene locus_tag LOCUS_29650 96 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 1261 311 gene locus_tag LOCUS_29660 gene crtE 1261 311 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_29660 2323 1439 gene locus_tag LOCUS_29670 gene folD 2323 1439 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMU0 protein_id gnl|my_center|LOCUS_29670 3367 5208 gene locus_tag LOCUS_29680 3367 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 5570 6784 gene locus_tag LOCUS_29690 5570 6784 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 protein_id gnl|my_center|LOCUS_29690 7336 8067 gene locus_tag LOCUS_29700 7336 8067 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257887.1 protein_id gnl|my_center|LOCUS_29700 9139 8294 gene locus_tag LOCUS_29710 9139 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 9228 9350 gene locus_tag LOCUS_29720 9228 9350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 9546 9971 gene locus_tag LOCUS_29730 9546 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 9995 10489 gene locus_tag LOCUS_29740 9995 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 10603 10953 gene locus_tag LOCUS_29750 10603 10953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 10953 11381 gene locus_tag LOCUS_29760 gene vapC 10953 11381 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKA5 protein_id gnl|my_center|LOCUS_29760 12139 11468 gene locus_tag LOCUS_29770 12139 11468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 12650 12234 gene locus_tag LOCUS_29780 12650 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 >Feature sequence0200 2490 2828 gene locus_tag LOCUS_29790 2490 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 3602 3153 gene locus_tag LOCUS_29800 3602 3153 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 protein_id gnl|my_center|LOCUS_29800 4223 3840 gene locus_tag LOCUS_29810 4223 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 4591 4337 gene locus_tag LOCUS_29820 4591 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 4908 6137 gene locus_tag LOCUS_29830 gene ispG 4908 6137 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK70 protein_id gnl|my_center|LOCUS_29830 7053 8339 gene locus_tag LOCUS_29840 7053 8339 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_29840 8561 8379 gene locus_tag LOCUS_29850 8561 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141741.1 protein_id gnl|my_center|LOCUS_29850 8572 9600 gene locus_tag LOCUS_29860 gene mtnA 8572 9600 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK09 protein_id gnl|my_center|LOCUS_29860 10082 9879 gene locus_tag LOCUS_29870 10082 9879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 10486 10142 gene locus_tag LOCUS_29880 10486 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029235.1 protein_id gnl|my_center|LOCUS_29880 10850 10608 gene locus_tag LOCUS_29890 10850 10608 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_29890 11537 10974 gene locus_tag LOCUS_29900 11537 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144386.1 protein_id gnl|my_center|LOCUS_29900 12728 11892 gene locus_tag LOCUS_29910 gene ccmO 12728 11892 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142089.1 protein_id gnl|my_center|LOCUS_29910 >Feature sequence0201 117 3644 gene locus_tag LOCUS_29920 117 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 3759 6209 gene locus_tag LOCUS_29930 3759 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 6654 12458 gene locus_tag LOCUS_29940 6654 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence0202 2733 124 gene locus_tag LOCUS_29950 2733 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 8256 2800 gene locus_tag LOCUS_29960 8256 2800 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_29960 9519 8374 gene locus_tag LOCUS_29970 9519 8374 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_29970 9737 9516 gene locus_tag LOCUS_29980 9737 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29980 10512 11438 gene locus_tag LOCUS_29990 10512 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 11404 12174 gene locus_tag LOCUS_30000 11404 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 >Feature sequence0203 509 709 gene locus_tag LOCUS_30010 509 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 1093 1620 gene locus_tag LOCUS_30020 1093 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056576.1 protein_id gnl|my_center|LOCUS_30020 2475 1798 gene locus_tag LOCUS_30030 2475 1798 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144083.1 protein_id gnl|my_center|LOCUS_30030 3051 4193 gene locus_tag LOCUS_30040 3051 4193 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_30040 4535 5428 gene locus_tag LOCUS_30050 4535 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 5436 6155 gene locus_tag LOCUS_30060 5436 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 7290 6943 gene locus_tag LOCUS_30070 7290 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 7348 10239 gene locus_tag LOCUS_30080 7348 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 10922 12109 gene locus_tag LOCUS_30090 10922 12109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_30090 12409 12744 gene locus_tag LOCUS_30100 12409 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence0204 536 1750 gene locus_tag LOCUS_30110 536 1750 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057372.1 protein_id gnl|my_center|LOCUS_30110 2024 3358 gene locus_tag LOCUS_30120 gene pyrC 2024 3358 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057373.1 protein_id gnl|my_center|LOCUS_30120 3836 4195 gene locus_tag LOCUS_30130 3836 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 4297 6096 gene locus_tag LOCUS_30140 4297 6096 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_30140 6913 6578 gene locus_tag LOCUS_30150 gene vapC2 6913 6578 CDS product ribonuclease VapC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71363 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30150 7134 6910 gene locus_tag LOCUS_30160 7134 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 7545 7285 gene locus_tag LOCUS_30170 7545 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 8127 7804 gene locus_tag LOCUS_30180 8127 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141222.1 protein_id gnl|my_center|LOCUS_30180 9024 8467 gene locus_tag LOCUS_30190 9024 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 9928 9284 gene locus_tag LOCUS_30200 9928 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 10264 10821 gene locus_tag LOCUS_30210 10264 10821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 11579 12439 gene locus_tag LOCUS_30220 11579 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 >Feature sequence0205 4465 848 gene locus_tag LOCUS_30230 gene metH 4465 848 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056870.1 protein_id gnl|my_center|LOCUS_30230 5381 6007 gene locus_tag LOCUS_30240 5381 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 7361 7966 gene locus_tag LOCUS_30250 7361 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 8745 9935 gene locus_tag LOCUS_30260 8745 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 10137 11780 gene locus_tag LOCUS_30270 10137 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 >Feature sequence0206 9 478 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccgcatcaaaccaatttgcccaccggaatcgtag 2956 650 gene locus_tag LOCUS_30280 2956 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 4855 3251 gene locus_tag LOCUS_30290 4855 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 6496 5165 gene locus_tag LOCUS_30300 6496 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140919.1 protein_id gnl|my_center|LOCUS_30300 7601 9517 gene locus_tag LOCUS_30310 7601 9517 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_30310 9936 10151 gene locus_tag LOCUS_30320 9936 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 10298 10582 gene locus_tag LOCUS_30330 10298 10582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 11358 11089 gene locus_tag LOCUS_30340 11358 11089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 11771 12034 gene locus_tag LOCUS_30350 11771 12034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 12042 12251 gene locus_tag LOCUS_30360 12042 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 >Feature sequence0207 324 1388 gene locus_tag LOCUS_30370 324 1388 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5M7 protein_id gnl|my_center|LOCUS_30370 1389 2357 gene locus_tag LOCUS_30380 1389 2357 CDS product type II restriction endonuclease BsuBI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 protein_id gnl|my_center|LOCUS_30380 5666 2634 gene locus_tag LOCUS_30390 5666 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058009.1 protein_id gnl|my_center|LOCUS_30390 7504 6566 gene locus_tag LOCUS_30400 7504 6566 CDS product chromosome partitioning ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600639.1 protein_id gnl|my_center|LOCUS_30400 7956 7768 gene locus_tag LOCUS_30410 7956 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 8314 8850 gene locus_tag LOCUS_30420 8314 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 9028 9213 gene locus_tag LOCUS_30430 9028 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 9379 9308 gene locus_tag LOCUS_t00200 9379 9308 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9586 10227 gene locus_tag LOCUS_30440 9586 10227 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI83 protein_id gnl|my_center|LOCUS_30440 11362 10733 gene locus_tag LOCUS_30450 11362 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 11741 11481 gene locus_tag LOCUS_30460 11741 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 12176 11766 gene locus_tag LOCUS_30470 12176 11766 CDS product UPF0332 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X095 protein_id gnl|my_center|LOCUS_30470 12604 12173 gene locus_tag LOCUS_30480 12604 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 >Feature sequence0208 1360 341 gene locus_tag LOCUS_30490 1360 341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055865.1 protein_id gnl|my_center|LOCUS_30490 2123 1677 gene locus_tag LOCUS_30500 2123 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140049.1 protein_id gnl|my_center|LOCUS_30500 2635 2300 gene locus_tag LOCUS_30510 gene fdx 2635 2300 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_30510 3464 4246 gene locus_tag LOCUS_30520 3464 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 5624 4482 gene locus_tag LOCUS_30530 5624 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141800.1 protein_id gnl|my_center|LOCUS_30530 6308 6913 gene locus_tag LOCUS_30540 6308 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 7340 7471 gene locus_tag LOCUS_30550 7340 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 8778 7852 gene locus_tag LOCUS_30560 gene petA 8778 7852 CDS product cytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N5 protein_id gnl|my_center|LOCUS_30560 9489 8950 gene locus_tag LOCUS_30570 gene petC 9489 8950 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N8 protein_id gnl|my_center|LOCUS_30570 9811 10128 gene locus_tag LOCUS_30580 9811 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_30580 11675 10551 gene locus_tag LOCUS_30590 11675 10551 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_30590 12546 12687 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggtacagtgcgacccttggg >Feature sequence0209 1957 5148 gene locus_tag LOCUS_30600 1957 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 5506 6306 gene locus_tag LOCUS_30610 5506 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 7599 6697 gene locus_tag LOCUS_30620 gene hemC 7599 6697 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE4 protein_id gnl|my_center|LOCUS_30620 8229 9416 gene locus_tag LOCUS_30630 gene lysA 8229 9416 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL42 protein_id gnl|my_center|LOCUS_30630 10015 10746 gene locus_tag LOCUS_30640 10015 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 11626 12384 gene locus_tag LOCUS_30650 11626 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 >Feature sequence0210 2692 287 gene locus_tag LOCUS_30660 2692 287 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056828.1 protein_id gnl|my_center|LOCUS_30660 4104 2923 gene locus_tag LOCUS_30670 4104 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 5276 4131 gene locus_tag LOCUS_30680 5276 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 6497 6991 gene locus_tag LOCUS_30690 6497 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 8050 7079 gene locus_tag LOCUS_30700 gene sds 8050 7079 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_30700 9649 9960 gene locus_tag LOCUS_30710 9649 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 9981 10502 gene locus_tag LOCUS_30720 9981 10502 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003606310.1 protein_id gnl|my_center|LOCUS_30720 10685 10509 gene locus_tag LOCUS_30730 10685 10509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 11278 12348 gene locus_tag LOCUS_30740 11278 12348 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence0211 47 157 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtcttggggtctccccaagtaga 1531 602 gene locus_tag LOCUS_30750 1531 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 2374 1688 gene locus_tag LOCUS_30760 2374 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 4139 2631 gene locus_tag LOCUS_30770 4139 2631 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056164.1 protein_id gnl|my_center|LOCUS_30770 5177 5252 gene locus_tag LOCUS_t00210 5177 5252 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5728 5657 gene locus_tag LOCUS_t00220 5728 5657 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5845 5761 gene locus_tag LOCUS_t00230 5845 5761 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7099 6005 gene locus_tag LOCUS_30780 7099 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 8114 9436 gene locus_tag LOCUS_30790 gene rimO 8114 9436 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL8 protein_id gnl|my_center|LOCUS_30790 9762 11180 gene locus_tag LOCUS_30800 9762 11180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142503.1 protein_id gnl|my_center|LOCUS_30800 11608 12438 gene locus_tag LOCUS_30810 gene ycf39 11608 12438 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056872.1 protein_id gnl|my_center|LOCUS_30810 >Feature sequence0212 950 3169 gene locus_tag LOCUS_30820 950 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3635 3267 gene locus_tag LOCUS_30830 3635 3267 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 protein_id gnl|my_center|LOCUS_30830 4098 6038 gene locus_tag LOCUS_30840 4098 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 6526 7104 gene locus_tag LOCUS_30850 6526 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 8746 7310 gene locus_tag LOCUS_30860 gene crtQ 8746 7310 CDS product Zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY9 protein_id gnl|my_center|LOCUS_30860 9130 10005 gene locus_tag LOCUS_30870 9130 10005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 11304 10270 gene locus_tag LOCUS_30880 11304 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 12206 11628 gene locus_tag LOCUS_30890 12206 11628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 protein_id gnl|my_center|LOCUS_30890 >Feature sequence0213 1302 1111 gene locus_tag LOCUS_30900 1302 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 1729 2214 gene locus_tag LOCUS_30910 gene apcA 1729 2214 CDS product allophycocyanin alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50030 protein_id gnl|my_center|LOCUS_30910 2292 2777 gene locus_tag LOCUS_30920 gene apcB 2292 2777 CDS product allophycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50031 protein_id gnl|my_center|LOCUS_30920 2992 3195 gene locus_tag LOCUS_30930 gene apcC 2992 3195 CDS product phycobilisome 7.8 kDa linker polypeptide, allophycocyanin-associated, core inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50036 protein_id gnl|my_center|LOCUS_30930 3392 4792 gene locus_tag LOCUS_30940 3392 4792 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_30940 7571 4917 gene locus_tag LOCUS_30950 7571 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 10361 8718 gene locus_tag LOCUS_30960 10361 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 11870 12400 gene locus_tag LOCUS_30970 11870 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143752.1 protein_id gnl|my_center|LOCUS_30970 >Feature sequence0214 434 1180 gene locus_tag LOCUS_30980 434 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 1147 2004 gene locus_tag LOCUS_30990 1147 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 2241 3143 gene locus_tag LOCUS_31000 2241 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 3148 5556 gene locus_tag LOCUS_31010 3148 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 6369 6578 gene locus_tag LOCUS_31020 6369 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 7196 9763 gene locus_tag LOCUS_31030 7196 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 9982 11142 gene locus_tag LOCUS_31040 9982 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 11084 12406 gene locus_tag LOCUS_31050 11084 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence0215 282 521 gene locus_tag LOCUS_31060 282 521 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141646.1 protein_id gnl|my_center|LOCUS_31060 572 1249 gene locus_tag LOCUS_31070 572 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707254.1 protein_id gnl|my_center|LOCUS_31070 1730 1173 gene locus_tag LOCUS_31080 1730 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 1944 2411 gene locus_tag LOCUS_31090 1944 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31090 2384 2899 gene locus_tag LOCUS_31100 2384 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31100 4691 3369 gene locus_tag LOCUS_31110 4691 3369 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 protein_id gnl|my_center|LOCUS_31110 5026 6036 gene locus_tag LOCUS_31120 5026 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 6473 6643 gene locus_tag LOCUS_31130 6473 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 7914 6916 gene locus_tag LOCUS_31140 7914 6916 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546734.1 protein_id gnl|my_center|LOCUS_31140 8476 9642 gene locus_tag LOCUS_31150 gene corA 8476 9642 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 protein_id gnl|my_center|LOCUS_31150 9901 10659 gene locus_tag LOCUS_31160 9901 10659 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975024.1 protein_id gnl|my_center|LOCUS_31160 12525 11014 gene locus_tag LOCUS_31170 gene pds 12525 11014 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057401.1 protein_id gnl|my_center|LOCUS_31170 >Feature sequence0216 4056 1084 gene locus_tag LOCUS_31180 4056 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 4738 5250 gene locus_tag LOCUS_31190 4738 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 7890 5347 gene locus_tag LOCUS_31200 7890 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 8668 8423 gene locus_tag LOCUS_31210 8668 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 >Feature sequence0217 196 4101 gene locus_tag LOCUS_31220 gene cobN 196 4101 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056744.1 protein_id gnl|my_center|LOCUS_31220 4453 4611 gene locus_tag LOCUS_31230 4453 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 4924 4688 gene locus_tag LOCUS_31240 4924 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 5175 5462 gene locus_tag LOCUS_31250 gene higB 5175 5462 CDS product mRNA interferase HigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64579 protein_id gnl|my_center|LOCUS_31250 5465 5686 gene locus_tag LOCUS_31260 5465 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 7020 6424 gene locus_tag LOCUS_31270 7020 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 8152 7514 gene locus_tag LOCUS_31280 8152 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 8537 9481 gene locus_tag LOCUS_31290 8537 9481 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464393.1 protein_id gnl|my_center|LOCUS_31290 11878 10085 gene locus_tag LOCUS_31300 11878 10085 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence0218 763 5379 gene locus_tag LOCUS_31310 763 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 5807 8080 gene locus_tag LOCUS_31320 5807 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 8100 9359 gene locus_tag LOCUS_31330 8100 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 10846 9515 gene locus_tag LOCUS_31340 10846 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 11894 11307 gene locus_tag LOCUS_31350 11894 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 >Feature sequence0219 365 135 gene locus_tag LOCUS_31360 365 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 554 3460 gene locus_tag LOCUS_31370 554 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 4442 3804 gene locus_tag LOCUS_31380 4442 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 5060 4773 gene locus_tag LOCUS_31390 5060 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 6514 5426 gene locus_tag LOCUS_31400 gene ccsA 6514 5426 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIH3 protein_id gnl|my_center|LOCUS_31400 8722 7028 gene locus_tag LOCUS_31410 8722 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 8795 8992 gene locus_tag LOCUS_31420 8795 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 10179 8989 gene locus_tag LOCUS_31430 gene cofH 10179 8989 CDS product FO synthase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DII8 protein_id gnl|my_center|LOCUS_31430 10807 10607 gene locus_tag LOCUS_31440 10807 10607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 10867 11883 gene locus_tag LOCUS_31450 gene wcaA 10867 11883 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_31450 >Feature sequence0220 702 58 gene locus_tag LOCUS_31460 702 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 4311 934 gene locus_tag LOCUS_31470 gene ppc 4311 934 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X5 protein_id gnl|my_center|LOCUS_31470 4868 4554 gene locus_tag LOCUS_31480 4868 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 5388 8639 gene locus_tag LOCUS_31490 5388 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 10273 9248 gene locus_tag LOCUS_31500 gene purM 10273 9248 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY2 protein_id gnl|my_center|LOCUS_31500 12113 10734 gene locus_tag LOCUS_31510 12113 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence0221 590 967 gene locus_tag LOCUS_31520 590 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 1002 1208 gene locus_tag LOCUS_31530 1002 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 1983 2462 gene locus_tag LOCUS_31540 1983 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 3245 2571 gene locus_tag LOCUS_31550 3245 2571 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR9 protein_id gnl|my_center|LOCUS_31550 4192 3266 gene locus_tag LOCUS_31560 gene fabD 4192 3266 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMS0 protein_id gnl|my_center|LOCUS_31560 5549 4515 gene locus_tag LOCUS_31570 gene fabH 5549 4515 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL4 protein_id gnl|my_center|LOCUS_31570 6656 5625 gene locus_tag LOCUS_31580 gene plsX 6656 5625 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL5 protein_id gnl|my_center|LOCUS_31580 7987 6989 gene locus_tag LOCUS_31590 gene pheS 7987 6989 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL09 protein_id gnl|my_center|LOCUS_31590 8300 8689 gene locus_tag LOCUS_31600 8300 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 8731 9567 gene locus_tag LOCUS_31610 gene surE 8731 9567 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI06 protein_id gnl|my_center|LOCUS_31610 9684 10013 gene locus_tag LOCUS_31620 9684 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 11816 10164 gene locus_tag LOCUS_31630 11816 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141331.1 protein_id gnl|my_center|LOCUS_31630 >Feature sequence0222 493 1677 gene locus_tag LOCUS_31640 493 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140948.1 protein_id gnl|my_center|LOCUS_31640 4161 1831 gene locus_tag LOCUS_31650 4161 1831 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVC5 protein_id gnl|my_center|LOCUS_31650 4486 4416 gene locus_tag LOCUS_t00240 4486 4416 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4567 4493 gene locus_tag LOCUS_t00250 4567 4493 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5440 4589 gene locus_tag LOCUS_31660 5440 4589 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027437.1 protein_id gnl|my_center|LOCUS_31660 5656 5584 gene locus_tag LOCUS_t00260 5656 5584 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5735 5661 gene locus_tag LOCUS_t00270 5735 5661 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5819 5746 gene locus_tag LOCUS_t00280 5819 5746 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5910 5836 gene locus_tag LOCUS_t00290 5910 5836 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5988 5915 gene locus_tag LOCUS_t00300 5988 5915 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6072 5990 gene locus_tag LOCUS_t00310 6072 5990 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6174 6097 gene locus_tag LOCUS_t00320 6174 6097 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6276 6202 gene locus_tag LOCUS_t00330 6276 6202 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6425 6352 gene locus_tag LOCUS_t00340 6425 6352 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6507 6431 gene locus_tag LOCUS_t00350 6507 6431 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6651 6576 gene locus_tag LOCUS_t00360 6651 6576 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 6856 6766 gene locus_tag LOCUS_t00370 6856 6766 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6933 6860 gene locus_tag LOCUS_t00380 6933 6860 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7137 7063 gene locus_tag LOCUS_t00390 7137 7063 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7419 7345 gene locus_tag LOCUS_t00400 7419 7345 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 7766 7692 gene locus_tag LOCUS_t00410 7766 7692 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7877 7800 gene locus_tag LOCUS_t00420 7877 7800 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8829 9038 gene locus_tag LOCUS_31670 8829 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 9824 9438 gene locus_tag LOCUS_31680 9824 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 10479 9949 gene locus_tag LOCUS_31690 10479 9949 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889035.1 protein_id gnl|my_center|LOCUS_31690 11756 10875 gene locus_tag LOCUS_31700 11756 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 >Feature sequence0223 432 773 gene locus_tag LOCUS_31710 432 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 1254 3926 gene locus_tag LOCUS_31720 1254 3926 CDS product B12-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058092.1 protein_id gnl|my_center|LOCUS_31720 4734 6827 gene locus_tag LOCUS_31730 gene rne 4734 6827 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056445.1 protein_id gnl|my_center|LOCUS_31730 7117 7743 gene locus_tag LOCUS_31740 gene rnhB 7117 7743 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE1 protein_id gnl|my_center|LOCUS_31740 7962 9014 gene locus_tag LOCUS_31750 7962 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 9691 9320 gene locus_tag LOCUS_31760 9691 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 10692 10105 gene locus_tag LOCUS_31770 10692 10105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057548.1 protein_id gnl|my_center|LOCUS_31770 11176 12021 gene locus_tag LOCUS_31780 gene pheA 11176 12021 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH54 protein_id gnl|my_center|LOCUS_31780 >Feature sequence0224 547 275 gene locus_tag LOCUS_31790 547 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 1175 699 gene locus_tag LOCUS_31800 1175 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 1468 1725 gene locus_tag LOCUS_31810 1468 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 2339 2082 gene locus_tag LOCUS_31820 2339 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 2567 6319 gene locus_tag LOCUS_31830 2567 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 7473 6991 gene locus_tag LOCUS_31840 7473 6991 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058135.1 protein_id gnl|my_center|LOCUS_31840 7815 9827 gene locus_tag LOCUS_31850 7815 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 8757 8833 gene locus_tag LOCUS_t00430 8757 8833 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10208 12037 gene locus_tag LOCUS_31860 10208 12037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 >Feature sequence0225 <1 4222 gene locus_tag LOCUS_31870 <1 4222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058208.1:translocation/assembly module TamB 7169 4326 gene locus_tag LOCUS_31880 7169 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 9222 7729 gene locus_tag LOCUS_31890 9222 7729 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_31890 11278 9452 gene locus_tag LOCUS_31900 11278 9452 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142407.1 protein_id gnl|my_center|LOCUS_31900 >Feature sequence0226 748 999 gene locus_tag LOCUS_31910 748 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 965 1333 gene locus_tag LOCUS_31920 965 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 1702 2904 gene locus_tag LOCUS_31930 1702 2904 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_31930 3264 4166 gene locus_tag LOCUS_31940 3264 4166 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_31940 6354 4555 gene locus_tag LOCUS_31950 6354 4555 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_31950 7640 6633 gene locus_tag LOCUS_31960 7640 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 9425 11395 gene locus_tag LOCUS_31970 gene acsA 9425 11395 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH2 protein_id gnl|my_center|LOCUS_31970 >Feature sequence0227 785 366 gene locus_tag LOCUS_31980 785 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_31980 1030 782 gene locus_tag LOCUS_31990 1030 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 4029 1861 gene locus_tag LOCUS_32000 4029 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056596.1 protein_id gnl|my_center|LOCUS_32000 4421 4618 gene locus_tag LOCUS_32010 4421 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 4837 6258 gene locus_tag LOCUS_32020 gene pcxA 4837 6258 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59112 protein_id gnl|my_center|LOCUS_32020 7697 6828 gene locus_tag LOCUS_32030 7697 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 9575 8409 gene locus_tag LOCUS_32040 9575 8409 CDS product succinyldiaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143457.1 protein_id gnl|my_center|LOCUS_32040 9938 9609 gene locus_tag LOCUS_32050 gene trxA 9938 9609 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UU9 protein_id gnl|my_center|LOCUS_32050 10941 10177 gene locus_tag LOCUS_32060 gene pspA 10941 10177 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_32060 >Feature sequence0228 434 754 gene locus_tag LOCUS_32070 434 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 1046 1366 gene locus_tag LOCUS_32080 1046 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 1363 1728 gene locus_tag LOCUS_32090 1363 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 1935 2381 gene locus_tag LOCUS_32100 1935 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 2864 2541 gene locus_tag LOCUS_32110 2864 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 3040 2762 gene locus_tag LOCUS_32120 3040 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 3286 3041 gene locus_tag LOCUS_32130 3286 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249168.1 protein_id gnl|my_center|LOCUS_32130 3607 3356 gene locus_tag LOCUS_32140 3607 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_32140 3804 4124 gene locus_tag LOCUS_32150 3804 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 4591 4394 gene locus_tag LOCUS_32160 4591 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 8198 4941 gene locus_tag LOCUS_32170 8198 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 10011 8638 gene locus_tag LOCUS_32180 gene murF 10011 8638 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM9 protein_id gnl|my_center|LOCUS_32180 10467 11753 gene locus_tag LOCUS_32190 10467 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 >Feature sequence0229 1429 695 gene locus_tag LOCUS_32200 1429 695 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_32200 4514 1416 gene locus_tag LOCUS_32210 gene hsdR-1 4514 1416 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_32210 6102 4771 gene locus_tag LOCUS_32220 6102 4771 CDS product type I restriction-modification enzyme, S subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010923.2 protein_id gnl|my_center|LOCUS_32220 6866 6132 gene locus_tag LOCUS_32230 6866 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 8058 6937 gene locus_tag LOCUS_32240 8058 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 9832 8102 gene locus_tag LOCUS_32250 9832 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 10210 10425 gene locus_tag LOCUS_32260 10210 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 11137 10805 gene locus_tag LOCUS_32270 11137 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 >Feature sequence0230 294 2000 gene locus_tag LOCUS_32280 294 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 3527 2334 gene locus_tag LOCUS_32290 3527 2334 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_32290 3544 4476 gene locus_tag LOCUS_32300 3544 4476 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103054.1 protein_id gnl|my_center|LOCUS_32300 5616 4828 gene locus_tag LOCUS_32310 5616 4828 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 protein_id gnl|my_center|LOCUS_32310 7252 5627 gene locus_tag LOCUS_32320 7252 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 7839 7639 gene locus_tag LOCUS_32330 7839 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 8847 8116 gene locus_tag LOCUS_32340 8847 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 9262 9047 gene locus_tag LOCUS_32350 9262 9047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 9689 9252 gene locus_tag LOCUS_32360 9689 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002249008.2 protein_id gnl|my_center|LOCUS_32360 11152 9818 gene locus_tag LOCUS_32370 11152 9818 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_32370 11697 11152 gene locus_tag LOCUS_32380 11697 11152 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence0231 4118 8155 gene locus_tag LOCUS_32390 4118 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 9713 8760 gene locus_tag LOCUS_32400 gene cysK 9713 8760 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI7 protein_id gnl|my_center|LOCUS_32400 10693 11601 gene locus_tag LOCUS_32410 10693 11601 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056436.1 protein_id gnl|my_center|LOCUS_32410 >Feature sequence0232 540 734 gene locus_tag LOCUS_32420 540 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 959 1780 gene locus_tag LOCUS_32430 959 1780 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_32430 1920 2534 gene locus_tag LOCUS_32440 1920 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 2953 3633 gene locus_tag LOCUS_32450 gene surE 2953 3633 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_32450 3825 3658 gene locus_tag LOCUS_32460 3825 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 4894 3929 gene locus_tag LOCUS_32470 4894 3929 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_32470 5496 5278 gene locus_tag LOCUS_32480 5496 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32480 5698 5468 gene locus_tag LOCUS_32490 5698 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 5880 5701 gene locus_tag LOCUS_32500 5880 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32500 10071 6595 gene locus_tag LOCUS_32510 10071 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 11266 10829 gene locus_tag LOCUS_32520 11266 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 >Feature sequence0233 158 2032 gene locus_tag LOCUS_32530 158 2032 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_32530 2492 4375 gene locus_tag LOCUS_32540 2492 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144229.1 protein_id gnl|my_center|LOCUS_32540 4656 6155 gene locus_tag LOCUS_32550 4656 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 6548 7786 gene locus_tag LOCUS_32560 6548 7786 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268208.1 protein_id gnl|my_center|LOCUS_32560 8244 7960 gene locus_tag LOCUS_32570 8244 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 8435 8662 gene locus_tag LOCUS_32580 8435 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 9073 9489 gene locus_tag LOCUS_32590 9073 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 9477 9824 gene locus_tag LOCUS_32600 9477 9824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 10487 11336 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccactaattcggcatcccactaggggatgcaact >Feature sequence0234 545 1201 gene locus_tag LOCUS_32610 545 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 2331 3281 gene locus_tag LOCUS_32620 2331 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 3278 4306 gene locus_tag LOCUS_32630 3278 4306 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_32630 5448 4849 gene locus_tag LOCUS_32640 5448 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 6316 6924 gene locus_tag LOCUS_32650 gene rpsD 6316 6924 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59134 protein_id gnl|my_center|LOCUS_32650 8197 7178 gene locus_tag LOCUS_32660 gene moaA 8197 7178 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCF5 protein_id gnl|my_center|LOCUS_32660 8909 9367 gene locus_tag LOCUS_32670 8909 9367 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_32670 10323 9679 gene locus_tag LOCUS_32680 gene lrtA 10323 9679 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_32680 >Feature sequence0235 205 519 gene locus_tag LOCUS_32690 205 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 841 1401 gene locus_tag LOCUS_32700 841 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 1998 5108 gene locus_tag LOCUS_32710 gene cupB5 1998 5108 CDS product adhesive protein CupB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113036.1 protein_id gnl|my_center|LOCUS_32710 6084 5215 gene locus_tag LOCUS_32720 6084 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087510.1 protein_id gnl|my_center|LOCUS_32720 9097 6497 gene locus_tag LOCUS_32730 9097 6497 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118806.1 protein_id gnl|my_center|LOCUS_32730 10012 9830 gene locus_tag LOCUS_32740 10012 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 10400 11593 gene locus_tag LOCUS_32750 10400 11593 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_32750 >Feature sequence0236 4102 3509 gene locus_tag LOCUS_32760 4102 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 5385 4357 gene locus_tag LOCUS_32770 5385 4357 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056527.1 protein_id gnl|my_center|LOCUS_32770 6359 5727 gene locus_tag LOCUS_32780 6359 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 10948 6374 gene locus_tag LOCUS_32790 10948 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 >Feature sequence0237 407 799 gene locus_tag LOCUS_32800 407 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701840.1 protein_id gnl|my_center|LOCUS_32800 2306 906 gene locus_tag LOCUS_32810 2306 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 3430 3224 gene locus_tag LOCUS_32820 3430 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 5088 3805 gene locus_tag LOCUS_32830 5088 3805 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC8 protein_id gnl|my_center|LOCUS_32830 5921 5484 gene locus_tag LOCUS_32840 5921 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057140.1 protein_id gnl|my_center|LOCUS_32840 7808 6747 gene locus_tag LOCUS_32850 7808 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 8507 9790 gene locus_tag LOCUS_32860 8507 9790 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057131.1 protein_id gnl|my_center|LOCUS_32860 >Feature sequence0238 2265 31 gene locus_tag LOCUS_32870 2265 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 2819 3475 gene locus_tag LOCUS_32880 2819 3475 CDS product KHG-KDPG bifunctional aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144255.1 protein_id gnl|my_center|LOCUS_32880 3926 4438 gene locus_tag LOCUS_32890 3926 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 5736 4861 gene locus_tag LOCUS_32900 5736 4861 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142171.1 protein_id gnl|my_center|LOCUS_32900 6382 5864 gene locus_tag LOCUS_32910 6382 5864 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144323.1 protein_id gnl|my_center|LOCUS_32910 7506 6853 gene locus_tag LOCUS_32920 7506 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141284.1 protein_id gnl|my_center|LOCUS_32920 7936 8472 gene locus_tag LOCUS_32930 7936 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 9064 8459 gene locus_tag LOCUS_32940 9064 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 10028 9183 gene locus_tag LOCUS_32950 10028 9183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 protein_id gnl|my_center|LOCUS_32950 10648 10337 gene locus_tag LOCUS_32960 10648 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 11069 10803 gene locus_tag LOCUS_32970 11069 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 11411 11100 gene locus_tag LOCUS_32980 11411 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence0239 2586 562 gene locus_tag LOCUS_32990 2586 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 4525 2834 gene locus_tag LOCUS_33000 gene radA 4525 2834 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX9 protein_id gnl|my_center|LOCUS_33000 4688 5425 gene locus_tag LOCUS_33010 4688 5425 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142663.1 protein_id gnl|my_center|LOCUS_33010 5491 6132 gene locus_tag LOCUS_33020 5491 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 protein_id gnl|my_center|LOCUS_33020 6619 7734 gene locus_tag LOCUS_33030 6619 7734 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_33030 7980 8321 gene locus_tag LOCUS_33040 7980 8321 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055899.1 protein_id gnl|my_center|LOCUS_33040 8681 9751 gene locus_tag LOCUS_33050 gene hrcA 8681 9751 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU4 protein_id gnl|my_center|LOCUS_33050 10138 10479 gene locus_tag LOCUS_33060 10138 10479 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL6 protein_id gnl|my_center|LOCUS_33060 11386 11550 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtcttggggtctccccaagt >Feature sequence0240 146 340 gene locus_tag LOCUS_33070 146 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 837 319 gene locus_tag LOCUS_33080 837 319 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_33080 3894 1507 gene locus_tag LOCUS_33090 3894 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 5466 4864 gene locus_tag LOCUS_33100 5466 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 7580 5457 gene locus_tag LOCUS_33110 7580 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 8693 9901 gene locus_tag LOCUS_33120 8693 9901 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM4 protein_id gnl|my_center|LOCUS_33120 10122 9898 gene locus_tag LOCUS_33130 10122 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 11241 10243 gene locus_tag LOCUS_33140 11241 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 >Feature sequence0241 721 1284 gene locus_tag LOCUS_33150 721 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140140.1 protein_id gnl|my_center|LOCUS_33150 2034 1555 gene locus_tag LOCUS_33160 2034 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 3246 2242 gene locus_tag LOCUS_33170 3246 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 4823 3621 gene locus_tag LOCUS_33180 4823 3621 CDS product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKP1 protein_id gnl|my_center|LOCUS_33180 5885 6253 gene locus_tag LOCUS_33190 gene rplS 5885 6253 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC4 protein_id gnl|my_center|LOCUS_33190 6347 6420 gene locus_tag LOCUS_t00440 6347 6420 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 6648 6872 gene locus_tag LOCUS_33200 gene secE 6648 6872 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM30 protein_id gnl|my_center|LOCUS_33200 6872 7513 gene locus_tag LOCUS_33210 gene nusG 6872 7513 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM29 protein_id gnl|my_center|LOCUS_33210 7531 7956 gene locus_tag LOCUS_33220 gene rplK 7531 7956 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM28 protein_id gnl|my_center|LOCUS_33220 8067 8780 gene locus_tag LOCUS_33230 gene rplA 8067 8780 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM27 protein_id gnl|my_center|LOCUS_33230 9111 9659 gene locus_tag LOCUS_33240 gene rplJ 9111 9659 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM26 protein_id gnl|my_center|LOCUS_33240 9811 10203 gene locus_tag LOCUS_33250 gene rplL 9811 10203 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM25 protein_id gnl|my_center|LOCUS_33250 11225 10476 gene locus_tag LOCUS_33260 11225 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 >Feature sequence0242 <1 1443 gene locus_tag LOCUS_33270 <1 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057580.1:RND transporter 1785 2960 gene locus_tag LOCUS_33280 1785 2960 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_33280 3523 3266 gene locus_tag LOCUS_33290 3523 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 5884 4178 gene locus_tag LOCUS_33300 gene ureC 5884 4178 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMV6 protein_id gnl|my_center|LOCUS_33300 6211 5906 gene locus_tag LOCUS_33310 gene ureB 6211 5906 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLZ6 protein_id gnl|my_center|LOCUS_33310 6556 6254 gene locus_tag LOCUS_33320 gene ureA 6556 6254 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK85 protein_id gnl|my_center|LOCUS_33320 7937 7056 gene locus_tag LOCUS_33330 gene ureD 7937 7056 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF7 protein_id gnl|my_center|LOCUS_33330 8633 7938 gene locus_tag LOCUS_33340 gene ureF 8633 7938 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ63 protein_id gnl|my_center|LOCUS_33340 9142 8903 gene locus_tag LOCUS_33350 9142 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 9919 9143 gene locus_tag LOCUS_33360 9919 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 10641 9916 gene locus_tag LOCUS_33370 10641 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 11272 10841 gene locus_tag LOCUS_33380 gene ureE 11272 10841 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ62 protein_id gnl|my_center|LOCUS_33380 >Feature sequence0243 348 1292 gene locus_tag LOCUS_33390 348 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 1834 1493 gene locus_tag LOCUS_33400 1834 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 2238 1804 gene locus_tag LOCUS_33410 2238 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 2972 2526 gene locus_tag LOCUS_33420 2972 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 4276 2975 gene locus_tag LOCUS_33430 4276 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979630.1 protein_id gnl|my_center|LOCUS_33430 4675 6330 gene locus_tag LOCUS_33440 4675 6330 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG7 protein_id gnl|my_center|LOCUS_33440 7739 6693 gene locus_tag LOCUS_33450 7739 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 8352 7732 gene locus_tag LOCUS_33460 8352 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 8606 8875 gene locus_tag LOCUS_33470 8606 8875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 9095 9523 gene locus_tag LOCUS_33480 9095 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 protein_id gnl|my_center|LOCUS_33480 9930 10106 gene locus_tag LOCUS_33490 9930 10106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 10598 10194 gene locus_tag LOCUS_33500 10598 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 10879 10586 gene locus_tag LOCUS_33510 10879 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 11163 11372 gene locus_tag LOCUS_33520 11163 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 >Feature sequence0244 2022 295 gene locus_tag LOCUS_33530 2022 295 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141774.1 protein_id gnl|my_center|LOCUS_33530 4230 2503 gene locus_tag LOCUS_33540 4230 2503 CDS product diflavin flavoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141773.1 protein_id gnl|my_center|LOCUS_33540 5000 7192 gene locus_tag LOCUS_33550 5000 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 7580 8107 gene locus_tag LOCUS_33560 7580 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055861.1 protein_id gnl|my_center|LOCUS_33560 8296 8508 gene locus_tag LOCUS_33570 8296 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 8635 9318 gene locus_tag LOCUS_33580 8635 9318 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056348.1 protein_id gnl|my_center|LOCUS_33580 9573 11291 gene locus_tag