>Feature sequence001 148 76 gene locus_tag LOCUS_t00010 148 76 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 577 197 gene locus_tag LOCUS_00010 gene cytM 577 197 CDS product cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058261.1 protein_id gnl|my_center|LOCUS_00010 944 1381 gene locus_tag LOCUS_00020 944 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1414 3117 gene locus_tag LOCUS_00030 1414 3117 CDS product putative peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702957.1 protein_id gnl|my_center|LOCUS_00030 3316 3798 gene locus_tag LOCUS_00040 3316 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4596 5042 gene locus_tag LOCUS_00050 4596 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5149 5475 gene locus_tag LOCUS_00060 5149 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534939.1 protein_id gnl|my_center|LOCUS_00060 6210 5779 gene locus_tag LOCUS_00070 6210 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057805.1 protein_id gnl|my_center|LOCUS_00070 6968 6513 gene locus_tag LOCUS_00080 6968 6513 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_00080 8011 7061 gene locus_tag LOCUS_00090 gene murK 8011 7061 CDS product N-acetylmuramic acid/N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ML3 protein_id gnl|my_center|LOCUS_00090 9287 8013 gene locus_tag LOCUS_00100 9287 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9366 12545 gene locus_tag LOCUS_00110 9366 12545 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056145.1 protein_id gnl|my_center|LOCUS_00110 13253 12495 gene locus_tag LOCUS_00120 13253 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14059 13244 gene locus_tag LOCUS_00130 14059 13244 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_00130 14741 14421 gene locus_tag LOCUS_00140 14741 14421 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946406.1 protein_id gnl|my_center|LOCUS_00140 15442 17925 gene locus_tag LOCUS_00150 gene arnT 15442 17925 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124217.1 protein_id gnl|my_center|LOCUS_00150 18817 17933 gene locus_tag LOCUS_00160 18817 17933 CDS product 2-hydroxy-6-oxohepta-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 protein_id gnl|my_center|LOCUS_00160 19047 19766 gene locus_tag LOCUS_00170 gene ho1 19047 19766 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056220.1 protein_id gnl|my_center|LOCUS_00170 20184 19954 gene locus_tag LOCUS_00180 20184 19954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20597 21994 gene locus_tag LOCUS_00190 20597 21994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22068 23429 gene locus_tag LOCUS_00200 22068 23429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24050 23430 gene locus_tag LOCUS_00210 gene lipA 24050 23430 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 protein_id gnl|my_center|LOCUS_00210 24986 24081 gene locus_tag LOCUS_00220 24986 24081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25415 26287 gene locus_tag LOCUS_00230 25415 26287 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123656.1 protein_id gnl|my_center|LOCUS_00230 27293 26292 gene locus_tag LOCUS_00240 27293 26292 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_00240 28260 27301 gene locus_tag LOCUS_00250 28260 27301 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_00250 28928 30106 gene locus_tag LOCUS_00260 28928 30106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30288 31976 gene locus_tag LOCUS_00270 gene mutL 30288 31976 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058297.1 protein_id gnl|my_center|LOCUS_00270 32034 32435 gene locus_tag LOCUS_00280 32034 32435 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_00280 32787 34508 gene locus_tag LOCUS_00290 32787 34508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 35884 34595 gene locus_tag LOCUS_00300 gene hemA 35884 34595 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI53 protein_id gnl|my_center|LOCUS_00300 37056 36019 gene locus_tag LOCUS_00310 37056 36019 CDS product D-fructose 1,6-bisphosphatase class 2/sedoheptulose 1,7-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE9 protein_id gnl|my_center|LOCUS_00310 38063 39343 gene locus_tag LOCUS_00320 38063 39343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 39728 40240 gene locus_tag LOCUS_00330 39728 40240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 40493 42169 gene locus_tag LOCUS_00340 gene ribA 40493 42169 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI64 protein_id gnl|my_center|LOCUS_00340 46286 42255 gene locus_tag LOCUS_00350 46286 42255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 49765 46385 gene locus_tag LOCUS_00360 49765 46385 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056203.1 protein_id gnl|my_center|LOCUS_00360 50514 49987 gene locus_tag LOCUS_00370 gene cheW 50514 49987 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056202.1 protein_id gnl|my_center|LOCUS_00370 50904 50530 gene locus_tag LOCUS_00380 50904 50530 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_00380 52387 51158 gene locus_tag LOCUS_00390 52387 51158 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056200.1 protein_id gnl|my_center|LOCUS_00390 52534 54375 gene locus_tag LOCUS_00400 52534 54375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 55146 54352 gene locus_tag LOCUS_00410 55146 54352 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_00410 55380 56249 gene locus_tag LOCUS_00420 55380 56249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 56610 56350 gene locus_tag LOCUS_00430 56610 56350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 56670 57653 gene locus_tag LOCUS_00440 gene accA 56670 57653 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB6 protein_id gnl|my_center|LOCUS_00440 57874 58599 gene locus_tag LOCUS_00450 57874 58599 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057150.1 protein_id gnl|my_center|LOCUS_00450 58652 59356 