LOCUS_33590 9573 11291 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_33590 >Feature sequence0245 180 557 gene locus_tag LOCUS_33600 180 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 596 1033 gene locus_tag LOCUS_33610 596 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 2561 1593 gene locus_tag LOCUS_33620 2561 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 3605 2790 gene locus_tag LOCUS_33630 3605 2790 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 protein_id gnl|my_center|LOCUS_33630 4766 3954 gene locus_tag LOCUS_33640 4766 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 5639 5881 gene locus_tag LOCUS_33650 5639 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 7996 6710 gene locus_tag LOCUS_33660 gene ftsZ 7996 6710 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNW0 protein_id gnl|my_center|LOCUS_33660 8997 8152 gene locus_tag LOCUS_33670 8997 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055991.1 protein_id gnl|my_center|LOCUS_33670 9454 9236 gene locus_tag LOCUS_33680 9454 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 10307 9729 gene locus_tag LOCUS_33690 10307 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 <11313 10635 gene locus_tag LOCUS_33700 <11313 10635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002287525.1:transposase note possible pseudo, frameshifted >Feature sequence0246 5759 162 gene locus_tag LOCUS_33710 5759 162 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_33710 6095 6238 gene locus_tag LOCUS_33720 6095 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 9560 6501 gene locus_tag LOCUS_33730 gene sbcC 9560 6501 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KM67 protein_id gnl|my_center|LOCUS_33730 11089 9899 gene locus_tag LOCUS_33740 gene sbcD 11089 9899 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT45 protein_id gnl|my_center|LOCUS_33740 >Feature sequence0247 3236 498 gene locus_tag LOCUS_33750 3236 498 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058103.1 protein_id gnl|my_center|LOCUS_33750 4568 5662 gene locus_tag LOCUS_33760 4568 5662 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_33760 6406 6774 gene locus_tag LOCUS_33770 6406 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 6796 8412 gene locus_tag LOCUS_33780 6796 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 >Feature sequence0248 973 140 gene locus_tag LOCUS_33790 973 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702708.1 protein_id gnl|my_center|LOCUS_33790 2316 1414 gene locus_tag LOCUS_33800 gene crtR 2316 1414 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_33800 2783 4570 gene locus_tag LOCUS_33810 2783 4570 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP1 protein_id gnl|my_center|LOCUS_33810 5458 5039 gene locus_tag LOCUS_33820 5458 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 5760 5545 gene locus_tag LOCUS_33830 5760 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 6241 6041 gene locus_tag LOCUS_33840 6241 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 6724 6245 gene locus_tag LOCUS_33850 6724 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 7273 6992 gene locus_tag LOCUS_33860 7273 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 7612 7869 gene locus_tag LOCUS_33870 7612 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 8374 8153 gene locus_tag LOCUS_33880 8374 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 8819 8361 gene locus_tag LOCUS_33890 8819 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 10807 9377 gene locus_tag LOCUS_33900 gene ycf46 10807 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141648.1 protein_id gnl|my_center|LOCUS_33900 11184 10954 gene locus_tag LOCUS_33910 11184 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 >Feature sequence0249 609 250 gene locus_tag LOCUS_33920 609 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 1894 791 gene locus_tag LOCUS_33930 1894 791 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533459.1 protein_id gnl|my_center|LOCUS_33930 3083 1950 gene locus_tag LOCUS_33940 3083 1950 CDS product gamma-butyrobetaine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 protein_id gnl|my_center|LOCUS_33940 4724 3408 gene locus_tag LOCUS_33950 4724 3408 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533465.1 protein_id gnl|my_center|LOCUS_33950 5842 4772 gene locus_tag LOCUS_33960 5842 4772 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708578.1 protein_id gnl|my_center|LOCUS_33960 6760 6068 gene locus_tag LOCUS_33970 6760 6068 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533464.1 protein_id gnl|my_center|LOCUS_33970 8341 7454 gene locus_tag LOCUS_33980 8341 7454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143303.1 protein_id gnl|my_center|LOCUS_33980 9537 8752 gene locus_tag LOCUS_33990 9537 8752 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_33990 9824 10777 gene locus_tag LOCUS_34000 9824 10777 CDS product manganese ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143301.1 protein_id gnl|my_center|LOCUS_34000 >Feature sequence0250 10029 679 gene locus_tag LOCUS_34010 10029 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 10824 11054 gene locus_tag LOCUS_34020 10824 11054 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_34020 >Feature sequence0251 1248 145 gene locus_tag LOCUS_34030 1248 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 1570 1238 gene locus_tag LOCUS_34040 gene ycf20 1570 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 protein_id gnl|my_center|LOCUS_34040 2097 2420 gene locus_tag LOCUS_34050 2097 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140979.1 protein_id gnl|my_center|LOCUS_34050 2401 2628 gene locus_tag LOCUS_34060 2401 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 2790 4889 gene locus_tag LOCUS_34070 2790 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 5558 7180 gene locus_tag LOCUS_34080 5558 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 7369 10845 gene locus_tag LOCUS_34090 7369 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_34090 >Feature sequence0252 253 777 gene locus_tag LOCUS_34100 253 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 1188 1418 gene locus_tag LOCUS_34110 1188 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 1519 3243 gene locus_tag LOCUS_34120 1519 3243 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_34120 4371 3727 gene locus_tag LOCUS_34130 4371 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_34130 5700 4375 gene locus_tag LOCUS_34140 5700 4375 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_34140 6235 5942 gene locus_tag LOCUS_34150 6235 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125696.1 protein_id gnl|my_center|LOCUS_34150 8489 6831 gene locus_tag LOCUS_34160 gene mutL 8489 6831 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058297.1 protein_id gnl|my_center|LOCUS_34160 9267 8719 gene locus_tag LOCUS_34170 9267 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 9533 9820 gene locus_tag LOCUS_34180 9533 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 10025 10588 gene locus_tag LOCUS_34190 10025 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 >Feature sequence0253 967 566 gene locus_tag LOCUS_34200 967 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 1250 951 gene locus_tag LOCUS_34210 1250 951 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_34210 1678 1932 gene locus_tag LOCUS_34220 1678 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 1997 2242 gene locus_tag LOCUS_34230 1997 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 2239 3174 gene locus_tag LOCUS_34240 gene queG 2239 3174 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA9 protein_id gnl|my_center|LOCUS_34240 4350 3277 gene locus_tag LOCUS_34250 4350 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 4298 4621 gene locus_tag LOCUS_34260 4298 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 5112 5930 gene locus_tag LOCUS_34270 5112 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_34270 7128 6466 gene locus_tag LOCUS_34280 7128 6466 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 protein_id gnl|my_center|LOCUS_34280 7742 7128 gene locus_tag LOCUS_34290 7742 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057650.1 protein_id gnl|my_center|LOCUS_34290 8038 7742 gene locus_tag LOCUS_34300 8038 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057651.1 protein_id gnl|my_center|LOCUS_34300 8302 8045 gene locus_tag LOCUS_34310 8302 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 protein_id gnl|my_center|LOCUS_34310 8688 8299 gene locus_tag LOCUS_34320 8688 8299 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057653.1 protein_id gnl|my_center|LOCUS_34320 10280 8685 gene locus_tag LOCUS_34330 gene ndhD5 10280 8685 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057654.1 protein_id gnl|my_center|LOCUS_34330 10528 10277 gene locus_tag LOCUS_34340 10528 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence0254 814 398 gene locus_tag LOCUS_34350 814 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 2159 807 gene locus_tag LOCUS_34360 2159 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 3491 2160 gene locus_tag LOCUS_34370 3491 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 4034 3687 gene locus_tag LOCUS_34380 4034 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 4153 4302 gene locus_tag LOCUS_34390 4153 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 7355 4734 gene locus_tag LOCUS_34400 gene clpB1 7355 4734 CDS product chaperone protein ClpB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ40 protein_id gnl|my_center|LOCUS_34400 8030 8569 gene locus_tag LOCUS_34410 8030 8569 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 protein_id gnl|my_center|LOCUS_34410 8745 9584 gene locus_tag LOCUS_34420 8745 9584 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056776.1 protein_id gnl|my_center|LOCUS_34420 10818 9949 gene locus_tag LOCUS_34430 10818 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 >Feature sequence0255 222 1856 gene locus_tag LOCUS_34440 222 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142479.1 protein_id gnl|my_center|LOCUS_34440 3162 8147 gene locus_tag LOCUS_34450 3162 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 8267 8043 gene locus_tag LOCUS_34460 8267 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 10252 8927 gene locus_tag LOCUS_34470 10252 8927 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057746.1 protein_id gnl|my_center|LOCUS_34470 10982 10305 gene locus_tag LOCUS_34480 10982 10305 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057747.1 protein_id gnl|my_center|LOCUS_34480 >Feature sequence0256 1463 363 gene locus_tag LOCUS_34490 gene yubA 1463 363 CDS product UPF0118 membrane protein YubA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32086 protein_id gnl|my_center|LOCUS_34490 2464 2243 gene locus_tag LOCUS_34500 2464 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058260.1 protein_id gnl|my_center|LOCUS_34500 3981 2908 gene locus_tag LOCUS_34510 3981 2908 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057238.1 protein_id gnl|my_center|LOCUS_34510 4500 4715 gene locus_tag LOCUS_34520 4500 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 8428 5417 gene locus_tag LOCUS_34530 8428 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 10512 8704 gene locus_tag LOCUS_34540 10512 8704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 >Feature sequence0257 692 1024 gene locus_tag LOCUS_34550 692 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 1061 1438 gene locus_tag LOCUS_34560 1061 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144314.1 protein_id gnl|my_center|LOCUS_34560 1771 2379 gene locus_tag LOCUS_34570 1771 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 4439 2889 gene locus_tag LOCUS_34580 gene panC/cmk 4439 2889 CDS product bifunctional pantoate ligase/cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG73 protein_id gnl|my_center|LOCUS_34580 5071 4553 gene locus_tag LOCUS_34590 5071 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 6068 7570 gene locus_tag LOCUS_34600 6068 7570 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058264.1 protein_id gnl|my_center|LOCUS_34600 7711 9168 gene locus_tag LOCUS_34610 7711 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_34610 9345 10517 gene locus_tag LOCUS_34620 gene aspC 9345 10517 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG0 protein_id gnl|my_center|LOCUS_34620 >Feature sequence0258 1001 171 gene locus_tag LOCUS_34630 gene pstB 1001 171 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCU7 protein_id gnl|my_center|LOCUS_34630 2211 1393 gene locus_tag LOCUS_34640 2211 1393 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG4 protein_id gnl|my_center|LOCUS_34640 3440 2487 gene locus_tag LOCUS_34650 3440 2487 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG5 protein_id gnl|my_center|LOCUS_34650 4152 5219 gene locus_tag LOCUS_34660 gene bioB 4152 5219 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT7 protein_id gnl|my_center|LOCUS_34660 5381 6031 gene locus_tag LOCUS_34670 5381 6031 CDS product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056745.1 protein_id gnl|my_center|LOCUS_34670 6236 6742 gene locus_tag LOCUS_34680 gene lspA 6236 6742 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA3 protein_id gnl|my_center|LOCUS_34680 6793 7917 gene locus_tag LOCUS_34690 6793 7917 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257745.1 protein_id gnl|my_center|LOCUS_34690 8350 10626 gene locus_tag LOCUS_34700 8350 10626 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057331.1 protein_id gnl|my_center|LOCUS_34700 >Feature sequence0259 705 88 gene locus_tag LOCUS_34710 705 88 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142214.1 protein_id gnl|my_center|LOCUS_34710 1413 1225 gene locus_tag LOCUS_34720 1413 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 3277 1400 gene locus_tag LOCUS_34730 3277 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 4014 5165 gene locus_tag LOCUS_34740 4014 5165 CDS product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125189.1 protein_id gnl|my_center|LOCUS_34740 5293 5745 gene locus_tag LOCUS_34750 5293 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058296.1 protein_id gnl|my_center|LOCUS_34750 6419 9214 gene locus_tag LOCUS_34760 6419 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 9462 10736 gene locus_tag LOCUS_34770 gene crtH 9462 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 protein_id gnl|my_center|LOCUS_34770 >Feature sequence0260 1547 51 gene locus_tag LOCUS_34780 1547 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 2711 1668 gene locus_tag LOCUS_34790 2711 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 2884 4050 gene locus_tag LOCUS_34800 2884 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 4463 5683 gene locus_tag LOCUS_34810 4463 5683 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_34810 6263 5943 gene locus_tag LOCUS_34820 6263 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 6848 6600 gene locus_tag LOCUS_34830 6848 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 7083 9047 gene locus_tag LOCUS_34840 7083 9047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 9249 9575 gene locus_tag LOCUS_34850 9249 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 9787 10200 gene locus_tag LOCUS_34860 9787 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 10188 10523 gene locus_tag LOCUS_34870 10188 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 >Feature sequence0261 867 100 gene locus_tag LOCUS_34880 gene fabG 867 100 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_34880 1017 1334 gene locus_tag LOCUS_34890 gene trxM1 1017 1334 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGN0 protein_id gnl|my_center|LOCUS_34890 1949 1656 gene locus_tag LOCUS_34900 1949 1656 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141908.1 protein_id gnl|my_center|LOCUS_34900 2215 1946 gene locus_tag LOCUS_34910 2215 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 4375 2639 gene locus_tag LOCUS_34920 4375 2639 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084171.1 protein_id gnl|my_center|LOCUS_34920 5631 4876 gene locus_tag LOCUS_34930 5631 4876 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973635.1 protein_id gnl|my_center|LOCUS_34930 7220 8587 gene locus_tag LOCUS_34940 7220 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 10190 8610 gene locus_tag LOCUS_34950 10190 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 >Feature sequence0262 850 296 gene locus_tag LOCUS_34960 850 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 2368 2183 gene locus_tag LOCUS_34970 2368 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 3987 2356 gene locus_tag LOCUS_34980 3987 2356 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 protein_id gnl|my_center|LOCUS_34980 4781 4518 gene locus_tag LOCUS_34990 4781 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 5055 5876 gene locus_tag LOCUS_35000 5055 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 5869 9531 gene locus_tag LOCUS_35010 5869 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 10009 10275 gene locus_tag LOCUS_35020 10009 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 >Feature sequence0263 2082 307 gene locus_tag LOCUS_35030 2082 307 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_35030 3104 7822 gene locus_tag LOCUS_35040 3104 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 8536 8048 gene locus_tag LOCUS_35050 8536 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 9675 8542 gene locus_tag LOCUS_35060 9675 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 10429 9920 gene locus_tag LOCUS_35070 10429 9920 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_35070 >Feature sequence0264 1303 428 gene locus_tag LOCUS_35080 1303 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 2396 5119 gene locus_tag LOCUS_35090 2396 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 5837 7273 gene locus_tag LOCUS_35100 gene pleD 5837 7273 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971526.1 protein_id gnl|my_center|LOCUS_35100 7880 9853 gene locus_tag LOCUS_35110 7880 9853 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211122.1 protein_id gnl|my_center|LOCUS_35110 >Feature sequence0265 925 3552 gene locus_tag LOCUS_35120 925 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 5142 3790 gene locus_tag LOCUS_35130 5142 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 6064 5354 gene locus_tag LOCUS_35140 6064 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 6786 6244 gene locus_tag LOCUS_35150 6786 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 9493 7316 gene locus_tag LOCUS_35160 gene recQ 9493 7316 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142623.1 protein_id gnl|my_center|LOCUS_35160 9587 9775 gene locus_tag LOCUS_35170 9587 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 10048 10303 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttacgcttcttcggaagttgaattagtggaaac >Feature sequence0266 421 1548 gene locus_tag LOCUS_35180 gene ribD 421 1548 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH08 protein_id gnl|my_center|LOCUS_35180 2000 2893 gene locus_tag LOCUS_35190 2000 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 3229 3594 gene locus_tag LOCUS_35200 3229 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35200 3613 4221 gene locus_tag LOCUS_35210 gene cheC44H 3613 4221 CDS product CheY-P-specific phosphatase CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943818.1 protein_id gnl|my_center|LOCUS_35210 5714 4863 gene locus_tag LOCUS_35220 gene cheR1 5714 4863 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XC4 protein_id gnl|my_center|LOCUS_35220 7028 5958 gene locus_tag LOCUS_35230 gene cheB 7028 5958 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIX8 protein_id gnl|my_center|LOCUS_35230 8327 7290 gene locus_tag LOCUS_35240 8327 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 <10507 8469 gene locus_tag LOCUS_35250 <10507 8469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89S13:histidine kinase >Feature sequence0267 522 989 gene locus_tag LOCUS_35260 522 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 1276 2028 gene locus_tag LOCUS_35270 gene cpcG2 1276 2028 CDS product phycobilisome rod-core linker polypeptide CpcG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50040 protein_id gnl|my_center|LOCUS_35270 3386 2325 gene locus_tag LOCUS_35280 3386 2325 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP3 protein_id gnl|my_center|LOCUS_35280 4604 3474 gene locus_tag LOCUS_35290 gene proB 4604 3474 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH42 protein_id gnl|my_center|LOCUS_35290 5154 6053 gene locus_tag LOCUS_35300 5154 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 6603 7001 gene locus_tag LOCUS_35310 6603 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 7892 7668 gene locus_tag LOCUS_35320 7892 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058280.1 protein_id gnl|my_center|LOCUS_35320 9999 8401 gene locus_tag LOCUS_35330 9999 8401 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056886.1 protein_id gnl|my_center|LOCUS_35330 >Feature sequence0268 787 1683 gene locus_tag LOCUS_35340 787 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 2169 7364 gene locus_tag LOCUS_35350 2169 7364 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_35350 7659 7946 gene locus_tag LOCUS_35360 7659 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 8291 8746 gene locus_tag LOCUS_35370 8291 8746 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_35370 8791 9906 gene locus_tag LOCUS_35380 8791 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 9903 10313 gene locus_tag LOCUS_35390 9903 10313 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_35390 >Feature sequence0269 769 29 gene locus_tag LOCUS_35400 769 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142610.1 protein_id gnl|my_center|LOCUS_35400 2277 1270 gene locus_tag LOCUS_35410 gene glk 2277 1270 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIT6 protein_id gnl|my_center|LOCUS_35410 3080 2433 gene locus_tag LOCUS_35420 3080 2433 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404693.1 protein_id gnl|my_center|LOCUS_35420 3300 3527 gene locus_tag LOCUS_35430 3300 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 3520 3723 gene locus_tag LOCUS_35440 3520 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 4752 3718 gene locus_tag LOCUS_35450 4752 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 6896 4887 gene locus_tag LOCUS_35460 6896 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 7874 9259 gene locus_tag LOCUS_35470 7874 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 9467 9688 gene locus_tag LOCUS_35480 9467 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 9708 10352 gene locus_tag LOCUS_35490 9708 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 >Feature sequence0270 200 1276 gene locus_tag LOCUS_35500 200 1276 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_35500 2279 1473 gene locus_tag LOCUS_35510 gene wecG 2279 1473 CDS product UDP-N-acetyl-D-mannosaminuronic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123818.1 protein_id gnl|my_center|LOCUS_35510 3624 2548 gene locus_tag LOCUS_35520 3624 2548 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_35520 5493 4270 gene locus_tag LOCUS_35530 5493 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 6888 5761 gene locus_tag LOCUS_35540 6888 5761 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123820.1 protein_id gnl|my_center|LOCUS_35540 7503 8483 gene locus_tag LOCUS_35550 7503 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 8813 10000 gene locus_tag LOCUS_35560 8813 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence0271 605 318 gene locus_tag LOCUS_35570 605 318 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058066.1 protein_id gnl|my_center|LOCUS_35570 1105 917 gene locus_tag LOCUS_35580 1105 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 1344 1114 gene locus_tag LOCUS_35590 1344 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 1639 1472 gene locus_tag LOCUS_35600 1639 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 3529 1760 gene locus_tag LOCUS_35610 3529 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 6069 3661 gene locus_tag LOCUS_35620 6069 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 7064 6099 gene locus_tag LOCUS_35630 7064 6099 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778163.1 protein_id gnl|my_center|LOCUS_35630 8115 7081 gene locus_tag LOCUS_35640 8115 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 8568 8155 gene locus_tag LOCUS_35650 8568 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 9837 8788 gene locus_tag LOCUS_35660 9837 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 >Feature sequence0272 400 2928 gene locus_tag LOCUS_35670 400 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 4251 4886 gene locus_tag LOCUS_35680 4251 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 5455 5967 gene locus_tag LOCUS_35690 5455 5967 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 protein_id gnl|my_center|LOCUS_35690 7128 6190 gene locus_tag LOCUS_35700 gene wcaG 7128 6190 CDS product mRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 protein_id gnl|my_center|LOCUS_35700 7892 7461 gene locus_tag LOCUS_35710 7892 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868781.1 protein_id gnl|my_center|LOCUS_35710 9055 7889 gene locus_tag LOCUS_35720 9055 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868782.1 protein_id gnl|my_center|LOCUS_35720 9202 9825 gene locus_tag LOCUS_35730 9202 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 >Feature sequence0273 24 710 gene locus_tag LOCUS_35740 24 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 2646 868 gene locus_tag LOCUS_35750 2646 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 2750 3067 gene locus_tag LOCUS_35760 2750 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 8403 3220 gene locus_tag LOCUS_35770 8403 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 8918 9409 gene locus_tag LOCUS_35780 gene coaD 8918 9409 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ7 protein_id gnl|my_center|LOCUS_35780 9385 10032 gene locus_tag LOCUS_35790 9385 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057008.1 protein_id gnl|my_center|LOCUS_35790 >Feature sequence0274 2602 4377 gene locus_tag LOCUS_35800 2602 4377 CDS product potassium efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140386.1 protein_id gnl|my_center|LOCUS_35800 5718 6056 gene locus_tag LOCUS_35810 5718 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057859.1 protein_id gnl|my_center|LOCUS_35810 6106 6339 gene locus_tag LOCUS_35820 6106 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 6428 6970 gene locus_tag LOCUS_35830 6428 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144145.1 protein_id gnl|my_center|LOCUS_35830 8965 7166 gene locus_tag LOCUS_35840 8965 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 9884 9345 gene locus_tag LOCUS_35850 9884 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 >Feature sequence0275 753 355 gene locus_tag LOCUS_35860 753 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 834 3869 gene locus_tag LOCUS_35870 834 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 5865 4489 gene locus_tag LOCUS_35880 5865 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 7018 6887 gene locus_tag LOCUS_35890 7018 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 7906 8157 gene locus_tag LOCUS_35900 7906 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 >Feature sequence0276 273 1142 gene locus_tag LOCUS_35910 273 1142 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_35910 1142 1933 gene locus_tag LOCUS_35920 1142 1933 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946403.1 protein_id gnl|my_center|LOCUS_35920 3049 2309 gene locus_tag LOCUS_35930 3049 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 4285 3050 gene locus_tag LOCUS_35940 4285 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 4588 5865 gene locus_tag LOCUS_35950 4588 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 6106 7455 gene locus_tag LOCUS_35960 6106 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 7936 8553 gene locus_tag LOCUS_35970 7936 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 9359 10072 gene locus_tag LOCUS_35980 9359 10072 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056089.1 protein_id gnl|my_center|LOCUS_35980 >Feature sequence0277 3906 373 gene locus_tag LOCUS_35990 3906 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 4486 5631 gene locus_tag LOCUS_36000 4486 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143082.1 protein_id gnl|my_center|LOCUS_36000 6503 6312 gene locus_tag LOCUS_36010 6503 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 7314 6778 gene locus_tag LOCUS_36020 gene cpcS 7314 6778 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI91 protein_id gnl|my_center|LOCUS_36020 7771 10086 gene locus_tag LOCUS_36030 7771 10086 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056388.1 protein_id gnl|my_center|LOCUS_36030 >Feature sequence0278 431 1804 gene locus_tag LOCUS_36040 gene thiC 431 1804 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLZ2 protein_id gnl|my_center|LOCUS_36040 2101 2481 gene locus_tag LOCUS_36050 2101 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 2508 2852 gene locus_tag LOCUS_36060 2508 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 3392 3643 gene locus_tag LOCUS_36070 3392 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 3892 4839 gene locus_tag LOCUS_36080 3892 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 5207 5383 gene locus_tag LOCUS_36090 5207 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 5498 8680 gene locus_tag LOCUS_36100 5498 8680 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229450.1 protein_id gnl|my_center|LOCUS_36100 9070 8831 gene locus_tag LOCUS_36110 9070 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 9564 9220 gene locus_tag LOCUS_36120 9564 9220 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_36120 9859 9548 gene locus_tag LOCUS_36130 9859 9548 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_36130 >Feature sequence0279 1200 529 gene locus_tag LOCUS_36140 1200 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_36140 1649 2662 gene locus_tag LOCUS_36150 1649 2662 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_36150 3123 3992 gene locus_tag LOCUS_36160 gene rsmI 3123 3992 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR7 protein_id gnl|my_center|LOCUS_36160 4142 4318 gene locus_tag LOCUS_36170 4142 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 4800 6839 gene locus_tag LOCUS_36180 4800 6839 CDS product glycogen debranching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143985.1 protein_id gnl|my_center|LOCUS_36180 7501 7202 gene locus_tag LOCUS_36190 7501 7202 CDS product putative 30S ribosomal protein PSRP-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59327 protein_id gnl|my_center|LOCUS_36190 7584 8384 gene locus_tag LOCUS_36200 7584 8384 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056155.1 protein_id gnl|my_center|LOCUS_36200 9938 8658 gene locus_tag LOCUS_36210 gene serS 9938 8658 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN0 protein_id gnl|my_center|LOCUS_36210 >Feature sequence0280 1410 214 gene locus_tag LOCUS_36220 gene nifS 1410 214 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_36220 2115 1555 gene locus_tag LOCUS_36230 2115 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 2613 3398 gene locus_tag LOCUS_36240 2613 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 4803 3913 gene locus_tag LOCUS_36250 4803 3913 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 protein_id gnl|my_center|LOCUS_36250 4850 5017 gene locus_tag LOCUS_36260 4850 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 5577 5014 gene locus_tag LOCUS_36270 5577 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 6960 6643 gene locus_tag LOCUS_36280 6960 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 8876 8421 gene locus_tag LOCUS_36290 8876 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 9234 8893 gene locus_tag LOCUS_36300 9234 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 >Feature sequence0281 1671 811 gene locus_tag LOCUS_36310 1671 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 3014 2202 gene locus_tag LOCUS_36320 3014 2202 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056948.1 protein_id gnl|my_center|LOCUS_36320 4257 3142 gene locus_tag LOCUS_36330 4257 3142 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056169.1 protein_id gnl|my_center|LOCUS_36330 4314 5426 gene locus_tag LOCUS_36340 4314 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 6305 9883 gene locus_tag LOCUS_36350 6305 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 >Feature sequence0282 3015 148 gene locus_tag LOCUS_36360 3015 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 4839 6035 gene locus_tag LOCUS_36370 4839 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 6282 9014 gene locus_tag LOCUS_36380 6282 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 >Feature sequence0283 294 1889 gene locus_tag LOCUS_36390 294 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 2117 2770 gene locus_tag LOCUS_36400 gene hisB 2117 2770 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMJ6 protein_id gnl|my_center|LOCUS_36400 3573 2965 gene locus_tag LOCUS_36410 3573 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 3660 4214 gene locus_tag LOCUS_36420 3660 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 4632 4246 gene locus_tag LOCUS_36430 4632 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 protein_id gnl|my_center|LOCUS_36430 4979 6082 gene locus_tag LOCUS_36440 gene queA 4979 6082 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKD7 protein_id gnl|my_center|LOCUS_36440 6559 6380 gene locus_tag LOCUS_36450 gene rpmF 6559 6380 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBW1 protein_id gnl|my_center|LOCUS_36450 6829 6620 gene locus_tag LOCUS_36460 6829 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 7021 6938 gene locus_tag LOCUS_t00450 7021 6938 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7217 7864 gene locus_tag LOCUS_36470 7217 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 8994 10085 gene locus_tag LOCUS_36480 8994 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 >Feature sequence0284 1007 585 gene locus_tag LOCUS_36490 1007 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 5687 1104 gene locus_tag LOCUS_36500 5687 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 6158 6757 gene locus_tag LOCUS_36510 6158 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 7612 7145 gene locus_tag LOCUS_36520 7612 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 8584 7820 gene locus_tag LOCUS_36530 8584 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 9777 9553 gene locus_tag LOCUS_36540 9777 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 >Feature sequence0285 1072 473 gene locus_tag LOCUS_36550 1072 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 3701 2178 gene locus_tag LOCUS_36560 3701 2178 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057032.1 protein_id gnl|my_center|LOCUS_36560 5196 4264 gene locus_tag LOCUS_36570 5196 4264 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI21 protein_id gnl|my_center|LOCUS_36570 6581 5571 gene locus_tag LOCUS_36580 gene trpS 6581 5571 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHG3 protein_id gnl|my_center|LOCUS_36580 6690 6935 gene locus_tag LOCUS_36590 6690 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 7243 8139 gene locus_tag LOCUS_36600 7243 8139 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_36600 8841 9572 gene locus_tag LOCUS_36610 8841 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 protein_id gnl|my_center|LOCUS_36610 >Feature sequence0286 1254 337 gene locus_tag LOCUS_36620 gene rbsK 1254 337 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKN5 protein_id gnl|my_center|LOCUS_36620 1872 1528 gene locus_tag LOCUS_36630 1872 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 2219 2025 gene locus_tag LOCUS_36640 2219 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 2725 2243 gene locus_tag LOCUS_36650 gene psaF 2725 2243 CDS product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A401 protein_id gnl|my_center|LOCUS_36650 2894 3970 gene locus_tag LOCUS_36660 gene tsaD 2894 3970 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI9 protein_id gnl|my_center|LOCUS_36660 5118 4258 gene locus_tag LOCUS_36670 5118 4258 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_36670 5982 5257 gene locus_tag LOCUS_36680 5982 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057518.1 protein_id gnl|my_center|LOCUS_36680 6763 7293 gene locus_tag LOCUS_36690 gene ycf52 6763 7293 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 protein_id gnl|my_center|LOCUS_36690 7800 10028 gene locus_tag LOCUS_36700 7800 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 >Feature sequence0287 529 101 gene locus_tag LOCUS_36710 529 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 505 1276 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaaattaatgaatcctggaaacgggattgaaac 2991 1480 gene locus_tag LOCUS_36720 2991 1480 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 protein_id gnl|my_center|LOCUS_36720 3215 4108 gene locus_tag LOCUS_36730 3215 4108 CDS product 2-hydroxy-6-oxohepta-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 protein_id gnl|my_center|LOCUS_36730 4442 5032 gene locus_tag LOCUS_36740 4442 5032 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140022.1 protein_id gnl|my_center|LOCUS_36740 5263 5577 gene locus_tag LOCUS_36750 5263 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141909.1 protein_id gnl|my_center|LOCUS_36750 6721 6017 gene locus_tag LOCUS_36760 6721 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 7565 8233 gene locus_tag LOCUS_36770 7565 8233 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141158.1 protein_id gnl|my_center|LOCUS_36770 8249 9004 gene locus_tag LOCUS_36780 8249 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141159.1 protein_id gnl|my_center|LOCUS_36780 9306 9917 gene locus_tag LOCUS_36790 9306 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 >Feature sequence0288 361 621 gene locus_tag LOCUS_36800 361 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 659 1606 gene locus_tag LOCUS_36810 gene dnaX 659 1606 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056369.1 protein_id gnl|my_center|LOCUS_36810 1860 2465 gene locus_tag LOCUS_36820 1860 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 2697 2867 gene locus_tag LOCUS_36830 2697 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 3057 4187 gene locus_tag LOCUS_36840 3057 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142948.1 protein_id gnl|my_center|LOCUS_36840 4953 4168 gene locus_tag LOCUS_36850 4953 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142947.1 protein_id gnl|my_center|LOCUS_36850 5355 5044 gene locus_tag LOCUS_36860 5355 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 6573 5656 gene locus_tag LOCUS_36870 6573 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 7658 6774 gene locus_tag LOCUS_36880 7658 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 9180 7984 gene locus_tag LOCUS_36890 9180 7984 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056224.1 protein_id gnl|my_center|LOCUS_36890 9475 9696 gene locus_tag LOCUS_36900 9475 9696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 >Feature sequence0289 811 1038 gene locus_tag LOCUS_36910 811 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 2171 4165 gene locus_tag LOCUS_36920 2171 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 4669 7434 gene locus_tag LOCUS_36930 4669 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 9720 8146 gene locus_tag LOCUS_36940 9720 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 >Feature sequence0290 1555 233 gene locus_tag LOCUS_36950 1555 233 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144084.1 protein_id gnl|my_center|LOCUS_36950 2000 1758 gene locus_tag LOCUS_36960 2000 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 2488 4206 gene locus_tag LOCUS_36970 2488 4206 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144086.1 protein_id gnl|my_center|LOCUS_36970 4434 4904 gene locus_tag LOCUS_36980 4434 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 4996 5478 gene locus_tag LOCUS_36990 4996 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 5848 6330 gene locus_tag LOCUS_37000 5848 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 6357 6668 gene locus_tag LOCUS_37010 6357 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144090.1 protein_id gnl|my_center|LOCUS_37010 7052 7366 gene locus_tag LOCUS_37020 7052 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 7707 8507 gene locus_tag LOCUS_37030 7707 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 8537 9880 gene locus_tag LOCUS_37040 8537 9880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258026.1 protein_id gnl|my_center|LOCUS_37040 >Feature sequence0291 <1 999 gene locus_tag LOCUS_37050 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727119.1:FAD-binding molybdopterin dehydrogenase 996 3200 gene locus_tag LOCUS_37060 996 3200 CDS product acylaldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706537.1 protein_id gnl|my_center|LOCUS_37060 3320 4306 gene locus_tag LOCUS_37070 gene cps1E 3320 4306 CDS product acyltransferase/acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101284.1 protein_id gnl|my_center|LOCUS_37070 9855 4426 gene locus_tag LOCUS_37080 9855 4426 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_37080 >Feature sequence0292 396 1109 gene locus_tag LOCUS_37090 396 1109 CDS product nitrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057403.1 protein_id gnl|my_center|LOCUS_37090 1674 1949 gene locus_tag LOCUS_37100 1674 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 2354 2695 gene locus_tag LOCUS_37110 gene ndhM 2354 2695 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLN5 protein_id gnl|my_center|LOCUS_37110 3237 5348 gene locus_tag LOCUS_37120 3237 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056767.1 protein_id gnl|my_center|LOCUS_37120 5705 6172 gene locus_tag LOCUS_37130 5705 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056084.1 protein_id gnl|my_center|LOCUS_37130 6448 7335 gene locus_tag LOCUS_37140 6448 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056085.1 protein_id gnl|my_center|LOCUS_37140 7797 8246 gene locus_tag LOCUS_37150 7797 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056323.1 protein_id gnl|my_center|LOCUS_37150 9911 8895 gene locus_tag LOCUS_37160 9911 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 >Feature sequence0293 1743 325 gene locus_tag LOCUS_37170 1743 325 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528760.1 protein_id gnl|my_center|LOCUS_37170 2774 3532 gene locus_tag LOCUS_37180 2774 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 3583 3900 gene locus_tag LOCUS_37190 3583 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 3976 4218 gene locus_tag LOCUS_37200 3976 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 4264 4629 gene locus_tag LOCUS_37210 4264 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37210 4743 5048 gene locus_tag LOCUS_37220 4743 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 5180 5455 gene locus_tag LOCUS_37230 5180 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 5516 6943 gene locus_tag LOCUS_37240 5516 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 8002 9600 gene locus_tag LOCUS_37250 8002 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 >Feature sequence0294 1509 955 gene locus_tag LOCUS_37260 1509 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 2365 3297 gene locus_tag LOCUS_37270 gene lipA2 2365 3297 CDS product lipoyl synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLC2 protein_id gnl|my_center|LOCUS_37270 4140 5876 gene locus_tag LOCUS_37280 4140 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 6376 6618 gene locus_tag LOCUS_37290 6376 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 6611 6958 gene locus_tag LOCUS_37300 6611 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 >Feature sequence0295 1352 399 gene locus_tag LOCUS_37310 1352 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 protein_id gnl|my_center|LOCUS_37310 2126 2347 gene locus_tag LOCUS_37320 2126 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 2350 2784 gene locus_tag LOCUS_37330 gene vapC 2350 2784 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IUZ4 protein_id gnl|my_center|LOCUS_37330 3228 3824 gene locus_tag LOCUS_37340 3228 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144066.1 protein_id gnl|my_center|LOCUS_37340 4524 5348 gene locus_tag LOCUS_37350 gene ilvE 4524 5348 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142576.1 protein_id gnl|my_center|LOCUS_37350 5698 7086 gene locus_tag LOCUS_37360 5698 7086 CDS product alkaline invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 protein_id gnl|my_center|LOCUS_37360 9222 7615 gene locus_tag LOCUS_37370 9222 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 >Feature sequence0296 3178 1430 gene locus_tag LOCUS_37380 3178 1430 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056502.1 protein_id gnl|my_center|LOCUS_37380 3866 3480 gene locus_tag LOCUS_37390 gene vapC 3866 3480 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RQ5 protein_id gnl|my_center|LOCUS_37390 4282 3866 gene locus_tag LOCUS_37400 4282 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 4437 4778 gene locus_tag LOCUS_37410 4437 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 4783 5103 gene locus_tag LOCUS_37420 4783 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 5295 5630 gene locus_tag LOCUS_37430 5295 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 5627 5980 gene locus_tag LOCUS_37440 5627 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 7079 6270 gene locus_tag LOCUS_37450 7079 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 7914 7714 gene locus_tag LOCUS_37460 7914 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 8132 9529 gene locus_tag LOCUS_37470 8132 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 >Feature sequence0297 669 460 gene locus_tag LOCUS_37480 669 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 846 682 gene locus_tag LOCUS_37490 846 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 1069 836 gene locus_tag LOCUS_37500 1069 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 1965 1297 gene locus_tag LOCUS_37510 1965 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255961.1 protein_id gnl|my_center|LOCUS_37510 4560 2047 gene locus_tag LOCUS_37520 gene pheT 4560 2047 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL37 protein_id gnl|my_center|LOCUS_37520 5158 5352 gene locus_tag LOCUS_37530 5158 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 5349 5549 gene locus_tag LOCUS_37540 5349 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 7676 6060 gene locus_tag LOCUS_37550 7676 6060 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 protein_id gnl|my_center|LOCUS_37550 8358 7873 gene locus_tag LOCUS_37560 gene ruvC 8358 7873 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJT5 protein_id gnl|my_center|LOCUS_37560 9611 8520 gene locus_tag LOCUS_37570 gene chlI 9611 8520 CDS product Mg-protoporphyrin IX chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS0 protein_id gnl|my_center|LOCUS_37570 >Feature sequence0298 1107 1628 gene locus_tag LOCUS_37580 1107 1628 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_37580 1858 2436 gene locus_tag LOCUS_37590 1858 2436 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057165.1 protein_id gnl|my_center|LOCUS_37590 2697 3128 gene locus_tag LOCUS_37600 gene rsfS 2697 3128 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK1 protein_id gnl|my_center|LOCUS_37600 3125 3625 gene locus_tag LOCUS_37610 gene ycf36 3125 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140851.1 protein_id gnl|my_center|LOCUS_37610 4056 3655 gene locus_tag LOCUS_37620 4056 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 5297 4278 gene locus_tag LOCUS_37630 5297 4278 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021382.1 protein_id gnl|my_center|LOCUS_37630 5925 7292 gene locus_tag LOCUS_37640 gene aspA 5925 7292 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141457.1 protein_id gnl|my_center|LOCUS_37640 7572 7889 gene locus_tag LOCUS_37650 7572 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 8214 8705 gene locus_tag LOCUS_37660 8214 8705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 9587 8949 gene locus_tag LOCUS_37670 gene hisI 9587 8949 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM88 protein_id gnl|my_center|LOCUS_37670 >Feature sequence0299 960 340 gene locus_tag LOCUS_37680 gene cpcS 960 340 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL67 protein_id gnl|my_center|LOCUS_37680 1064 1891 gene locus_tag LOCUS_37690 1064 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141258.1 protein_id gnl|my_center|LOCUS_37690 2067 2231 gene locus_tag LOCUS_37700 2067 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 2636 2905 gene locus_tag LOCUS_37710 2636 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 2895 3260 gene locus_tag LOCUS_37720 2895 3260 CDS product motility twitching protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392206.1 protein_id gnl|my_center|LOCUS_37720 4951 3686 gene locus_tag LOCUS_37730 gene cpeY 4951 3686 CDS product phycocyanin operon protein Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141188.1 protein_id gnl|my_center|LOCUS_37730 5080 5355 gene locus_tag LOCUS_37740 5080 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 5648 6541 gene locus_tag LOCUS_37750 5648 6541 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141255.1 protein_id gnl|my_center|LOCUS_37750 7590 6985 gene locus_tag LOCUS_37760 gene cpeZ 7590 6985 CDS product phycocyanin operon protein Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141187.1 protein_id gnl|my_center|LOCUS_37760 9601 8000 gene locus_tag LOCUS_37770 9601 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 >Feature sequence0300 1599 913 gene locus_tag LOCUS_37780 gene deoC 1599 913 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJZ1 protein_id gnl|my_center|LOCUS_37780 3834 1855 gene locus_tag LOCUS_37790 3834 1855 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056106.1 protein_id gnl|my_center|LOCUS_37790 6051 4201 gene locus_tag LOCUS_37800 6051 4201 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056106.1 protein_id gnl|my_center|LOCUS_37800 8822 7773 gene locus_tag LOCUS_37810 gene cobW 8822 7773 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057463.1 protein_id gnl|my_center|LOCUS_37810 9624 9211 gene locus_tag LOCUS_37820 9624 9211 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086045.1 protein_id gnl|my_center|LOCUS_37820 >Feature sequence0301 1470 64 gene locus_tag LOCUS_37830 gene leuC 1470 64 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKF0 protein_id gnl|my_center|LOCUS_37830 1658 2761 gene locus_tag LOCUS_37840 1658 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_37840 2764 3423 gene locus_tag LOCUS_37850 2764 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 3462 3638 gene locus_tag LOCUS_37860 3462 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 3581 3907 gene locus_tag LOCUS_37870 3581 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 4409 4699 gene locus_tag LOCUS_37880 4409 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 5363 6280 gene locus_tag LOCUS_37890 5363 6280 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141217.1 protein_id gnl|my_center|LOCUS_37890 6506 7783 gene locus_tag LOCUS_37900 6506 7783 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228237.1 protein_id gnl|my_center|LOCUS_37900 9162 7810 gene locus_tag LOCUS_37910 9162 7810 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_37910 >Feature sequence0302 1 219 gene locus_tag LOCUS_37920 1 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 1904 372 gene locus_tag LOCUS_37930 1904 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 3724 2963 gene locus_tag LOCUS_37940 gene ycf53 3724 2963 CDS product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057433.1 protein_id gnl|my_center|LOCUS_37940 4317 3823 gene locus_tag LOCUS_37950 4317 3823 CDS product cytidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057432.1 protein_id gnl|my_center|LOCUS_37950 5203 4454 gene locus_tag LOCUS_37960 gene ycf29 5203 4454 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 protein_id gnl|my_center|LOCUS_37960 5767 7194 gene locus_tag LOCUS_37970 gene icd 5767 7194 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9S5 protein_id gnl|my_center|LOCUS_37970 9214 7517 gene locus_tag LOCUS_37980 9214 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 >Feature sequence0303 16 922 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccattcaactaatttccccagcgagtggggg 3790 1850 gene locus_tag LOCUS_37990 3790 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 3836 4009 gene locus_tag LOCUS_38000 3836 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 4410 4760 gene locus_tag LOCUS_38010 4410 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 4903 8592 gene locus_tag LOCUS_38020 4903 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 8618 >9830 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccattcaactaatttccccagcgagtggggg >Feature sequence0304 170 349 gene locus_tag LOCUS_38030 170 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 1609 338 gene locus_tag LOCUS_38040 1609 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 3455 1725 gene locus_tag LOCUS_38050 3455 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 4098 3691 gene locus_tag LOCUS_38060 4098 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 5063 4098 gene locus_tag LOCUS_38070 5063 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 6163 5063 gene locus_tag LOCUS_38080 6163 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 7857 6142 gene locus_tag LOCUS_38090 7857 6142 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880206.1 protein_id gnl|my_center|LOCUS_38090 9572 8700 gene locus_tag LOCUS_38100 9572 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 >Feature sequence0305 3174 1900 gene locus_tag LOCUS_38110 3174 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 4109 3168 gene locus_tag LOCUS_38120 4109 3168 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_38120 5452 4094 gene locus_tag LOCUS_38130 5452 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 5641 5943 gene locus_tag LOCUS_38140 5641 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 7406 6135 gene locus_tag LOCUS_38150 7406 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 8407 7604 gene locus_tag LOCUS_38160 8407 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 9295 8429 gene locus_tag LOCUS_38170 9295 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 9563 9267 gene locus_tag LOCUS_38180 9563 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 >Feature sequence0306 492 1775 gene locus_tag LOCUS_38190 492 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 1931 2485 gene locus_tag LOCUS_38200 1931 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 2717 6118 gene locus_tag LOCUS_38210 2717 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 6519 6734 gene locus_tag LOCUS_38220 6519 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 7308 6913 gene locus_tag LOCUS_38230 gene ntrR1 7308 6913 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7APC4 protein_id gnl|my_center|LOCUS_38230 7626 7312 gene locus_tag LOCUS_38240 7626 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 9118 7910 gene locus_tag LOCUS_38250 gene ispH 9118 7910 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK29 protein_id gnl|my_center|LOCUS_38250 9234 9587 gene locus_tag LOCUS_38260 9234 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 >Feature sequence0307 1898 552 gene locus_tag LOCUS_38270 1898 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141410.1 protein_id gnl|my_center|LOCUS_38270 3258 2152 gene locus_tag LOCUS_38280 3258 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141411.1 protein_id gnl|my_center|LOCUS_38280 5656 3449 gene locus_tag LOCUS_38290 5656 3449 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141412.1 protein_id gnl|my_center|LOCUS_38290 6264 5851 gene locus_tag LOCUS_38300 6264 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141413.1 protein_id gnl|my_center|LOCUS_38300 6940 6644 gene locus_tag LOCUS_38310 6940 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 9600 7468 gene locus_tag LOCUS_38320 9600 7468 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140428.1 protein_id gnl|my_center|LOCUS_38320 >Feature sequence0308 5007 1738 gene locus_tag LOCUS_38330 5007 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 9404 5010 gene locus_tag LOCUS_38340 9404 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 >Feature sequence0309 110 1897 gene locus_tag LOCUS_38350 110 1897 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141553.1 protein_id gnl|my_center|LOCUS_38350 1894 2118 gene locus_tag LOCUS_38360 1894 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 2440 2183 gene locus_tag LOCUS_38370 2440 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 2748 2479 gene locus_tag LOCUS_38380 2748 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 3327 2890 gene locus_tag LOCUS_38390 gene hspA 3327 2890 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_38390 4119 3772 gene locus_tag LOCUS_38400 4119 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 4575 4808 gene locus_tag LOCUS_38410 4575 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 5822 4707 gene locus_tag LOCUS_38420 5822 4707 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224176.1 protein_id gnl|my_center|LOCUS_38420 7376 6048 gene locus_tag LOCUS_38430 7376 6048 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674116.1 protein_id gnl|my_center|LOCUS_38430 7957 7577 gene locus_tag LOCUS_38440 7957 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 9286 8366 gene locus_tag LOCUS_38450 9286 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 >Feature sequence0310 875 3988 gene locus_tag LOCUS_38460 875 3988 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120142.1 protein_id gnl|my_center|LOCUS_38460 6132 4441 gene locus_tag LOCUS_38470 6132 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 7876 7604 gene locus_tag LOCUS_38480 7876 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 8271 8026 gene locus_tag LOCUS_38490 8271 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 9397 8615 gene locus_tag LOCUS_38500 9397 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141905.1 protein_id gnl|my_center|LOCUS_38500 >Feature sequence0311 728 369 gene locus_tag LOCUS_38510 728 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 1497 2717 gene locus_tag LOCUS_38520 gene chlP 1497 2717 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056005.1 protein_id gnl|my_center|LOCUS_38520 3870 2872 gene locus_tag LOCUS_38530 3870 2872 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142928.1 protein_id gnl|my_center|LOCUS_38530 4319 5344 gene locus_tag LOCUS_38540 gene gap1 4319 5344 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG48 protein_id gnl|my_center|LOCUS_38540 7004 6468 gene locus_tag LOCUS_38550 7004 6468 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143500.1 protein_id gnl|my_center|LOCUS_38550 7793 8557 gene locus_tag LOCUS_38560 7793 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 9045 9344 gene locus_tag LOCUS_38570 9045 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 >Feature sequence0312 446 2251 gene locus_tag LOCUS_38580 446 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 3035 2418 gene locus_tag LOCUS_38590 3035 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 4843 3536 gene locus_tag LOCUS_38600 gene trpE 4843 3536 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056140.1 protein_id gnl|my_center|LOCUS_38600 6240 5374 gene locus_tag LOCUS_38610 6240 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 7736 6462 gene locus_tag LOCUS_38620 gene folC 7736 6462 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_38620 9120 7870 gene locus_tag LOCUS_38630 gene folC 9120 7870 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_38630 >Feature sequence0313 348 614 gene locus_tag LOCUS_38640 348 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 1244 597 gene locus_tag LOCUS_38650 1244 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 1854 1510 gene locus_tag LOCUS_38660 1854 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 2251 1880 gene locus_tag LOCUS_38670 2251 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 2995 2720 gene locus_tag LOCUS_38680 2995 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 4374 3565 gene locus_tag LOCUS_38690 gene cysE 4374 3565 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK8 protein_id gnl|my_center|LOCUS_38690 5011 7980 gene locus_tag LOCUS_38700 5011 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 8093 8413 gene locus_tag LOCUS_38710 8093 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 8717 9022 gene locus_tag LOCUS_38720 8717 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 9500 9156 gene locus_tag LOCUS_38730 9500 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 >Feature sequence0314 49 200 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtcttggggtctccccaag 717 2429 gene locus_tag LOCUS_38740 717 2429 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_38740 2710 3636 gene locus_tag LOCUS_38750 2710 3636 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_38750 4065 3871 gene locus_tag LOCUS_38760 4065 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 5066 5593 gene locus_tag LOCUS_38770 5066 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 6649 6086 gene locus_tag LOCUS_38780 6649 6086 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258945.1 protein_id gnl|my_center|LOCUS_38780 8876 6984 gene locus_tag LOCUS_38790 8876 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 >Feature sequence0315 3722 3916 gene locus_tag LOCUS_38800 3722 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 5061 6785 gene locus_tag LOCUS_38810 5061 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 9130 7619 gene locus_tag LOCUS_38820 9130 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 >Feature sequence0316 2566 935 gene locus_tag LOCUS_38830 gene guaA 2566 935 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA5 protein_id gnl|my_center|LOCUS_38830 4185 3049 gene locus_tag LOCUS_38840 gene cbiD 4185 3049 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT8 protein_id gnl|my_center|LOCUS_38840 4473 4204 gene locus_tag LOCUS_38850 4473 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 7006 7848 gene locus_tag LOCUS_38860 gene ycf66 7006 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057849.1 protein_id gnl|my_center|LOCUS_38860 7877 8560 gene locus_tag LOCUS_38870 7877 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 8721 9254 gene locus_tag LOCUS_38880 8721 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 >Feature sequence0317 694 1863 gene locus_tag LOCUS_38890 gene sat 694 1863 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK26 protein_id gnl|my_center|LOCUS_38890 3524 5755 gene locus_tag LOCUS_38900 3524 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057163.1 protein_id gnl|my_center|LOCUS_38900 7242 6136 gene locus_tag LOCUS_38910 7242 6136 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 protein_id gnl|my_center|LOCUS_38910 8303 9274 gene locus_tag LOCUS_38920 8303 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 >Feature sequence0318 396 1379 gene locus_tag LOCUS_38930 396 1379 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_38930 1578 2495 gene locus_tag LOCUS_38940 1578 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_38940 3609 7187 gene locus_tag LOCUS_38950 3609 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 7345 7124 gene locus_tag LOCUS_38960 7345 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 8786 7614 gene locus_tag LOCUS_38970 gene petH 8786 7614 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93RE3 protein_id gnl|my_center|LOCUS_38970 >Feature sequence0319 607 323 gene locus_tag LOCUS_38980 607 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142361.1 protein_id gnl|my_center|LOCUS_38980 1304 906 gene locus_tag LOCUS_38990 1304 906 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143050.1 protein_id gnl|my_center|LOCUS_38990 1733 3487 gene locus_tag LOCUS_39000 1733 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 3763 4329 gene locus_tag LOCUS_39010 3763 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 4620 4892 gene locus_tag LOCUS_39020 4620 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 6806 6734 gene locus_tag LOCUS_t00460 6806 6734 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9408 9337 gene locus_tag LOCUS_t00470 9408 9337 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0320 402 1055 gene locus_tag LOCUS_39030 gene mtnX 402 1055 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEC8 protein_id gnl|my_center|LOCUS_39030 4482 1435 gene locus_tag LOCUS_39040 4482 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 5062 5511 gene locus_tag LOCUS_39050 5062 5511 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI95 protein_id gnl|my_center|LOCUS_39050 6040 5696 gene locus_tag LOCUS_39060 6040 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 9221 6540 gene locus_tag LOCUS_39070 9221 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 >Feature sequence0321 1071 394 gene locus_tag LOCUS_39080 1071 394 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_39080 2394 2621 gene locus_tag LOCUS_39090 2394 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 2786 3349 gene locus_tag LOCUS_39100 2786 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 5291 4995 gene locus_tag LOCUS_39110 5291 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 5441 5734 gene locus_tag LOCUS_39120 5441 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 7141 6902 gene locus_tag LOCUS_39130 7141 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 7529 8839 gene locus_tag LOCUS_39140 7529 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 9276 9448 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttggggagaccccaagacc >Feature sequence0322 1194 175 gene locus_tag LOCUS_39150 1194 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 2749 1292 gene locus_tag LOCUS_39160 2749 1292 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976195.1 protein_id gnl|my_center|LOCUS_39160 5498 3246 gene locus_tag LOCUS_39170 5498 3246 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057117.1 protein_id gnl|my_center|LOCUS_39170 6286 5990 gene locus_tag LOCUS_39180 6286 5990 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057133.1 protein_id gnl|my_center|LOCUS_39180 7028 6375 gene locus_tag LOCUS_39190 7028 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 protein_id gnl|my_center|LOCUS_39190 7591 9162 gene locus_tag LOCUS_39200 7591 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 >Feature sequence0323 1014 274 gene locus_tag LOCUS_39210 1014 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 2275 1397 gene locus_tag LOCUS_39220 2275 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 2756 3226 gene locus_tag LOCUS_39230 2756 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 4179 3400 gene locus_tag LOCUS_39240 4179 3400 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_39240 5909 5391 gene locus_tag LOCUS_39250 5909 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058114.1 protein_id gnl|my_center|LOCUS_39250 6505 8088 gene locus_tag LOCUS_39260 gene serA 6505 8088 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM01 protein_id gnl|my_center|LOCUS_39260 8196 9236 gene locus_tag LOCUS_39270 gene prmA 8196 9236 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM00 protein_id gnl|my_center|LOCUS_39270 >Feature sequence0324 1775 960 gene locus_tag LOCUS_39280 1775 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 protein_id gnl|my_center|LOCUS_39280 3571 2051 gene locus_tag LOCUS_39290 3571 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 4446 3721 gene locus_tag LOCUS_39300 4446 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 6929 4533 gene locus_tag LOCUS_39310 gene mutS 6929 4533 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG52 protein_id gnl|my_center|LOCUS_39310 7956 7567 gene locus_tag LOCUS_39320 7956 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 9138 8332 gene locus_tag LOCUS_39330 gene queE 9138 8332 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKG4 protein_id gnl|my_center|LOCUS_39330 >Feature sequence0325 1417 506 gene locus_tag LOCUS_39340 1417 506 CDS product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024331.1 protein_id gnl|my_center|LOCUS_39340 2571 1453 gene locus_tag LOCUS_39350 2571 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 3441 4625 gene locus_tag LOCUS_39360 3441 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 6239 5214 gene locus_tag LOCUS_39370 6239 5214 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028250.1 protein_id gnl|my_center|LOCUS_39370 >Feature sequence0326 907 2088 gene locus_tag LOCUS_39380 907 2088 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056455.1 protein_id gnl|my_center|LOCUS_39380 3078 2320 gene locus_tag LOCUS_39390 gene rsmG 3078 2320 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMQ7 protein_id gnl|my_center|LOCUS_39390 3640 3840 gene locus_tag LOCUS_39400 3640 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 4527 5324 gene locus_tag LOCUS_39410 4527 5324 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058143.1 protein_id gnl|my_center|LOCUS_39410 5574 5341 gene locus_tag LOCUS_39420 5574 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 7985 5646 gene locus_tag LOCUS_39430 7985 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_39430 >Feature sequence0327 683 1642 gene locus_tag LOCUS_39440 683 1642 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_39440 3228 2203 gene locus_tag LOCUS_39450 3228 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 4699 3761 gene locus_tag LOCUS_39460 4699 3761 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143025.1 protein_id gnl|my_center|LOCUS_39460 5739 6257 gene locus_tag LOCUS_39470 5739 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 6901 6431 gene locus_tag LOCUS_39480 6901 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 7765 7367 gene locus_tag LOCUS_39490 gene psb27 7765 7367 CDS product photosystem II lipoprotein Psb27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG60 protein_id gnl|my_center|LOCUS_39490 8417 8965 gene locus_tag LOCUS_39500 8417 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 >Feature sequence0328 1201 452 gene locus_tag LOCUS_39510 gene uppS 1201 452 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI29 protein_id gnl|my_center|LOCUS_39510 2546 1635 gene locus_tag LOCUS_39520 2546 1635 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057599.1 protein_id gnl|my_center|LOCUS_39520 4834 3431 gene locus_tag LOCUS_39530 gene lysA 4834 3431 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI31 protein_id gnl|my_center|LOCUS_39530 4938 5510 gene locus_tag LOCUS_39540 4938 5510 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL5 protein_id gnl|my_center|LOCUS_39540 6612 5722 gene locus_tag LOCUS_39550 6612 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 8049 6616 gene locus_tag LOCUS_39560 8049 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 >Feature sequence0329 309 97 gene locus_tag LOCUS_39570 309 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 431 1273 gene locus_tag LOCUS_39580 gene dapF 431 1273 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM2 protein_id gnl|my_center|LOCUS_39580 1572 2711 gene locus_tag LOCUS_39590 1572 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 5213 3681 gene locus_tag LOCUS_39600 5213 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 6102 7304 gene locus_tag LOCUS_39610 gene thiE 6102 7304 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHK2 protein_id gnl|my_center|LOCUS_39610 7321 7569 gene locus_tag LOCUS_39620 gene ycf40 7321 7569 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056654.1 protein_id gnl|my_center|LOCUS_39620 7900 8823 gene locus_tag LOCUS_39630 7900 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057334.1 protein_id gnl|my_center|LOCUS_39630 >Feature sequence0330 147 1814 gene locus_tag LOCUS_39640 147 1814 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057298.1 protein_id gnl|my_center|LOCUS_39640 2126 3091 gene locus_tag LOCUS_39650 2126 3091 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 protein_id gnl|my_center|LOCUS_39650 3532 3804 gene locus_tag LOCUS_39660 3532 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 3804 4223 gene locus_tag LOCUS_39670 3804 4223 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141678.1 protein_id gnl|my_center|LOCUS_39670 6101 4476 gene locus_tag LOCUS_39680 6101 4476 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_39680 7073 7573 gene locus_tag LOCUS_39690 7073 7573 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057106.1 protein_id gnl|my_center|LOCUS_39690 7661 8815 gene locus_tag LOCUS_39700 7661 8815 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC5 protein_id gnl|my_center|LOCUS_39700 >Feature sequence0331 3020 2694 gene locus_tag LOCUS_39710 3020 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 3258 4970 gene locus_tag LOCUS_39720 gene ansB 3258 4970 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 protein_id gnl|my_center|LOCUS_39720 5464 5718 gene locus_tag LOCUS_39730 5464 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 5794 6426 gene locus_tag LOCUS_39740 5794 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 6613 7287 gene locus_tag LOCUS_39750 6613 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 8848 7457 gene locus_tag LOCUS_39760 8848 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 >Feature sequence0332 33 142 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gacacggagacacggagacac 727 1566 gene locus_tag LOCUS_39770 727 1566 CDS product primosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057597.1 protein_id gnl|my_center|LOCUS_39770 2206 1814 gene locus_tag LOCUS_39780 gene gcvH 2206 1814 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFJ4 protein_id gnl|my_center|LOCUS_39780 2555 3373 gene locus_tag LOCUS_39790 2555 3373 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_39790 3467 3594 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tccggggcaagcacgggggcattgccccta 3586 3798 gene locus_tag LOCUS_39800 3586 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 4585 3707 gene locus_tag LOCUS_39810 4585 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 protein_id gnl|my_center|LOCUS_39810 5467 6960 gene locus_tag LOCUS_39820 5467 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 8665 7298 gene locus_tag LOCUS_39830 8665 7298 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_39830 >Feature sequence0333 3121 512 gene locus_tag LOCUS_39840 3121 512 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL06 protein_id gnl|my_center|LOCUS_39840 3924 4164 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcggagcagggtagcacggtagcacggta 4977 7814 gene locus_tag LOCUS_39850 4977 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 8170 8532 gene locus_tag LOCUS_39860 8170 8532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 >Feature sequence0334 1273 779 gene locus_tag LOCUS_39870 gene psbV 1273 779 CDS product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A386 protein_id gnl|my_center|LOCUS_39870 2422 2060 gene locus_tag LOCUS_39880 2422 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 3192 3914 gene locus_tag LOCUS_39890 3192 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 5425 4871 gene locus_tag LOCUS_39900 5425 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056704.1 protein_id gnl|my_center|LOCUS_39900 6049 5861 gene locus_tag LOCUS_39910 6049 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 6785 7387 gene locus_tag LOCUS_39920 6785 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 >Feature sequence0335 1695 382 gene locus_tag LOCUS_39930 1695 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 2073 3596 gene locus_tag LOCUS_39940 2073 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 4738 3878 gene locus_tag LOCUS_39950 4738 3878 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_39950 6015 5503 gene locus_tag LOCUS_39960 gene ppa 6015 5503 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR2 protein_id gnl|my_center|LOCUS_39960 8694 6484 gene locus_tag LOCUS_39970 8694 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 >Feature sequence0336 1122 274 gene locus_tag LOCUS_39980 1122 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142803.1 protein_id gnl|my_center|LOCUS_39980 1808 4255 gene locus_tag LOCUS_39990 1808 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 5239 4430 gene locus_tag LOCUS_40000 gene tatC 5239 4430 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA6 protein_id gnl|my_center|LOCUS_40000 5675 6268 gene locus_tag LOCUS_40010 5675 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142458.1 protein_id gnl|my_center|LOCUS_40010 6268 6963 gene locus_tag LOCUS_40020 6268 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 8757 7816 gene locus_tag LOCUS_40030 gene fcl 8757 7816 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL64 protein_id gnl|my_center|LOCUS_40030 >Feature sequence0337 3079 2786 gene locus_tag LOCUS_40040 3079 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40040 3643 3882 gene locus_tag LOCUS_40050 3643 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 3833 3997 gene locus_tag LOCUS_40060 3833 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 4107 4415 gene locus_tag LOCUS_40070 4107 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 5721 5128 gene locus_tag LOCUS_40080 5721 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 9099 6130 gene locus_tag LOCUS_40090 9099 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 >Feature sequence0338 137 979 gene locus_tag LOCUS_40100 137 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 2691 1276 gene locus_tag LOCUS_40110 2691 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_40110 3689 2688 gene locus_tag LOCUS_40120 gene icmP 3689 2688 CDS product insulin-cleaving metalloproteinase outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112765.1 protein_id gnl|my_center|LOCUS_40120 4742 5506 gene locus_tag LOCUS_40130 4742 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057260.1 protein_id gnl|my_center|LOCUS_40130 5771 6241 gene locus_tag LOCUS_40140 5771 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057259.1 protein_id gnl|my_center|LOCUS_40140 6452 7099 gene locus_tag LOCUS_40150 6452 7099 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057258.1 protein_id gnl|my_center|LOCUS_40150 7119 7904 gene locus_tag LOCUS_40160 7119 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 8116 8886 gene locus_tag LOCUS_40170 8116 8886 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNW9 protein_id gnl|my_center|LOCUS_40170 >Feature sequence0339 2331 463 gene locus_tag LOCUS_40180 2331 463 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_40180 3580 3798 gene locus_tag LOCUS_40190 3580 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 4541 6064 gene locus_tag LOCUS_40200 4541 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 7306 6581 gene locus_tag LOCUS_40210 7306 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 >Feature sequence0340 321 623 gene locus_tag LOCUS_40220 321 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 1393 2439 gene locus_tag LOCUS_40230 gene fbp 1393 2439 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF2 protein_id gnl|my_center|LOCUS_40230 2378 2575 gene locus_tag LOCUS_40240 2378 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 2787 3926 gene locus_tag LOCUS_40250 gene tal 2787 3926 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFZ7 protein_id gnl|my_center|LOCUS_40250 4283 5812 gene locus_tag LOCUS_40260 gene zwf 4283 5812 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF3 protein_id gnl|my_center|LOCUS_40260 5975 7306 gene locus_tag LOCUS_40270 gene opcA 5975 7306 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 protein_id gnl|my_center|LOCUS_40270 7520 7810 gene locus_tag LOCUS_40280 7520 7810 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058066.1 protein_id gnl|my_center|LOCUS_40280 8843 7917 gene locus_tag LOCUS_40290 8843 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 >Feature sequence0341 806 210 gene locus_tag LOCUS_40300 806 210 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124122.1 protein_id gnl|my_center|LOCUS_40300 1152 1841 gene locus_tag LOCUS_40310 1152 1841 CDS product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087053.1 protein_id gnl|my_center|LOCUS_40310 8509 3158 gene locus_tag LOCUS_40320 8509 3158 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_40320 >Feature sequence0342 610 1908 gene locus_tag LOCUS_40330 610 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 2307 3965 gene locus_tag LOCUS_40340 2307 3965 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 protein_id gnl|my_center|LOCUS_40340 4825 4049 gene locus_tag LOCUS_40350 gene hisA 4825 4049 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA5 protein_id gnl|my_center|LOCUS_40350 5285 5503 gene locus_tag LOCUS_40360 5285 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 7097 6105 gene locus_tag LOCUS_40370 gene ilvC 7097 6105 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR0 protein_id gnl|my_center|LOCUS_40370 7489 7995 gene locus_tag LOCUS_40380 gene dnaJ 7489 7995 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055973.1 protein_id gnl|my_center|LOCUS_40380 8514 8786 gene locus_tag LOCUS_40390 8514 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 protein_id gnl|my_center|LOCUS_40390 >Feature sequence0343 713 126 gene locus_tag LOCUS_40400 713 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 1514 927 gene locus_tag LOCUS_40410 1514 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 1761 5123 gene locus_tag LOCUS_40420 1761 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 7145 5172 gene locus_tag LOCUS_40430 7145 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 8329 7193 gene locus_tag LOCUS_40440 gene ruvB 8329 7193 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR1 protein_id gnl|my_center|LOCUS_40440 8310 8480 gene locus_tag LOCUS_40450 8310 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 >Feature sequence0344 1750 2277 gene locus_tag LOCUS_40460 1750 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 2321 5434 gene locus_tag LOCUS_40470 2321 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 5661 5825 gene locus_tag LOCUS_40480 5661 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 8148 6454 gene locus_tag LOCUS_40490 8148 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 >Feature sequence0345 447 1844 gene locus_tag LOCUS_40500 447 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 2610 3323 gene locus_tag LOCUS_40510 2610 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 3410 4114 gene locus_tag LOCUS_40520 3410 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 6326 4737 gene locus_tag LOCUS_40530 6326 4737 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_40530 6594 7271 gene locus_tag LOCUS_40540 6594 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 7546 7866 gene locus_tag LOCUS_40550 7546 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 >Feature sequence0346 461 994 gene locus_tag LOCUS_40560 461 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 1404 1213 gene locus_tag LOCUS_40570 1404 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 1499 4219 gene locus_tag LOCUS_40580 1499 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 4249 5841 gene locus_tag LOCUS_40590 4249 5841 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_40590 6651 6358 gene locus_tag LOCUS_40600 6651 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 7077 7742 gene locus_tag LOCUS_40610 7077 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 >Feature sequence0347 992 1312 gene locus_tag LOCUS_40620 992 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 1242 1670 gene locus_tag LOCUS_40630 1242 1670 CDS product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_40630 1972 2217 gene locus_tag LOCUS_40640 1972 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 2214 2636 gene locus_tag LOCUS_40650 2214 2636 CDS product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_40650 3076 2849 gene locus_tag LOCUS_40660 3076 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 3648 3076 gene locus_tag LOCUS_40670 3648 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_40670 4139 4384 gene locus_tag LOCUS_40680 4139 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 4394 4717 gene locus_tag LOCUS_40690 4394 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 6511 5132 gene locus_tag LOCUS_40700 6511 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 6662 7138 gene locus_tag LOCUS_40710 6662 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057333.1 protein_id gnl|my_center|LOCUS_40710 7448 8431 gene locus_tag LOCUS_40720 7448 8431 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144236.1 protein_id gnl|my_center|LOCUS_40720 >Feature sequence0348 1527 148 gene locus_tag LOCUS_40730 1527 148 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_40730 2864 1917 gene locus_tag LOCUS_40740 gene rfbB 2864 1917 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 protein_id gnl|my_center|LOCUS_40740 3953 4510 gene locus_tag LOCUS_40750 3953 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_40750 5178 4906 gene locus_tag LOCUS_40760 5178 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 5345 5530 gene locus_tag LOCUS_40770 5345 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 6054 5464 gene locus_tag LOCUS_40780 6054 5464 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976220.1 protein_id gnl|my_center|LOCUS_40780 8002 6146 gene locus_tag LOCUS_40790 gene lepA 8002 6146 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM20 protein_id gnl|my_center|LOCUS_40790 8354 8584 gene locus_tag LOCUS_40800 8354 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 >Feature sequence0349 988 1173 gene locus_tag LOCUS_40810 988 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 1479 1201 gene locus_tag LOCUS_40820 1479 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 1962 2141 gene locus_tag LOCUS_40830 1962 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 3250 3101 gene locus_tag LOCUS_40840 3250 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 5002 3266 gene locus_tag LOCUS_40850 5002 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 8403 5047 gene locus_tag LOCUS_40860 8403 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 >Feature sequence0350 1163 2254 gene locus_tag LOCUS_40870 1163 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 2495 3334 gene locus_tag LOCUS_40880 2495 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 5233 3428 gene locus_tag LOCUS_40890 gene menD 5233 3428 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI6 protein_id gnl|my_center|LOCUS_40890 7146 5722 gene locus_tag LOCUS_40900 7146 5722 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_40900 7708 8550 gene locus_tag LOCUS_40910 gene menA 7708 8550 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW6 protein_id gnl|my_center|LOCUS_40910 >Feature sequence0351 445 963 gene locus_tag LOCUS_40920 445 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 1396 5328 gene locus_tag LOCUS_40930 1396 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 5674 6918 gene locus_tag LOCUS_40940 5674 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 >Feature sequence0352 1 264 gene locus_tag LOCUS_40950 1 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 1569 997 gene locus_tag LOCUS_40960 1569 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 2853 1687 gene locus_tag LOCUS_40970 2853 1687 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5D8 protein_id gnl|my_center|LOCUS_40970 4942 3155 gene locus_tag LOCUS_40980 gene aspS 4942 3155 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJS8 protein_id gnl|my_center|LOCUS_40980 5733 5308 gene locus_tag LOCUS_40990 5733 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 6821 5931 gene locus_tag LOCUS_41000 gene htpx 6821 5931 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SF0 protein_id gnl|my_center|LOCUS_41000 8460 7573 gene locus_tag LOCUS_41010 8460 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 >Feature sequence0353 1692 238 gene locus_tag LOCUS_41020 1692 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 3939 1723 gene locus_tag LOCUS_41030 3939 1723 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729174.1 protein_id gnl|my_center|LOCUS_41030 4596 6641 gene locus_tag LOCUS_41040 gene dnaG 4596 6641 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB0 protein_id gnl|my_center|LOCUS_41040 7067 7903 gene locus_tag LOCUS_41050 7067 7903 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_41050 >Feature sequence0354 548 204 gene locus_tag LOCUS_41060 548 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 1276 950 gene locus_tag LOCUS_41070 1276 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 2394 2636 gene locus_tag LOCUS_41080 2394 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 5595 3016 gene locus_tag LOCUS_41090 gene priA 5595 3016 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLR3 protein_id gnl|my_center|LOCUS_41090 6982 5924 gene locus_tag LOCUS_41100 6982 5924 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_41100 7459 7298 gene locus_tag LOCUS_41110 7459 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 8309 7401 gene locus_tag LOCUS_41120 8309 7401 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809044.1 protein_id gnl|my_center|LOCUS_41120 >Feature sequence0355 214 339 gene locus_tag LOCUS_41130 214 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 606 1202 gene locus_tag LOCUS_41140 606 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 1211 1777 gene locus_tag LOCUS_41150 1211 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 1960 2352 gene locus_tag LOCUS_41160 1960 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142480.1 protein_id gnl|my_center|LOCUS_41160 2391 3578 gene locus_tag LOCUS_41170 2391 3578 CDS product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 protein_id gnl|my_center|LOCUS_41170 4015 4878 gene locus_tag LOCUS_41180 4015 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143111.1 protein_id gnl|my_center|LOCUS_41180 5110 5262 gene locus_tag LOCUS_41190 5110 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 8303 5673 gene locus_tag LOCUS_41200 gene alaS 8303 5673 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH56 protein_id gnl|my_center|LOCUS_41200 >Feature sequence0356 637 1509 gene locus_tag LOCUS_41210 637 1509 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142637.1 protein_id gnl|my_center|LOCUS_41210 1960 1727 gene locus_tag LOCUS_41220 1960 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 2802 4079 gene locus_tag LOCUS_41230 gene ahcY 2802 4079 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC8 protein_id gnl|my_center|LOCUS_41230 4285 4908 gene locus_tag LOCUS_41240 4285 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057912.1 protein_id gnl|my_center|LOCUS_41240 5103 5031 gene locus_tag LOCUS_t00480 5103 5031 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5545 5345 gene locus_tag LOCUS_41250 5545 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 6989 6222 gene locus_tag LOCUS_41260 gene hisF 6989 6222 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN7 protein_id gnl|my_center|LOCUS_41260 7397 7597 gene locus_tag LOCUS_41270 7397 7597 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056374.1 protein_id gnl|my_center|LOCUS_41270 >Feature sequence0357 951 58 gene locus_tag LOCUS_41280 gene aroE 951 58 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA6 protein_id gnl|my_center|LOCUS_41280 1362 2468 gene locus_tag LOCUS_41290 1362 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 3067 3303 gene locus_tag LOCUS_41300 3067 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 3762 5765 gene locus_tag LOCUS_41310 3762 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 6278 7396 gene locus_tag LOCUS_41320 6278 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141501.1 protein_id gnl|my_center|LOCUS_41320 7772 7575 gene locus_tag LOCUS_41330 7772 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 >Feature sequence0358 1347 673 gene locus_tag LOCUS_41340 1347 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 1793 1566 gene locus_tag LOCUS_41350 1793 1566 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057929.1 protein_id gnl|my_center|LOCUS_41350 3364 2075 gene locus_tag LOCUS_41360 gene hisZ 3364 2075 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHZ4 protein_id gnl|my_center|LOCUS_41360 4319 3372 gene locus_tag LOCUS_41370 4319 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_41370 5514 4684 gene locus_tag LOCUS_41380 5514 4684 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 protein_id gnl|my_center|LOCUS_41380 7663 5771 gene locus_tag LOCUS_41390 7663 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 8352 7831 gene locus_tag LOCUS_41400 8352 7831 CDS product thermonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545903.1 protein_id gnl|my_center|LOCUS_41400 >Feature sequence0359 2804 2430 gene locus_tag LOCUS_41410 2804 2430 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_41410 3238 2801 gene locus_tag LOCUS_41420 3238 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 5146 3569 gene locus_tag LOCUS_41430 5146 3569 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807932.1 protein_id gnl|my_center|LOCUS_41430 7082 6834 gene locus_tag LOCUS_41440 7082 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 7394 7173 gene locus_tag LOCUS_41450 7394 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 7610 7449 gene locus_tag LOCUS_41460 7610 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 8200 7859 gene locus_tag LOCUS_41470 8200 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 8421 8230 gene locus_tag LOCUS_41480 8421 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 >Feature sequence0360 366 1385 gene locus_tag LOCUS_41490 366 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 1574 1876 gene locus_tag LOCUS_41500 gene rpsN 1574 1876 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW7 protein_id gnl|my_center|LOCUS_41500 2404 2078 gene locus_tag LOCUS_41510 2404 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056249.1 protein_id gnl|my_center|LOCUS_41510 2608 2680 gene locus_tag LOCUS_t00490 2608 2680 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5462 2817 gene locus_tag LOCUS_41520 5462 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 6390 6061 gene locus_tag LOCUS_41530 6390 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 6686 6438 gene locus_tag LOCUS_41540 6686 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 >Feature sequence0361 2082 568 gene locus_tag LOCUS_41550 gene lnt 2082 568 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIC3 protein_id gnl|my_center|LOCUS_41550 2204 2419 gene locus_tag LOCUS_41560 2204 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 3457 5595 gene locus_tag LOCUS_41570 3457 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 6178 5630 gene locus_tag LOCUS_41580 6178 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 6943 6554 gene locus_tag LOCUS_41590 6943 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 8076 7288 gene locus_tag LOCUS_41600 gene cpdA 8076 7288 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT4 protein_id gnl|my_center|LOCUS_41600 8196 8266 gene locus_tag LOCUS_t00500 8196 8266 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0362 957 406 gene locus_tag LOCUS_41610 957 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_41610 1218 1925 gene locus_tag LOCUS_41620 1218 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 1943 3409 gene locus_tag LOCUS_41630 1943 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 5026 7071 gene locus_tag LOCUS_41640 5026 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918443.1 protein_id gnl|my_center|LOCUS_41640 7068 8231 gene locus_tag LOCUS_41650 7068 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_41650 >Feature sequence0363 1057 1323 gene locus_tag LOCUS_41660 1057 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 3238 1553 gene locus_tag LOCUS_41670 3238 1553 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056296.1 protein_id gnl|my_center|LOCUS_41670 4064 5017 gene locus_tag LOCUS_41680 4064 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 5040 6263 gene locus_tag LOCUS_41690 5040 6263 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257201.1 protein_id gnl|my_center|LOCUS_41690 7088 6297 gene locus_tag LOCUS_41700 7088 6297 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976396.1 protein_id gnl|my_center|LOCUS_41700 7182 8192 gene locus_tag LOCUS_41710 7182 8192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 >Feature sequence0364 1296 268 gene locus_tag LOCUS_41720 1296 268 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_41720 2112 1738 gene locus_tag LOCUS_41730 2112 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 6294 2347 gene locus_tag LOCUS_41740 6294 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 6746 7894 gene locus_tag LOCUS_41750 6746 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 >Feature sequence0365 676 134 gene locus_tag LOCUS_41760 676 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 1475 1020 gene locus_tag LOCUS_41770 1475 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 2794 1508 gene locus_tag LOCUS_41780 2794 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 3219 2872 gene locus_tag LOCUS_41790 3219 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 3977 3246 gene locus_tag LOCUS_41800 3977 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 5209 4067 gene locus_tag LOCUS_41810 5209 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 