gene locus_tag LOCUS_00460 gene folE 58652 59356 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB8 protein_id gnl|my_center|LOCUS_00460 60699 59560 gene locus_tag LOCUS_00470 gene serC-2 60699 59560 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFA1 protein_id gnl|my_center|LOCUS_00470 61055 62488 gene locus_tag LOCUS_00480 61055 62488 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140391.1 protein_id gnl|my_center|LOCUS_00480 62485 63063 gene locus_tag LOCUS_00490 62485 63063 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHZ6 protein_id gnl|my_center|LOCUS_00490 63488 63150 gene locus_tag LOCUS_00500 gene glnB 63488 63150 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 protein_id gnl|my_center|LOCUS_00500 63856 65694 gene locus_tag LOCUS_00510 gene ilvG 63856 65694 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD1 protein_id gnl|my_center|LOCUS_00510 66775 65780 gene locus_tag LOCUS_00520 66775 65780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 68191 67259 gene locus_tag LOCUS_00530 68191 67259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 68848 70236 gene locus_tag LOCUS_00540 gene thiC 68848 70236 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLZ2 protein_id gnl|my_center|LOCUS_00540 70499 70651 gene locus_tag LOCUS_00550 70499 70651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 71210 70758 gene locus_tag LOCUS_00560 71210 70758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 >Feature sequence002 779 369 gene locus_tag LOCUS_00570 779 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143307.1 protein_id gnl|my_center|LOCUS_00570 1987 878 gene locus_tag LOCUS_00580 gene prfA 1987 878 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMG9 protein_id gnl|my_center|LOCUS_00580 2409 2173 gene locus_tag LOCUS_00590 gene rpmE 2409 2173 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9Y9 protein_id gnl|my_center|LOCUS_00590 2924 2514 gene locus_tag LOCUS_00600 gene rpsI 2924 2514 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND17 protein_id gnl|my_center|LOCUS_00600 3385 2927 gene locus_tag LOCUS_00610 gene rplM 3385 2927 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK8 protein_id gnl|my_center|LOCUS_00610 4244 3405 gene locus_tag LOCUS_00620 gene truA 4244 3405 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM6 protein_id gnl|my_center|LOCUS_00620 4667 4317 gene locus_tag LOCUS_00630 gene rplQ 4667 4317 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK9 protein_id gnl|my_center|LOCUS_00630 5682 4735 gene locus_tag LOCUS_00640 gene rpoA 5682 4735 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFF5 protein_id gnl|my_center|LOCUS_00640 6203 5811 gene locus_tag LOCUS_00650 gene rpsK 6203 5811 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59379 protein_id gnl|my_center|LOCUS_00650 6682 6302 gene locus_tag LOCUS_00660 gene rpsM 6682 6302 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML1 protein_id gnl|my_center|LOCUS_00660 7407 7183 gene locus_tag LOCUS_00670 gene infA 7407 7183 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML3 protein_id gnl|my_center|LOCUS_00670 8204 7647 gene locus_tag LOCUS_00680 gene adk 8204 7647 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWT7 protein_id gnl|my_center|LOCUS_00680 9513 8209 gene locus_tag LOCUS_00690 gene secY 9513 8209 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML5 protein_id gnl|my_center|LOCUS_00690 10042 9554 gene locus_tag LOCUS_00700 gene rplO 10042 9554 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML6 protein_id gnl|my_center|LOCUS_00700 10614 10075 gene locus_tag LOCUS_00710 gene rpsE 10614 10075 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59126 protein_id gnl|my_center|LOCUS_00710 11089 10727 gene locus_tag LOCUS_00720 gene rplR 11089 10727 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML7 protein_id gnl|my_center|LOCUS_00720 11632 11093 gene locus_tag LOCUS_00730 gene rplF 11632 11093 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML8 protein_id gnl|my_center|LOCUS_00730 12080 11679 gene locus_tag LOCUS_00740 gene rpsH 12080 11679 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML9 protein_id gnl|my_center|LOCUS_00740 12650 12105 gene locus_tag LOCUS_00750 gene rplE 12650 12105 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM0 protein_id gnl|my_center|LOCUS_00750 13112 12759 gene locus_tag LOCUS_00760 gene rplX 13112 12759 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM1 protein_id gnl|my_center|LOCUS_00760 13480 13112 gene locus_tag LOCUS_00770 gene rplN 13480 13112 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM2 protein_id gnl|my_center|LOCUS_00770 14139 13891 gene locus_tag LOCUS_00780 gene rpmC 14139 13891 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM4 protein_id gnl|my_center|LOCUS_00780 14579 14154 gene locus_tag LOCUS_00790 gene rplP 14579 14154 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM5 protein_id gnl|my_center|LOCUS_00790 15346 14618 gene locus_tag LOCUS_00800 gene rpsC 15346 14618 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59187 protein_id gnl|my_center|LOCUS_00800 15751 15395 gene locus_tag LOCUS_00810 gene rplV 15751 15395 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM6 protein_id gnl|my_center|LOCUS_00810 16036 15758 gene locus_tag LOCUS_00820 gene rpsS 16036 15758 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM7 protein_id gnl|my_center|LOCUS_00820 16968 16105 gene locus_tag LOCUS_00830 gene rplB 16968 16105 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM8 protein_id gnl|my_center|LOCUS_00830 17339 17031 gene locus_tag LOCUS_00840 gene rplW 17339 17031 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM9 protein_id gnl|my_center|LOCUS_00840 17964 17332 gene locus_tag LOCUS_00850 gene rplD 17964 17332 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN0 protein_id gnl|my_center|LOCUS_00850 18672 17977 gene locus_tag LOCUS_00860 gene rplC 18672 