5928 5230 gene locus_tag LOCUS_41820 5928 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 6369 5935 gene locus_tag LOCUS_41830 6369 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 7013 6354 gene locus_tag LOCUS_41840 7013 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 7491 7015 gene locus_tag LOCUS_41850 7491 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 >Feature sequence0366 204 881 gene locus_tag LOCUS_41860 gene ntcA 204 881 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057487.1 protein_id gnl|my_center|LOCUS_41860 1000 2814 gene locus_tag LOCUS_41870 1000 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 2815 3240 gene locus_tag LOCUS_41880 2815 3240 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL47 protein_id gnl|my_center|LOCUS_41880 4078 4974 gene locus_tag LOCUS_41890 4078 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 5383 7743 gene locus_tag LOCUS_41900 5383 7743 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143682.1 protein_id gnl|my_center|LOCUS_41900 >Feature sequence0367 23 204 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtcttggggtctccccaagtagag 647 1021 gene locus_tag LOCUS_41910 647 1021 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL6 protein_id gnl|my_center|LOCUS_41910 4197 1867 gene locus_tag LOCUS_41920 4197 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 4850 4431 gene locus_tag LOCUS_41930 4850 4431 CDS product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_41930 6061 5027 gene locus_tag LOCUS_41940 6061 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 7957 6494 gene locus_tag LOCUS_41950 7957 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 >Feature sequence0368 1891 377 gene locus_tag LOCUS_41960 1891 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 3423 2071 gene locus_tag LOCUS_41970 3423 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 4759 3671 gene locus_tag LOCUS_41980 4759 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 6751 4988 gene locus_tag LOCUS_41990 6751 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057930.1 protein_id gnl|my_center|LOCUS_41990 7109 7468 gene locus_tag LOCUS_42000 7109 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 8255 7791 gene locus_tag LOCUS_42010 8255 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 >Feature sequence0369 224 1339 gene locus_tag LOCUS_42020 gene pilM 224 1339 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058174.1 protein_id gnl|my_center|LOCUS_42020 1339 2160 gene locus_tag LOCUS_42030 1339 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 2144 2968 gene locus_tag LOCUS_42040 2144 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 3688 5472 gene locus_tag LOCUS_42050 3688 5472 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 protein_id gnl|my_center|LOCUS_42050 5613 7958 gene locus_tag LOCUS_42060 5613 7958 CDS product general secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058177.1 protein_id gnl|my_center|LOCUS_42060 >Feature sequence0370 293 2629 gene locus_tag LOCUS_42070 293 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 3012 3572 gene locus_tag LOCUS_42080 3012 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 3843 4607 gene locus_tag LOCUS_42090 3843 4607 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI45 protein_id gnl|my_center|LOCUS_42090 5142 4618 gene locus_tag LOCUS_42100 5142 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 7994 6333 gene locus_tag LOCUS_42110 7994 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140887.1 protein_id gnl|my_center|LOCUS_42110 >Feature sequence0371 853 359 gene locus_tag LOCUS_42120 853 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 1952 2245 gene locus_tag LOCUS_42130 1952 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 2254 2661 gene locus_tag LOCUS_42140 gene vapC 2254 2661 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEK4 protein_id gnl|my_center|LOCUS_42140 3561 4238 gene locus_tag LOCUS_42150 3561 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 4256 5485 gene locus_tag LOCUS_42160 4256 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 5759 8116 gene locus_tag LOCUS_42170 5759 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 >Feature sequence0372 660 325 gene locus_tag LOCUS_42180 660 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 1341 1183 gene locus_tag LOCUS_42190 1341 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 1558 1863 gene locus_tag LOCUS_42200 1558 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 2407 2042 gene locus_tag LOCUS_42210 2407 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_42210 5864 2670 gene locus_tag LOCUS_42220 gene apcE 5864 2670 CDS product photosystem I reaction center subunit X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058198.1 protein_id gnl|my_center|LOCUS_42220 6784 7998 gene locus_tag LOCUS_42230 6784 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 protein_id gnl|my_center|LOCUS_42230 >Feature sequence0373 <1 558 gene locus_tag LOCUS_42240 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003120048.1:two-component sensor histidine kinase 558 2495 gene locus_tag LOCUS_42250 558 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 2557 8019 gene locus_tag LOCUS_42260 2557 8019 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_42260 >Feature sequence0374 91 1515 gene locus_tag LOCUS_42270 91 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 905 834 gene locus_tag LOCUS_t00510 905 834 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1705 2865 gene locus_tag LOCUS_42280 gene cotSA 1705 2865 CDS product spore coat protein SA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46915 protein_id gnl|my_center|LOCUS_42280 3324 4325 gene locus_tag LOCUS_42290 3324 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 5754 4603 gene locus_tag LOCUS_42300 5754 4603 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065345.1 protein_id gnl|my_center|LOCUS_42300 6266 7417 gene locus_tag LOCUS_42310 gene hisC 6266 7417 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM42 protein_id gnl|my_center|LOCUS_42310 7508 7999 gene locus_tag LOCUS_42320 7508 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 >Feature sequence0375 1491 1694 gene locus_tag LOCUS_42330 1491 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 1768 3219 gene locus_tag LOCUS_42340 1768 3219 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130104.1 protein_id gnl|my_center|LOCUS_42340 >Feature sequence0376 632 78 gene locus_tag LOCUS_42350 632 78 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_42350 1974 3020 gene locus_tag LOCUS_42360 1974 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 3739 5286 gene locus_tag LOCUS_42370 3739 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 5791 5621 gene locus_tag LOCUS_42380 5791 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 6124 6729 gene locus_tag LOCUS_42390 gene ycf58 6124 6729 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD5 protein_id gnl|my_center|LOCUS_42390 6732 7364 gene locus_tag LOCUS_42400 6732 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 >Feature sequence0377 942 592 gene locus_tag LOCUS_42410 942 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 2458 1445 gene locus_tag LOCUS_42420 2458 1445 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057413.1 protein_id gnl|my_center|LOCUS_42420 2586 3365 gene locus_tag LOCUS_42430 2586 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 4121 4717 gene locus_tag LOCUS_42440 gene cobH 4121 4717 CDS product cobalt-precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056028.1 protein_id gnl|my_center|LOCUS_42440 5084 6394 gene locus_tag LOCUS_42450 gene cobL 5084 6394 CDS product precorrin-6Y C5,15-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056027.1 protein_id gnl|my_center|LOCUS_42450 <8228 6749 gene locus_tag LOCUS_42460 <8228 6749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037121.1:sensor histidine kinase >Feature sequence0378 447 722 gene locus_tag LOCUS_42470 447 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 1182 1646 gene locus_tag LOCUS_42480 1182 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_42480 1803 2108 gene locus_tag LOCUS_42490 1803 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 2122 2541 gene locus_tag LOCUS_42500 gene vapC 2122 2541 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KY5 protein_id gnl|my_center|LOCUS_42500 2550 3128 gene locus_tag LOCUS_42510 2550 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_42510 6187 3230 gene locus_tag LOCUS_42520 6187 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 7046 7252 gene locus_tag LOCUS_42530 7046 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 7203 7598 gene locus_tag LOCUS_42540 7203 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 >Feature sequence0379 330 1643 gene locus_tag LOCUS_42550 gene kmo 330 1643 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_42550 1822 3036 gene locus_tag LOCUS_42560 1822 3036 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091709.1 protein_id gnl|my_center|LOCUS_42560 3313 4290 gene locus_tag LOCUS_42570 3313 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 5785 4406 gene locus_tag LOCUS_42580 5785 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 6329 7447 gene locus_tag LOCUS_42590 6329 7447 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026984.1 protein_id gnl|my_center|LOCUS_42590 7628 8077 gene locus_tag LOCUS_42600 7628 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 >Feature sequence0380 2996 5410 gene locus_tag LOCUS_42610 2996 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 5649 6209 gene locus_tag LOCUS_42620 5649 6209 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_42620 6209 7267 gene locus_tag LOCUS_42630 6209 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 >Feature sequence0381 302 934 gene locus_tag LOCUS_42640 302 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 1435 4413 gene locus_tag LOCUS_42650 1435 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_42650 4799 5935 gene locus_tag LOCUS_42660 4799 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 6788 7024 gene locus_tag LOCUS_42670 6788 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 7024 7428 gene locus_tag LOCUS_42680 7024 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 >Feature sequence0382 223 3432 gene locus_tag LOCUS_42690 223 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 3863 4921 gene locus_tag LOCUS_42700 3863 4921 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141637.1 protein_id gnl|my_center|LOCUS_42700 5402 5055 gene locus_tag LOCUS_42710 5402 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 5812 5522 gene locus_tag LOCUS_42720 5812 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42720 7192 6437 gene locus_tag LOCUS_42730 7192 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42730 7632 7366 gene locus_tag LOCUS_42740 7632 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42740 >Feature sequence0383 396 1091 gene locus_tag LOCUS_42750 396 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 1101 1556 gene locus_tag LOCUS_42760 1101 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 1574 2020 gene locus_tag LOCUS_42770 1574 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 3748 2303 gene locus_tag LOCUS_42780 3748 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 4318 3767 gene locus_tag LOCUS_42790 4318 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963161.1 protein_id gnl|my_center|LOCUS_42790 4795 4722 gene locus_tag LOCUS_t00520 4795 4722 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4830 5402 gene locus_tag LOCUS_42800 gene moaC 4830 5402 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCF1 protein_id gnl|my_center|LOCUS_42800 5951 5421 gene locus_tag LOCUS_42810 5951 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143205.1 protein_id gnl|my_center|LOCUS_42810 6445 6690 gene locus_tag LOCUS_42820 6445 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 protein_id gnl|my_center|LOCUS_42820 7038 7340 gene locus_tag LOCUS_42830 7038 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057560.1 protein_id gnl|my_center|LOCUS_42830 7688 7503 gene locus_tag LOCUS_42840 7688 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 >Feature sequence0384 592 6225 gene locus_tag LOCUS_42850 592 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 >Feature sequence0385 677 243 gene locus_tag LOCUS_42860 677 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 1256 1092 gene locus_tag LOCUS_42870 1256 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 4064 2034 gene locus_tag LOCUS_42880 4064 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 7560 4645 gene locus_tag LOCUS_42890 7560 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 >Feature sequence0386 199 2133 gene locus_tag LOCUS_42900 199 2133 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_42900 2809 3768 gene locus_tag LOCUS_42910 2809 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879978.1 protein_id gnl|my_center|LOCUS_42910 4070 4339 gene locus_tag LOCUS_42920 4070 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142102.1 protein_id gnl|my_center|LOCUS_42920 4992 4762 gene locus_tag LOCUS_42930 4992 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 4879 5109 gene locus_tag LOCUS_42940 4879 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 5163 5696 gene locus_tag LOCUS_42950 5163 5696 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL3 protein_id gnl|my_center|LOCUS_42950 5839 6027 gene locus_tag LOCUS_42960 5839 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 6826 6038 gene locus_tag LOCUS_42970 6826 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 7787 6870 gene locus_tag LOCUS_42980 7787 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 >Feature sequence0387 1265 168 gene locus_tag LOCUS_42990 1265 168 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_42990 2044 1520 gene locus_tag LOCUS_43000 2044 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 5086 2672 gene locus_tag LOCUS_43010 5086 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 5828 6439 gene locus_tag LOCUS_43020 5828 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 7631 6672 gene locus_tag LOCUS_43030 gene ubiA 7631 6672 CDS product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 protein_id gnl|my_center|LOCUS_43030 >Feature sequence0388 569 1996 gene locus_tag LOCUS_43040 569 1996 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_43040 2012 2923 gene locus_tag LOCUS_43050 2012 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 3854 3102 gene locus_tag LOCUS_43060 3854 3102 CDS product circadian oscillation regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056401.1 protein_id gnl|my_center|LOCUS_43060 5246 4212 gene locus_tag LOCUS_43070 gene pilT 5246 4212 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056402.1 protein_id gnl|my_center|LOCUS_43070 5333 5512 gene locus_tag LOCUS_43080 5333 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 6471 7592 gene locus_tag LOCUS_43090 6471 7592 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_43090 >Feature sequence0389 748 2367 gene locus_tag LOCUS_43100 748 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 2982 2428 gene locus_tag LOCUS_43110 2982 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 3228 3028 gene locus_tag LOCUS_43120 3228 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 4468 3368 gene locus_tag LOCUS_43130 4468 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_43130 6912 4690 gene locus_tag LOCUS_43140 6912 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 7777 6950 gene locus_tag LOCUS_43150 7777 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057438.1 protein_id gnl|my_center|LOCUS_43150 >Feature sequence0390 544 1404 gene locus_tag LOCUS_43160 544 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 1772 4192 gene locus_tag LOCUS_43170 1772 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 4680 5501 gene locus_tag LOCUS_43180 4680 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 5726 5953 gene locus_tag LOCUS_43190 5726 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144012.1 protein_id gnl|my_center|LOCUS_43190 6281 6556 gene locus_tag LOCUS_43200 6281 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 7737 6823 gene locus_tag LOCUS_43210 7737 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 7761 7979 gene locus_tag LOCUS_43220 7761 7979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 >Feature sequence0391 809 153 gene locus_tag LOCUS_43230 809 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 2025 931 gene locus_tag LOCUS_43240 2025 931 CDS product histidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142216.1 protein_id gnl|my_center|LOCUS_43240 3407 2193 gene locus_tag LOCUS_43250 3407 2193 CDS product cytochrome P-450 like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141940.1 protein_id gnl|my_center|LOCUS_43250 3970 3719 gene locus_tag LOCUS_43260 3970 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 4977 4024 gene locus_tag LOCUS_43270 4977 4024 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141945.1 protein_id gnl|my_center|LOCUS_43270 6033 5077 gene locus_tag LOCUS_43280 6033 5077 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141945.1 protein_id gnl|my_center|LOCUS_43280 7179 6211 gene locus_tag LOCUS_43290 7179 6211 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141945.1 protein_id gnl|my_center|LOCUS_43290 >Feature sequence0392 2271 274 gene locus_tag LOCUS_43300 2271 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 5925 3130 gene locus_tag LOCUS_43310 5925 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 5999 6712 gene locus_tag LOCUS_43320 5999 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 6854 7564 gene locus_tag LOCUS_43330 gene rpiA 6854 7564 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJF2 protein_id gnl|my_center|LOCUS_43330 >Feature sequence0393 359 2854 gene locus_tag LOCUS_43340 359 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 3448 5052 gene locus_tag LOCUS_43350 3448 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 5346 6968 gene locus_tag LOCUS_43360 5346 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 7301 7543 gene locus_tag LOCUS_43370 7301 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 >Feature sequence0394 1459 230 gene locus_tag LOCUS_43380 1459 230 CDS product UPF0754 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM9 protein_id gnl|my_center|LOCUS_43380 2341 1607 gene locus_tag LOCUS_43390 gene menG 2341 1607 CDS product 2-phytyl-1,4-naphtoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPC8 protein_id gnl|my_center|LOCUS_43390 3348 2401 gene locus_tag LOCUS_43400 3348 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 4438 7788 gene locus_tag LOCUS_43410 4438 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 >Feature sequence0395 1093 251 gene locus_tag LOCUS_43420 1093 251 CDS product S-adenosyl-L-methionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQ31 protein_id gnl|my_center|LOCUS_43420 2283 2906 gene locus_tag LOCUS_43430 2283 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 3623 5020 gene locus_tag LOCUS_43440 3623 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143146.1 protein_id gnl|my_center|LOCUS_43440 6107 5415 gene locus_tag LOCUS_43450 gene coaE 6107 5415 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIP9 protein_id gnl|my_center|LOCUS_43450 6344 6622 gene locus_tag LOCUS_43460 6344 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 6654 6965 gene locus_tag LOCUS_43470 6654 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43470 7004 7450 gene locus_tag LOCUS_43480 7004 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43480 >Feature sequence0396 450 91 gene locus_tag LOCUS_43490 450 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 2046 1051 gene locus_tag LOCUS_43500 2046 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057700.1 protein_id gnl|my_center|LOCUS_43500 2309 1950 gene locus_tag LOCUS_43510 2309 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 4138 2306 gene locus_tag LOCUS_43520 4138 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 5714 5127 gene locus_tag LOCUS_43530 5714 5127 CDS product fibrillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 protein_id gnl|my_center|LOCUS_43530 7619 6030 gene locus_tag LOCUS_43540 gene betA 7619 6030 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230760.1 protein_id gnl|my_center|LOCUS_43540 >Feature sequence0397 324 989 gene locus_tag LOCUS_43550 324 989 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423260.1 protein_id gnl|my_center|LOCUS_43550 3546 1306 gene locus_tag LOCUS_43560 3546 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 4760 5770 gene locus_tag LOCUS_43570 4760 5770 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAP0 protein_id gnl|my_center|LOCUS_43570 5976 7274 gene locus_tag LOCUS_43580 gene proP 5976 7274 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125726.1 protein_id gnl|my_center|LOCUS_43580 >Feature sequence0398 1997 285 gene locus_tag LOCUS_43590 1997 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 2546 3961 gene locus_tag LOCUS_43600 2546 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057642.1 protein_id gnl|my_center|LOCUS_43600 4480 6081 gene locus_tag LOCUS_43610 4480 6081 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_43610 6442 7002 gene locus_tag LOCUS_43620 6442 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124316.1 protein_id gnl|my_center|LOCUS_43620 7260 7332 gene locus_tag LOCUS_t00530 7260 7332 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0399 1586 204 gene locus_tag LOCUS_43630 1586 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889590.1 protein_id gnl|my_center|LOCUS_43630 2009 1626 gene locus_tag LOCUS_43640 2009 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 3213 4331 gene locus_tag LOCUS_43650 3213 4331 CDS product UPF0284 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGL0 protein_id gnl|my_center|LOCUS_43650 5096 4509 gene locus_tag LOCUS_43660 5096 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 5766 6344 gene locus_tag LOCUS_43670 gene cpcS 5766 6344 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKE7 protein_id gnl|my_center|LOCUS_43670 6348 7529 gene locus_tag LOCUS_43680 6348 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056563.1 protein_id gnl|my_center|LOCUS_43680 >Feature sequence0400 519 1499 gene locus_tag LOCUS_43690 519 1499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_43690 3815 1743 gene locus_tag LOCUS_43700 3815 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 6228 4126 gene locus_tag LOCUS_43710 6228 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 6794 7753 gene locus_tag LOCUS_43720 gene rfbD 6794 7753 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67175 protein_id gnl|my_center|LOCUS_43720 >Feature sequence0401 <1 1066 gene locus_tag LOCUS_43730 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938022.1:PAS domain-containing sensor histidine kinase 1756 7263 gene locus_tag LOCUS_43740 1756 7263 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_43740 >Feature sequence0402 161 1834 gene locus_tag LOCUS_43750 161 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 2314 3423 gene locus_tag LOCUS_43760 2314 3423 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_43760 4088 3690 gene locus_tag LOCUS_43770 4088 3690 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817440.1 protein_id gnl|my_center|LOCUS_43770 4387 4091 gene locus_tag LOCUS_43780 4387 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 5064 4768 gene locus_tag LOCUS_43790 5064 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 7341 5275 gene locus_tag LOCUS_43800 7341 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142700.1 protein_id gnl|my_center|LOCUS_43800 >Feature sequence0403 149 1024 gene locus_tag LOCUS_43810 149 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 2658 1453 gene locus_tag LOCUS_43820 2658 1453 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72F23 protein_id gnl|my_center|LOCUS_43820 3677 3201 gene locus_tag LOCUS_43830 3677 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 5865 4138 gene locus_tag LOCUS_43840 gene sdhA 5865 4138 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057217.1 protein_id gnl|my_center|LOCUS_43840 6359 6015 gene locus_tag LOCUS_43850 6359 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058283.1 protein_id gnl|my_center|LOCUS_43850 >Feature sequence0404 130 3102 gene locus_tag LOCUS_43860 gene uvrA 130 3102 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD5 protein_id gnl|my_center|LOCUS_43860 3334 4716 gene locus_tag LOCUS_43870 3334 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 4947 5219 gene locus_tag LOCUS_43880 4947 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43880 5284 6318 gene locus_tag LOCUS_43890 5284 6318 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204628.1 protein_id gnl|my_center|LOCUS_43890 6686 7567 gene locus_tag LOCUS_43900 6686 7567 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056762.1 protein_id gnl|my_center|LOCUS_43900 >Feature sequence0405 41 652 gene locus_tag LOCUS_43910 gene rimM 41 652 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK05 protein_id gnl|my_center|LOCUS_43910 1345 1626 gene locus_tag LOCUS_43920 1345 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 1997 3238 gene locus_tag LOCUS_43930 1997 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 >Feature sequence0406 1222 41 gene locus_tag LOCUS_43940 gene ycf84 1222 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143323.1 protein_id gnl|my_center|LOCUS_43940 2122 1346 gene locus_tag LOCUS_43950 2122 1346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143254.1 protein_id gnl|my_center|LOCUS_43950 2741 2352 gene locus_tag LOCUS_43960 2741 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 5336 3144 gene locus_tag LOCUS_43970 5336 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 6397 6212 gene locus_tag LOCUS_43980 6397 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 6461 7480 gene locus_tag LOCUS_43990 6461 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_43990 >Feature sequence0407 496 275 gene locus_tag LOCUS_44000 496 275 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYZ8 protein_id gnl|my_center|LOCUS_44000 2948 690 gene locus_tag LOCUS_44010 2948 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 4247 3195 gene locus_tag LOCUS_44020 4247 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 6985 4361 gene locus_tag LOCUS_44030 6985 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 >Feature sequence0408 1692 625 gene locus_tag LOCUS_44040 gene ddl 1692 625 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH0 protein_id gnl|my_center|LOCUS_44040 3527 4885 gene locus_tag LOCUS_44050 3527 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 4899 5753 gene locus_tag LOCUS_44060 4899 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 5848 7227 gene locus_tag LOCUS_44070 5848 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_44070 >Feature sequence0409 174 2267 gene locus_tag LOCUS_44080 174 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 3557 2697 gene locus_tag LOCUS_44090 3557 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 4009 3554 gene locus_tag LOCUS_44100 4009 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 4847 7324 gene locus_tag LOCUS_44110 gene clpC 4847 7324 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_44110 >Feature sequence0410 2661 280 gene locus_tag LOCUS_44120 2661 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 6304 3857 gene locus_tag LOCUS_44130 6304 3857 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525365.1 protein_id gnl|my_center|LOCUS_44130 6963 6301 gene locus_tag LOCUS_44140 6963 6301 CDS product chew domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525366.1 protein_id gnl|my_center|LOCUS_44140 >Feature sequence0411 2342 645 gene locus_tag LOCUS_44150 2342 645 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143683.1 protein_id gnl|my_center|LOCUS_44150 3787 2834 gene locus_tag LOCUS_44160 gene truB 3787 2834 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM3 protein_id gnl|my_center|LOCUS_44160 4886 7369 gene locus_tag LOCUS_44170 4886 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 >Feature sequence0412 1476 706 gene locus_tag LOCUS_44180 1476 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 3334 2375 gene locus_tag LOCUS_44190 3334 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 3903 4070 gene locus_tag LOCUS_44200 3903 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44200 4128 4379 gene locus_tag LOCUS_44210 4128 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44210 6750 4906 gene locus_tag LOCUS_44220 gene ftsH 6750 4906 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI5 protein_id gnl|my_center|LOCUS_44220 >Feature sequence0413 <1 1770 gene locus_tag LOCUS_44230 <1 1770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211638.1:autotransporter 1953 4634 gene locus_tag LOCUS_44240 1953 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 5167 5412 gene locus_tag LOCUS_44250 5167 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 5826 6497 gene locus_tag LOCUS_44260 5826 6497 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN8 protein_id gnl|my_center|LOCUS_44260 >Feature sequence0414 1231 218 gene locus_tag LOCUS_44270 1231 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 2245 1520 gene locus_tag LOCUS_44280 gene rph 2245 1520 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA4 protein_id gnl|my_center|LOCUS_44280 3047 2490 gene locus_tag LOCUS_44290 gene adk 3047 2490 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML4 protein_id gnl|my_center|LOCUS_44290 3169 3453 gene locus_tag LOCUS_44300 3169 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 3583 3924 gene locus_tag LOCUS_44310 3583 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 3924 4655 gene locus_tag LOCUS_44320 3924 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 6949 5105 gene locus_tag LOCUS_44330 6949 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 >Feature sequence0415 1094 2380 gene locus_tag LOCUS_44340 1094 2380 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924694.1 protein_id gnl|my_center|LOCUS_44340 2384 3340 gene locus_tag LOCUS_44350 2384 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599571.1 protein_id gnl|my_center|LOCUS_44350 4318 4623 gene locus_tag LOCUS_44360 gene ndhC 4318 4623 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDP3 protein_id gnl|my_center|LOCUS_44360 4614 5339 gene locus_tag LOCUS_44370 gene ndhK 4614 5339 CDS product NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ4 protein_id gnl|my_center|LOCUS_44370 5332 5862 gene locus_tag LOCUS_44380 gene ndhJ 5332 5862 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ01 protein_id gnl|my_center|LOCUS_44380 6997 6116 gene locus_tag LOCUS_44390 6997 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 >Feature sequence0416 2474 3484 gene locus_tag LOCUS_44400 gene uge 2474 3484 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_44400 5689 3734 gene locus_tag LOCUS_44410 gene wbfY 5689 3734 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_44410 6815 6252 gene locus_tag LOCUS_44420 6815 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_44420 >Feature sequence0417 491 1126 gene locus_tag LOCUS_44430 491 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 1626 1150 gene locus_tag LOCUS_44440 1626 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 2017 1649 gene locus_tag LOCUS_44450 gene ftrC 2017 1649 CDS product ferredoxin-thioredoxin reductase, catalytic chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK3 protein_id gnl|my_center|LOCUS_44450 3099 2251 gene locus_tag LOCUS_44460 3099 2251 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND10 protein_id gnl|my_center|LOCUS_44460 3510 3256 gene locus_tag LOCUS_44470 3510 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 4654 3545 gene locus_tag LOCUS_44480 4654 3545 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 protein_id gnl|my_center|LOCUS_44480 5180 6268 gene locus_tag LOCUS_44490 5180 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 7256 6852 gene locus_tag LOCUS_44500 7256 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056714.1 protein_id gnl|my_center|LOCUS_44500 >Feature sequence0418 1214 333 gene locus_tag LOCUS_44510 1214 333 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 protein_id gnl|my_center|LOCUS_44510 2480 1221 gene locus_tag LOCUS_44520 2480 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 2453 2641 gene locus_tag LOCUS_44530 2453 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 2773 3771 gene locus_tag LOCUS_44540 2773 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 7267 3887 gene locus_tag LOCUS_44550 7267 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 >Feature sequence0419 1859 636 gene locus_tag LOCUS_44560 1859 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057855.1 protein_id gnl|my_center|LOCUS_44560 2117 2998 gene locus_tag LOCUS_44570 gene desC2 2117 2998 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057490.1 protein_id gnl|my_center|LOCUS_44570 3864 3154 gene locus_tag LOCUS_44580 3864 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 5039 3864 gene locus_tag LOCUS_44590 5039 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 6791 5523 gene locus_tag LOCUS_44600 gene proA 6791 5523 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEF6 protein_id gnl|my_center|LOCUS_44600 >Feature sequence0420 695 607 gene locus_tag LOCUS_t00540 695 607 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3243 826 gene locus_tag LOCUS_44610 gene comE 3243 826 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057539.1 protein_id gnl|my_center|LOCUS_44610 3740 3258 gene locus_tag LOCUS_44620 3740 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 4899 3973 gene locus_tag LOCUS_44630 gene glyQ 4899 3973 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK36 protein_id gnl|my_center|LOCUS_44630 5783 5604 gene locus_tag LOCUS_44640 5783 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 6431 5922 gene locus_tag LOCUS_44650 6431 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 7112 6504 gene locus_tag LOCUS_44660 7112 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 >Feature sequence0421 1870 458 gene locus_tag LOCUS_44670 1870 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 3231 1867 gene locus_tag LOCUS_44680 3231 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 4750 4127 gene locus_tag LOCUS_44690 4750 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 5203 4841 gene locus_tag LOCUS_44700 5203 4841 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122372.1 protein_id gnl|my_center|LOCUS_44700 5492 6136 gene locus_tag LOCUS_44710 5492 6136 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_44710 6403 6996 gene locus_tag LOCUS_44720 6403 6996 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940393.1 protein_id gnl|my_center|LOCUS_44720 >Feature sequence0422 1033 728 gene locus_tag LOCUS_44730 1033 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 1778 1332 gene locus_tag LOCUS_44740 1778 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 2368 4071 gene locus_tag LOCUS_44750 2368 4071 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_44750 5012 5785 gene locus_tag LOCUS_44760 gene cobA 5012 5785 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055999.1 protein_id gnl|my_center|LOCUS_44760 6766 6296 gene locus_tag LOCUS_44770 6766 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 >Feature sequence0423 636 241 gene locus_tag LOCUS_44780 636 241 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218564.1 protein_id gnl|my_center|LOCUS_44780 864 1895 gene locus_tag LOCUS_44790 864 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 2458 1946 gene locus_tag LOCUS_44800 2458 1946 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031805.1 protein_id gnl|my_center|LOCUS_44800 2623 3660 gene locus_tag LOCUS_44810 2623 3660 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030519.1 protein_id gnl|my_center|LOCUS_44810 3958 5265 gene locus_tag LOCUS_44820 3958 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 5265 5519 gene locus_tag LOCUS_44830 5265 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 5932 6870 gene locus_tag LOCUS_44840 gene era 5932 6870 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ5 protein_id gnl|my_center|LOCUS_44840 >Feature sequence0424 1644 502 gene locus_tag LOCUS_44850 1644 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057888.1 protein_id gnl|my_center|LOCUS_44850 2250 1804 gene locus_tag LOCUS_44860 2250 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 5407 3080 gene locus_tag LOCUS_44870 5407 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 7214 6000 gene locus_tag LOCUS_44880 7214 6000 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_44880 >Feature sequence0425 2824 332 gene locus_tag LOCUS_44890 2824 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 3134 3784 gene locus_tag LOCUS_44900 3134 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 protein_id gnl|my_center|LOCUS_44900 4302 3919 gene locus_tag LOCUS_44910 4302 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140855.1 protein_id gnl|my_center|LOCUS_44910 5156 6667 gene locus_tag LOCUS_44920 5156 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 >Feature sequence0426 3909 3577 gene locus_tag LOCUS_44930 3909 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 4316 3897 gene locus_tag LOCUS_44940 4316 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 5025 4762 gene locus_tag LOCUS_44950 5025 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 5813 5133 gene locus_tag LOCUS_44960 5813 5133 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_44960 6520 5858 gene locus_tag LOCUS_44970 6520 5858 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878130.1 protein_id gnl|my_center|LOCUS_44970 >Feature sequence0427 2417 252 gene locus_tag LOCUS_44980 2417 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 2841 3404 gene locus_tag LOCUS_44990 2841 3404 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144254.1 protein_id gnl|my_center|LOCUS_44990 3709 6384 gene locus_tag LOCUS_45000 3709 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 >Feature sequence0428 1679 42 gene locus_tag LOCUS_45010 1679 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 1968 2930 gene locus_tag LOCUS_45020 gene por 1968 2930 CDS product protochlorophyllide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 protein_id gnl|my_center|LOCUS_45020 3691 5001 gene locus_tag LOCUS_45030 gene kmo 3691 5001 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_45030 5589 6950 gene locus_tag LOCUS_45040 5589 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 >Feature sequence0429 <1 1690 gene locus_tag LOCUS_45050 <1 1690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DAV7:serine protease 1693 2784 gene locus_tag LOCUS_45060 1693 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 2788 3897 gene locus_tag LOCUS_45070 2788 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 3882 4802 gene locus_tag LOCUS_45080 3882 4802 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706832.1 protein_id gnl|my_center|LOCUS_45080 4799 5929 gene locus_tag LOCUS_45090 4799 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 >Feature sequence0430 423 674 gene locus_tag LOCUS_45100 423 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45100 761 1009 gene locus_tag LOCUS_45110 761 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 987 1445 gene locus_tag LOCUS_45120 987 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 2049 1588 gene locus_tag LOCUS_45130 gene vapC 2049 1588 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHV3 protein_id gnl|my_center|LOCUS_45130 2981 2046 gene locus_tag LOCUS_45140 2981 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 4163 3264 gene locus_tag LOCUS_45150 4163 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 5161 4934 gene locus_tag LOCUS_45160 5161 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 5552 5145 gene locus_tag LOCUS_45170 5552 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 >Feature sequence0431 1287 505 gene locus_tag LOCUS_45180 1287 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 2624 1761 gene locus_tag LOCUS_45190 2624 1761 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141681.1 protein_id gnl|my_center|LOCUS_45190 3803 2862 gene locus_tag LOCUS_45200 3803 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45200 5734 3905 gene locus_tag LOCUS_45210 5734 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 6355 6912 gene locus_tag LOCUS_45220 gene aroK 6355 6912 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH7 protein_id gnl|my_center|LOCUS_45220 >Feature sequence0432 1011 1235 gene locus_tag LOCUS_45230 1011 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 1144 6117 gene locus_tag LOCUS_45240 1144 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 >Feature sequence0433 414 614 gene locus_tag LOCUS_45250 414 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 2011 1046 gene locus_tag LOCUS_45260 2011 1046 CDS product isoaspartyl peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_45260 3509 2433 gene locus_tag LOCUS_45270 3509 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 4130 5155 gene locus_tag LOCUS_45280 4130 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 5382 5203 gene locus_tag LOCUS_45290 5382 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 5966 6718 gene locus_tag LOCUS_45300 gene trmJ 5966 6718 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIP3 protein_id gnl|my_center|LOCUS_45300 6976 6791 gene locus_tag LOCUS_45310 6976 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 >Feature sequence0434 550 1788 gene locus_tag LOCUS_45320 550 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902302.1 protein_id gnl|my_center|LOCUS_45320 2453 3454 gene locus_tag LOCUS_45330 2453 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 4456 3878 gene locus_tag LOCUS_45340 gene aat 4456 3878 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKJ8 protein_id gnl|my_center|LOCUS_45340 6724 4886 gene locus_tag LOCUS_45350 6724 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 >Feature sequence0435 6280 839 gene locus_tag LOCUS_45360 6280 839 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_45360 6934 6764 gene locus_tag LOCUS_45370 6934 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 >Feature sequence0436 2434 6783 gene locus_tag LOCUS_45380 2434 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 >Feature sequence0437 836 324 gene locus_tag LOCUS_45390 836 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142303.1 protein_id gnl|my_center|LOCUS_45390 2917 1145 gene locus_tag LOCUS_45400 2917 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 3419 3135 gene locus_tag LOCUS_45410 3419 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 3515 5179 gene locus_tag LOCUS_45420 3515 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_45420 5548 5384 gene locus_tag LOCUS_45430 5548 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 6343 5894 gene locus_tag LOCUS_45440 6343 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 >Feature sequence0438 330 1268 gene locus_tag LOCUS_45450 330 1268 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057801.1 protein_id gnl|my_center|LOCUS_45450 1417 1959 gene locus_tag LOCUS_45460 1417 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056693.1 protein_id gnl|my_center|LOCUS_45460 3263 2196 gene locus_tag LOCUS_45470 3263 2196 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056993.1 protein_id gnl|my_center|LOCUS_45470 4248 3679 gene locus_tag LOCUS_45480 4248 3679 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK42 protein_id gnl|my_center|LOCUS_45480 5657 4998 gene locus_tag LOCUS_45490 gene ycf39 5657 4998 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056872.1 protein_id gnl|my_center|LOCUS_45490 5916 6707 gene locus_tag LOCUS_45500 5916 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 >Feature sequence0439 166 1713 gene locus_tag LOCUS_45510 166 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 2214 3554 gene locus_tag LOCUS_45520 2214 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 >Feature sequence0440 4812 76 gene locus_tag LOCUS_45530 gene glsF 4812 76 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057208.1 protein_id gnl|my_center|LOCUS_45530 5278 5057 gene locus_tag LOCUS_45540 5278 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 >Feature sequence0441 3779 864 gene locus_tag LOCUS_45550 3779 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 >Feature sequence0442 1662 484 gene locus_tag LOCUS_45560 1662 484 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837503.1 protein_id gnl|my_center|LOCUS_45560 4178 3192 gene locus_tag LOCUS_45570 4178 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 5310 4243 gene locus_tag LOCUS_45580 gene mraY 5310 4243 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK95 protein_id gnl|my_center|LOCUS_45580 5802 5488 gene locus_tag LOCUS_45590 5802 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 5877 6494 gene locus_tag LOCUS_45600 5877 6494 CDS product fibrillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 protein_id gnl|my_center|LOCUS_45600 >Feature sequence0443 1755 352 gene locus_tag LOCUS_45610 1755 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 2381 1752 gene locus_tag LOCUS_45620 2381 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056685.1 protein_id gnl|my_center|LOCUS_45620 3123 3635 gene locus_tag LOCUS_45630 gene apt 3123 3635 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH9 protein_id gnl|my_center|LOCUS_45630 4047 5105 gene locus_tag LOCUS_45640 4047 5105 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 protein_id gnl|my_center|LOCUS_45640 5123 5357 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgatcgggtcaacagccgttgacccctac 5546 6145 gene locus_tag LOCUS_45650 5546 6145 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH13 protein_id gnl|my_center|LOCUS_45650 >Feature sequence0444 939 238 gene locus_tag LOCUS_45660 939 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 2349 1768 gene locus_tag LOCUS_45670 2349 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 4004 3405 gene locus_tag LOCUS_45680 4004 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 5614 5838 gene locus_tag LOCUS_45690 5614 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 5904 6164 gene locus_tag LOCUS_45700 5904 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 6148 6630 gene locus_tag LOCUS_45710 6148 6630 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141707.1 protein_id gnl|my_center|LOCUS_45710 >Feature sequence0445 268 1968 gene locus_tag LOCUS_45720 268 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 1969 3018 gene locus_tag LOCUS_45730 1969 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 3249 4178 gene locus_tag LOCUS_45740 3249 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 4226 4690 gene locus_tag LOCUS_45750 4226 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 4786 6537 gene locus_tag LOCUS_45760 4786 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 >Feature sequence0446 571 65 gene locus_tag LOCUS_45770 571 65 CDS product oligoketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125274.1 protein_id gnl|my_center|LOCUS_45770 1751 1323 gene locus_tag LOCUS_45780 1751 1323 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_45780 2155 1784 gene locus_tag LOCUS_45790 gene ssb 2155 1784 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIU1 protein_id gnl|my_center|LOCUS_45790 2352 3386 gene locus_tag LOCUS_45800 2352 3386 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056782.1 protein_id gnl|my_center|LOCUS_45800 3658 4455 gene locus_tag LOCUS_45810 3658 4455 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056783.1 protein_id gnl|my_center|LOCUS_45810 4452 5021 gene locus_tag LOCUS_45820 4452 5021 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056784.1 protein_id gnl|my_center|LOCUS_45820 5792 5007 gene locus_tag LOCUS_45830 5792 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 6796 6269 gene locus_tag LOCUS_45840 6796 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 >Feature sequence0447 913 350 gene locus_tag LOCUS_45850 913 350 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056410.1 protein_id gnl|my_center|LOCUS_45850 1792 3630 gene locus_tag LOCUS_45860 gene ftsH 1792 3630 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW1 protein_id gnl|my_center|LOCUS_45860 3900 4331 gene locus_tag LOCUS_45870 3900 4331 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_45870 5173 4616 gene locus_tag LOCUS_45880 5173 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142953.1 protein_id gnl|my_center|LOCUS_45880 5488 6594 gene locus_tag LOCUS_45890 gene pdxA 5488 6594 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHB4 protein_id gnl|my_center|LOCUS_45890 >Feature sequence0448 30 1007 gene locus_tag LOCUS_45900 30 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 1004 3400 gene locus_tag LOCUS_45910 1004 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 3754 4848 gene locus_tag LOCUS_45920 3754 4848 