17977 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN1 protein_id gnl|my_center|LOCUS_00860 19410 19886 gene locus_tag LOCUS_00870 gene ndhN 19410 19886 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJU2 protein_id gnl|my_center|LOCUS_00870 20472 20630 gene locus_tag LOCUS_00880 20472 20630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 20844 21239 gene locus_tag LOCUS_00890 20844 21239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701840.1 protein_id gnl|my_center|LOCUS_00890 21492 21914 gene locus_tag LOCUS_00900 21492 21914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 22751 21915 gene locus_tag LOCUS_00910 22751 21915 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 protein_id gnl|my_center|LOCUS_00910 24038 22758 gene locus_tag LOCUS_00920 gene ftsZ 24038 22758 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNW0 protein_id gnl|my_center|LOCUS_00920 25033 24221 gene locus_tag LOCUS_00930 25033 24221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055991.1 protein_id gnl|my_center|LOCUS_00930 25259 26608 gene locus_tag LOCUS_00940 25259 26608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 27364 32505 gene locus_tag LOCUS_00950 27364 32505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 32705 33508 gene locus_tag LOCUS_00960 32705 33508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056104.1 protein_id gnl|my_center|LOCUS_00960 33744 34370 gene locus_tag LOCUS_00970 33744 34370 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056907.1 protein_id gnl|my_center|LOCUS_00970 35062 34367 gene locus_tag LOCUS_00980 35062 34367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056056.1 protein_id gnl|my_center|LOCUS_00980 36034 35165 gene locus_tag LOCUS_00990 36034 35165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141545.1 protein_id gnl|my_center|LOCUS_00990 37533 36094 gene locus_tag LOCUS_01000 37533 36094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 38859 37771 gene locus_tag LOCUS_01010 38859 37771 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEB1 protein_id gnl|my_center|LOCUS_01010 39176 40531 gene locus_tag LOCUS_01020 gene murA 39176 40531 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS7 protein_id gnl|my_center|LOCUS_01020 40663 41541 gene locus_tag LOCUS_01030 40663 41541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 protein_id gnl|my_center|LOCUS_01030 41520 41601 gene locus_tag LOCUS_t00020 41520 41601 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 42810 41620 gene locus_tag LOCUS_01040 42810 41620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 44365 42812 gene locus_tag LOCUS_01050 gene crtH 44365 42812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 protein_id gnl|my_center|LOCUS_01050 44453 45022 gene locus_tag LOCUS_01060 44453 45022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 45556 45029 gene locus_tag LOCUS_01070 45556 45029 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 protein_id gnl|my_center|LOCUS_01070 45850 46620 gene locus_tag LOCUS_01080 45850 46620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143602.1 protein_id gnl|my_center|LOCUS_01080 46704 47600 gene locus_tag LOCUS_01090 gene prmC 46704 47600 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHV7 protein_id gnl|my_center|LOCUS_01090 47597 48214 gene locus_tag LOCUS_01100 47597 48214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057957.1 protein_id gnl|my_center|LOCUS_01100 48223 49182 gene locus_tag LOCUS_01110 48223 49182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 49514 51424 gene locus_tag LOCUS_01120 gene ftsH 49514 51424 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG5 protein_id gnl|my_center|LOCUS_01120 51654 52967 gene locus_tag LOCUS_01130 51654 52967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058239.1 protein_id gnl|my_center|LOCUS_01130 54176 53055 gene locus_tag LOCUS_01140 54176 53055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141501.1 protein_id gnl|my_center|LOCUS_01140 54627 54406 gene locus_tag LOCUS_01150 54627 54406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 54999 54778 gene locus_tag LOCUS_01160 54999 54778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 55910 55506 gene locus_tag LOCUS_01170 55910 55506 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056952.1 protein_id gnl|my_center|LOCUS_01170 56775 56050 gene locus_tag LOCUS_01180 gene ycf63 56775 56050 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057285.1 protein_id gnl|my_center|LOCUS_01180 57071 57310 gene locus_tag LOCUS_01190 57071 57310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 58014 57403 gene locus_tag LOCUS_01200 58014 57403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 >Feature sequence003 <1 1041 gene locus_tag LOCUS_01210 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057605.1:polysaccharide export protein 1064 3304 gene locus_tag LOCUS_01220 1064 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057041.1 protein_id gnl|my_center|LOCUS_01220 3859 4647 gene locus_tag LOCUS_01230 3859 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 4889 6574 gene locus_tag LOCUS_01240 4889 6574 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142407.1 protein_id gnl|my_center|LOCUS_01240 7146 6592 gene locus_tag LOCUS_01250 7146 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 7376 7167 gene locus_tag LOCUS_01260 7376 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 7375 7728 gene locus_tag LOCUS_01270 7375 7728 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932868.1 protein_id gnl|my_center|LOCUS_01270 9439 7826 gene locus_tag LOCUS_01280 9439 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 10221 13562 gene locus_tag LOCUS_01290 10221 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 13656 16487 gene locus_tag LOCUS_01300 13656 16487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 16531 17949 gene locus_tag LOCUS_01310 16531 17949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 18001 19941 gene locus_tag LOCUS_01320 18001 19941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 20138 21904 gene locus_tag LOCUS_01330 20138 21904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 22122 22550 gene locus_tag LOCUS_01340 22122 22550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 22715 23122 gene locus_tag LOCUS_01350 gene rplU 22715 23122 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMF1 protein_id gnl|my_center|LOCUS_01350 23164 23451 gene locus_tag LOCUS_01360 gene rpmA 23164 23451 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NME2 protein_id gnl|my_center|LOCUS_01360 23807 24283 gene locus_tag LOCUS_01370 23807 24283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 24976 24284 gene locus_tag LOCUS_01380 24976 24284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 25119 25322 gene locus_tag LOCUS_01390 25119 25322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 25294 26754 gene locus_tag LOCUS_01400 25294 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 28014 26815 gene locus_tag LOCUS_01410 gene moeB 28014 26815 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_01410 28738 29232 gene locus_tag LOCUS_01420 28738 29232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_01420 29295 29648 gene locus_tag LOCUS_01430 29295 29648 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144135.1 protein_id gnl|my_center|LOCUS_01430 29802 30515 gene locus_tag LOCUS_01440 gene pyrF 29802 30515 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLT3 protein_id gnl|my_center|LOCUS_01440 30915 31160 gene locus_tag LOCUS_01450 30915 31160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 31225 31758 gene locus_tag LOCUS_01460 31225 31758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 32423 32115 gene locus_tag LOCUS_01470 32423 32115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 32547 34094 gene locus_tag LOCUS_01480 32547 34094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 34422 37043 gene locus_tag LOCUS_01490 34422 37043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 38289 37216 gene locus_tag LOCUS_01500 38289 37216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 39348 38362 gene locus_tag LOCUS_01510 39348 38362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 39821 39456 gene locus_tag LOCUS_01520 39821 39456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 40616 39900 gene locus_tag LOCUS_01530 40616 39900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 40907 40647 gene locus_tag LOCUS_01540 40907 40647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 41147 41485 gene locus_tag LOCUS_01550 41147 41485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 41487 42170 gene locus_tag LOCUS_01560 41487 42170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 42240 42437 gene locus_tag LOCUS_01570 42240 42437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 42444 43727 gene locus_tag LOCUS_01580 42444 43727 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZI7 protein_id gnl|my_center|LOCUS_01580 43777 44832 gene locus_tag LOCUS_01590 43777 44832 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124924.1 protein_id gnl|my_center|LOCUS_01590 45219 44905 gene locus_tag LOCUS_01600 45219 44905 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_01600 45511 46557 gene locus_tag LOCUS_01610 gene ribF 45511 46557 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM6 protein_id gnl|my_center|LOCUS_01610 46595 47503 gene locus_tag LOCUS_01620 46595 47503 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_01620 49504 47504 gene locus_tag LOCUS_01630 gene uvrB 49504 47504 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC6 protein_id gnl|my_center|LOCUS_01630 49600 50472 gene locus_tag LOCUS_01640 49600 50472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_01640 51427 50639 gene locus_tag LOCUS_01650 51427 50639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 53273 51600 gene locus_tag LOCUS_01660 53273 51600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence004 3597 259 gene locus_tag LOCUS_01670 3597 259 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 protein_id gnl|my_center|LOCUS_01670 3943 4803 gene locus_tag LOCUS_01680 3943 4803 CDS product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_01680 5679 4924 gene locus_tag LOCUS_01690 5679 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 6356 5682 gene locus_tag LOCUS_01700 6356 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 6728 8275 gene locus_tag LOCUS_01710 6728 8275 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 protein_id gnl|my_center|LOCUS_01710 9413 14488 gene locus_tag LOCUS_01720 9413 14488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 15138 14950 gene locus_tag LOCUS_01730 15138 14950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 15611 16078 gene locus_tag LOCUS_01740 15611 16078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 18367 16115 gene locus_tag LOCUS_01750 18367 16115 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_01750 19961 18555 gene locus_tag LOCUS_01760 19961 18555 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528760.1 protein_id gnl|my_center|LOCUS_01760 20320 21540 gene locus_tag LOCUS_01770 gene pilT 20320 21540 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056402.1 protein_id gnl|my_center|LOCUS_01770 21718 22509 gene locus_tag LOCUS_01780 21718 22509 CDS product circadian oscillation regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056401.1 protein_id gnl|my_center|LOCUS_01780 24648 22780 gene locus_tag LOCUS_01790 24648 22780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 30224 24951 gene locus_tag LOCUS_01800 30224 24951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 31567 31178 gene locus_tag LOCUS_01810 31567 31178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 32097 38357 gene