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 protein_id gnl|my_center|LOCUS_45920 5052 5894 gene locus_tag LOCUS_45930 5052 5894 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868648.1 protein_id gnl|my_center|LOCUS_45930 >Feature sequence0449 1337 1486 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggggcaagcacgggggcattg 1609 6576 gene locus_tag LOCUS_45940 1609 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 >Feature sequence0450 1344 1607 gene locus_tag LOCUS_45950 1344 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 1638 1883 gene locus_tag LOCUS_45960 1638 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 1880 2368 gene locus_tag LOCUS_45970 1880 2368 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249869.1 protein_id gnl|my_center|LOCUS_45970 2581 4176 gene locus_tag LOCUS_45980 gene hemD 2581 4176 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057989.1 protein_id gnl|my_center|LOCUS_45980 4797 4615 gene locus_tag LOCUS_45990 4797 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 5594 6367 gene locus_tag LOCUS_46000 5594 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 >Feature sequence0451 976 1422 gene locus_tag LOCUS_46010 976 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 2076 2249 gene locus_tag LOCUS_46020 2076 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 2357 3490 gene locus_tag LOCUS_46030 2357 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 4076 3621 gene locus_tag LOCUS_46040 4076 3621 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143294.1 protein_id gnl|my_center|LOCUS_46040 5976 4732 gene locus_tag LOCUS_46050 5976 4732 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEW6 protein_id gnl|my_center|LOCUS_46050 >Feature sequence0452 2431 1256 gene locus_tag LOCUS_46060 gene bioF 2431 1256 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNL4 protein_id gnl|my_center|LOCUS_46060 2721 3992 gene locus_tag LOCUS_46070 2721 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 6329 4905 gene locus_tag LOCUS_46080 6329 4905 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083861.1 protein_id gnl|my_center|LOCUS_46080 6555 6370 gene locus_tag LOCUS_46090 6555 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 >Feature sequence0453 1032 148 gene locus_tag LOCUS_46100 1032 148 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256458.1 protein_id gnl|my_center|LOCUS_46100 1785 1054 gene locus_tag LOCUS_46110 1785 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 3247 2351 gene locus_tag LOCUS_46120 3247 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 6487 3551 gene locus_tag LOCUS_46130 6487 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 >Feature sequence0454 413 817 gene locus_tag LOCUS_46140 413 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 807 1505 gene locus_tag LOCUS_46150 807 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 4461 1486 gene locus_tag LOCUS_46160 4461 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 5606 6736 gene locus_tag LOCUS_46170 5606 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 >Feature sequence0455 1197 547 gene locus_tag LOCUS_46180 1197 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 3549 2893 gene locus_tag LOCUS_46190 3549 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 6529 5138 gene locus_tag LOCUS_46200 6529 5138 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLC0 protein_id gnl|my_center|LOCUS_46200 >Feature sequence0456 2631 316 gene locus_tag LOCUS_46210 2631 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 3689 5335 gene locus_tag LOCUS_46220 3689 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 6359 5742 gene locus_tag LOCUS_46230 6359 5742 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHX1 protein_id gnl|my_center|LOCUS_46230 >Feature sequence0457 <1 509 gene locus_tag LOCUS_46240 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003892903.1:histidine kinase 1836 1912 gene locus_tag LOCUS_t00550 1836 1912 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2759 2304 gene locus_tag LOCUS_46250 2759 2304 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 protein_id gnl|my_center|LOCUS_46250 >Feature sequence0458 666 845 gene locus_tag LOCUS_46260 666 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 1489 1280 gene locus_tag LOCUS_46270 1489 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 1488 2657 gene locus_tag LOCUS_46280 gene dapL 1488 2657 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDX4 protein_id gnl|my_center|LOCUS_46280 3500 3099 gene locus_tag LOCUS_46290 3500 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 3695 3976 gene locus_tag LOCUS_46300 gene clpS 3695 3976 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056066.1 protein_id gnl|my_center|LOCUS_46300 4087 4872 gene locus_tag LOCUS_46310 4087 4872 CDS product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056065.1 protein_id gnl|my_center|LOCUS_46310 5442 5245 gene locus_tag LOCUS_46320 5442 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 6576 6322 gene locus_tag LOCUS_46330 6576 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 >Feature sequence0459 1847 429 gene locus_tag LOCUS_46340 gene argH 1847 429 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLW0 protein_id gnl|my_center|LOCUS_46340 2378 2127 gene locus_tag LOCUS_46350 2378 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 3892 2396 gene locus_tag LOCUS_46360 3892 2396 CDS product regulator of sigma-B activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 protein_id gnl|my_center|LOCUS_46360 6519 4759 gene locus_tag LOCUS_46370 6519 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 >Feature sequence0460 1787 2257 gene locus_tag LOCUS_46380 1787 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 2259 4373 gene locus_tag LOCUS_46390 2259 4373 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_46390 5087 4872 gene locus_tag LOCUS_46400 5087 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 5556 5125 gene locus_tag LOCUS_46410 5556 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 6388 5633 gene locus_tag LOCUS_46420 6388 5633 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 protein_id gnl|my_center|LOCUS_46420 >Feature sequence0461 153 503 gene locus_tag LOCUS_46430 153 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 517 801 gene locus_tag LOCUS_46440 517 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057701.1 protein_id gnl|my_center|LOCUS_46440 876 2135 gene locus_tag LOCUS_46450 gene hisS 876 2135 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHP7 protein_id gnl|my_center|LOCUS_46450 3477 2473 gene locus_tag LOCUS_46460 3477 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 4886 3969 gene locus_tag LOCUS_46470 4886 3969 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_46470 5779 5279 gene locus_tag LOCUS_46480 5779 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 6641 6183 gene locus_tag LOCUS_46490 6641 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 >Feature sequence0462 1009 413 gene locus_tag LOCUS_46500 1009 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 2517 2975 gene locus_tag LOCUS_46510 2517 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 >Feature sequence0463 1396 446 gene locus_tag LOCUS_46520 1396 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 1742 2008 gene locus_tag LOCUS_46530 1742 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_46530 2011 2271 gene locus_tag LOCUS_46540 2011 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 3126 2455 gene locus_tag LOCUS_46550 3126 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 3668 3123 gene locus_tag LOCUS_46560 3668 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 6157 4229 gene locus_tag LOCUS_46570 6157 4229 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058113.1 protein_id gnl|my_center|LOCUS_46570 >Feature sequence0464 1969 509 gene locus_tag LOCUS_46580 gene mnmE 1969 509 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P1 protein_id gnl|my_center|LOCUS_46580 2031 4295 gene locus_tag LOCUS_46590 2031 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 4628 6409 gene locus_tag LOCUS_46600 4628 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 >Feature sequence0465 6208 62 gene locus_tag LOCUS_46610 6208 62 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_46610 >Feature sequence0466 614 4828 gene locus_tag LOCUS_46620 614 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 >Feature sequence0467 446 5065 gene locus_tag LOCUS_46630 446 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 >Feature sequence0468 784 119 gene locus_tag LOCUS_46640 784 119 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056125.1 protein_id gnl|my_center|LOCUS_46640 1091 1720 gene locus_tag LOCUS_46650 1091 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 2858 2292 gene locus_tag LOCUS_46660 2858 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056026.1 protein_id gnl|my_center|LOCUS_46660 3884 5422 gene locus_tag LOCUS_46670 3884 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056025.1 protein_id gnl|my_center|LOCUS_46670 >Feature sequence0469 26 2931 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cccccactcgctggggaaattagttgaatggaaac 3342 3064 gene locus_tag LOCUS_46680 3342 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 4186 3641 gene locus_tag LOCUS_46690 4186 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 4544 4206 gene locus_tag LOCUS_46700 4544 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 6389 5124 gene locus_tag LOCUS_46710 6389 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256460.1 protein_id gnl|my_center|LOCUS_46710 >Feature sequence0470 1790 27 gene locus_tag LOCUS_46720 1790 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 2749 1802 gene locus_tag LOCUS_46730 2749 1802 CDS product phosphonates-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016927.1 protein_id gnl|my_center|LOCUS_46730 4268 3330 gene locus_tag LOCUS_46740 4268 3330 CDS product phosphonates-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016927.1 protein_id gnl|my_center|LOCUS_46740 5387 5662 gene locus_tag LOCUS_46750 5387 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 6411 5782 gene locus_tag LOCUS_46760 6411 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 >Feature sequence0471 3526 317 gene locus_tag LOCUS_46770 3526 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 >Feature sequence0472 1320 502 gene locus_tag LOCUS_46780 1320 502 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057803.1 protein_id gnl|my_center|LOCUS_46780 1828 1745 gene locus_tag LOCUS_t00560 1828 1745 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2176 3576 gene locus_tag LOCUS_46790 gene murA 2176 3576 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS7 protein_id gnl|my_center|LOCUS_46790 3676 4551 gene locus_tag LOCUS_46800 3676 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 protein_id gnl|my_center|LOCUS_46800 4530 4612 gene locus_tag LOCUS_t00570 4530 4612 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5353 5589 gene locus_tag LOCUS_46810 5353 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 5827 6144 gene locus_tag LOCUS_46820 5827 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 >Feature sequence0473 348 1361 gene locus_tag LOCUS_46830 348 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_46830 1649 2197 gene locus_tag LOCUS_46840 1649 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 2717 3517 gene locus_tag LOCUS_46850 2717 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 4951 3548 gene locus_tag LOCUS_46860 4951 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704726.1 protein_id gnl|my_center|LOCUS_46860 5490 6314 gene locus_tag LOCUS_46870 5490 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 >Feature sequence0474 271 5742 gene locus_tag LOCUS_46880 271 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 5758 6330 gene locus_tag LOCUS_46890 5758 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 >Feature sequence0475 2853 3170 gene locus_tag LOCUS_46900 2853 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 4423 3485 gene locus_tag LOCUS_46910 4423 3485 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_46910 5793 4834 gene locus_tag LOCUS_46920 5793 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 6398 5970 gene locus_tag LOCUS_46930 6398 5970 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900026.1 protein_id gnl|my_center|LOCUS_46930 >Feature sequence0476 375 7 gene locus_tag LOCUS_46940 375 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 868 410 gene locus_tag LOCUS_46950 868 410 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_46950 1090 1302 gene locus_tag LOCUS_46960 1090 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140926.1 protein_id gnl|my_center|LOCUS_46960 1450 3645 gene locus_tag LOCUS_46970 gene ppk 1450 3645 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA8 protein_id gnl|my_center|LOCUS_46970 5681 3939 gene locus_tag LOCUS_46980 5681 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 6070 5717 gene locus_tag LOCUS_46990 6070 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55580 protein_id gnl|my_center|LOCUS_46990 >Feature sequence0477 2236 1262 gene locus_tag LOCUS_47000 2236 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 2913 2353 gene locus_tag LOCUS_47010 2913 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 5092 3035 gene locus_tag LOCUS_47020 5092 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 5990 5136 gene locus_tag LOCUS_47030 5990 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 >Feature sequence0478 2564 3556 gene locus_tag LOCUS_47040 2564 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 3583 5619 gene locus_tag LOCUS_47050 3583 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 >Feature sequence0479 1301 432 gene locus_tag LOCUS_47060 gene cdsA 1301 432 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 protein_id gnl|my_center|LOCUS_47060 2500 1898 gene locus_tag LOCUS_47070 gene cobL 2500 1898 CDS product precorrin-6B methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 protein_id gnl|my_center|LOCUS_47070 4593 3082 gene locus_tag LOCUS_47080 gene speA 4593 3082 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21885 protein_id gnl|my_center|LOCUS_47080 4998 6089 gene locus_tag LOCUS_47090 gene ychF 4998 6089 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ8 protein_id gnl|my_center|LOCUS_47090 >Feature sequence0480 808 404 gene locus_tag LOCUS_47100 808 404 CDS product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLK3 protein_id gnl|my_center|LOCUS_47100 1989 844 gene locus_tag LOCUS_47110 1989 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 3238 6252 gene locus_tag LOCUS_47120 3238 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 >Feature sequence0481 2639 4297 gene locus_tag LOCUS_47130 2639 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 4682 5992 gene locus_tag LOCUS_47140 4682 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 >Feature sequence0482 1050 160 gene locus_tag LOCUS_47150 1050 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 1636 1445 gene locus_tag LOCUS_47160 1636 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 2588 4969 gene locus_tag LOCUS_47170 gene zam 2588 4969 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057710.1 protein_id gnl|my_center|LOCUS_47170 5583 6230 gene locus_tag LOCUS_47180 gene ubiX 5583 6230 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK39 protein_id gnl|my_center|LOCUS_47180 >Feature sequence0483 1912 698 gene locus_tag LOCUS_47190 1912 698 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058279.1 protein_id gnl|my_center|LOCUS_47190 3431 2739 gene locus_tag LOCUS_47200 gene bioD 3431 2739 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB5 protein_id gnl|my_center|LOCUS_47200 6138 3880 gene locus_tag LOCUS_47210 6138 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 >Feature sequence0484 1138 254 gene locus_tag LOCUS_47220 1138 254 CDS product heparan sulfate glucosamine 3-O-sulfotransferase 3B1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887312.1 protein_id gnl|my_center|LOCUS_47220 3273 1360 gene locus_tag LOCUS_47230 3273 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 4091 4942 gene locus_tag LOCUS_47240 4091 4942 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085765.1 protein_id gnl|my_center|LOCUS_47240 5547 5984 gene locus_tag LOCUS_47250 5547 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 >Feature sequence0485 <1 964 gene locus_tag LOCUS_47260 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143975.1:hemolysin D 1922 4018 gene locus_tag LOCUS_47270 1922 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 4113 5510 gene locus_tag LOCUS_47280 4113 5510 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228803.1 protein_id gnl|my_center|LOCUS_47280 5946 5719 gene locus_tag LOCUS_47290 5946 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 6196 6311 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgcggtcttggggtctccccaagt >Feature sequence0486 240 662 gene locus_tag LOCUS_47300 240 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 1339 683 gene locus_tag LOCUS_47310 1339 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 3397 1901 gene locus_tag LOCUS_47320 gene dacB 3397 1901 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_47320 5861 3849 gene locus_tag LOCUS_47330 5861 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 6306 6121 gene locus_tag LOCUS_47340 6306 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 >Feature sequence0487 607 1497 gene locus_tag LOCUS_47350 607 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 1652 1725 gene locus_tag LOCUS_t00580 1652 1725 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2574 2026 gene locus_tag LOCUS_47360 2574 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 3320 3664 gene locus_tag LOCUS_47370 3320 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 4243 4587 gene locus_tag LOCUS_47380 4243 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 5433 4648 gene locus_tag LOCUS_47390 5433 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 5986 6306 gene locus_tag LOCUS_47400 5986 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 >Feature sequence0488 2737 392 gene locus_tag LOCUS_47410 2737 392 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM14 protein_id gnl|my_center|LOCUS_47410 2806 3234 gene locus_tag LOCUS_47420 2806 3234 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258015.1 protein_id gnl|my_center|LOCUS_47420 3454 3663 gene locus_tag LOCUS_47430 3454 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 3715 4086 gene locus_tag LOCUS_47440 3715 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 5817 4321 gene locus_tag LOCUS_47450 5817 4321 CDS product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124737.1 protein_id gnl|my_center|LOCUS_47450 >Feature sequence0489 1359 3470 gene locus_tag LOCUS_47460 1359 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056358.1 protein_id gnl|my_center|LOCUS_47460 3700 4896 gene locus_tag LOCUS_47470 3700 4896 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F7G9 protein_id gnl|my_center|LOCUS_47470 5574 5939 gene locus_tag LOCUS_47480 5574 5939 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_47480 >Feature sequence0490 351 596 gene locus_tag LOCUS_47490 351 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 593 1117 gene locus_tag LOCUS_47500 593 1117 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_47500 1596 1345 gene locus_tag LOCUS_47510 1596 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 2002 1817 gene locus_tag LOCUS_47520 2002 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 2075 2479 gene locus_tag LOCUS_47530 2075 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 2738 3895 gene locus_tag LOCUS_47540 2738 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125209.1 protein_id gnl|my_center|LOCUS_47540 4370 4675 gene locus_tag LOCUS_47550 4370 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 >Feature sequence0491 125 1972 gene locus_tag LOCUS_47560 125 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 2223 2450 gene locus_tag LOCUS_47570 2223 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 2455 3021 gene locus_tag LOCUS_47580 2455 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 3197 3538 gene locus_tag LOCUS_47590 3197 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 3641 3799 gene locus_tag LOCUS_47600 3641 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 5866 4046 gene locus_tag LOCUS_47610 gene thrS 5866 4046 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW0 protein_id gnl|my_center|LOCUS_47610 >Feature sequence0492 2970 862 gene locus_tag LOCUS_47620 2970 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 5381 3279 gene locus_tag LOCUS_47630 5381 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 >Feature sequence0493 845 240 gene locus_tag LOCUS_47640 gene drga 845 240 CDS product reductase DrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_47640 1544 918 gene locus_tag LOCUS_47650 1544 918 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943220.1 protein_id gnl|my_center|LOCUS_47650 2018 2911 gene locus_tag LOCUS_47660 2018 2911 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086032.1 protein_id gnl|my_center|LOCUS_47660 >Feature sequence0494 336 1655 gene locus_tag LOCUS_47670 336 1655 CDS product DNA modification methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057779.1 protein_id gnl|my_center|LOCUS_47670 1652 2221 gene locus_tag LOCUS_47680 1652 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 2233 2967 gene locus_tag LOCUS_47690 2233 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 protein_id gnl|my_center|LOCUS_47690 3078 3818 gene locus_tag LOCUS_47700 3078 3818 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_47700 4597 3965 gene locus_tag LOCUS_47710 4597 3965 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024041.1 protein_id gnl|my_center|LOCUS_47710 4984 5997 gene locus_tag LOCUS_47720 4984 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140179.1 protein_id gnl|my_center|LOCUS_47720 >Feature sequence0495 249 5768 gene locus_tag LOCUS_47730 249 5768 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_47730 >Feature sequence0496 2427 334 gene locus_tag LOCUS_47740 2427 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 3151 2579 gene locus_tag LOCUS_47750 3151 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 3991 3797 gene locus_tag LOCUS_47760 3991 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 3909 4817 gene locus_tag LOCUS_47770 3909 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 5981 4980 gene locus_tag LOCUS_47780 5981 4980 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528925.1 protein_id gnl|my_center|LOCUS_47780 >Feature sequence0497 382 3564 gene locus_tag LOCUS_47790 gene nolG 382 3564 CDS product nodulation protein NolG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207561.1 protein_id gnl|my_center|LOCUS_47790 3750 3950 gene locus_tag LOCUS_47800 3750 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 4690 4151 gene locus_tag LOCUS_47810 4690 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 5811 5023 gene locus_tag LOCUS_47820 5811 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 >Feature sequence0498 404 228 gene locus_tag LOCUS_47830 404 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 760 2364 gene locus_tag LOCUS_47840 gene ndhD2 760 2364 CDS product NAD(P)H-quinone oxidoreductase chain 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHX4 protein_id gnl|my_center|LOCUS_47840 3939 3337 gene locus_tag LOCUS_47850 3939 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 5668 3944 gene locus_tag LOCUS_47860 5668 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 >Feature sequence0499 1370 1531 gene locus_tag LOCUS_47870 1370 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 3231 2998 gene locus_tag LOCUS_47880 3231 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 >Feature sequence0500 111 1886 gene locus_tag LOCUS_47890 gene recN 111 1886 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNY7 protein_id gnl|my_center|LOCUS_47890 2231 2914 gene locus_tag LOCUS_47900 2231 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 3894 6038 gene locus_tag LOCUS_47910 3894 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 >Feature sequence0501 >Feature sequence0502 472 6081 gene locus_tag LOCUS_47920 472 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 >Feature sequence0503 2766 1927 gene locus_tag LOCUS_47930 2766 1927 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760917.1 protein_id gnl|my_center|LOCUS_47930 3525 3094 gene locus_tag LOCUS_47940 3525 3094 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390315.1 protein_id gnl|my_center|LOCUS_47940 3794 4144 gene locus_tag LOCUS_47950 3794 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 5258 4119 gene locus_tag LOCUS_47960 5258 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 >Feature sequence0504 132 1145 gene locus_tag LOCUS_47970 132 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 1689 1985 gene locus_tag LOCUS_47980 1689 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 2228 3013 gene locus_tag LOCUS_47990 2228 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143452.1 protein_id gnl|my_center|LOCUS_47990 3145 3888 gene locus_tag LOCUS_48000 3145 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144138.1 protein_id gnl|my_center|LOCUS_48000 4906 4166 gene locus_tag LOCUS_48010 4906 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_48010 5225 4974 gene locus_tag LOCUS_48020 5225 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 5592 5374 gene locus_tag LOCUS_48030 5592 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 >Feature sequence0505 2429 207 gene locus_tag LOCUS_48040 2429 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 3172 4665 gene locus_tag LOCUS_48050 gene dagA 3172 4665 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_48050 5233 4844 gene locus_tag LOCUS_48060 5233 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 >Feature sequence0506 >Feature sequence0507 148 402 gene locus_tag LOCUS_48070 148 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 1457 753 gene locus_tag LOCUS_48080 1457 753 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141890.1 protein_id gnl|my_center|LOCUS_48080 2230 1622 gene locus_tag LOCUS_48090 2230 1622 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 protein_id gnl|my_center|LOCUS_48090 2587 3654 gene locus_tag LOCUS_48100 2587 3654 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_48100 4401 4108 gene locus_tag LOCUS_48110 4401 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 5735 5148 gene locus_tag LOCUS_48120 gene pyrE 5735 5148 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW5 protein_id gnl|my_center|LOCUS_48120 >Feature sequence0508 386 1858 gene locus_tag LOCUS_48130 386 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 2071 1880 gene locus_tag LOCUS_48140 2071 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 2271 2831 gene locus_tag LOCUS_48150 2271 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 3994 3377 gene locus_tag LOCUS_48160 3994 3377 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143281.1 protein_id gnl|my_center|LOCUS_48160 4467 5966 gene locus_tag LOCUS_48170 4467 5966 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057178.1 protein_id gnl|my_center|LOCUS_48170 >Feature sequence0509 850 1029 gene locus_tag LOCUS_48180 850 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 1695 3233 gene locus_tag LOCUS_48190 1695 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 3642 5354 gene locus_tag LOCUS_48200 gene yqhH 3642 5354 CDS product putative ATP-dependent helicase YqhH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54509 protein_id gnl|my_center|LOCUS_48200 >Feature sequence0510 1453 635 gene locus_tag LOCUS_48210 1453 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 2357 1470 gene locus_tag LOCUS_48220 2357 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 4343 2625 gene locus_tag LOCUS_48230 4343 2625 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 protein_id gnl|my_center|LOCUS_48230 >Feature sequence0511 1205 42 gene locus_tag LOCUS_48240 1205 42 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_48240 3646 4731 gene locus_tag LOCUS_48250 3646 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 5247 5738 gene locus_tag LOCUS_48260 5247 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 >Feature sequence0512 1794 853 gene locus_tag LOCUS_48270 1794 853 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533468.1 protein_id gnl|my_center|LOCUS_48270 2557 1817 gene locus_tag LOCUS_48280 2557 1817 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_48280 2894 2595 gene locus_tag LOCUS_48290 2894 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 4618 3131 gene locus_tag LOCUS_48300 4618 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 <5965 5041 gene locus_tag LOCUS_48310 <5965 5041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533468.1:2OG-Fe(II) oxygenase >Feature sequence0513 5614 176 gene locus_tag LOCUS_48320 5614 176 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_48320 >Feature sequence0514 277 549 gene locus_tag LOCUS_48330 277 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 1047 703 gene locus_tag LOCUS_48340 1047 703 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_48340 1334 1044 gene locus_tag LOCUS_48350 1334 1044 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403413.1 protein_id gnl|my_center|LOCUS_48350 1937 1746 gene locus_tag LOCUS_48360 1937 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 2256 2032 gene locus_tag LOCUS_48370 2256 2032 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 protein_id gnl|my_center|LOCUS_48370 2483 2944 gene locus_tag LOCUS_48380 2483 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_48380 3111 4283 gene locus_tag LOCUS_48390 gene moeB 3111 4283 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_48390 5692 4640 gene locus_tag LOCUS_48400 5692 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 >Feature sequence0515 37 152 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tacttggggagaccccaagaccgc 680 423 gene locus_tag LOCUS_48410 680 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 976 644 gene locus_tag LOCUS_48420 976 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 1325 1179 gene locus_tag LOCUS_48430 1325 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 2124 1774 gene locus_tag LOCUS_48440 2124 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 4137 2233 gene locus_tag LOCUS_48450 4137 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 4697 4110 gene locus_tag LOCUS_48460 4697 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 5576 5256 gene locus_tag LOCUS_48470 5576 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 >Feature sequence0516 1718 567 gene locus_tag LOCUS_48480 gene anmK 1718 567 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC2 protein_id gnl|my_center|LOCUS_48480 3475 1994 gene locus_tag LOCUS_48490 3475 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 4003 4425 gene locus_tag LOCUS_48500 4003 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 4460 4744 gene locus_tag LOCUS_48510 4460 4744 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055881.1 protein_id gnl|my_center|LOCUS_48510 5745 5005 gene locus_tag LOCUS_48520 5745 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 >Feature sequence0517 689 204 gene locus_tag LOCUS_48530 689 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 4024 1568 gene locus_tag LOCUS_48540 4024 1568 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057085.1 protein_id gnl|my_center|LOCUS_48540 5446 4898 gene locus_tag LOCUS_48550 5446 4898 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 protein_id gnl|my_center|LOCUS_48550 >Feature sequence0518 1149 3539 gene locus_tag LOCUS_48560 1149 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 >Feature sequence0519 732 217 gene locus_tag LOCUS_48570 732 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 3564 1690 gene locus_tag LOCUS_48580 3564 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 4157 3834 gene locus_tag LOCUS_48590 4157 3834 CDS product phosphoribosyl-ATP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966108.1 protein_id gnl|my_center|LOCUS_48590 4386 4610 gene locus_tag LOCUS_48600 4386 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 5079 4762 gene locus_tag LOCUS_48610 5079 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 5432 5076 gene locus_tag LOCUS_48620 5432 5076 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 protein_id gnl|my_center|LOCUS_48620 >Feature sequence0520 1947 142 gene locus_tag LOCUS_48630 gene ycf55 1947 142 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058156.1 protein_id gnl|my_center|LOCUS_48630 4479 2041 gene locus_tag LOCUS_48640 4479 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 5730 5230 gene locus_tag LOCUS_48650 5730 5230 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 protein_id gnl|my_center|LOCUS_48650 >Feature sequence0521 224 2395 gene locus_tag LOCUS_48660 224 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 2729 3280 gene locus_tag LOCUS_48670 2729 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 3674 3958 gene locus_tag LOCUS_48680 3674 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 4572 4174 gene locus_tag LOCUS_48690 4572 4174 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_48690 4859 4569 gene locus_tag LOCUS_48700 4859 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 >Feature sequence0522 2553 181 gene locus_tag LOCUS_48710 2553 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 3116 3517 gene locus_tag LOCUS_48720 3116 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 3994 3581 gene locus_tag LOCUS_48730 gene atpC 3994 3581 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG7 protein_id gnl|my_center|LOCUS_48730 5580 4123 gene locus_tag LOCUS_48740 gene atpD 5580 4123 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG8 protein_id gnl|my_center|LOCUS_48740 >Feature sequence0523 91 624 gene locus_tag LOCUS_48750 91 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 1167 949 gene locus_tag LOCUS_48760 1167 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 1927 3942 gene locus_tag LOCUS_48770 1927 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 4741 4529 gene locus_tag LOCUS_48780 4741 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058299.1 protein_id gnl|my_center|LOCUS_48780 5577 4945 gene locus_tag LOCUS_48790 5577 4945 CDS product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 protein_id gnl|my_center|LOCUS_48790 >Feature sequence0524 3186 394 gene locus_tag LOCUS_48800 3186 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 3987 3385 gene locus_tag LOCUS_48810 3987 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 4600 3977 gene locus_tag LOCUS_48820 4600 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 5426 4605 gene locus_tag LOCUS_48830 5426 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 >Feature sequence0525 1621 191 gene locus_tag LOCUS_48840 1621 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 protein_id gnl|my_center|LOCUS_48840 3747 1657 gene locus_tag LOCUS_48850 3747 1657 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_48850 4258 3866 gene locus_tag LOCUS_48860 4258 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 5470 4646 gene locus_tag LOCUS_48870 gene ycf38 5470 4646 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJA3 protein_id gnl|my_center|LOCUS_48870 >Feature sequence0526 871 431 gene locus_tag LOCUS_48880 871 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 2504 876 gene locus_tag LOCUS_48890 2504 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 3785 2889 gene locus_tag LOCUS_48900 gene rsmH 3785 2889 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH87 protein_id gnl|my_center|LOCUS_48900 4464 5642 gene locus_tag LOCUS_48910 gene ndhH 4464 5642 CDS product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD9 protein_id gnl|my_center|LOCUS_48910 >Feature sequence0527 2094 250 gene locus_tag LOCUS_48920 2094 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 3242 2091 gene locus_tag LOCUS_48930 3242 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 5514 3463 gene locus_tag LOCUS_48940 5514 3463 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_48940 >Feature sequence0528 796 575 gene locus_tag LOCUS_48950 796 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 2663 1716 gene locus_tag LOCUS_48960 2663 1716 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058188.1 protein_id gnl|my_center|LOCUS_48960 3310 3095 gene locus_tag LOCUS_48970 gene ndhO 3310 3095 CDS product NAD(P)H-quinone oxidoreductase subunit O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFI1 protein_id gnl|my_center|LOCUS_48970 3534 3672 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttgaggaacgaaacccaacc 4633 3749 gene locus_tag LOCUS_48980 gene mutM 4633 3749 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59065 protein_id gnl|my_center|LOCUS_48980 4974 4768 gene locus_tag LOCUS_48990 gene psaE 4974 4768 CDS product photosystem I reaction center subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A423 protein_id gnl|my_center|LOCUS_48990 5687 5076 gene locus_tag LOCUS_49000 5687 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140118.1 protein_id gnl|my_center|LOCUS_49000 >Feature sequence0529 3272 3592 gene locus_tag LOCUS_49010 3272 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140979.1 protein_id gnl|my_center|LOCUS_49010 3589 3960 gene locus_tag LOCUS_49020 3589 3960 CDS product UPF0332 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X095 protein_id gnl|my_center|LOCUS_49020 4748 4209 gene locus_tag LOCUS_49030 4748 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 4990 4763 gene locus_tag LOCUS_49040 4990 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_49040 5140 4994 gene locus_tag LOCUS_49050 5140 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 5775 5533 gene locus_tag LOCUS_49060 5775 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 >Feature sequence0530 962 594 gene locus_tag LOCUS_49070 962 594 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 protein_id gnl|my_center|LOCUS_49070 1442 1532 gene locus_tag LOCUS_t00590 1442 1532 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3397 1607 gene locus_tag LOCUS_49080 3397 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 4607 5539 gene locus_tag LOCUS_49090 4607 5539 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125164.1 protein_id gnl|my_center|LOCUS_49090 5580 5666 gene locus_tag LOCUS_t00600 5580 5666 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0531 114 500 gene locus_tag LOCUS_49100 114 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057643.1 protein_id gnl|my_center|LOCUS_49100 1124 2509 gene locus_tag LOCUS_49110 1124 2509 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089836.1 protein_id gnl|my_center|LOCUS_49110 2511 4559 gene locus_tag LOCUS_49120 2511 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 5554 4817 gene locus_tag LOCUS_49130 5554 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 >Feature sequence0532 279 875 gene locus_tag LOCUS_49140 279 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 1045 1482 gene locus_tag LOCUS_49150 1045 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 1907 3031 gene locus_tag LOCUS_49160 1907 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 3028 3513 gene locus_tag LOCUS_49170 3028 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 3612 5177 gene locus_tag LOCUS_49180 3612 5177 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_49180 >Feature sequence0533 597 208 gene locus_tag LOCUS_49190 597 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 1745 3745 gene locus_tag LOCUS_49200 gene uvrB 1745 3745 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC6 protein_id gnl|my_center|LOCUS_49200 4535 5530 gene locus_tag LOCUS_49210 4535 5530 CDS product porphyromonas-type peptidyl-arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701340.1 protein_id gnl|my_center|LOCUS_49210 >Feature sequence0534 233 1009 gene locus_tag LOCUS_49220 gene cpmA 233 1009 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057031.1 protein_id gnl|my_center|LOCUS_49220 1564 2763 gene locus_tag LOCUS_49230 1564 2763 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056868.1 protein_id gnl|my_center|LOCUS_49230 3121 3654 gene locus_tag LOCUS_49240 3121 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 4288 3800 gene locus_tag LOCUS_49250 4288 3800 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389753.1 protein_id gnl|my_center|LOCUS_49250 4956 4318 gene locus_tag LOCUS_49260 4956 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 5037 5702 gene locus_tag LOCUS_49270 5037 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 protein_id gnl|my_center|LOCUS_49270 >Feature sequence0535 272 21 gene locus_tag LOCUS_49280 272 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 1075 530 gene locus_tag LOCUS_49290 1075 530 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023351.1 protein_id gnl|my_center|LOCUS_49290 1460 1068 gene locus_tag LOCUS_49300 1460 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 2407 1643 gene locus_tag LOCUS_49310 2407 1643 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987003.1 protein_id gnl|my_center|LOCUS_49310 3328 2432 gene locus_tag LOCUS_49320 3328 2432 CDS product CDP-4-dehydro-6-deoxy-D-gulose 4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_49320 3858 3325 gene locus_tag LOCUS_49330 3858 3325 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_49330 5145 3862 gene locus_tag LOCUS_49340 5145 3862 CDS product NDP-hexose 3-C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_49340 5473 5243 gene locus_tag LOCUS_49350 5473 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 >Feature sequence0536 1431 52 gene locus_tag LOCUS_49360 1431 52 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140150.1 protein_id gnl|my_center|LOCUS_49360 1863 4043 gene locus_tag LOCUS_49370 1863 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 >Feature sequence0537 1868 558 gene locus_tag LOCUS_49380 1868 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 3249 2338 gene locus_tag LOCUS_49390 3249 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 3755 3426 gene locus_tag LOCUS_49400 3755 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 4832 3780 gene locus_tag LOCUS_49410 4832 3780 CDS product DUF1016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_49410 >Feature sequence0538 364 20 gene locus_tag LOCUS_49420 364 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 2798 1047 gene locus_tag LOCUS_49430 2798 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 4716 3259 gene locus_tag LOCUS_49440 gene cysS 4716 3259 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW6 protein_id gnl|my_center|LOCUS_49440 5310 5053 gene locus_tag LOCUS_49450 5310 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 >Feature sequence0539 1086 289 gene locus_tag LOCUS_49460 1086 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 2565 1348 gene locus_tag LOCUS_49470 2565 1348 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGU7 protein_id gnl|my_center|LOCUS_49470 4828 3395 gene locus_tag LOCUS_49480 4828 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_49480 5002 5250 gene locus_tag LOCUS_49490 5002 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 5365 5583 gene locus_tag LOCUS_49500 5365 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 >Feature sequence0540 1047 349 gene locus_tag LOCUS_49510 1047 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056267.1 protein_id gnl|my_center|LOCUS_49510 3031 1514 gene locus_tag LOCUS_49520 3031 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 5457 3943 gene locus_tag LOCUS_49530 5457 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 >Feature sequence0541 725 1159 gene locus_tag LOCUS_49540 725 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49540 1246 1422 gene locus_tag LOCUS_49550 1246 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 1794 2678 gene locus_tag LOCUS_49560 1794 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 3342 5273 gene locus_tag LOCUS_49570 3342 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 >Feature sequence0542 236 661 gene locus_tag LOCUS_49580 236 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 695 1216 gene locus_tag LOCUS_49590 695 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 2370 1366 gene locus_tag LOCUS_49600 2370 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 2921 2373 gene locus_tag LOCUS_49610 2921 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 3263 5194 gene locus_tag LOCUS_49620 3263 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 >Feature sequence0543 922 689 gene locus_tag LOCUS_49630 922 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 2318 1077 gene locus_tag LOCUS_49640 2318 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 protein_id gnl|my_center|LOCUS_49640 2630 3286 gene locus_tag LOCUS_49650 gene clpP 2630 3286 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI33 protein_id gnl|my_center|LOCUS_49650 3496 4092 gene locus_tag LOCUS_49660 gene clpP2 3496 4092 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJZ9 protein_id gnl|my_center|LOCUS_49660 4522 5268 gene locus_tag LOCUS_49670 4522 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 >Feature sequence0544 5628 154 gene locus_tag LOCUS_49680 5628 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 >Feature sequence0545 447 1838 gene locus_tag LOCUS_49690 447 1838 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKB7 protein_id gnl|my_center|LOCUS_49690 1947 2279 gene locus_tag LOCUS_49700 1947 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056708.1 protein_id gnl|my_center|LOCUS_49700 2909 3961 gene locus_tag LOCUS_49710 gene lpxD3 2909 3961 CDS product UDP-3-O-acylglucosamine N-acyltransferase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH24 protein_id gnl|my_center|LOCUS_49710 4686 5099 gene locus_tag LOCUS_49720 4686 5099 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056992.1 protein_id gnl|my_center|LOCUS_49720 >Feature sequence0546 1488 394 gene locus_tag LOCUS_49730 1488 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 5080 1493 gene locus_tag LOCUS_49740 5080 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 >Feature sequence0547 5293 5144 gene locus_tag LOCUS_49750 5293 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 >Feature sequence0548 157 1134 gene locus_tag LOCUS_49760 157 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49760 1330 2685 gene locus_tag LOCUS_49770 1330 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 3448 3726 gene locus_tag LOCUS_49780 3448 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_49780 3726 4013 gene locus_tag LOCUS_49790 3726 4013 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 protein_id gnl|my_center|LOCUS_49790 5119 4349 gene locus_tag LOCUS_49800 5119 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726965.1 protein_id gnl|my_center|LOCUS_49800 >Feature sequence0549 3264 3037 gene locus_tag LOCUS_49810 3264 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 >Feature sequence0550 835 362 gene locus_tag LOCUS_49820 835 362 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142985.1 protein_id gnl|my_center|LOCUS_49820 2530 1118 gene locus_tag LOCUS_49830 2530 1118 CDS product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHJ8 protein_id gnl|my_center|LOCUS_49830 3442 4227 gene locus_tag LOCUS_49840 3442 4227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056183.1 protein_id gnl|my_center|LOCUS_49840 >Feature sequence0551 1678 1388 gene locus_tag LOCUS_49850 1678 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 3579 5174 gene locus_tag LOCUS_49860 gene pgi 3579 5174 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY2 protein_id gnl|my_center|LOCUS_49860 >Feature sequence0552 1153 350 gene locus_tag LOCUS_49870 1153 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 1777 1376 gene locus_tag LOCUS_49880 1777 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056141.1 protein_id gnl|my_center|LOCUS_49880 3315 2731 gene locus_tag LOCUS_49890 3315 2731 CDS product TIGR04376 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140547.1 protein_id gnl|my_center|LOCUS_49890 4941 3547 gene locus_tag LOCUS_49900 4941 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 >Feature sequence0553 985 641 gene locus_tag LOCUS_49910 985 641 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_49910 4021 1295 gene locus_tag LOCUS_49920 4021 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 >Feature sequence0554 618 2579 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcaatgaaacctaatccctatgagggattgaaac 3146 5479 gene locus_tag LOCUS_49930 3146 5479 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919291.1 protein_id gnl|my_center|LOCUS_49930 >Feature sequence0555 <1 5219 gene locus_tag LOCUS_49940 <1 5219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0556 427 2433 gene locus_tag LOCUS_49950 427 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 3884 3063 gene locus_tag LOCUS_49960 3884 3063 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_49960 