locus_tag LOCUS_01820 32097 38357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 38714 39070 gene locus_tag LOCUS_01830 38714 39070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 39456 40259 gene locus_tag LOCUS_01840 39456 40259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 41619 42167 gene locus_tag LOCUS_01850 41619 42167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 42181 44229 gene locus_tag LOCUS_01860 42181 44229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 44344 46167 gene locus_tag LOCUS_01870 44344 46167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056407.1 protein_id gnl|my_center|LOCUS_01870 46617 46231 gene locus_tag LOCUS_01880 gene trxM2 46617 46231 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH72 protein_id gnl|my_center|LOCUS_01880 47275 46808 gene locus_tag LOCUS_01890 47275 46808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_01890 47740 47282 gene locus_tag LOCUS_01900 47740 47282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 protein_id gnl|my_center|LOCUS_01900 48254 48523 gene locus_tag LOCUS_01910 48254 48523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 48815 49201 gene locus_tag LOCUS_01920 48815 49201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140108.1 protein_id gnl|my_center|LOCUS_01920 49715 49281 gene locus_tag LOCUS_01930 49715 49281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140148.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence005 1172 261 gene locus_tag LOCUS_01940 1172 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 2118 1342 gene locus_tag LOCUS_01950 2118 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 3187 2156 gene locus_tag LOCUS_01960 3187 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 4108 6009 gene locus_tag LOCUS_01970 4108 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 6186 7787 gene locus_tag LOCUS_01980 6186 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 7960 9762 gene locus_tag LOCUS_01990 7960 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 11285 10485 gene locus_tag LOCUS_02000 gene minD 11285 10485 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE2 protein_id gnl|my_center|LOCUS_02000 12280 11474 gene locus_tag LOCUS_02010 gene minC 12280 11474 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ40 protein_id gnl|my_center|LOCUS_02010 13689 12367 gene locus_tag LOCUS_02020 13689 12367 CDS product putative anthranilate synthase component I TrpE2/ Salicylate synthase MbtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702980.1 protein_id gnl|my_center|LOCUS_02020 15231 13906 gene locus_tag LOCUS_02030 15231 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058262.1 protein_id gnl|my_center|LOCUS_02030 15963 15283 gene locus_tag LOCUS_02040 15963 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 16663 16079 gene locus_tag LOCUS_02050 16663 16079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 18056 16749 gene locus_tag LOCUS_02060 18056 16749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 20053 18419 gene locus_tag LOCUS_02070 20053 18419 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_02070 20608 20141 gene locus_tag LOCUS_02080 20608 20141 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862466.1 protein_id gnl|my_center|LOCUS_02080 20693 21898 gene locus_tag LOCUS_02090 20693 21898 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 protein_id gnl|my_center|LOCUS_02090 23338 21932 gene locus_tag LOCUS_02100 23338 21932 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878099.1 protein_id gnl|my_center|LOCUS_02100 23613 24704 gene locus_tag LOCUS_02110 23613 24704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 25906 27183 gene locus_tag LOCUS_02120 gene ahcY 25906 27183 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC8 protein_id gnl|my_center|LOCUS_02120 27305 27922 gene locus_tag LOCUS_02130 27305 27922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057912.1 protein_id gnl|my_center|LOCUS_02130 28189 29622 gene locus_tag LOCUS_02140 28189 29622 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031501.1 protein_id gnl|my_center|LOCUS_02140 29834 30568 gene locus_tag LOCUS_02150 29834 30568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 31074 30637 gene locus_tag LOCUS_02160 31074 30637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 32060 31215 gene locus_tag LOCUS_02170 32060 31215 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058143.1 protein_id gnl|my_center|LOCUS_02170 33236 32400 gene locus_tag LOCUS_02180 33236 32400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 34000 35013 gene locus_tag LOCUS_02190 34000 35013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 37129 35177 gene locus_tag LOCUS_02200 37129 35177 CDS product glycogen debranching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143985.1 protein_id gnl|my_center|LOCUS_02200 37402 40959 gene locus_tag LOCUS_02210 37402 40959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 42387 40945 gene locus_tag LOCUS_02220 42387 40945 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056229.1 protein_id gnl|my_center|LOCUS_02220 42767 42450 gene locus_tag LOCUS_02230 42767 42450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 43203 44390 gene locus_tag LOCUS_02240 gene purK 43203 44390 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJG7 protein_id gnl|my_center|LOCUS_02240 44488 46332 gene locus_tag LOCUS_02250 44488 46332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 >Feature sequence006 148 480 gene locus_tag LOCUS_02260 148 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02260 782 1963 gene locus_tag LOCUS_02270 782 1963 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082727.1 protein_id gnl|my_center|LOCUS_02270 2415 2909 gene locus_tag LOCUS_02280 2415 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 3150 2920 gene locus_tag LOCUS_02290 3150 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 