4725 3925 gene locus_tag LOCUS_49970 4725 3925 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_49970 <5488 4842 gene locus_tag LOCUS_49980 <5488 4842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020082.1:zinc ABC transporter substrate-binding protein >Feature sequence0557 627 265 gene locus_tag LOCUS_49990 627 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 969 5414 gene locus_tag LOCUS_50000 969 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 >Feature sequence0558 837 2135 gene locus_tag LOCUS_50010 837 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460075.1 protein_id gnl|my_center|LOCUS_50010 3885 2563 gene locus_tag LOCUS_50020 3885 2563 CDS product modification methylase, putative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_277101.1 protein_id gnl|my_center|LOCUS_50020 4130 5098 gene locus_tag LOCUS_50030 4130 5098 CDS product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529592.1 protein_id gnl|my_center|LOCUS_50030 >Feature sequence0559 1465 50 gene locus_tag LOCUS_50040 1465 50 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223419.1 protein_id gnl|my_center|LOCUS_50040 4135 1553 gene locus_tag LOCUS_50050 4135 1553 CDS product terpene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223227.1 protein_id gnl|my_center|LOCUS_50050 >Feature sequence0560 184 1086 gene locus_tag LOCUS_50060 gene argB 184 1086 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59303 protein_id gnl|my_center|LOCUS_50060 1357 1139 gene locus_tag LOCUS_50070 1357 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 2746 1397 gene locus_tag LOCUS_50080 2746 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 3675 3938 gene locus_tag LOCUS_50090 3675 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 4704 4093 gene locus_tag LOCUS_50100 4704 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_50100 5012 5356 gene locus_tag LOCUS_50110 5012 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 >Feature sequence0561 483 208 gene locus_tag LOCUS_50120 483 208 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_50120 2001 703 gene locus_tag LOCUS_50130 gene thrC 2001 703 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056826.1 protein_id gnl|my_center|LOCUS_50130 2509 3858 gene locus_tag LOCUS_50140 2509 3858 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057484.1 protein_id gnl|my_center|LOCUS_50140 4197 3925 gene locus_tag LOCUS_50150 4197 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 4894 4214 gene locus_tag LOCUS_50160 4894 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 >Feature sequence0562 1689 313 gene locus_tag LOCUS_50170 gene murD 1689 313 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN8 protein_id gnl|my_center|LOCUS_50170 4166 2001 gene locus_tag LOCUS_50180 gene glyS 4166 2001 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGX0 protein_id gnl|my_center|LOCUS_50180 4804 4628 gene locus_tag LOCUS_50190 4804 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50190 5184 4930 gene locus_tag LOCUS_50200 5184 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141909.1 protein_id gnl|my_center|LOCUS_50200 >Feature sequence0563 83 1306 gene locus_tag LOCUS_50210 83 1306 CDS product cysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 protein_id gnl|my_center|LOCUS_50210 1742 2299 gene locus_tag LOCUS_50220 1742 2299 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122464.1 protein_id gnl|my_center|LOCUS_50220 2592 2822 gene locus_tag LOCUS_50230 2592 2822 CDS product response regulator SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920728.1 protein_id gnl|my_center|LOCUS_50230 5079 3130 gene locus_tag LOCUS_50240 5079 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 >Feature sequence0564 1159 2298 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccctcactcgctgaggaaattagttgaatggaaac 2879 2613 gene locus_tag LOCUS_50250 2879 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 3208 2960 gene locus_tag LOCUS_50260 3208 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 3750 4649 gene locus_tag LOCUS_50270 3750 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 >Feature sequence0565 3081 868 gene locus_tag LOCUS_50280 3081 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 4154 3240 gene locus_tag LOCUS_50290 4154 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 4577 5113 gene locus_tag LOCUS_50300 4577 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 >Feature sequence0566 1290 700 gene locus_tag LOCUS_50310 1290 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 1893 1471 gene locus_tag LOCUS_50320 1893 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 2197 2457 gene locus_tag LOCUS_50330 2197 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 4704 3418 gene locus_tag LOCUS_50340 4704 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 >Feature sequence0567 668 1105 gene locus_tag LOCUS_50350 668 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140148.1 protein_id gnl|my_center|LOCUS_50350 1403 1191 gene locus_tag LOCUS_50360 1403 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 2394 1333 gene locus_tag LOCUS_50370 2394 1333 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057692.1 protein_id gnl|my_center|LOCUS_50370 4058 2760 gene locus_tag LOCUS_50380 gene hemL 4058 2760 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLK8 protein_id gnl|my_center|LOCUS_50380 4584 5342 gene locus_tag LOCUS_50390 4584 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 >Feature sequence0568 1247 5197 gene locus_tag LOCUS_50400 1247 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 >Feature sequence0569 1005 169 gene locus_tag LOCUS_50410 1005 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057850.1 protein_id gnl|my_center|LOCUS_50410 1134 2204 gene locus_tag LOCUS_50420 gene murG 1134 2204 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY4 protein_id gnl|my_center|LOCUS_50420 2638 5316 gene locus_tag LOCUS_50430 2638 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 >Feature sequence0570 3458 69 gene locus_tag LOCUS_50440 3458 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 4851 3925 gene locus_tag LOCUS_50450 4851 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 >Feature sequence0571 >Feature sequence0572 801 76 gene locus_tag LOCUS_50460 801 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 2298 1168 gene locus_tag LOCUS_50470 2298 1168 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_50470 2587 2796 gene locus_tag LOCUS_50480 2587 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 3929 2817 gene locus_tag LOCUS_50490 3929 2817 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385237.1 protein_id gnl|my_center|LOCUS_50490 4832 3945 gene locus_tag LOCUS_50500 4832 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259386.1 protein_id gnl|my_center|LOCUS_50500 >Feature sequence0573 778 377 gene locus_tag LOCUS_50510 gene rbfA 778 377 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF9 protein_id gnl|my_center|LOCUS_50510 3760 1298 gene locus_tag LOCUS_50520 3760 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 protein_id gnl|my_center|LOCUS_50520 4766 3768 gene locus_tag LOCUS_50530 4766 3768 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974801.1 protein_id gnl|my_center|LOCUS_50530 >Feature sequence0574 405 965 gene locus_tag LOCUS_50540 405 965 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056687.1 protein_id gnl|my_center|LOCUS_50540 2610 2212 gene locus_tag LOCUS_50550 2610 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 >Feature sequence0575 1485 112 gene locus_tag LOCUS_50560 1485 112 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056050.1 protein_id gnl|my_center|LOCUS_50560 2187 1744 gene locus_tag LOCUS_50570 2187 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50570 2906 2736 gene locus_tag LOCUS_50580 2906 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 3130 5283 gene locus_tag LOCUS_50590 3130 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 >Feature sequence0576 1809 1537 gene locus_tag LOCUS_50600 1809 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 1817 2821 gene locus_tag LOCUS_50610 1817 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 3811 3182 gene locus_tag LOCUS_50620 gene hisH 3811 3182 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP5 protein_id gnl|my_center|LOCUS_50620 3989 4510 gene locus_tag LOCUS_50630 3989 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 >Feature sequence0577 3381 907 gene locus_tag LOCUS_50640 gene clpC 3381 907 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_50640 3881 4720 gene locus_tag LOCUS_50650 3881 4720 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_50650 >Feature sequence0578 4038 4853 gene locus_tag LOCUS_50660 gene fdhD 4038 4853 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBW0 protein_id gnl|my_center|LOCUS_50660 >Feature sequence0579 1507 479 gene locus_tag LOCUS_50670 1507 479 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_50670 1991 1659 gene locus_tag LOCUS_50680 1991 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056921.1 protein_id gnl|my_center|LOCUS_50680 3833 2877 gene locus_tag LOCUS_50690 gene sigD 3833 2877 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056119.1 protein_id gnl|my_center|LOCUS_50690 >Feature sequence0580 620 1591 gene locus_tag LOCUS_50700 gene nadA 620 1591 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_50700 2090 1905 gene locus_tag LOCUS_50710 2090 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 2361 2167 gene locus_tag LOCUS_50720 2361 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 3041 3541 gene locus_tag LOCUS_50730 3041 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125002.1 protein_id gnl|my_center|LOCUS_50730 3546 4703 gene locus_tag LOCUS_50740 gene purK 3546 4703 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJG7 protein_id gnl|my_center|LOCUS_50740 >Feature sequence0581 1219 146 gene locus_tag LOCUS_50750 gene metE 1219 146 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227080.1 protein_id gnl|my_center|LOCUS_50750 3469 2144 gene locus_tag LOCUS_50760 3469 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 4859 4323 gene locus_tag LOCUS_50770 4859 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331451.1 protein_id gnl|my_center|LOCUS_50770 >Feature sequence0582 620 357 gene locus_tag LOCUS_50780 620 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 910 1743 gene locus_tag LOCUS_50790 910 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 >Feature sequence0583 3278 3541 gene locus_tag LOCUS_50800 3278 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 4914 3568 gene locus_tag LOCUS_50810 4914 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 >Feature sequence0584 491 1102 gene locus_tag LOCUS_50820 491 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 1988 3553 gene locus_tag LOCUS_50830 1988 3553 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056473.1 protein_id gnl|my_center|LOCUS_50830 3917 4618 gene locus_tag LOCUS_50840 3917 4618 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 protein_id gnl|my_center|LOCUS_50840 >Feature sequence0585 2197 512 gene locus_tag LOCUS_50850 2197 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056997.1 protein_id gnl|my_center|LOCUS_50850 2892 3446 gene locus_tag LOCUS_50860 gene cpcS 2892 3446 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU5 protein_id gnl|my_center|LOCUS_50860 >Feature sequence0586 1633 596 gene locus_tag LOCUS_50870 1633 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140549.1 protein_id gnl|my_center|LOCUS_50870 1741 1968 gene locus_tag LOCUS_50880 1741 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 2124 2297 gene locus_tag LOCUS_50890 2124 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 2555 4258 gene locus_tag LOCUS_50900 2555 4258 CDS product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142261.1 protein_id gnl|my_center|LOCUS_50900 5120 4440 gene locus_tag LOCUS_50910 gene trmD 5120 4440 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM2 protein_id gnl|my_center|LOCUS_50910 >Feature sequence0587 22 245 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcatcatcgtcggagtcatc 1873 1010 gene locus_tag LOCUS_50920 gene chlL 1873 1010 CDS product light-independent protochlorophyllide reductase iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH0 protein_id gnl|my_center|LOCUS_50920 2574 3410 gene locus_tag LOCUS_50930 gene menB 2574 3410 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG66 protein_id gnl|my_center|LOCUS_50930 >Feature sequence0588 1266 2246 gene locus_tag LOCUS_50940 1266 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 4512 3469 gene locus_tag LOCUS_50950 4512 3469 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057144.1 protein_id gnl|my_center|LOCUS_50950 >Feature sequence0589 >Feature sequence0590 943 2442 gene locus_tag LOCUS_50960 gene murE 943 2442 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJI4 protein_id gnl|my_center|LOCUS_50960 2884 3258 gene locus_tag LOCUS_50970 2884 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 3850 3428 gene locus_tag LOCUS_50980 3850 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 4400 4726 gene locus_tag LOCUS_50990 4400 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 >Feature sequence0591 1625 288 gene locus_tag LOCUS_51000 gene trmFO 1625 288 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59109 protein_id gnl|my_center|LOCUS_51000 3147 2038 gene locus_tag LOCUS_51010 3147 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 protein_id gnl|my_center|LOCUS_51010 3972 4574 gene locus_tag LOCUS_51020 3972 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 >Feature sequence0592 699 1073 gene locus_tag LOCUS_51030 699 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 1099 1461 gene locus_tag LOCUS_51040 1099 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 3133 1619 gene locus_tag LOCUS_51050 3133 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 3566 3180 gene locus_tag LOCUS_51060 3566 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 3859 4227 gene locus_tag LOCUS_51070 3859 4227 CDS product addiction module killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_51070 4233 4559 gene locus_tag LOCUS_51080 4233 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 >Feature sequence0593 1893 409 gene locus_tag LOCUS_51090 1893 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 2306 3709 gene locus_tag LOCUS_51100 2306 3709 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878099.1 protein_id gnl|my_center|LOCUS_51100 3897 4136 gene locus_tag LOCUS_51110 3897 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 4583 4278 gene locus_tag LOCUS_51120 4583 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 4936 4643 gene locus_tag LOCUS_51130 4936 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 >Feature sequence0594 1657 26 gene locus_tag LOCUS_51140 gene ppx 1657 26 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057517.1 protein_id gnl|my_center|LOCUS_51140 1738 2622 gene locus_tag LOCUS_51150 gene ubiA 1738 2622 CDS product 4-hydroxybenzoate solanesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFU6 protein_id gnl|my_center|LOCUS_51150 2798 2965 gene locus_tag LOCUS_51160 2798 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 3195 3989 gene locus_tag LOCUS_51170 3195 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 4903 4334 gene locus_tag LOCUS_51180 4903 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_51180 >Feature sequence0595 237 1437 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccattaatttcacttccggagaagtgtaaag 2723 2055 gene locus_tag LOCUS_51190 2723 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 4075 4686 gene locus_tag LOCUS_51200 4075 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 >Feature sequence0596 917 141 gene locus_tag LOCUS_51210 917 141 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098738.1 protein_id gnl|my_center|LOCUS_51210 1856 921 gene locus_tag LOCUS_51220 1856 921 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732470.1 protein_id gnl|my_center|LOCUS_51220 1849 1989 gene locus_tag LOCUS_51230 1849 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 3073 2150 gene locus_tag LOCUS_51240 3073 2150 CDS product Bpu10I family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259288.1 protein_id gnl|my_center|LOCUS_51240 4293 3100 gene locus_tag LOCUS_51250 4293 3100 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8J4 protein_id gnl|my_center|LOCUS_51250 5045 4758 gene locus_tag LOCUS_51260 5045 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 >Feature sequence0597 174 623 gene locus_tag LOCUS_51270 174 623 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055874.1 protein_id gnl|my_center|LOCUS_51270 866 1597 gene locus_tag LOCUS_51280 gene pdxJ 866 1597 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKM1 protein_id gnl|my_center|LOCUS_51280 1852 2184 gene locus_tag LOCUS_51290 gene ycf54 1852 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 protein_id gnl|my_center|LOCUS_51290 2331 2924 gene locus_tag LOCUS_51300 2331 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 3673 3861 gene locus_tag LOCUS_51310 3673 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 4100 5068 gene locus_tag LOCUS_51320 4100 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 >Feature sequence0598 729 499 gene locus_tag LOCUS_51330 729 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 2143 974 gene locus_tag LOCUS_51340 2143 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 2797 2507 gene locus_tag LOCUS_51350 2797 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 3517 3026 gene locus_tag LOCUS_51360 3517 3026 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922126.1 protein_id gnl|my_center|LOCUS_51360 3874 3542 gene locus_tag LOCUS_51370 gene transposase_A 3874 3542 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976527.1 protein_id gnl|my_center|LOCUS_51370 >Feature sequence0599 1230 244 gene locus_tag LOCUS_51380 1230 244 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056182.1 protein_id gnl|my_center|LOCUS_51380 3205 1715 gene locus_tag LOCUS_51390 3205 1715 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058069.1 protein_id gnl|my_center|LOCUS_51390 4576 3674 gene locus_tag LOCUS_51400 gene recO 4576 3674 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGS9 protein_id gnl|my_center|LOCUS_51400 >Feature sequence0600 164 466 gene locus_tag LOCUS_51410 164 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 657 1343 gene locus_tag LOCUS_51420 657 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 1349 1921 gene locus_tag LOCUS_51430 1349 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 1921 2361 gene locus_tag LOCUS_51440 1921 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 >Feature sequence0601 >Feature sequence0602 219 434 gene locus_tag LOCUS_51450 219 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_51450 490 1233 gene locus_tag LOCUS_51460 490 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 1243 1524 gene locus_tag LOCUS_51470 1243 1524 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391906.1 protein_id gnl|my_center|LOCUS_51470 2052 4130 gene locus_tag LOCUS_51480 2052 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 >Feature sequence0603 418 2106 gene locus_tag LOCUS_51490 418 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 >Feature sequence0604 470 2293 gene locus_tag LOCUS_51500 470 2293 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057670.1 protein_id gnl|my_center|LOCUS_51500 2586 3671 gene locus_tag LOCUS_51510 gene leuB 2586 3671 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59029 protein_id gnl|my_center|LOCUS_51510 3963 4832 gene locus_tag LOCUS_51520 3963 4832 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_51520 >Feature sequence0605 1861 1094 gene locus_tag LOCUS_51530 1861 1094 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_51530 3450 2458 gene locus_tag LOCUS_51540 3450 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 4443 3490 gene locus_tag LOCUS_51550 4443 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 >Feature sequence0606 509 1003 gene locus_tag LOCUS_51560 509 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 981 1532 gene locus_tag LOCUS_51570 981 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 <5001 1640 gene locus_tag LOCUS_51580 <5001 1640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0607 8 373 gene locus_tag LOCUS_51590 8 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 370 789 gene locus_tag LOCUS_51600 370 789 CDS product putative toxin-antitoxin system toxin component, PIN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393815.1 protein_id gnl|my_center|LOCUS_51600 947 1177 gene locus_tag LOCUS_51610 947 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 2501 1737 gene locus_tag LOCUS_51620 2501 1737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140178.1 protein_id gnl|my_center|LOCUS_51620 3205 2594 gene locus_tag LOCUS_51630 3205 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 4531 3704 gene locus_tag LOCUS_51640 gene sigF 4531 3704 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_51640 >Feature sequence0608 828 1322 gene locus_tag LOCUS_51650 828 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 3788 1959 gene locus_tag LOCUS_51660 3788 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 4258 4647 gene locus_tag LOCUS_51670 4258 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056170.1 protein_id gnl|my_center|LOCUS_51670 >Feature sequence0609 >Feature sequence0610 4952 336 gene locus_tag LOCUS_51680 4952 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 >Feature sequence0611 189 2105 gene locus_tag LOCUS_51690 gene glmS 189 2105 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJI6 protein_id gnl|my_center|LOCUS_51690 2622 4562 gene locus_tag LOCUS_51700 2622 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143667.1 protein_id gnl|my_center|LOCUS_51700 >Feature sequence0612 334 155 gene locus_tag LOCUS_51710 334 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 958 1626 gene locus_tag LOCUS_51720 958 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 4051 1982 gene locus_tag LOCUS_51730 gene fus 4051 1982 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058192.1 protein_id gnl|my_center|LOCUS_51730 >Feature sequence0613 >Feature sequence0614 1934 276 gene locus_tag LOCUS_51740 1934 276 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124464.1 protein_id gnl|my_center|LOCUS_51740 2059 4905 gene locus_tag LOCUS_51750 2059 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 >Feature sequence0615 2156 1767 gene locus_tag LOCUS_51760 2156 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 2869 4773 gene locus_tag LOCUS_51770 2869 4773 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140246.1 protein_id gnl|my_center|LOCUS_51770 >Feature sequence0616 2411 105 gene locus_tag LOCUS_51780 2411 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 4597 3752 gene locus_tag LOCUS_51790 gene btpA 4597 3752 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 protein_id gnl|my_center|LOCUS_51790 >Feature sequence0617 1451 1206 gene locus_tag LOCUS_51800 1451 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 2924 1923 gene locus_tag LOCUS_51810 2924 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 3463 3776 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gacatatcgtggttcatagt >Feature sequence0618 714 64 gene locus_tag LOCUS_51820 gene nusB 714 64 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS0 protein_id gnl|my_center|LOCUS_51820 1579 1208 gene locus_tag LOCUS_51830 1579 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 4388 1848 gene locus_tag LOCUS_51840 gene nirB 4388 1848 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205570.1 protein_id gnl|my_center|LOCUS_51840 >Feature sequence0619 543 1118 gene locus_tag LOCUS_51850 gene cobU 543 1118 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 protein_id gnl|my_center|LOCUS_51850 1468 1962 gene locus_tag LOCUS_51860 1468 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 3219 2275 gene locus_tag LOCUS_51870 gene rnz 3219 2275 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKE4 protein_id gnl|my_center|LOCUS_51870 3600 4730 gene locus_tag LOCUS_51880 3600 4730 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056246.1 protein_id gnl|my_center|LOCUS_51880 >Feature sequence0620 132 1094 gene locus_tag LOCUS_51890 132 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 1091 2851 gene locus_tag LOCUS_51900 1091 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 2980 4608 gene locus_tag LOCUS_51910 2980 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 >Feature sequence0621 839 1693 gene locus_tag LOCUS_51920 839 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 2369 2806 gene locus_tag LOCUS_51930 2369 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 3620 4447 gene locus_tag LOCUS_51940 3620 4447 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057495.1 protein_id gnl|my_center|LOCUS_51940 >Feature sequence0622 >Feature sequence0623 968 156 gene locus_tag LOCUS_51950 968 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 3040 1661 gene locus_tag LOCUS_51960 3040 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 4666 4860 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttgggtcaaccgccgttga >Feature sequence0624 951 52 gene locus_tag LOCUS_51970 951 52 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141255.1 protein_id gnl|my_center|LOCUS_51970 1057 2349 gene locus_tag LOCUS_51980 gene cpeY 1057 2349 CDS product phycocyanin operon protein Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141188.1 protein_id gnl|my_center|LOCUS_51980 2592 3131 gene locus_tag LOCUS_51990 gene cpeB 2592 3131 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141190.1 protein_id gnl|my_center|LOCUS_51990 3184 3672 gene locus_tag LOCUS_52000 gene cpeA 3184 3672 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141189.1 protein_id gnl|my_center|LOCUS_52000 3876 4172 gene locus_tag LOCUS_52010 3876 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 4198 4689 gene locus_tag LOCUS_52020 4198 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 >Feature sequence0625 258 2069 gene locus_tag LOCUS_52030 258 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 3398 4666 gene locus_tag LOCUS_52040 gene pilT 3398 4666 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056402.1 protein_id gnl|my_center|LOCUS_52040 >Feature sequence0626 1312 731 gene locus_tag LOCUS_52050 1312 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 1605 1429 gene locus_tag LOCUS_52060 1605 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 1997 2482 gene locus_tag LOCUS_52070 1997 2482 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228095.1 protein_id gnl|my_center|LOCUS_52070 2703 4172 gene locus_tag LOCUS_52080 2703 4172 CDS product neopullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143635.1 protein_id gnl|my_center|LOCUS_52080 >Feature sequence0627 628 1515 gene locus_tag LOCUS_52090 628 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 2849 3718 gene locus_tag LOCUS_52100 2849 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 >Feature sequence0628 835 521 gene locus_tag LOCUS_52110 835 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 1427 4507 gene locus_tag LOCUS_52120 1427 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 >Feature sequence0629 1374 517 gene locus_tag LOCUS_52130 1374 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 2421 2987 gene locus_tag LOCUS_52140 2421 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 3354 4625 gene locus_tag LOCUS_52150 3354 4625 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057271.1 protein_id gnl|my_center|LOCUS_52150 >Feature sequence0630 1302 646 gene locus_tag LOCUS_52160 1302 646 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142341.1 protein_id gnl|my_center|LOCUS_52160 2156 2569 gene locus_tag LOCUS_52170 2156 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056602.1 protein_id gnl|my_center|LOCUS_52170 3226 2945 gene locus_tag LOCUS_52180 gene ycf19 3226 2945 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056384.1 protein_id gnl|my_center|LOCUS_52180 3708 3361 gene locus_tag LOCUS_52190 3708 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 4604 3954 gene locus_tag LOCUS_52200 4604 3954 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI28 protein_id gnl|my_center|LOCUS_52200 >Feature sequence0631 83 4492 gene locus_tag LOCUS_52210 83 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 >Feature sequence0632 1011 313 gene locus_tag LOCUS_52220 1011 313 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461598.1 protein_id gnl|my_center|LOCUS_52220 2842 1421 gene locus_tag LOCUS_52230 gene glgA 2842 1421 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU2 protein_id gnl|my_center|LOCUS_52230 4081 3053 gene locus_tag LOCUS_52240 4081 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 >Feature sequence0633 836 2995 gene locus_tag LOCUS_52250 gene pnp 836 2995 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW9 protein_id gnl|my_center|LOCUS_52250 4309 3524 gene locus_tag LOCUS_52260 4309 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 >Feature sequence0634 509 204 gene locus_tag LOCUS_52270 gene acyP 509 204 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE87 protein_id gnl|my_center|LOCUS_52270 1381 617 gene locus_tag LOCUS_52280 gene pcyA 1381 617 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59288 protein_id gnl|my_center|LOCUS_52280 4439 1887 gene locus_tag LOCUS_52290 4439 1887 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058004.1 protein_id gnl|my_center|LOCUS_52290 >Feature sequence0635 1166 1309 gene locus_tag LOCUS_52300 1166 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 1527 4463 gene locus_tag LOCUS_52310 1527 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 >Feature sequence0636 >Feature sequence0637 1271 984 gene locus_tag LOCUS_52320 1271 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 1613 1314 gene locus_tag LOCUS_52330 1613 1314 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020161.1 protein_id gnl|my_center|LOCUS_52330 3282 1936 gene locus_tag LOCUS_52340 3282 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 4545 3781 gene locus_tag LOCUS_52350 4545 3781 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122379.1 protein_id gnl|my_center|LOCUS_52350 >Feature sequence0638 292 1242 gene locus_tag LOCUS_52360 292 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 2812 1448 gene locus_tag LOCUS_52370 2812 1448 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884008.1 protein_id gnl|my_center|LOCUS_52370 >Feature sequence0639 958 353 gene locus_tag LOCUS_52380 958 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 1973 945 gene locus_tag LOCUS_52390 1973 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 2902 2306 gene locus_tag LOCUS_52400 2902 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 4403 3516 gene locus_tag LOCUS_52410 4403 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 >Feature sequence0640 296 436 gene locus_tag LOCUS_52420 296 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 1556 723 gene locus_tag LOCUS_52430 1556 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 2240 1755 gene locus_tag LOCUS_52440 2240 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 4489 2804 gene locus_tag LOCUS_52450 gene ndhB 4489 2804 CDS product NAD(P)H-quinone oxidoreductase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR6 protein_id gnl|my_center|LOCUS_52450 >Feature sequence0641 1503 235 gene locus_tag LOCUS_52460 1503 235 CDS product Na+-transporting ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056159.1 protein_id gnl|my_center|LOCUS_52460 2782 2132 gene locus_tag LOCUS_52470 gene nth 2782 2132 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE9 protein_id gnl|my_center|LOCUS_52470 4219 3131 gene locus_tag LOCUS_52480 4219 3131 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE8 protein_id gnl|my_center|LOCUS_52480 >Feature sequence0642 570 2792 gene locus_tag LOCUS_52490 570 2792 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_52490 4078 3899 gene locus_tag LOCUS_52500 4078 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 >Feature sequence0643 513 1592 gene locus_tag LOCUS_52510 513 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 2839 1976 gene locus_tag LOCUS_52520 2839 1976 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256681.1 protein_id gnl|my_center|LOCUS_52520 4137 3277 gene locus_tag LOCUS_52530 4137 3277 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384269.1 protein_id gnl|my_center|LOCUS_52530 >Feature sequence0644 1048 1626 gene locus_tag LOCUS_52540 1048 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 2345 3406 gene locus_tag LOCUS_52550 gene yfbL 2345 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76482 protein_id gnl|my_center|LOCUS_52550 4113 4319 gene locus_tag LOCUS_52560 4113 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 4491 4339 gene locus_tag LOCUS_52570 4491 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 >Feature sequence0645 577 317 gene locus_tag LOCUS_52580 577 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 >Feature sequence0646 2391 1654 gene locus_tag LOCUS_52590 2391 1654 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_52590 3645 2506 gene locus_tag LOCUS_52600 3645 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142879.1 protein_id gnl|my_center|LOCUS_52600 4290 3901 gene locus_tag LOCUS_52610 gene ywkD 4290 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45871 protein_id gnl|my_center|LOCUS_52610 >Feature sequence0647 >Feature sequence0648 511 1851 gene locus_tag LOCUS_52620 511 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 1848 4328 gene locus_tag LOCUS_52630 1848 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 >Feature sequence0649 >Feature sequence0650 2057 75 gene locus_tag LOCUS_52640 2057 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 2935 2396 gene locus_tag LOCUS_52650 2935 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 3813 4388 gene locus_tag LOCUS_52660 3813 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 >Feature sequence0651 47 4438 gene locus_tag LOCUS_52670 47 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 >Feature sequence0652 296 538 gene locus_tag LOCUS_52680 296 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 556 1185 gene locus_tag LOCUS_52690 556 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 1151 1579 gene locus_tag LOCUS_52700 1151 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 1703 2437 gene locus_tag LOCUS_52710 1703 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 2879 2493 gene locus_tag LOCUS_52720 2879 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 3322 4350 gene locus_tag LOCUS_52730 3322 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 >Feature sequence0653 899 498 gene locus_tag LOCUS_52740 899 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 1549 1349 gene locus_tag LOCUS_52750 1549 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 2901 4292 gene locus_tag LOCUS_52760 2901 4292 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 protein_id gnl|my_center|LOCUS_52760 >Feature sequence0654 92 1528 gene locus_tag LOCUS_52770 92 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 1954 3714 gene locus_tag LOCUS_52780 1954 3714 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057611.1 protein_id gnl|my_center|LOCUS_52780 >Feature sequence0655 609 3770 gene locus_tag LOCUS_52790 609 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 >Feature sequence0656 719 2002 gene locus_tag LOCUS_52800 719 2002 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_52800 2237 2764 gene locus_tag LOCUS_52810 2237 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 2941 4290 gene locus_tag LOCUS_52820 2941 4290 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 protein_id gnl|my_center|LOCUS_52820 >Feature sequence0657 330 740 gene locus_tag LOCUS_52830 330 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 818 2119 gene locus_tag LOCUS_52840 818 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52840 >Feature sequence0658 652 1782 gene locus_tag LOCUS_52850 652 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 2095 2796 gene locus_tag LOCUS_52860 gene wcaJ 2095 2796 CDS product galactosyl-1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125542.1 protein_id gnl|my_center|LOCUS_52860 3281 4351 gene locus_tag LOCUS_52870 gene gmd 3281 4351 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 protein_id gnl|my_center|LOCUS_52870 >Feature sequence0659 1054 2160 gene locus_tag LOCUS_52880 1054 2160 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661212.1 protein_id gnl|my_center|LOCUS_52880 4139 2793 gene locus_tag LOCUS_52890 4139 2793 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057361.1 protein_id gnl|my_center|LOCUS_52890 >Feature sequence0660 501 1733 gene locus_tag LOCUS_52900 501 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 2199 3134 gene locus_tag LOCUS_52910 2199 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058095.1 protein_id gnl|my_center|LOCUS_52910 3807 4199 gene locus_tag LOCUS_52920 3807 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 >Feature sequence0661 903 694 gene locus_tag LOCUS_52930 903 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 1583 1458 gene locus_tag LOCUS_52940 1583 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 3314 2532 gene locus_tag LOCUS_52950 3314 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 >Feature sequence0662 1331 246 gene locus_tag LOCUS_52960 1331 246 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WXS5 protein_id gnl|my_center|LOCUS_52960 1800 4349 gene locus_tag LOCUS_52970 1800 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 >Feature sequence0663 104 1264 gene locus_tag LOCUS_52980 104 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058195.1 protein_id gnl|my_center|LOCUS_52980 3095 1860 gene locus_tag LOCUS_52990 3095 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 3249 3368 gene locus_tag LOCUS_53000 3249 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 >Feature sequence0664 419 1984 gene locus_tag LOCUS_53010 gene purH 419 1984 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN5 protein_id gnl|my_center|LOCUS_53010 2700 3386 gene locus_tag LOCUS_53020 2700 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 >Feature sequence0665 2618 51 gene locus_tag LOCUS_53030 2618 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 >Feature sequence0666 662 1402 gene locus_tag LOCUS_53040 662 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 2697 1528 gene locus_tag LOCUS_53050 gene rsgA 2697 1528 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK79 protein_id gnl|my_center|LOCUS_53050 2960 2703 gene locus_tag LOCUS_53060 2960 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056832.1 protein_id gnl|my_center|LOCUS_53060 4219 2957 gene locus_tag LOCUS_53070 gene dnaJ 4219 2957 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR7 protein_id gnl|my_center|LOCUS_53070 >Feature sequence0667 1949 159 gene locus_tag LOCUS_53080 1949 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 3360 3686 gene locus_tag LOCUS_53090 3360 3686 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL6 protein_id gnl|my_center|LOCUS_53090 >Feature sequence0668 459 3221 gene locus_tag LOCUS_53100 gene valS 459 3221 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS8 protein_id gnl|my_center|LOCUS_53100 >Feature sequence0669 1796 1641 gene locus_tag LOCUS_53110 1796 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 1795 2085 gene locus_tag LOCUS_53120 1795 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 2069 2398 gene locus_tag LOCUS_53130 2069 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 3828 2773 gene locus_tag LOCUS_53140 gene psbD2 3828 2773 CDS product photosystem II reaction center D2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_681245.1 protein_id gnl|my_center|LOCUS_53140 >Feature sequence0670 261 3386 gene locus_tag LOCUS_53150 261 3386 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 protein_id gnl|my_center|LOCUS_53150 3977 3756 gene locus_tag LOCUS_53160 3977 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 >Feature sequence0671 363 1748 gene locus_tag LOCUS_53170 363 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 3351 1981 gene locus_tag LOCUS_53180 3351 1981 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531469.1 protein_id gnl|my_center|LOCUS_53180 3724 3984 gene locus_tag LOCUS_53190 3724 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 >Feature sequence0672 1658 2590 gene locus_tag LOCUS_53200 1658 2590 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992754.1 protein_id gnl|my_center|LOCUS_53200 <4298 2998 gene locus_tag LOCUS_53210 <4298 2998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256484.1:PBS lyase >Feature sequence0673 198 1013 gene locus_tag LOCUS_53220 198 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143821.1 protein_id gnl|my_center|LOCUS_53220 1272 1709 gene locus_tag LOCUS_53230 1272 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 1845 2321 gene locus_tag LOCUS_53240 1845 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 2378 2962 gene locus_tag LOCUS_53250 2378 2962 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887596.1 protein_id gnl|my_center|LOCUS_53250 3061 4032 gene locus_tag LOCUS_53260 3061 4032 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDD1 protein_id gnl|my_center|LOCUS_53260 >Feature sequence0674 136 1033 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcggattatctaaaatccgcgtgaatcaaaac 1195 1479 gene locus_tag LOCUS_53270 1195 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 1626 1886 gene locus_tag LOCUS_53280 1626 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 1890 2102 gene locus_tag LOCUS_53290 1890 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 3073 2813 gene locus_tag LOCUS_53300 3073 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 3369 3124 gene locus_tag LOCUS_53310 3369 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 >Feature sequence0675 978 727 gene locus_tag LOCUS_53320 gene ycf33 978 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057323.1 protein_id gnl|my_center|LOCUS_53320 1233 1712 gene locus_tag LOCUS_53330 1233 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 1709 2476 gene locus_tag LOCUS_53340 1709 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056083.1 protein_id gnl|my_center|LOCUS_53340 3039 2686 gene locus_tag LOCUS_53350 3039 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53350 3322 3029 gene locus_tag LOCUS_53360 3322 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141164.1 protein_id gnl|my_center|LOCUS_53360 3794 4246 gene locus_tag LOCUS_53370 3794 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 >Feature sequence0676 >Feature sequence0677 >Feature sequence0678 897 1535 gene locus_tag LOCUS_53380 897 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 1528 1839 gene locus_tag LOCUS_53390 1528 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 1856 3850 gene locus_tag LOCUS_53400 1856 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 >Feature sequence0679 1066 1311 gene locus_tag LOCUS_53410 1066 1311 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172914.1 protein_id gnl|my_center|LOCUS_53410 1629 3320 gene locus_tag LOCUS_53420 1629 3320 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 protein_id gnl|my_center|LOCUS_53420 >Feature sequence0680 169 450 gene locus_tag LOCUS_53430 169 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 896 1096 gene locus_tag LOCUS_53440 896 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 2289 3833 gene locus_tag LOCUS_53450 2289 3833 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_53450 >Feature sequence0681 482 700 gene locus_tag LOCUS_53460 gene gvpA 482 700 CDS product gas vesicle structural protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWB1 protein_id gnl|my_center|LOCUS_53460 1405 2376 gene locus_tag LOCUS_53470 1405 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 2538 3845 gene locus_tag LOCUS_53480 2538 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 3890 4210 gene locus_tag LOCUS_53490 gene gvpJ 3890 4210 CDS product gas vesicle structural protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWA2 protein_id gnl|my_center|LOCUS_53490 >Feature sequence0682 156 773 gene locus_tag LOCUS_53500 156 773 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE37 protein_id gnl|my_center|LOCUS_53500 2205 1264 gene locus_tag LOCUS_53510 2205 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 2640 3359 gene locus_tag LOCUS_53520 2640 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 >Feature sequence0683 >Feature sequence0684 1858 3462 gene locus_tag LOCUS_53530 gene gpmI 1858 3462 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59177 protein_id gnl|my_center|LOCUS_53530 3774 4004 gene locus_tag LOCUS_53540 gene secG 3774 4004 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 protein_id gnl|my_center|LOCUS_53540 >Feature sequence0685 64 1206 gene locus_tag LOCUS_53550 gene xdhC 64 1206 CDS product xanthine dehydrogenase accessory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_53550 1673 2125 gene locus_tag LOCUS_53560 1673 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 3250 3579 gene locus_tag LOCUS_53570 3250 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 3641 3838 gene locus_tag LOCUS_53580 3641 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 >Feature sequence0686 1061 891 gene locus_tag LOCUS_53590 1061 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 >Feature sequence0687 1336 443 gene locus_tag LOCUS_53600 1336 443 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228102.1 protein_id gnl|my_center|LOCUS_53600 1874 2941 gene locus_tag LOCUS_53610 1874 2941 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_53610 2925 3959 gene locus_tag LOCUS_53620 2925 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_53620 >Feature sequence0688 327 1676 gene locus_tag LOCUS_53630 gene dnaE 327 1676 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057904.1 protein_id gnl|my_center|LOCUS_53630 1869 2225 gene locus_tag LOCUS_53640 1869 2225 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141555.1 protein_id gnl|my_center|LOCUS_53640 3958 2801 gene locus_tag LOCUS_53650 3958 2801 CDS product protoporphyrin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP87 protein_id gnl|my_center|LOCUS_53650 >Feature sequence0689 528 2069 gene locus_tag LOCUS_53660 gene nnr 528 2069 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC3 protein_id gnl|my_center|LOCUS_53660 3334 4012 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttacgcttcttcggaagttgaattagtggaaac >Feature sequence0690 1755 271 gene locus_tag LOCUS_53670 gene ndhD 1755 271 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141006.1 protein_id gnl|my_center|LOCUS_53670 3837 1930 gene locus_tag LOCUS_53680 gene ndhF 3837 1930 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141005.1 protein_id gnl|my_center|LOCUS_53680 >Feature sequence0691 912 463 gene locus_tag LOCUS_53690 912 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 1443 1658 gene locus_tag LOCUS_53700 1443 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 1682 3739 gene locus_tag LOCUS_53710 1682 3739 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_53710 >Feature sequence0692 622 137 gene locus_tag LOCUS_53720 622 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057975.1 protein_id gnl|my_center|LOCUS_53720 1357 3168 gene locus_tag LOCUS_53730 1357 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056767.