3403 3918 gene locus_tag LOCUS_02300 3403 3918 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707485.1 protein_id gnl|my_center|LOCUS_02300 4159 5535 gene locus_tag LOCUS_02310 4159 5535 CDS product chloride channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057316.1 protein_id gnl|my_center|LOCUS_02310 5651 6196 gene locus_tag LOCUS_02320 5651 6196 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 protein_id gnl|my_center|LOCUS_02320 6917 6492 gene locus_tag LOCUS_02330 6917 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 7321 6950 gene locus_tag LOCUS_02340 7321 6950 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706948.1 protein_id gnl|my_center|LOCUS_02340 7842 8717 gene locus_tag LOCUS_02350 7842 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02350 8982 9182 gene locus_tag LOCUS_02360 8982 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 10286 9303 gene locus_tag LOCUS_02370 gene ctaB 10286 9303 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIL7 protein_id gnl|my_center|LOCUS_02370 10619 10401 gene locus_tag LOCUS_02380 10619 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 11583 10582 gene locus_tag LOCUS_02390 11583 10582 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 protein_id gnl|my_center|LOCUS_02390 12227 13225 gene locus_tag LOCUS_02400 gene ctaC 12227 13225 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE8 protein_id gnl|my_center|LOCUS_02400 13246 14994 gene locus_tag LOCUS_02410 gene ctaD 13246 14994 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE9 protein_id gnl|my_center|LOCUS_02410 15141 15767 gene locus_tag LOCUS_02420 gene ctaE 15141 15767 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_02420 16179 17276 gene locus_tag LOCUS_02430 gene rfbB 16179 17276 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGD6 protein_id gnl|my_center|LOCUS_02430 18351 21053 gene locus_tag LOCUS_02440 18351 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 21654 21926 gene locus_tag LOCUS_02450 21654 21926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 23379 22045 gene locus_tag LOCUS_02460 23379 22045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 24771 23500 gene locus_tag LOCUS_02470 gene cls 24771 23500 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039240.1 protein_id gnl|my_center|LOCUS_02470 25111 24923 gene locus_tag LOCUS_02480 25111 24923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 26708 25323 gene locus_tag LOCUS_02490 26708 25323 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_02490 26972 28003 gene locus_tag LOCUS_02500 26972 28003 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057389.1 protein_id gnl|my_center|LOCUS_02500 28256 28101 gene locus_tag LOCUS_02510 28256 28101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 29569 28484 gene locus_tag LOCUS_02520 29569 28484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057861.1 protein_id gnl|my_center|LOCUS_02520 30189 29803 gene locus_tag LOCUS_02530 30189 29803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057860.1 protein_id gnl|my_center|LOCUS_02530 30416 31594 gene locus_tag LOCUS_02540 30416 31594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 31669 32463 gene locus_tag LOCUS_02550 31669 32463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141492.1 protein_id gnl|my_center|LOCUS_02550 32475 33110 gene locus_tag LOCUS_02560 32475 33110 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR9 protein_id gnl|my_center|LOCUS_02560 33241 33540 gene locus_tag LOCUS_02570 33241 33540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 33920 33531 gene locus_tag LOCUS_02580 33920 33531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 34142 35329 gene locus_tag LOCUS_02590 34142 35329 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 protein_id gnl|my_center|LOCUS_02590 35620 37686 gene locus_tag LOCUS_02600 35620 37686 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_02600 38510 37722 gene locus_tag LOCUS_02610 38510 37722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205364.1 protein_id gnl|my_center|LOCUS_02610 39151 40272 gene locus_tag LOCUS_02620 39151 40272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_02620 40308 41381 gene locus_tag LOCUS_02630 40308 41381 CDS product amino-acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582642.1 protein_id gnl|my_center|LOCUS_02630 42028 41438 gene locus_tag LOCUS_02640 42028 41438 CDS product fibrillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 protein_id gnl|my_center|LOCUS_02640 43998 42082 gene locus_tag LOCUS_02650 43998 42082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 44408 45457 gene locus_tag LOCUS_02660 gene mtnA 44408 45457 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK09 protein_id gnl|my_center|LOCUS_02660 >Feature sequence007 <1 1101 gene locus_tag LOCUS_02670 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P56081:3-dehydroquinate synthase 1122 2147 gene locus_tag LOCUS_02680 1122 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 2369 3247 gene locus_tag LOCUS_02690 2369 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 3496 4335 gene locus_tag LOCUS_02700 gene map 3496 4335 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ4 protein_id gnl|my_center|LOCUS_02700 5833 4496 gene locus_tag LOCUS_02710 5833 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 6226 5888 gene locus_tag LOCUS_02720 6226 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 6673 8118 gene locus_tag LOCUS_02730 gene gltX 6673 8118 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI5 protein_id gnl|my_center|LOCUS_02730 8166 9041 gene locus_tag LOCUS_02740 8166 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 9019 9219 gene locus_tag LOCUS_02750 9019 9219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 9760 9230 gene locus_tag LOCUS_02760 9760 9230 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930643.1 