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53730 3541 4038 gene locus_tag LOCUS_53740 3541 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 >Feature sequence0693 1681 50 gene locus_tag LOCUS_53750 gene menE 1681 50 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057063.1 protein_id gnl|my_center|LOCUS_53750 2831 1845 gene locus_tag LOCUS_53760 gene menC 2831 1845 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP8 protein_id gnl|my_center|LOCUS_53760 3856 3032 gene locus_tag LOCUS_53770 gene menH 3856 3032 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBE3 protein_id gnl|my_center|LOCUS_53770 >Feature sequence0694 2370 589 gene locus_tag LOCUS_53780 2370 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 >Feature sequence0695 1176 325 gene locus_tag LOCUS_53790 1176 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057694.1 protein_id gnl|my_center|LOCUS_53790 3689 1491 gene locus_tag LOCUS_53800 3689 1491 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_53800 >Feature sequence0696 370 684 gene locus_tag LOCUS_53810 370 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 916 1362 gene locus_tag LOCUS_53820 916 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_53820 1391 1570 gene locus_tag LOCUS_53830 1391 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 1564 1755 gene locus_tag LOCUS_53840 1564 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53840 2185 2484 gene locus_tag LOCUS_53850 2185 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 2824 2651 gene locus_tag LOCUS_53860 2824 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 3158 2937 gene locus_tag LOCUS_53870 3158 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 3414 3220 gene locus_tag LOCUS_53880 3414 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 3718 3401 gene locus_tag LOCUS_53890 3718 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 >Feature sequence0697 957 184 gene locus_tag LOCUS_53900 957 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 1301 2335 gene locus_tag LOCUS_53910 gene yfbL 1301 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721273.1 protein_id gnl|my_center|LOCUS_53910 2903 2514 gene locus_tag LOCUS_53920 2903 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 >Feature sequence0698 452 1981 gene locus_tag LOCUS_53930 452 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 3210 2272 gene locus_tag LOCUS_53940 3210 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 3856 3341 gene locus_tag LOCUS_53950 3856 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 >Feature sequence0699 1433 354 gene locus_tag LOCUS_53960 1433 354 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_53960 2856 1774 gene locus_tag LOCUS_53970 2856 1774 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_53970 <4049 3280 gene locus_tag LOCUS_53980 <4049 3280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058074.1:multidrug resistance protein >Feature sequence0700 1638 268 gene locus_tag LOCUS_53990 gene trpB 1638 268 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA80 protein_id gnl|my_center|LOCUS_53990 2000 3820 gene locus_tag LOCUS_54000 gene pepF 2000 3820 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_54000 >Feature sequence0701 298 930 gene locus_tag LOCUS_54010 298 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 1362 1153 gene locus_tag LOCUS_54020 1362 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 1419 3992 gene locus_tag LOCUS_54030 1419 3992 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140434.1 protein_id gnl|my_center|LOCUS_54030 >Feature sequence0702 474 1217 gene locus_tag LOCUS_54040 474 1217 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941829.1 protein_id gnl|my_center|LOCUS_54040 3147 1798 gene locus_tag LOCUS_54050 3147 1798 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141685.1 protein_id gnl|my_center|LOCUS_54050 3881 3159 gene locus_tag LOCUS_54060 3881 3159 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_54060 >Feature sequence0703 1762 461 gene locus_tag LOCUS_54070 1762 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 3712 2846 gene locus_tag LOCUS_54080 3712 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058126.1 protein_id gnl|my_center|LOCUS_54080 >Feature sequence0704 447 2381 gene locus_tag LOCUS_54090 447 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 2374 3657 gene locus_tag LOCUS_54100 2374 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 >Feature sequence0705 2095 377 gene locus_tag LOCUS_54110 2095 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 3797 3225 gene locus_tag LOCUS_54120 3797 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057906.1 protein_id gnl|my_center|LOCUS_54120 >Feature sequence0706 2071 1838 gene locus_tag LOCUS_54130 2071 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 3888 2068 gene locus_tag LOCUS_54140 3888 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 >Feature sequence0707 529 1938 gene locus_tag LOCUS_54150 529 1938 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_54150 2668 2108 gene locus_tag LOCUS_54160 2668 2108 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK86 protein_id gnl|my_center|LOCUS_54160 3732 3013 gene locus_tag LOCUS_54170 gene pspA 3732 3013 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_54170 >Feature sequence0708 1168 2904 gene locus_tag LOCUS_54180 1168 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 3281 3664 gene locus_tag LOCUS_54190 3281 3664 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142884.1 protein_id gnl|my_center|LOCUS_54190 >Feature sequence0709 703 1443 gene locus_tag LOCUS_54200 703 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 2088 2324 gene locus_tag LOCUS_54210 2088 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54210 3807 2428 gene locus_tag LOCUS_54220 3807 2428 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_54220 >Feature sequence0710 906 583 gene locus_tag LOCUS_54230 906 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 1248 952 gene locus_tag LOCUS_54240 gene fdx 1248 952 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_54240 1496 1894 gene locus_tag LOCUS_54250 1496 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 2450 3649 gene locus_tag LOCUS_54260 2450 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 >Feature sequence0711 793 1500 gene locus_tag LOCUS_54270 793 1500 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057970.1 protein_id gnl|my_center|LOCUS_54270 2086 2268 gene locus_tag LOCUS_54280 2086 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 2504 2731 gene locus_tag LOCUS_54290 2504 2731 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 protein_id gnl|my_center|LOCUS_54290 2757 3596 gene locus_tag LOCUS_54300 2757 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 >Feature sequence0712 1978 188 gene locus_tag LOCUS_54310 1978 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 3480 2338 gene locus_tag LOCUS_54320 3480 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 >Feature sequence0713 >Feature sequence0714 392 1081 gene locus_tag LOCUS_54330 392 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058125.1 protein_id gnl|my_center|LOCUS_54330 2422 2237 gene locus_tag LOCUS_54340 2422 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 2502 3455 gene locus_tag LOCUS_54350 2502 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 3658 3888 gene locus_tag LOCUS_54360 3658 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 >Feature sequence0715 1008 313 gene locus_tag LOCUS_54370 1008 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 2603 1548 gene locus_tag LOCUS_54380 2603 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 3689 2631 gene locus_tag LOCUS_54390 3689 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 >Feature sequence0716 99 740 gene locus_tag LOCUS_54400 99 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 737 3454 gene locus_tag LOCUS_54410 737 3454 CDS product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_54410 >Feature sequence0717 455 51 gene locus_tag LOCUS_54420 455 51 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 protein_id gnl|my_center|LOCUS_54420 860 1462 gene locus_tag LOCUS_54430 gene trxA 860 1462 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056210.1 protein_id gnl|my_center|LOCUS_54430 1491 2075 gene locus_tag LOCUS_54440 1491 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 2189 3586 gene locus_tag LOCUS_54450 2189 3586 CDS product alkaline invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 protein_id gnl|my_center|LOCUS_54450 >Feature sequence0718 1472 285 gene locus_tag LOCUS_54460 1472 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 1920 2084 gene locus_tag LOCUS_54470 1920 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 2349 2119 gene locus_tag LOCUS_54480 2349 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 3207 2971 gene locus_tag LOCUS_54490 3207 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 >Feature sequence0719 3628 1931 gene locus_tag LOCUS_54500 3628 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 >Feature sequence0720 283 432 gene locus_tag LOCUS_54510 283 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 826 512 gene locus_tag LOCUS_54520 826 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 1132 1734 gene locus_tag LOCUS_54530 1132 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 2543 2316 gene locus_tag LOCUS_54540 2543 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 2842 3444 gene locus_tag LOCUS_54550 2842 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 >Feature sequence0721 753 2210 gene locus_tag LOCUS_54560 753 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 >Feature sequence0722 371 1870 gene locus_tag LOCUS_54570 371 1870 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ1 protein_id gnl|my_center|LOCUS_54570 2725 1904 gene locus_tag LOCUS_54580 2725 1904 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_54580 3565 2753 gene locus_tag LOCUS_54590 3565 2753 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL42 protein_id gnl|my_center|LOCUS_54590 3691 3798 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acttggggagaccccaagacc >Feature sequence0723 1693 305 gene locus_tag LOCUS_54600 1693 305 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E055 protein_id gnl|my_center|LOCUS_54600 2857 1802 gene locus_tag LOCUS_54610 2857 1802 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058099.1 protein_id gnl|my_center|LOCUS_54610 3190 2906 gene locus_tag LOCUS_54620 3190 2906 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058100.1 protein_id gnl|my_center|LOCUS_54620 >Feature sequence0724 <1 3780 gene locus_tag LOCUS_54630 <1 3780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0725 274 684 gene locus_tag LOCUS_54640 274 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_54640 1258 956 gene locus_tag LOCUS_54650 1258 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 >Feature sequence0726 76 966 gene locus_tag LOCUS_54660 76 966 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938841.1 protein_id gnl|my_center|LOCUS_54660 1803 1435 gene locus_tag LOCUS_54670 gene ccmK1 1803 1435 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_54670 2263 1958 gene locus_tag LOCUS_54680 gene ccmK2 2263 1958 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056791.1 protein_id gnl|my_center|LOCUS_54680 2857 2543 gene locus_tag LOCUS_54690 2857 2543 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_54690 >Feature sequence0727 957 3251 gene locus_tag LOCUS_54700 957 3251 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056743.1 protein_id gnl|my_center|LOCUS_54700 3767 3633 gene locus_tag LOCUS_54710 3767 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 >Feature sequence0728 1335 271 gene locus_tag LOCUS_54720 gene metX 1335 271 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES7 protein_id gnl|my_center|LOCUS_54720 2661 1357 gene locus_tag LOCUS_54730 gene cysD 2661 1357 CDS product O-acetylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_54730 >Feature sequence0729 549 2042 gene locus_tag LOCUS_54740 549 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140725.1 protein_id gnl|my_center|LOCUS_54740 2045 3253 gene locus_tag LOCUS_54750 2045 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 3274 3498 gene locus_tag LOCUS_54760 3274 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_54760 >Feature sequence0730 1472 231 gene locus_tag LOCUS_54770 gene hemN2 1472 231 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057034.1 protein_id gnl|my_center|LOCUS_54770 1836 2918 gene locus_tag LOCUS_54780 gene ycf81 1836 2918 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055863.1 protein_id gnl|my_center|LOCUS_54780 >Feature sequence0731 3627 103 gene locus_tag LOCUS_54790 3627 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 >Feature sequence0732 2454 1171 gene locus_tag LOCUS_54800 2454 1171 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_54800 2986 3534 gene locus_tag LOCUS_54810 2986 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 >Feature sequence0733 3225 2344 gene locus_tag LOCUS_54820 3225 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 >Feature sequence0734 1076 3394 gene locus_tag LOCUS_54830 gene glgB 1076 3394 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB8 protein_id gnl|my_center|LOCUS_54830 >Feature sequence0735 826 1044 gene locus_tag LOCUS_54840 826 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 1361 1981 gene locus_tag LOCUS_54850 1361 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 2866 2414 gene locus_tag LOCUS_54860 2866 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 3120 2866 gene locus_tag LOCUS_54870 3120 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 >Feature sequence0736 1895 99 gene locus_tag LOCUS_54880 1895 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057893.1 protein_id gnl|my_center|LOCUS_54880 2289 2546 gene locus_tag LOCUS_54890 2289 2546 CDS product UPF0296 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ID1 protein_id gnl|my_center|LOCUS_54890 2757 3299 gene locus_tag LOCUS_54900 gene gmk 2757 3299 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ7 protein_id gnl|my_center|LOCUS_54900 >Feature sequence0737 1135 1338 gene locus_tag LOCUS_54910 1135 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 2341 1427 gene locus_tag LOCUS_54920 2341 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 2595 2825 gene locus_tag LOCUS_54930 2595 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 >Feature sequence0738 1409 174 gene locus_tag LOCUS_54940 1409 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_54940 1899 2120 gene locus_tag LOCUS_54950 gene cp12 1899 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057657.1 protein_id gnl|my_center|LOCUS_54950 2608 3129 gene locus_tag LOCUS_54960 2608 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057787.1 protein_id gnl|my_center|LOCUS_54960 >Feature sequence0739 35 964 gene locus_tag LOCUS_54970 35 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 1451 3412 gene locus_tag LOCUS_54980 1451 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 >Feature sequence0740 170 640 gene locus_tag LOCUS_54990 170 640 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226958.1 protein_id gnl|my_center|LOCUS_54990 1218 820 gene locus_tag LOCUS_55000 gene msrB 1218 820 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE61 protein_id gnl|my_center|LOCUS_55000 2099 1434 gene locus_tag LOCUS_55010 2099 1434 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056611.1 protein_id gnl|my_center|LOCUS_55010 2856 2389 gene locus_tag LOCUS_55020 2856 2389 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057639.1 protein_id gnl|my_center|LOCUS_55020 >Feature sequence0741 531 863 gene locus_tag LOCUS_55030 531 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 1200 988 gene locus_tag LOCUS_55040 1200 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 1469 1735 gene locus_tag LOCUS_55050 1469 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 1735 2196 gene locus_tag LOCUS_55060 1735 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002249008.2 protein_id gnl|my_center|LOCUS_55060 2196 2405 gene locus_tag LOCUS_55070 2196 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 >Feature sequence0742 1298 504 gene locus_tag LOCUS_55080 1298 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142967.1 protein_id gnl|my_center|LOCUS_55080 3359 1551 gene locus_tag LOCUS_55090 gene proS 3359 1551 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT0 protein_id gnl|my_center|LOCUS_55090 >Feature sequence0743 663 370 gene locus_tag LOCUS_55100 663 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 1704 928 gene locus_tag LOCUS_55110 1704 928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_55110 3135 1954 gene locus_tag LOCUS_55120 3135 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 >Feature sequence0744 1100 252 gene locus_tag LOCUS_55130 gene tyrA 1100 252 CDS product arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058267.1 protein_id gnl|my_center|LOCUS_55130 1811 3343 gene locus_tag LOCUS_55140 1811 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 >Feature sequence0745 311 1903 gene locus_tag LOCUS_55150 gene lysS 311 1903 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG18 protein_id gnl|my_center|LOCUS_55150 2408 2725 gene locus_tag LOCUS_55160 2408 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 >Feature sequence0746 188 1567 gene locus_tag LOCUS_55170 188 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143184.1 protein_id gnl|my_center|LOCUS_55170 1620 2315 gene locus_tag LOCUS_55180 1620 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143183.1 protein_id gnl|my_center|LOCUS_55180 2538 3323 gene locus_tag LOCUS_55190 2538 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 >Feature sequence0747 2115 1045 gene locus_tag LOCUS_55200 2115 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 3514 2642 gene locus_tag LOCUS_55210 3514 2642 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 protein_id gnl|my_center|LOCUS_55210 >Feature sequence0748 267 3539 gene locus_tag LOCUS_55220 gene pyrA 267 3539 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI5 protein_id gnl|my_center|LOCUS_55220 >Feature sequence0749 599 763 gene locus_tag LOCUS_55230 599 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 1490 3157 gene locus_tag LOCUS_55240 1490 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 >Feature sequence0750 1502 99 gene locus_tag LOCUS_55250 1502 99 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083716.1 protein_id gnl|my_center|LOCUS_55250 >Feature sequence0751 2338 3543 gene locus_tag LOCUS_55260 gene ydcM 2338 3543 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_55260 >Feature sequence0752 482 1168 gene locus_tag LOCUS_55270 482 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057488.1 protein_id gnl|my_center|LOCUS_55270 2973 1225 gene locus_tag LOCUS_55280 2973 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 >Feature sequence0753 1237 377 gene locus_tag LOCUS_55290 gene cphB 1237 377 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P3 protein_id gnl|my_center|LOCUS_55290 2129 3364 gene locus_tag LOCUS_55300 2129 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 >Feature sequence0754 169 3378 gene locus_tag LOCUS_55310 169 3378 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 protein_id gnl|my_center|LOCUS_55310 >Feature sequence0755 596 3271 gene locus_tag LOCUS_55320 596 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 >Feature sequence0756 1982 219 gene locus_tag LOCUS_55330 1982 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 2732 2073 gene locus_tag LOCUS_55340 gene msrA 2732 2073 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_55340 3118 3417 gene locus_tag LOCUS_55350 3118 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057308.1 protein_id gnl|my_center|LOCUS_55350 >Feature sequence0757 1384 371 gene locus_tag LOCUS_55360 1384 371 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIZ8 protein_id gnl|my_center|LOCUS_55360 3107 2010 gene locus_tag LOCUS_55370 3107 2010 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_55370 >Feature sequence0758 1663 401 gene locus_tag LOCUS_55380 1663 401 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143371.1 protein_id gnl|my_center|LOCUS_55380 3012 1831 gene locus_tag LOCUS_55390 3012 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058308.1 protein_id gnl|my_center|LOCUS_55390 >Feature sequence0759 256 1596 gene locus_tag LOCUS_55400 256 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 2450 2707 gene locus_tag LOCUS_55410 2450 2707 CDS product hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703741.1 protein_id gnl|my_center|LOCUS_55410 2822 3160 gene locus_tag LOCUS_55420 2822 3160 CDS product antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_55420 >Feature sequence0760 327 3248 gene locus_tag LOCUS_55430 327 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403128.1 protein_id gnl|my_center|LOCUS_55430 >Feature sequence0761 >Feature sequence0762 618 1145 gene locus_tag LOCUS_55440 618 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 1663 1812 gene locus_tag LOCUS_55450 1663 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55450 2185 1769 gene locus_tag LOCUS_55460 2185 1769 CDS product putative toxin-antitoxin system toxin component, PIN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142603.1 protein_id gnl|my_center|LOCUS_55460 2510 2190 gene locus_tag LOCUS_55470 2510 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 >Feature sequence0763 2981 909 gene locus_tag LOCUS_55480 2981 909 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_55480 3226 2978 gene locus_tag LOCUS_55490 3226 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 >Feature sequence0764 >Feature sequence0765 1207 215 gene locus_tag LOCUS_55500 gene prs 1207 215 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN6 protein_id gnl|my_center|LOCUS_55500 1668 2417 gene locus_tag LOCUS_55510 1668 2417 CDS product sucrose-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143827.1 protein_id gnl|my_center|LOCUS_55510 2586 3209 gene locus_tag LOCUS_55520 gene ruvA 2586 3209 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG1 protein_id gnl|my_center|LOCUS_55520 >Feature sequence0766 4 854 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaaattaatgaatcctggcaacgggattgaaac 1254 3224 gene locus_tag LOCUS_55530 1254 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 >Feature sequence0767 259 3351 gene locus_tag LOCUS_55540 259 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 >Feature sequence0768 1188 16 gene locus_tag LOCUS_55550 gene iscS 1188 16 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_55550 1838 1278 gene locus_tag LOCUS_55560 1838 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_55560 2633 2292 gene locus_tag LOCUS_55570 2633 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 >Feature sequence0769 1342 356 gene locus_tag LOCUS_55580 1342 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 1821 3477 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaaattaatgaatcctggcaacgggattgaaac >Feature sequence0770 146 907 gene locus_tag LOCUS_55590 146 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 1716 1375 gene locus_tag LOCUS_55600 1716 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 1946 1713 gene locus_tag LOCUS_55610 1946 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_55610 3172 2681 gene locus_tag LOCUS_55620 3172 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 >Feature sequence0771 3057 430 gene locus_tag LOCUS_55630 3057 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 >Feature sequence0772 >Feature sequence0773 2645 882 gene locus_tag LOCUS_55640 2645 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 >Feature sequence0774 84 3383 gene locus_tag LOCUS_55650 84 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 >Feature sequence0775 857 24 gene locus_tag LOCUS_55660 857 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143510.1 protein_id gnl|my_center|LOCUS_55660 1084 854 gene locus_tag LOCUS_55670 1084 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 1378 1992 gene locus_tag LOCUS_55680 1378 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 2131 2439 gene locus_tag LOCUS_55690 2131 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 2872 2528 gene locus_tag LOCUS_55700 2872 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 3279 2860 gene locus_tag LOCUS_55710 3279 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 >Feature sequence0776 1025 2806 gene locus_tag LOCUS_55720 1025 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 >Feature sequence0777 359 865 gene locus_tag LOCUS_55730 359 865 CDS product TIGR02652 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058200.1 protein_id gnl|my_center|LOCUS_55730 984 1439 gene locus_tag LOCUS_55740 984 1439 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057581.1 protein_id gnl|my_center|LOCUS_55740 1605 2342 gene locus_tag LOCUS_55750 1605 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 2700 3185 gene locus_tag LOCUS_55760 2700 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 >Feature sequence0778 699 478 gene locus_tag LOCUS_55770 699 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 1144 806 gene locus_tag LOCUS_55780 1144 806 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_55780 1469 1131 gene locus_tag LOCUS_55790 1469 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_55790 3354 1903 gene locus_tag LOCUS_55800 3354 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 >Feature sequence0779 475 837 gene locus_tag LOCUS_55810 475 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 2852 1269 gene locus_tag LOCUS_55820 2852 1269 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_55820 >Feature sequence0780 1886 375 gene locus_tag LOCUS_55830 1886 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 2423 2100 gene locus_tag LOCUS_55840 2423 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 2752 2420 gene locus_tag LOCUS_55850 2752 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55850 3179 2910 gene locus_tag LOCUS_55860 3179 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 >Feature sequence0781 1798 113 gene locus_tag LOCUS_55870 1798 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 3244 2195 gene locus_tag LOCUS_55880 3244 2195 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531761.1 protein_id gnl|my_center|LOCUS_55880 >Feature sequence0782 594 1658 gene locus_tag LOCUS_55890 594 1658 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_55890 2340 1858 gene locus_tag LOCUS_55900 2340 1858 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_55900 3185 2682 gene locus_tag LOCUS_55910 3185 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142895.1 protein_id gnl|my_center|LOCUS_55910 >Feature sequence0783 2154 319 gene locus_tag LOCUS_55920 2154 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 2319 2158 gene locus_tag LOCUS_55930 2319 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55930 2524 2342 gene locus_tag LOCUS_55940 2524 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 2899 2750 gene locus_tag LOCUS_55950 2899 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 3141 2890 gene locus_tag LOCUS_55960 3141 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 >Feature sequence0784 236 3382 gene locus_tag LOCUS_55970 236 3382 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142413.1 protein_id gnl|my_center|LOCUS_55970 >Feature sequence0785 778 1926 gene locus_tag LOCUS_55980 778 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 2998 3189 gene locus_tag LOCUS_55990 2998 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 >Feature sequence0786 255 539 gene locus_tag LOCUS_56000 255 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 1414 896 gene locus_tag LOCUS_56010 1414 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 3217 2213 gene locus_tag LOCUS_56020 gene prk 3217 2213 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN2 protein_id gnl|my_center|LOCUS_56020 >Feature sequence0787 529 1293 gene locus_tag LOCUS_56030 529 1293 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DME3 protein_id gnl|my_center|LOCUS_56030 1769 1452 gene locus_tag LOCUS_56040 1769 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 3085 2132 gene locus_tag LOCUS_56050 3085 2132 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 protein_id gnl|my_center|LOCUS_56050 >Feature sequence0788 258 977 gene locus_tag LOCUS_56060 gene pyrH 258 977 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM63 protein_id gnl|my_center|LOCUS_56060 974 1522 gene locus_tag LOCUS_56070 gene frr 974 1522 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM64 protein_id gnl|my_center|LOCUS_56070 1969 3102 gene locus_tag LOCUS_56080 1969 3102 CDS product geranylgeranyl bacteriochlorophyll reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057244.1 protein_id gnl|my_center|LOCUS_56080 >Feature sequence0789 571 999 gene locus_tag LOCUS_56090 gene psbU 571 999 CDS product photosystem II 12 kDa extrinsic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F1L5 protein_id gnl|my_center|LOCUS_56090 >Feature sequence0790 1058 2434 gene locus_tag LOCUS_56100 1058 2434 CDS product chloride channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057316.1 protein_id gnl|my_center|LOCUS_56100 >Feature sequence0791 2030 2611 gene locus_tag LOCUS_56110 2030 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 >Feature sequence0792 3253 593 gene locus_tag LOCUS_56120 3253 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 >Feature sequence0793 1115 264 gene locus_tag LOCUS_56130 1115 264 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_56130 3017 1716 gene locus_tag LOCUS_56140 gene hisD 3017 1716 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR2 protein_id gnl|my_center|LOCUS_56140 >Feature sequence0794 109 1281 gene locus_tag LOCUS_56150 109 1281 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249921.1 protein_id gnl|my_center|LOCUS_56150 1480 2172 gene locus_tag LOCUS_56160 gene trmH 1480 2172 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_56160 >Feature sequence0795 239 925 gene locus_tag LOCUS_56170 gene ycf29 239 925 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 protein_id gnl|my_center|LOCUS_56170 1073 1660 gene locus_tag LOCUS_56180 1073 1660 CDS product IS607 family transposase ISSto13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980553.1 protein_id gnl|my_center|LOCUS_56180 >Feature sequence0796 565 272 gene locus_tag LOCUS_56190 565 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 1104 820 gene locus_tag LOCUS_56200 1104 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 1338 1177 gene locus_tag LOCUS_56210 1338 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 2133 2987 gene locus_tag LOCUS_56220 2133 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 >Feature sequence0797 630 759 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgcggtcttggggtctccccaagt 1089 1289 gene locus_tag LOCUS_56230 1089 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 2314 1580 gene locus_tag LOCUS_56240 gene sfsA 2314 1580 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI93 protein_id gnl|my_center|LOCUS_56240 >Feature sequence0798 3070 344 gene locus_tag LOCUS_56250 3070 344 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142589.1 protein_id gnl|my_center|LOCUS_56250 >Feature sequence0799 1285 872 gene locus_tag LOCUS_56260 1285 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56260 1336 1509 gene locus_tag LOCUS_56270 1336 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 1929 3179 gene locus_tag LOCUS_56280 1929 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 >Feature sequence0800 664 915 gene locus_tag LOCUS_56290 664 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 2819 1344 gene locus_tag LOCUS_56300 2819 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 >Feature sequence0801 1107 1438 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccactaatttcacttcaagagaagtgtaaag >Feature sequence0802 1084 293 gene locus_tag LOCUS_56310 1084 293 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143200.1 protein_id gnl|my_center|LOCUS_56310 2992 1529 gene locus_tag LOCUS_56320 gene gatA 2992 1529 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK65 protein_id gnl|my_center|LOCUS_56320 >Feature sequence0803 1937 477 gene locus_tag LOCUS_56330 1937 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56330 2954 2469 gene locus_tag LOCUS_56340 gene apcD 2954 2469 CDS product allophycocyanin-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057391.1 protein_id gnl|my_center|LOCUS_56340 >Feature sequence0804 257 1012 gene locus_tag LOCUS_56350 257 1012 CDS product FraH-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889592.1 protein_id gnl|my_center|LOCUS_56350 1025 2917 gene locus_tag LOCUS_56360 1025 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 >Feature sequence0805 1610 2854 gene locus_tag LOCUS_56370 1610 2854 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056970.1 protein_id gnl|my_center|LOCUS_56370 >Feature sequence0806 1930 23 gene locus_tag LOCUS_56380 gene mnmG 1930 23 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF8 protein_id gnl|my_center|LOCUS_56380 2711 2971 gene locus_tag LOCUS_56390 2711 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56390 >Feature sequence0807 264 1598 gene locus_tag LOCUS_56400 264 1598 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_56400 1668 2948 gene locus_tag LOCUS_56410 1668 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796266.1 protein_id gnl|my_center|LOCUS_56410 >Feature sequence0808 1113 2822 gene locus_tag LOCUS_56420 1113 2822 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 protein_id gnl|my_center|LOCUS_56420 >Feature sequence0809 253 390 gene locus_tag LOCUS_56430 253 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56430 451 1434 gene locus_tag LOCUS_56440 451 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 1673 1951 gene locus_tag LOCUS_56450 1673 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 1979 2290 gene locus_tag LOCUS_56460 1979 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 >Feature sequence0810 762 124 gene locus_tag LOCUS_56470 762 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_56470 1598 825 gene locus_tag LOCUS_56480 1598 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56480 2161 1595 gene locus_tag LOCUS_56490 2161 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56490 <3210 2253 gene locus_tag LOCUS_56500 <3210 2253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141571.1:flavohemoprotein >Feature sequence0811 479 336 gene locus_tag LOCUS_56510 479 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 2783 1080 gene locus_tag LOCUS_56520 2783 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 >Feature sequence0812 583 675 gene locus_tag LOCUS_t00610 583 675 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1831 896 gene locus_tag LOCUS_56530 1831 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058107.1 protein_id gnl|my_center|LOCUS_56530 2240 2953 gene locus_tag LOCUS_56540 2240 2953 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058023.1 protein_id gnl|my_center|LOCUS_56540 >Feature sequence0813 1651 581 gene locus_tag LOCUS_56550 1651 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 1958 2431 gene locus_tag LOCUS_56560 1958 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 >Feature sequence0814 248 1585 gene locus_tag LOCUS_56570 gene aroA 248 1585 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY3 protein_id gnl|my_center|LOCUS_56570 2232 1804 gene locus_tag LOCUS_56580 2232 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 >Feature sequence0815 2294 3046 gene locus_tag LOCUS_56590 2294 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 >Feature sequence0816 2594 3031 gene locus_tag LOCUS_56600 2594 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 >Feature sequence0817 249 1607 gene locus_tag LOCUS_56610 249 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56610 3017 1881 gene locus_tag LOCUS_56620 3017 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56620 >Feature sequence0818 315 190 gene locus_tag LOCUS_56630 315 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 1967 606 gene locus_tag LOCUS_56640 1967 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 2424 2729 gene locus_tag LOCUS_56650 2424 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 >Feature sequence0819 2435 285 gene locus_tag LOCUS_56660 2435 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 >Feature sequence0820 650 1597 gene locus_tag LOCUS_56670 650 1597 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_56670 2253 1768 gene locus_tag LOCUS_56680 2253 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 >Feature sequence0821 989 153 gene locus_tag LOCUS_56690 989 153 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140177.1 protein_id gnl|my_center|LOCUS_56690 1551 1835 gene locus_tag LOCUS_56700 1551 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 >Feature sequence0822 2492 1488 gene locus_tag LOCUS_56710 gene rbsK 2492 1488 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683574.1 protein_id gnl|my_center|LOCUS_56710 >Feature sequence0823 2373 1546 gene locus_tag LOCUS_56720 2373 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 >Feature sequence0824 443 1711 gene locus_tag LOCUS_56730 443 1711 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 protein_id gnl|my_center|LOCUS_56730 2671 1931 gene locus_tag LOCUS_56740 gene glpQ 2671 1931 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_56740 2932 3082 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggggagaccccaagaccgca >Feature sequence0825 >Feature sequence0826 2198 192 gene locus_tag LOCUS_56750 2198 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 >Feature sequence0827 2365 302 gene locus_tag LOCUS_56760 2365 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 >Feature sequence0828 430 1788 gene locus_tag LOCUS_56770 430 1788 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223419.1 protein_id gnl|my_center|LOCUS_56770 2904 2356 gene locus_tag LOCUS_56780 2904 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56780 >Feature sequence0829 533 898 gene locus_tag LOCUS_56790 533 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 2500 1250 gene locus_tag LOCUS_56800 2500 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 >Feature sequence0830 1291 308 gene locus_tag LOCUS_56810 gene cysM 1291 308 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058144.1 protein_id gnl|my_center|LOCUS_56810 2380 1742 gene locus_tag LOCUS_56820 2380 1742 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_56820 2540 2827 gene locus_tag LOCUS_56830 2540 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056692.1 protein_id gnl|my_center|LOCUS_56830 >Feature sequence0831 1222 68 gene locus_tag LOCUS_56840 gene wecE 1222 68 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124471.1 protein_id gnl|my_center|LOCUS_56840 2374 2646 gene locus_tag LOCUS_56850 2374 2646 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_56850 >Feature sequence0832 1071 73 gene locus_tag LOCUS_56860 gene tgt 1071 73 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMG4 protein_id gnl|my_center|LOCUS_56860 1723 1271 gene locus_tag LOCUS_56870 1723 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 1886 2677 gene locus_tag LOCUS_56880 gene cobS 1886 2677 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ91 protein_id gnl|my_center|LOCUS_56880 >Feature sequence0833 507 1088 gene locus_tag LOCUS_56890 507 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 1081 2844 gene locus_tag LOCUS_56900 1081 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 >Feature sequence0834 2315 192 gene locus_tag LOCUS_56910 2315 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 >Feature sequence0835 427 191 gene locus_tag LOCUS_56920 427 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 614 417 gene locus_tag LOCUS_56930 614 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 917 642 gene locus_tag LOCUS_56940 917 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 1155 1922 gene locus_tag LOCUS_56950 1155 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 >Feature sequence0836 1784 105 gene locus_tag LOCUS_56960 1784 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 1913 2704 gene locus_tag LOCUS_56970 1913 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142774.1 protein_id gnl|my_center|LOCUS_56970 >Feature sequence0837 2627 231 gene locus_tag LOCUS_56980 2627 231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057093.1 protein_id gnl|my_center|LOCUS_56980 >Feature sequence0838 >Feature sequence0839 >Feature sequence0840 1163 246 gene locus_tag LOCUS_56990 1163 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 1646 2713 gene locus_tag LOCUS_57000 1646 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 >Feature sequence0841 2481 985 gene locus_tag LOCUS_57010 2481 985 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887389.1 protein_id gnl|my_center|LOCUS_57010 >Feature sequence0842 >Feature sequence0843 <2984 658 gene locus_tag LOCUS_57020 <2984 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388279.1:ATPase >Feature sequence0844 71 2632 gene locus_tag LOCUS_57030 71 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57030 >Feature sequence0845 92 280 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctctacttggggagaccccaagacc 1368 2840 gene locus_tag LOCUS_57040 gene tldD 1368 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056379.1 protein_id gnl|my_center|LOCUS_57040 >Feature sequence0846 >Feature sequence0847 381 79 gene locus_tag LOCUS_57050 381 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057417.1 protein_id gnl|my_center|LOCUS_57050 1890 451 gene locus_tag LOCUS_57060 1890 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 >Feature sequence0848 434 352 gene locus_tag LOCUS_t00620 434 352 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 522 449 gene locus_tag LOCUS_t00630 522 449 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 627 558 gene locus_tag LOCUS_t00640 627 558 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 713 640 gene locus_tag LOCUS_t00650 713 640 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1351 1276 gene locus_tag LOCUS_t00660 1351 1276 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1429 1355 gene locus_tag LOCUS_t00670 1429 1355 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1891 1445 gene locus_tag LOCUS_57070 1891 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058296.1 protein_id gnl|my_center|LOCUS_57070 2559 2487 gene locus_tag LOCUS_t00680 2559 2487 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2642 2568 gene locus_tag LOCUS_t00690 2642 2568 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2720 2649 gene locus_tag LOCUS_t00700 2720 2649 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2801 2727 gene locus_tag LOCUS_t00710 2801 2727 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0849 340 1257 gene locus_tag LOCUS_57080 gene ugpE 340 1257 CDS product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D3H6 protein_id gnl|my_center|LOCUS_57080 1375 2580 gene locus_tag LOCUS_57090 1375 2580 CDS product putative sugar ABC transporter, ATP-binding protein SugC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702115.1 protein_id gnl|my_center|LOCUS_57090 >Feature sequence0850 1794 118 gene locus_tag LOCUS_57100 1794 118 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 protein_id gnl|my_center|LOCUS_57100 2457 2179 gene locus_tag LOCUS_57110 2457 2179 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW8 protein_id gnl|my_center|LOCUS_57110 >Feature sequence0851 >Feature sequence0852 2626 2363 gene locus_tag LOCUS_57120 2626 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 >Feature sequence0853 83 529 gene locus_tag LOCUS_57130 gene dtd 83 529 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66742 protein_id gnl|my_center|LOCUS_57130 2506 821 gene locus_tag LOCUS_57140 gene groL2 2506 821 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7MBB4 protein_id gnl|my_center|LOCUS_57140 >Feature sequence0854 1819 86 gene locus_tag LOCUS_57150 1819 86 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_57150 2316 1912 gene locus_tag LOCUS_57160 2316 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 >Feature sequence0855 558 1631 gene locus_tag LOCUS_57170 558 1631 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW51 protein_id gnl|my_center|LOCUS_57170 1683 1943 gene locus_tag LOCUS_57180 1683 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 2795 2064 gene locus_tag LOCUS_57190 2795 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57190 >Feature sequence0856 811 302 gene locus_tag LOCUS_57200 811 302 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141194.1 protein_id gnl|my_center|LOCUS_57200 1615 986 gene locus_tag LOCUS_57210 1615 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 protein_id gnl|my_center|LOCUS_57210 <2870 1807 gene locus_tag LOCUS_57220 <2870 1807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024484.1:tetratricopeptide repeat protein >Feature sequence0857 1336 389 gene locus_tag LOCUS_57230 1336 389 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKP2 protein_id gnl|my_center|LOCUS_57230 2609 1698 gene locus_tag LOCUS_57240 2609 1698 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_57240 >Feature sequence0858 154 501 gene locus_tag LOCUS_57250 154 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 2341 638 gene locus_tag LOCUS_57260 2341 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140819.1 protein_id gnl|my_center|LOCUS_57260 >Feature sequence0859 2217 241 gene locus_tag LOCUS_57270 2217 241 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 protein_id gnl|my_center|LOCUS_57270 >Feature sequence0860 1032 2036 gene locus_tag LOCUS_57280 gene sigB 1032 2036 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056675.1 protein_id gnl|my_center|LOCUS_57280 >Feature sequence0861 >Feature sequence0862 978 49 gene locus_tag LOCUS_57290 978 49 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056888.1 protein_id gnl|my_center|LOCUS_57290 1116 2534 gene locus_tag LOCUS_57300 1116 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 >Feature sequence0863 689 1645 gene locus_tag LOCUS_57310 689 1645 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_57310 2014 2604 gene locus_tag LOCUS_57320 gene wcaF 2014 2604 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 protein_id gnl|my_center|LOCUS_57320 >Feature sequence0864 585 214 gene locus_tag LOCUS_57330 585 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 977 582 gene locus_tag LOCUS_57340 977 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57340 1268 1705 gene locus_tag LOCUS_57350 1268 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932031.1 protein_id gnl|my_center|LOCUS_57350 2270 2593 gene locus_tag LOCUS_57360 2270 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 >Feature sequence0865 305 630 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccactaattcggcatcccactaggggatgcaac 1504 866 gene locus_tag LOCUS_57370 1504 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_57370 2462 1779 gene locus_tag LOCUS_57380 gene ispD 2462 1779 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL91 protein_id gnl|my_center|LOCUS_57380 >Feature sequence0866 9 294 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttggggtctccccaagtagagca 1118 1897 gene locus_tag LOCUS_57390 1118 1897 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI97 protein_id gnl|my_center|LOCUS_57390 >Feature sequence0867 818 519 gene locus_tag LOCUS_57400 818 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 2323 950 gene locus_tag LOCUS_57410 2323 950 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_57410 >Feature sequence0868 <1 547 gene locus_tag LOCUS_57420 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056220.1:heme oxygenase 815 1039 gene locus_tag LOCUS_57430 815 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 1032 1400 gene locus_tag LOCUS_57440 1032 1400 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI95 protein_id gnl|my_center|LOCUS_57440 2343 1645 gene locus_tag LOCUS_57450 2343 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 protein_id gnl|my_center|LOCUS_57450 2417 2626 gene locus_tag LOCUS_57460 gene ytjA 2417 2626 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34601 protein_id gnl|my_center|LOCUS_57460 >Feature sequence0869 893 60 gene locus_tag LOCUS_57470 893 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 2531 1329 gene locus_tag LOCUS_57480 2531 1329 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_57480 >Feature sequence0870 719 135 gene locus_tag LOCUS_57490 719 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056696.1 protein_id gnl|my_center|LOCUS_57490 1425 835 gene locus_tag LOCUS_57500 1425 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 protein_id gnl|my_center|LOCUS_57500 2355 2026 gene locus_tag LOCUS_57510 2355 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 >Feature sequence0871 466 200 gene locus_tag LOCUS_57520 466 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 1589 555 gene locus_tag LOCUS_57530 1589 555 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057692.1 protein_id gnl|my_center|LOCUS_57530 2459 1902 gene locus_tag LOCUS_57540 2459 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 >Feature sequence0872 566 2350 gene locus_tag LOCUS_57550 566 2350 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 protein_id gnl|my_center|LOCUS_57550 >Feature sequence0873 365 1702 gene locus_tag LOCUS_57560 365 1702 CDS product modulator of DNA gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056923.1 protein_id gnl|my_center|LOCUS_57560 2439 1960 gene locus_tag LOCUS_57570 2439 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 >Feature sequence0874 1654 566 gene locus_tag LOCUS_57580 1654 566 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_57580 2424 1849 gene locus_tag LOCUS_57590 2424 1849 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058037.1 protein_id gnl|my_center|LOCUS_57590 >Feature sequence0875 343 1791 gene locus_tag LOCUS_57600 343 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_57600 >Feature sequence0876 718 1047 gene locus_tag LOCUS_57610 718 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57610 2274 1474 gene locus_tag LOCUS_57620 2274 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 >Feature sequence0877 1011 817 gene locus_tag LOCUS_57630 1011 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945260.1 protein_id gnl|my_center|LOCUS_57630 1240 2622 gene locus_tag LOCUS_57640 1240 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57640 >Feature sequence0878 1010 732 gene locus_tag LOCUS_57650 1010 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57650 1251 964 gene locus_tag LOCUS_57660 1251 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679319.1 protein_id gnl|my_center|LOCUS_57660 1520 2272 gene locus_tag LOCUS_57670 1520 2272 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMH9 protein_id gnl|my_center|LOCUS_57670 >Feature sequence0879 364 2310 gene locus_tag LOCUS_57680 364 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57680 >Feature sequence0880 388 1959 gene locus_tag LOCUS_57690 388 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 2308 2033 gene locus_tag LOCUS_57700 2308 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 >Feature sequence0881 768 2285 gene locus_tag LOCUS_57710 768 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056673.1 protein_id gnl|my_center|LOCUS_57710 >Feature sequence0882 298 528 gene locus_tag LOCUS_57720 298 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 1004 1750 gene locus_tag LOCUS_57730 gene ho1 1004 1750 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056220.1 protein_id gnl|my_center|LOCUS_57730 2293 2466 gene locus_tag LOCUS_57740 2293 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 >Feature sequence0883 1670 534 gene locus_tag LOCUS_57750 gene cheB2 1670 534 CDS product chemotaxis response regulator protein-glutamate methylesterase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63J47 protein_id gnl|my_center|LOCUS_57750 2638 1901 gene locus_tag LOCUS_57760 2638 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57760 >Feature sequence0884 538 341 gene locus_tag LOCUS_57770 538 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 799 629 gene locus_tag LOCUS_57780 799 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 1305 964 gene locus_tag LOCUS_57790 1305 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 2645 1758 gene locus_tag LOCUS_57800 2645 1758 CDS product heme ABC transporter substrate-binding protein IsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717362.1 protein_id gnl|my_center|LOCUS_57800 >Feature sequence0885 1116 460 gene locus_tag LOCUS_57810 1116 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57810 >Feature sequence0886 123 494 gene locus_tag LOCUS_57820 123 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087280.1 protein_id gnl|my_center|LOCUS_57820 497 1012 gene locus_tag LOCUS_57830 497 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084500.1 protein_id gnl|my_center|LOCUS_57830 1235 1705 gene locus_tag LOCUS_57840 1235 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 1698 2024 gene locus_tag LOCUS_57850 1698 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 >Feature sequence0887 202 2169 gene locus_tag LOCUS_57860 202 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 >Feature sequence0888 1545 1868 gene locus_tag LOCUS_57870 1545 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 <2699 1916 gene locus_tag LOCUS_57880 <2699 1916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000682783.1:peptidase >Feature sequence0889 964 437 gene locus_tag LOCUS_57890 964 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 2566 1244 gene locus_tag LOCUS_57900 2566 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57900 >Feature sequence0890 2296 251 gene locus_tag LOCUS_57910 2296 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57910 >Feature sequence0891 376 518 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcccacacttcccacact 681 2339 gene locus_tag LOCUS_57920 gene ndhD2 681 2339 CDS product NAD(P)H-quinone oxidoreductase chain 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHX4 protein_id gnl|my_center|LOCUS_57920 >Feature sequence0892 865 509 gene locus_tag LOCUS_57930 865 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 2413 1031 gene locus_tag LOCUS_57940 2413 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57940 >Feature sequence0893 >Feature sequence0894 132 518 gene locus_tag LOCUS_57950 132 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 1665 619 gene locus_tag LOCUS_57960 1665 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 >Feature sequence0895 1481 180 gene locus_tag LOCUS_57970 1481 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_57970 1848 2237 gene locus_tag LOCUS_57980 1848 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 >Feature sequence0896 627 833 gene locus_tag LOCUS_57990 627 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 967 1326 gene locus_tag LOCUS_58000 967 1326 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222856.1 protein_id gnl|my_center|LOCUS_58000 1323 1592 gene locus_tag LOCUS_58010 1323 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 >Feature sequence0897 46 287 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgacggcacaacgccagcag 1041 1772 gene locus_tag LOCUS_58020 1041 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 >Feature sequence0898 1615 296 gene locus_tag LOCUS_58030 1615 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 >Feature sequence0899 <2608 1602 gene locus_tag LOCUS_58040 <2608 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545144.1:polysaccharide deacetylase >Feature sequence0900 >Feature sequence0901 2407 326 gene locus_tag LOCUS_58050 2407 326 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056593.1 protein_id gnl|my_center|LOCUS_58050 >Feature sequence0902 >Feature sequence0903 324 743 gene locus_tag LOCUS_58060 324 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 728 1060 gene locus_tag LOCUS_58070 728 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58070 1150 2232 gene locus_tag LOCUS_58080 1150 2232 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_58080 2258 2440 gene locus_tag LOCUS_58090 2258 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 >Feature sequence0904 369 515 gene locus_tag LOCUS_58100 369 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 2046 802 gene locus_tag LOCUS_58110 2046 802 CDS product carbon dioxide concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_58110 >Feature sequence0905 200 610 gene locus_tag LOCUS_58120 200 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 protein_id gnl|my_center|LOCUS_58120 825 2306 gene locus_tag LOCUS_58130 gene cobQ 825 2306 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI74 protein_id gnl|my_center|LOCUS_58130 >Feature sequence0906 399 1547 gene locus_tag LOCUS_58140 399 1547 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 protein_id gnl|my_center|LOCUS_58140 1739 2377 gene locus_tag LOCUS_58150 1739 2377 CDS product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGB4 protein_id gnl|my_center|LOCUS_58150 >Feature sequence0907 225 878 gene locus_tag LOCUS_58160 225 878 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_58160 2188 1451 gene locus_tag LOCUS_58170 gene ribC 2188 1451 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143593.1 protein_id gnl|my_center|LOCUS_58170 >Feature sequence0908 1935 598 gene locus_tag LOCUS_58180 1935 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 >Feature sequence0909 298 1428 gene locus_tag LOCUS_58190 298 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058078.1 protein_id gnl|my_center|LOCUS_58190 1841 2226 gene locus_tag LOCUS_tm00010 1841 2226 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0910 1080 526 gene locus_tag LOCUS_58200 gene cpeB 1080 526 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141190.1 protein_id gnl|my_center|LOCUS_58200 1623 1934 gene locus_tag LOCUS_58210 1623 1934 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_58210 >Feature sequence0911 971 2011 gene locus_tag LOCUS_58220 971 2011 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_58220 >Feature sequence0912 1990 785 gene locus_tag LOCUS_58230 1990 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057862.1 protein_id gnl|my_center|LOCUS_58230 >Feature sequence0913 >Feature sequence0914 1242 307 gene locus_tag LOCUS_58240 1242 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58240 >Feature sequence0915 228 617 gene locus_tag LOCUS_58250 228 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 610 2124 gene locus_tag LOCUS_58260 610 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58260 >Feature sequence0916 1396 518 gene locus_tag LOCUS_58270 1396 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58270 1948 1727 gene locus_tag LOCUS_58280 1948 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58280 >Feature sequence0917 906 1778 gene locus_tag LOCUS_58290 906 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 >Feature sequence0918 2451 853 gene locus_tag LOCUS_58300 2451 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_58300 >Feature sequence0919 1912 209 gene locus_tag LOCUS_58310 1912 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057497.1 protein_id gnl|my_center|LOCUS_58310 >Feature sequence0920 1094 264 gene locus_tag LOCUS_58320 1094 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 1717 2394 gene locus_tag LOCUS_58330 gene nanE 1717 2394 CDS product putative N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGQ5 protein_id gnl|my_center|LOCUS_58330 >Feature sequence0921 583 1818 gene locus_tag LOCUS_58340 583 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 >Feature sequence0922 1689 454 gene locus_tag LOCUS_58350 1689 454 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057389.1 protein_id gnl|my_center|LOCUS_58350 >Feature sequence0923 26 199 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttgattcacgcggattttagataatccgaaag 1412 633 gene locus_tag LOCUS_58360 1412 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 2134 1766 gene locus_tag LOCUS_58370 2134 1766 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_58370 >Feature sequence0924 >Feature sequence0925 948 2210 gene locus_tag LOCUS_58380 gene avtA 948 2210 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057579.1 protein_id gnl|my_center|LOCUS_58380 >Feature sequence0926 2274 397 gene locus_tag LOCUS_58390 2274 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58390 >Feature sequence0927 876 1028 gene locus_tag LOCUS_58400 876 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 >Feature sequence0928 496 1803 gene locus_tag LOCUS_58410 496 1803 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_58410 >Feature sequence0929 2 2317 gene locus_tag LOCUS_58420 2 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 >Feature sequence0930 >Feature sequence0931 1781 492 gene locus_tag LOCUS_58430 gene eno 1781 492 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL40 protein_id gnl|my_center|LOCUS_58430 >Feature sequence0932 1185 754 gene locus_tag LOCUS_58440 1185 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 >Feature sequence0933 549 199 gene locus_tag LOCUS_58450 549 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58450 923 2176 gene locus_tag LOCUS_58460 gene trpB 923 2176 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG49 protein_id gnl|my_center|LOCUS_58460 >Feature sequence0934 528 1244 gene locus_tag LOCUS_58470 528 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143458.1 protein_id gnl|my_center|LOCUS_58470 1472 1672 gene locus_tag LOCUS_58480 1472 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 2077 1730 gene locus_tag LOCUS_58490 2077 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58490 >Feature sequence0935 1181 1516 gene locus_tag LOCUS_58500 1181 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 2298 1876 gene locus_tag LOCUS_58510 2298 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 >Feature sequence0936 <2362 88 gene locus_tag LOCUS_58520 <2362 88 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004544542.1:two-component system sensor kinase >Feature sequence0937 988 485 gene locus_tag LOCUS_58530 988 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 1499 2089 gene locus_tag LOCUS_58540 1499 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58540 >Feature sequence0938 746 1492 gene locus_tag LOCUS_58550 746 1492 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460434.1 protein_id gnl|my_center|LOCUS_58550 >Feature sequence0939 1518 259 gene locus_tag LOCUS_58560 1518 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58560 1923 1624 gene locus_tag LOCUS_58570 1923 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58570 >Feature sequence0940 >Feature sequence0941 1894 440 gene locus_tag LOCUS_58580 1894 440 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729175.1 protein_id gnl|my_center|LOCUS_58580 >Feature sequence0942 155 1972 gene locus_tag LOCUS_58590 155 1972 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057909.1 protein_id gnl|my_center|LOCUS_58590 >Feature sequence0943 >Feature sequence0944 >Feature sequence0945 927 394 gene locus_tag LOCUS_58600 927 394 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057261.1 protein_id gnl|my_center|LOCUS_58600 1833 1351 gene locus_tag LOCUS_58610 1833 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143485.1 protein_id gnl|my_center|LOCUS_58610 >Feature sequence0946 2 508 gene locus_tag LOCUS_58620 2 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 >Feature sequence0947 1477 839 gene locus_tag LOCUS_58630 1477 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 >Feature sequence0948 1477 155 gene locus_tag LOCUS_58640 1477 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 1851 2129 gene locus_tag LOCUS_58650 1851 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 >Feature sequence0949 <1 1047 gene locus_tag LOCUS_58660 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065100.1:peptide transporter >Feature sequence0950 338 1141 gene locus_tag LOCUS_58670 338 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 1208 2002 gene locus_tag LOCUS_58680 1208 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 >Feature sequence0951 <1 925 gene locus_tag LOCUS_58690 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533468.1:2OG-Fe(II) oxygenase 1228 1968 gene locus_tag LOCUS_58700 1228 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 >Feature sequence0952 >Feature sequence0953 1614 1853 gene locus_tag LOCUS_58710 1614 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58710 >Feature sequence0954 1335 1688 gene locus_tag LOCUS_58720 1335 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 >Feature sequence0955 1904 1831 gene locus_tag LOCUS_t00720 1904 1831 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0956 496 1062 gene locus_tag LOCUS_58730 496 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 1311 2024 gene locus_tag LOCUS_58740 1311 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 >Feature sequence0957 1588 581 gene locus_tag LOCUS_58750 1588 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58750 >Feature sequence0958 832 1935 gene locus_tag LOCUS_58760 832 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58760 >Feature sequence0959 1048 296 gene locus_tag LOCUS_58770 1048 296 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_58770 1538 1341 gene locus_tag LOCUS_58780 1538 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 >Feature sequence0960 1819 428 gene locus_tag LOCUS_58790 gene chlN 1819 428 CDS product light-independent protochlorophyllide reductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH2 protein_id gnl|my_center|LOCUS_58790 1920 2188 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tccaagccatcgaggccatcatc >Feature sequence0961 1464 2054 gene locus_tag LOCUS_58800 1464 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 >Feature sequence0962 1664 363 gene locus_tag LOCUS_58810 1664 363 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265553.1 protein_id gnl|my_center|LOCUS_58810 >Feature sequence0963 >Feature sequence0964 >Feature sequence0965 1910 711 gene locus_tag LOCUS_58820 gene nifS 1910 711 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056757.1 protein_id gnl|my_center|LOCUS_58820 >Feature sequence0966 1635 1255 gene locus_tag LOCUS_58830 1635 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58830 1904 1632 gene locus_tag LOCUS_58840 1904 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58840 >Feature sequence0967 1505 357 gene locus_tag LOCUS_58850 1505 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 >Feature sequence0968 >Feature sequence0969 >Feature sequence0970 646 335 gene locus_tag LOCUS_58860 646 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057985.1 protein_id gnl|my_center|LOCUS_58860 1983 850 gene locus_tag LOCUS_58870 1983 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58870 >Feature sequence0971 215 1888 gene locus_tag LOCUS_58880 215 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 >Feature sequence0972 441 1622 gene locus_tag LOCUS_58890 441 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 >Feature sequence0973 244 435 gene locus_tag LOCUS_58900 244 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 601 1839 gene locus_tag LOCUS_58910 601 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_58910 >Feature sequence0974 14 151 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtcttggggtctccccaagtagagcaact 1283 339 gene locus_tag LOCUS_58920 gene murI 1283 339 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM3 protein_id gnl|my_center|LOCUS_58920 1802 1347 gene locus_tag LOCUS_58930 1802 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 >Feature sequence0975 1087 527 gene locus_tag LOCUS_58940 1087 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 1172 1726 gene locus_tag LOCUS_58950 1172 1726 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056062.1 protein_id gnl|my_center|LOCUS_58950 >Feature sequence0976 631 194 gene locus_tag LOCUS_58960 631 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 1419 1544 gene locus_tag LOCUS_58970 1419 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 >Feature sequence0977 1011 877 gene locus_tag LOCUS_58980 1011 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 1124 999 gene locus_tag LOCUS_58990 1124 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 1292 1795 gene locus_tag LOCUS_59000 1292 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 >Feature sequence0978 701 850 gene locus_tag LOCUS_59010 701 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 >Feature sequence0979 925 224 gene locus_tag LOCUS_59020 925 224 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_59020 1389 1153 gene locus_tag LOCUS_59030 1389 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 1544 1984 gene locus_tag LOCUS_59040 1544 1984 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340579.1 protein_id gnl|my_center|LOCUS_59040 >Feature sequence0980 1929 391 gene locus_tag LOCUS_59050 1929 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 >Feature sequence0981 1771 1265 gene locus_tag LOCUS_59060 1771 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057876.1 protein_id gnl|my_center|LOCUS_59060 >Feature sequence0982 530 1621 gene locus_tag LOCUS_59070 530 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 >Feature sequence0983 1092 1298 gene locus_tag LOCUS_59080 1092 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 1964 1269 gene locus_tag LOCUS_59090 1964 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 >Feature sequence0984 293 1105 gene locus_tag LOCUS_59100 293 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 >Feature sequence0985 1755 100 gene locus_tag LOCUS_59110 1755 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 >Feature sequence0986 824 1126 gene locus_tag LOCUS_59120 824 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 >Feature sequence0987 503 240 gene locus_tag LOCUS_59130 503 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058048.1 protein_id gnl|my_center|LOCUS_59130 1223 597 gene locus_tag LOCUS_59140 gene pth 1223 597 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ45 protein_id gnl|my_center|LOCUS_59140 1605 1321 gene locus_tag LOCUS_59150 gene tatA 1605 1321 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ44 protein_id gnl|my_center|LOCUS_59150 >Feature sequence0988 211 648 gene locus_tag LOCUS_59160 211 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 694 894 gene locus_tag LOCUS_59170 694 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 1683 1255 gene locus_tag LOCUS_59180 1683 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405426.1 protein_id gnl|my_center|LOCUS_59180 >Feature sequence0989 477 824 gene locus_tag LOCUS_59190 477 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59190 1752 988 gene locus_tag LOCUS_59200 1752 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_59200 >Feature sequence0990 692 96 gene locus_tag LOCUS_59210 692 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 1256 765 gene locus_tag LOCUS_59220 1256 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 1689 1862 gene locus_tag LOCUS_59230 1689 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 >Feature sequence0991 506 1246 gene locus_tag LOCUS_59240 506 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59240 1272 1517 gene locus_tag LOCUS_59250 1272 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 >Feature sequence0992 404 168 gene locus_tag LOCUS_59260 404 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 1126 899 gene locus_tag LOCUS_59270 1126 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140944.1 protein_id gnl|my_center|LOCUS_59270 >Feature sequence0993 >Feature sequence0994 447 184 gene locus_tag LOCUS_59280 447 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59280 1317 778 gene locus_tag LOCUS_59290 1317 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59290 1671 1327 gene locus_tag LOCUS_59300 1671 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59300 >Feature sequence0995 329 1099 gene locus_tag LOCUS_59310 329 1099 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057967.1 protein_id gnl|my_center|LOCUS_59310 >Feature sequence0996 719 1837 gene locus_tag LOCUS_59320 719 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 >Feature sequence0997 246 1076 gene locus_tag LOCUS_59330 gene map 246 1076 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ4 protein_id gnl|my_center|LOCUS_59330 1418 1852 gene locus_tag LOCUS_59340 1418 1852 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018151.1 protein_id gnl|my_center|LOCUS_59340 >Feature sequence0998 609 1673 gene locus_tag LOCUS_59350 609 1673 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889292.1 protein_id gnl|my_center|LOCUS_59350 >Feature sequence0999 1764 535 gene locus_tag LOCUS_59360 1764 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 >Feature sequence1000 1468 425 gene locus_tag LOCUS_59370 gene fmt 1468 425 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS1 protein_id gnl|my_center|LOCUS_59370 >Feature sequence1001 340 459 gene locus_tag LOCUS_59380 340 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 470 1441 gene locus_tag LOCUS_59390 470 1441 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083759.1 protein_id gnl|my_center|LOCUS_59390 >Feature sequence1002 1231 479 gene locus_tag LOCUS_59400 1231 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59400 >Feature sequence1003 >Feature sequence1004 230 1873 gene locus_tag LOCUS_59410 230 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 >Feature sequence1005 >Feature sequence1006 712 65 gene locus_tag LOCUS_59420 712 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 1602 886 gene locus_tag LOCUS_59430 1602 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59430 >Feature sequence1007 259 459 gene locus_tag LOCUS_59440 259 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59440 456 860 gene locus_tag LOCUS_59450 456 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 >Feature sequence1008 1679 462 gene locus_tag LOCUS_59460 1679 462 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143013.1 protein_id gnl|my_center|LOCUS_59460 >Feature sequence1009 <1885 289 gene locus_tag LOCUS_59470 <1885 289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338725.1:hemolysin >Feature sequence1010 >Feature sequence1011 >Feature sequence1012 1496 1005 gene locus_tag LOCUS_59480 1496 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 >Feature sequence1013 363 136 gene locus_tag LOCUS_59490 363 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 1817 540 gene locus_tag LOCUS_59500 gene argD 1817 540 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59322 protein_id gnl|my_center|LOCUS_59500 >Feature sequence1014 >Feature sequence1015 <1 1087 gene locus_tag LOCUS_59510 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004544542.1:two-component system sensor kinase >Feature sequence1016 518 703 gene locus_tag LOCUS_59520 518 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 716 1615 gene locus_tag LOCUS_59530 716 1615 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681897.1 protein_id gnl|my_center|LOCUS_59530 >Feature sequence1017 48 491 gene locus_tag LOCUS_59540 48 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 1554 715 gene locus_tag LOCUS_59550 1554 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142412.1 protein_id gnl|my_center|LOCUS_59550 >Feature sequence1018 310 843 gene locus_tag LOCUS_59560 310 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59560 749 1210 gene locus_tag LOCUS_59570 749 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59570 1526 1347 gene locus_tag LOCUS_59580 1526 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 1673 1551 gene locus_tag LOCUS_59590 1673 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59590 >Feature sequence1019 489 1823 gene locus_tag LOCUS_59600 489 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 >Feature sequence1020 1506 544 gene locus_tag LOCUS_59610 gene tnp 1506 544 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973848.1 protein_id gnl|my_center|LOCUS_59610 >Feature sequence1021 >Feature sequence1022 >Feature sequence1023 95 292 gene locus_tag LOCUS_59620 gene rpmI 95 292 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9L2 protein_id gnl|my_center|LOCUS_59620 483 833 gene locus_tag LOCUS_59630 gene rplT 483 833 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH02 protein_id gnl|my_center|LOCUS_59630 >Feature sequence1024 1337 81 gene locus_tag LOCUS_59640 1337 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 >Feature sequence1025 >Feature sequence1026 >Feature sequence1027 1432 581 gene locus_tag LOCUS_59650 1432 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 >Feature sequence1028 88 1584 gene locus_tag LOCUS_59660 88 1584 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 protein_id gnl|my_center|LOCUS_59660 >Feature sequence1029 >Feature sequence1030 <1817 269 gene locus_tag LOCUS_59670 <1817 269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289076.1:glycosyl transferase family 2 >Feature sequence1031 <1 1563 gene locus_tag LOCUS_59680 <1 1563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037121.1:sensor histidine kinase >Feature sequence1032 947 390 gene locus_tag LOCUS_59690 947 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 >Feature sequence1033 687 262 gene locus_tag LOCUS_59700 687 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 880 1551 gene locus_tag LOCUS_59710 880 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141964.1 protein_id gnl|my_center|LOCUS_59710 >Feature sequence1034 383 1447 gene locus_tag LOCUS_59720 gene mnmA 383 1447 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM0 protein_id gnl|my_center|LOCUS_59720 >Feature sequence1035 436 639 gene locus_tag LOCUS_59730 436 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 730 1368 gene locus_tag LOCUS_59740 730 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 >Feature sequence1036 178 1692 gene locus_tag LOCUS_59750 178 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 >Feature sequence1037 >Feature sequence1038 <1784 227 gene locus_tag LOCUS_59760 <1784 227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002378512.1:glycosyl transferase family 2 >Feature sequence1039 840 1583 gene locus_tag LOCUS_59770 840 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59770 >Feature sequence1040 1728 283 gene locus_tag LOCUS_59780 gene recQ 1728 283 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056643.1 protein_id gnl|my_center|LOCUS_59780 >Feature sequence1041 >Feature sequence1042 149 66 gene locus_tag LOCUS_t00730 149 66 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 345 274 gene locus_tag LOCUS_t00740 345 274 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 543 469 gene locus_tag LOCUS_t00750 543 469 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 796 715 gene locus_tag LOCUS_t00760 796 715 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 991 920 gene locus_tag LOCUS_t00770 991 920 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1437 1355 gene locus_tag LOCUS_t00780 1437 1355 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1632 1560 gene locus_tag LOCUS_t00790 1632 1560 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1043 >Feature sequence1044 1419 94 gene locus_tag LOCUS_59790 1419 94 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_59790 >Feature sequence1045 1435 299 gene locus_tag LOCUS_59800 gene recF 1435 299 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG79 protein_id gnl|my_center|LOCUS_59800 >Feature sequence1046 1154 60 gene locus_tag LOCUS_59810 1154 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59810 >Feature sequence1047 629 327 gene locus_tag LOCUS_59820 629 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056554.1 protein_id gnl|my_center|LOCUS_59820 1206 985 gene locus_tag LOCUS_59830 1206 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 >Feature sequence1048 >Feature sequence1049 >Feature sequence1050 >Feature sequence1051 >Feature sequence1052 1284 232 gene locus_tag LOCUS_59840 1284 232 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057733.1 protein_id gnl|my_center|LOCUS_59840 >Feature sequence1053 576 1367 gene locus_tag LOCUS_59850 576 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59850 >Feature sequence1054 >Feature sequence1055 869 1660 gene locus_tag LOCUS_59860 869 1660 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_59860 >Feature sequence1056 8 933 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcaatgagcataaatccctatgagggattgaaac 946 1657 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcaatgagcataaatccctatgagggattgaaac >Feature sequence1057 170 823 gene locus_tag LOCUS_59870 170 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59870 935 1135 gene locus_tag LOCUS_59880 935 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59880 >Feature sequence1058 1176 97 gene locus_tag LOCUS_59890 gene acsF1 1176 97 CDS product magnesium-protoporphyrin IX monomethyl ester [oxidative] cyclase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ05 protein_id gnl|my_center|LOCUS_59890 >Feature sequence1059 833 309 gene locus_tag LOCUS_59900 833 309 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530563.1 protein_id gnl|my_center|LOCUS_59900 1120 824 gene locus_tag LOCUS_59910 1120 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143463.1 protein_id gnl|my_center|LOCUS_59910 >Feature sequence1060 >Feature sequence1061 500 27 gene locus_tag LOCUS_59920 500 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 >Feature sequence1062 1122 565 gene locus_tag LOCUS_59930 1122 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59930 >Feature sequence1063 >Feature sequence1064 >Feature sequence1065 >Feature sequence1066 1151 228 gene locus_tag LOCUS_59940 1151 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 >Feature sequence1067 1351 452 gene locus_tag LOCUS_59950 1351 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59950 >Feature sequence1068 349 1338 gene locus_tag LOCUS_59960 349 1338 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058018.1 protein_id gnl|my_center|LOCUS_59960 >Feature sequence1069 1473 178 gene locus_tag LOCUS_59970 1473 178 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887226.1 protein_id gnl|my_center|LOCUS_59970 >Feature sequence1070 492 43 gene locus_tag LOCUS_59980 492 43 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_59980 504 1298 gene locus_tag LOCUS_59990 504 1298 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058216.1 protein_id gnl|my_center|LOCUS_59990 >Feature sequence1071 1366 146 gene locus_tag LOCUS_60000 1366 146 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_60000 >Feature sequence1072 862 272 gene locus_tag LOCUS_60010 862 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60010 916 1053 gene locus_tag LOCUS_60020 916 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60020 >Feature sequence1073 >Feature sequence1074 653 778 gene locus_tag LOCUS_60030 653 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60030 1147 1383 gene locus_tag LOCUS_60040 gene rpmB 1147 1383 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG62 protein_id gnl|my_center|LOCUS_60040 >Feature sequence1075 792 1379 gene locus_tag LOCUS_60050 792 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60050 >Feature sequence1076 352 606 gene locus_tag LOCUS_60060 352 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60060 614 832 gene locus_tag LOCUS_60070 614 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60070 >Feature sequence1077 347 171 gene locus_tag LOCUS_60080 347 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60080 544 822 gene locus_tag LOCUS_60090 544 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60090 1347 976 gene locus_tag LOCUS_60100 1347 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142519.1 protein_id gnl|my_center|LOCUS_60100 >Feature sequence1078 >Feature sequence1079 <1 781 gene locus_tag LOCUS_60110 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459437.1:transposase 799 1098 gene locus_tag LOCUS_60120 799 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60120 1140 1430 gene locus_tag LOCUS_60130 1140 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141164.1 protein_id gnl|my_center|LOCUS_60130 >Feature sequence1080 1106 108 gene locus_tag LOCUS_60140 1106 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60140 >Feature sequence1081 >Feature sequence1082 >Feature sequence1083 <1565 735 gene locus_tag LOCUS_60150 <1565 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338726.1:hemolysin expression modulating protein >Feature sequence1084 1399 218 gene locus_tag LOCUS_60160 1399 218 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932631.1 protein_id gnl|my_center|LOCUS_60160 >Feature sequence1085 642 124 gene locus_tag LOCUS_60170 642 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 1380 880 gene locus_tag LOCUS_60180 1380 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 >Feature sequence1086 >Feature sequence1087 946 578 gene locus_tag LOCUS_60190 946 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142925.1 protein_id gnl|my_center|LOCUS_60190 1291 950 gene locus_tag LOCUS_60200 1291 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142926.1 protein_id gnl|my_center|LOCUS_60200 >Feature sequence1088 >Feature sequence1089 >Feature sequence1090 172 1038 gene locus_tag LOCUS_60210 172 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 >Feature sequence1091 650 805 gene locus_tag LOCUS_60220 650 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60220 1171 1401 gene locus_tag LOCUS_60230 1171 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 >Feature sequence1092 1152 904 gene locus_tag LOCUS_60240 1152 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 >Feature sequence1093 >Feature sequence1094 1002 496 gene locus_tag LOCUS_60250 gene ppiB 1002 496 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP01 protein_id gnl|my_center|LOCUS_60250 >Feature sequence1095 203 1096 gene locus_tag LOCUS_60260 203 1096 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887225.1 protein_id gnl|my_center|LOCUS_60260 >Feature sequence1096 >Feature sequence1097 >Feature sequence1098 509 276 gene locus_tag LOCUS_60270 509 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60270 >Feature sequence1099 1078 695 gene locus_tag LOCUS_60280 1078 695 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057290.1 protein_id gnl|my_center|LOCUS_60280 >Feature sequence1100 176 1393 gene locus_tag LOCUS_60290 176 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404091.1 protein_id gnl|my_center|LOCUS_60290 >Feature sequence1101 210 1223 gene locus_tag LOCUS_60300 gene yocS 210 1223 CDS product putative sodium-dependent transporter YocS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34524 protein_id gnl|my_center|LOCUS_60300 >Feature sequence1102 392 249 gene locus_tag LOCUS_60310 392 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60310 1054 1278 gene locus_tag LOCUS_60320 1054 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60320 >Feature sequence1103 >Feature sequence1104 >Feature sequence1105 >Feature sequence1106 >Feature sequence1107 >Feature sequence1108 >Feature sequence1109 <1440 872 gene locus_tag LOCUS_60330 <1440 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938022.1:PAS domain-containing sensor histidine kinase >Feature sequence1110 302 826 gene locus_tag LOCUS_60340 302 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60340 >Feature sequence1111 608 1159 gene locus_tag LOCUS_60350 608 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60350 >Feature sequence1112 969 382 gene locus_tag LOCUS_60360 969 382 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 protein_id gnl|my_center|LOCUS_60360 >Feature sequence1113 797 372 gene locus_tag LOCUS_60370 797 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60370 >Feature sequence1114 1164 484 gene locus_tag LOCUS_60380 1164 484 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058278.1 protein_id gnl|my_center|LOCUS_60380 >Feature sequence1115 117 1322 gene locus_tag LOCUS_60390 117 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60390 >Feature sequence1116 1061 177 gene locus_tag LOCUS_60400 1061 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60400 >Feature sequence1117 >Feature sequence1118 >Feature sequence1119 772 407 gene locus_tag LOCUS_60410 772 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60410 >Feature sequence1120 1034 660 gene locus_tag LOCUS_60420 1034 660 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_60420 >Feature sequence1121 1109 918 gene locus_tag LOCUS_60430 1109 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60430 >Feature sequence1122 253 1152 gene locus_tag LOCUS_60440 253 1152 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 protein_id gnl|my_center|LOCUS_60440 >Feature sequence1123 141 974 gene locus_tag LOCUS_60450 141 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60450 >Feature sequence1124 >Feature sequence1125 468 1310 gene locus_tag LOCUS_60460 468 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941827.1 protein_id gnl|my_center|LOCUS_60460 >Feature sequence1126 >Feature sequence1127 374 1123 gene locus_tag LOCUS_60470 gene ycf23 374 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_60470 >Feature sequence1128 843 139 gene locus_tag LOCUS_60480 843 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058104.1 protein_id gnl|my_center|LOCUS_60480 1190 1354 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtcttggggtctccccaagt >Feature sequence1129 405 1004 gene locus_tag LOCUS_60490 405 1004 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_60490 >Feature sequence1130 654 842 gene locus_tag LOCUS_60500 654 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60500 >Feature sequence1131 467 1138 gene locus_tag LOCUS_60510 467 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60510 >Feature sequence1132 >Feature sequence1133 403 687 gene locus_tag LOCUS_60520 403 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60520 >Feature sequence1134 >Feature sequence1135 >Feature sequence1136 327 551 gene locus_tag LOCUS_60530 327 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60530 723 1016 gene locus_tag LOCUS_60540 723 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60540 >Feature sequence1137 968 123 gene locus_tag LOCUS_60550 968 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60550 >Feature sequence1138 834 1127 gene locus_tag LOCUS_60560 834 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60560 >Feature sequence1139 805 521 gene locus_tag LOCUS_60570 805 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 >Feature sequence1140 407 336 gene locus_tag LOCUS_t00800 407 336 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1006 509 gene locus_tag LOCUS_60580 1006 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_60580 >Feature sequence1141 111 1007 gene locus_tag LOCUS_60590 gene hslO 111 1007 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIA2 protein_id gnl|my_center|LOCUS_60590 >Feature sequence1142 >Feature sequence1143 >Feature sequence1144 >Feature sequence1145 438 782 gene locus_tag LOCUS_60600 438 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60600 >Feature sequence1146 99 476 gene locus_tag LOCUS_60610 99 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60610 522 971 gene locus_tag LOCUS_60620 522 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60620 >Feature sequence1147 >Feature sequence1148 94 177 gene locus_tag LOCUS_t00810 94 177 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 546 629 gene locus_tag LOCUS_t00820 546 629 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 705 778 gene locus_tag LOCUS_t00830 705 778 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1149 993 844 gene locus_tag LOCUS_60630 993 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60630 >Feature sequence1150 729 250 gene locus_tag LOCUS_60640 729 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60640 >Feature sequence1151 1157 255 gene locus_tag LOCUS_60650 1157 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 >Feature sequence1152 503 261 gene locus_tag LOCUS_60660 503 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 >Feature sequence1153 1261 419 gene locus_tag LOCUS_60670 1261 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60670 >Feature sequence1154 235 507 gene locus_tag LOCUS_60680 235 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60680 >Feature sequence1155 355 741 gene locus_tag LOCUS_60690 355 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60690 779 1150 gene locus_tag LOCUS_60700 779 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60700 >Feature sequence1156 1017 223 gene locus_tag LOCUS_60710 gene trpA 1017 223 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLN9 protein_id gnl|my_center|LOCUS_60710 >Feature sequence1157 >Feature sequence1158 584 243 gene locus_tag LOCUS_60720 584 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60720 >Feature sequence1159 851 1042 gene locus_tag LOCUS_60730 851 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60730 >Feature sequence1160 407 270 gene locus_tag LOCUS_60740 407 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60740 833 711 gene locus_tag LOCUS_60750 833 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60750 >Feature sequence1161 616 816 gene locus_tag LOCUS_60760 616 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60760 >Feature sequence1162 >Feature sequence1163 >Feature sequence1164 233 336 gene locus_tag LOCUS_r00010 233 336 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence1165 >Feature sequence1166 >Feature sequence1167 >Feature sequence1168 >Feature sequence1169 >Feature sequence1170 >Feature sequence1171 >Feature sequence1172 >Feature sequence1173 <1 125 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttggggtctccccaagtagagcaa 513 94 gene locus_tag LOCUS_60770 513 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60770 >Feature sequence1174 495 920 gene locus_tag LOCUS_60780 gene gloA 495 920 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0T3 protein_id gnl|my_center|LOCUS_60780 >Feature sequence1175 >Feature sequence1176 >Feature sequence1177 868 41 gene locus_tag LOCUS_60790 gene dapB 868 41 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH2 protein_id gnl|my_center|LOCUS_60790 >Feature sequence1178 1078 98 gene locus_tag LOCUS_60800 1078 98 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140505.1 protein_id gnl|my_center|LOCUS_60800 >Feature sequence1179 217 86 gene locus_tag LOCUS_60810 217 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60810 478 245 gene locus_tag LOCUS_60820 478 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_60820 637 515 gene locus_tag LOCUS_60830 637 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60830 >Feature sequence1180 >Feature sequence1181 470 204 gene locus_tag LOCUS_60840 470 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 641 1021 gene locus_tag LOCUS_60850 641 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60850 >Feature sequence1182 322 537 gene locus_tag LOCUS_60860 322 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60860 >Feature sequence1183 >Feature sequence1184 696 127 gene locus_tag LOCUS_60870 696 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60870 1017 784 gene locus_tag LOCUS_60880 1017 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60880 >Feature sequence1185 136 464 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccactaattcaacttccgaagaagcgtaaag >Feature sequence1186 >Feature sequence1187 200 30 gene locus_tag LOCUS_60890 200 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60890 >Feature sequence1188 >Feature sequence1189 1103 489 gene locus_tag LOCUS_60900 1103 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 >Feature sequence1190 <1 728 gene locus_tag LOCUS_60910 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003120048.1:two-component sensor histidine kinase >Feature sequence1191 2 139 gene locus_tag LOCUS_60920 2 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60920 >Feature sequence1192 >Feature sequence1193 >Feature sequence1194 >Feature sequence1195 121 312 gene locus_tag LOCUS_60930 121 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60930 778 545 gene locus_tag LOCUS_60940 778 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60940 >Feature sequence1196 816 664 gene locus_tag LOCUS_60950 816 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60950 >Feature sequence1197 >Feature sequence1198 >Feature sequence1199 234 1046 gene locus_tag LOCUS_60960 234 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60960 >Feature sequence1200 779 597 gene locus_tag LOCUS_60970 779 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60970 >Feature sequence1201 >Feature sequence1202 689 528 gene locus_tag LOCUS_60980 689 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 >Feature sequence1203 695 387 gene locus_tag LOCUS_60990 695 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 >Feature sequence1204 >Feature sequence1205 151 411 gene locus_tag LOCUS_61000 151 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61000 >Feature sequence1206 >Feature sequence1207 325 996 gene locus_tag LOCUS_61010 325 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61010 >Feature sequence1208 648 295 gene locus_tag LOCUS_61020 648 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_61020 >Feature sequence1209 314 931 gene locus_tag LOCUS_61030 314 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61030 >Feature sequence1210 <1 664 gene locus_tag LOCUS_61040 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257962.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence1211 560 294 gene locus_tag LOCUS_61050 560 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61050 >Feature sequence1212 >Feature sequence1213 931 560 gene locus_tag LOCUS_61060 931 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61060 >Feature sequence1214 164 562 gene locus_tag LOCUS_61070 164 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61070 626 967 gene locus_tag LOCUS_61080 626 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 >Feature sequence1215 >Feature sequence1216 294 857 gene locus_tag LOCUS_61090 294 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61090 >Feature sequence1217 679 825 gene locus_tag LOCUS_61100 679 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61100 >Feature sequence1218 >Feature sequence1219 166 32 gene locus_tag LOCUS_61110 166 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61110 612 436 gene locus_tag LOCUS_61120 612 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61120 >Feature sequence1220 418 119 gene locus_tag LOCUS_61130 418 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61130 949 686 gene locus_tag LOCUS_61140 949 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61140 >Feature sequence1221 >Feature sequence1222 >Feature sequence1223 799 587 gene locus_tag LOCUS_61150 799 587 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 protein_id gnl|my_center|LOCUS_61150 >Feature sequence1224 >Feature sequence1225 >Feature sequence1226 7 153 gene locus_tag LOCUS_61160 7 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61160 >Feature sequence1227 >Feature sequence1228 >Feature sequence1229 >Feature sequence1230 >Feature sequence1231 391 696 gene locus_tag LOCUS_61170 391 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61170 860 702 gene locus_tag LOCUS_61180 860 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61180 >Feature sequence1232 >Feature sequence1233 157 888 gene locus_tag LOCUS_61190 157 888 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250480.1 protein_id gnl|my_center|LOCUS_61190 >Feature sequence1234 282 443 gene locus_tag LOCUS_61200 282 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 492 698 gene locus_tag LOCUS_61210 492 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 >Feature sequence1235 435 713 gene locus_tag LOCUS_61220 435 713 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_61220