protein_id gnl|my_center|LOCUS_02760 9891 12104 gene locus_tag LOCUS_02770 9891 12104 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057683.1 protein_id gnl|my_center|LOCUS_02770 12461 13162 gene locus_tag LOCUS_02780 12461 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 15652 13703 gene locus_tag LOCUS_02790 15652 13703 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNN8 protein_id gnl|my_center|LOCUS_02790 16675 15962 gene locus_tag LOCUS_02800 16675 15962 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057242.1 protein_id gnl|my_center|LOCUS_02800 17930 16842 gene locus_tag LOCUS_02810 17930 16842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 19087 18380 gene locus_tag LOCUS_02820 19087 18380 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057970.1 protein_id gnl|my_center|LOCUS_02820 19576 20649 gene locus_tag LOCUS_02830 19576 20649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 21132 23396 gene locus_tag LOCUS_02840 21132 23396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 23942 23526 gene locus_tag LOCUS_02850 23942 23526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 24048 24260 gene locus_tag LOCUS_02860 24048 24260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 24859 24281 gene locus_tag LOCUS_02870 24859 24281 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056635.1 protein_id gnl|my_center|LOCUS_02870 25088 25348 gene locus_tag LOCUS_02880 25088 25348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 25444 25629 gene locus_tag LOCUS_02890 25444 25629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057262.1 protein_id gnl|my_center|LOCUS_02890 26949 25708 gene locus_tag LOCUS_02900 26949 25708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460346.1 protein_id gnl|my_center|LOCUS_02900 27200 26967 gene locus_tag LOCUS_02910 27200 26967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 27849 27475 gene locus_tag LOCUS_02920 27849 27475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 28472 27960 gene locus_tag LOCUS_02930 28472 27960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081148.1 protein_id gnl|my_center|LOCUS_02930 28815 30296 gene locus_tag LOCUS_02940 28815 30296 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_02940 30526 31437 gene locus_tag LOCUS_02950 30526 31437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404405.1 protein_id gnl|my_center|LOCUS_02950 31931 31539 gene locus_tag LOCUS_02960 31931 31539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 32162 33037 gene locus_tag LOCUS_02970 gene modA 32162 33037 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032249.1 protein_id gnl|my_center|LOCUS_02970 33065 34882 gene locus_tag LOCUS_02980 33065 34882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 36767 35103 gene locus_tag LOCUS_02990 gene putP 36767 35103 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125785.1 protein_id gnl|my_center|LOCUS_02990 37117 37665 gene locus_tag LOCUS_03000 37117 37665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_03000 38331 37699 gene locus_tag LOCUS_03010 38331 37699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140697.1 protein_id gnl|my_center|LOCUS_03010 39064 38459 gene locus_tag LOCUS_03020 39064 38459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 39515 39330 gene locus_tag LOCUS_03030 39515 39330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 41139 39808 gene locus_tag LOCUS_03040 41139 39808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 42979 41405 gene locus_tag LOCUS_03050 42979 41405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256724.1 protein_id gnl|my_center|LOCUS_03050 43227 42985 gene locus_tag LOCUS_03060 43227 42985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 44394 43330 gene locus_tag LOCUS_03070 44394 43330 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_03070 >Feature sequence008 821 588 gene locus_tag LOCUS_03080 821 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 1185 1601 gene locus_tag LOCUS_03090 1185 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 1780 1550 gene locus_tag LOCUS_03100 1780 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 2097 2561 gene locus_tag LOCUS_03110 2097 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057015.1 protein_id gnl|my_center|LOCUS_03110 2948 2751 gene locus_tag LOCUS_03120 2948 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3335 4576 gene locus_tag LOCUS_03130 3335 4576 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_03130 4872 5819 gene locus_tag LOCUS_03140 4872 5819 CDS product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289272.1 protein_id gnl|my_center|LOCUS_03140 5881 6837 gene locus_tag LOCUS_03150 5881 6837 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_03150 6972 7577 gene locus_tag LOCUS_03160 6972 7577 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153545.1 protein_id gnl|my_center|LOCUS_03160 7844 8077 gene locus_tag LOCUS_03170 7844 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 10098 8053 gene locus_tag LOCUS_03180 10098 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 10548 10790 gene locus_tag LOCUS_03190 10548 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 11166 15638 gene locus_tag LOCUS_03200 11166 15638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 16023 16616 gene locus_tag LOCUS_03210 16023 16616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_03210 17862 16630 gene locus_tag LOCUS_03220 17862 16630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055996.1 protein_id gnl|my_center|LOCUS_03220 18522 22241 gene locus_tag LOCUS_03230 gene cobN 18522 22241 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056744.1 protein_id gnl|my_center|LOCUS_03230 22524 22814 gene locus_tag LOCUS_03240 gene petF1 22524 22814 CDS product ferredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3C9 protein_id gnl|my_center|LOCUS_03240 23025 23321 gene locus_tag LOCUS_03250 gene petF 23025 23321 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143612.1 protein_id gnl|my_center|LOCUS_03250 23461 23763 gene locus_tag LOCUS_03260 gene petF 23461 23763 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143612.1 protein_id gnl|my_center|LOCUS_03260 23907 24200 gene locus_tag LOCUS_03270 gene petF 23907 24200 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143612.1 protein_id gnl|my_center|LOCUS_03270 25958 24279 gene locus_tag LOCUS_03280 gene spoIID 25958 24279 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125969.1 protein_id gnl|my_center|LOCUS_03280 26205 26987 gene locus_tag LOCUS_03290 26205 26987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 27057 27452 gene locus_tag LOCUS_03300 27057 27452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_03300 28285 27449 gene locus_tag LOCUS_03310 28285 27449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702708.1 protein_id gnl|my_center|LOCUS_03310 28600 30444 gene locus_tag LOCUS_03320 gene ftsH 28600 30444 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG5 protein_id gnl|my_center|LOCUS_03320 31091 30750 gene locus_tag LOCUS_03330 31091 30750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 31438 31683 gene locus_tag LOCUS_03340 gene psaC 31438 31683 CDS product photosystem I iron-sulfur center inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A415 protein_id gnl|my_center|LOCUS_03340 31983 33290 gene locus_tag LOCUS_03350 31983 33290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 33396 34799 gene locus_tag LOCUS_03360 33396 34799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_03360 35045 36463 gene locus_tag LOCUS_03370 35045 36463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_03370 36807 37220 gene locus_tag LOCUS_03380 36807 37220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 37259 37414 gene locus_tag LOCUS_03390 37259 37414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 37423 37797 gene locus_tag LOCUS_03400 37423 37797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 38241 37813 gene locus_tag LOCUS_03410 38241 37813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 38926 38744 gene locus_tag LOCUS_03420 38926 38744 CDS product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPL5 protein_id gnl|my_center|LOCUS_03420 39181 39723 gene locus_tag LOCUS_03430 39181 39723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 39868 40677 gene locus_tag LOCUS_03440 gene gdh 39868 40677 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089920.1 protein_id gnl|my_center|LOCUS_03440 40906 41142 gene locus_tag LOCUS_03450 40906 41142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 41992 41213 gene locus_tag LOCUS_03460 41992 41213 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_03460 42382 44028 gene locus_tag LOCUS_03470 42382 44028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 >Feature sequence009 1137 1454 gene locus_tag LOCUS_03480 1137 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 1924 2271 gene locus_tag LOCUS_03490 1924 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 2337 3089 gene locus_tag LOCUS_03500 gene atpB 2337 3089 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP8 protein_id gnl|my_center|LOCUS_03500 3217 3465 gene locus_tag LOCUS_03510 3217 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3571 4053 gene locus_tag LOCUS_03520 gene atpG 3571 4053 CDS product ATP synthase subunit b' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP6 protein_id gnl|my_center|LOCUS_03520 4139 4672 gene locus_tag LOCUS_03530 gene atpF 4139 4672 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP5 protein_id gnl|my_center|LOCUS_03530 4669 5211 gene locus_tag LOCUS_03540 gene atpH 4669 5211 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP4 protein_id gnl|my_center|LOCUS_03540 5357 6874 gene locus_tag LOCUS_03550 gene atpA 5357 6874 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP3 protein_id gnl|my_center|LOCUS_03550 6971 7915 gene locus_tag LOCUS_03560 gene atpG 6971 7915 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLU1 protein_id gnl|my_center|LOCUS_03560 8173 10014 gene locus_tag LOCUS_03570 gene thrS 8173 10014 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW0 protein_id gnl|my_center|LOCUS_03570 10261 10449 gene locus_tag LOCUS_03580 10261 10449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 10434 10724 gene locus_tag LOCUS_03590 10434 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 11009 11605 gene locus_tag LOCUS_03600 gene clpP1 11009 11605 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VC22 protein_id gnl|my_center|LOCUS_03600 12512 11739 gene locus_tag LOCUS_03610 12512 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 12940 15252 gene locus_tag LOCUS_03620 gene zam 12940 15252 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057710.1 protein_id gnl|my_center|LOCUS_03620 15986 16483 gene locus_tag LOCUS_03630 15986 16483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 17929 16556 gene locus_tag LOCUS_03640 gene glmU 17929 16556 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLT5 protein_id gnl|my_center|LOCUS_03640 19520 19065 gene locus_tag LOCUS_03650 gene ysnE 19520 19065 CDS product putative N-acetyltransferase YsnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94562 protein_id gnl|my_center|LOCUS_03650 20263 20036 gene locus_tag LOCUS_03660 20263 20036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 21262 20528 gene locus_tag LOCUS_03670 21262 20528 CDS product glutathione amide-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883987.1 protein_id gnl|my_center|LOCUS_03670 22895 21420 gene locus_tag LOCUS_03680 gene pepA 22895 21420 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI46 protein_id gnl|my_center|LOCUS_03680 23496 23245 gene locus_tag LOCUS_03690 23496 23245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 26206 23729 gene locus_tag LOCUS_03700 gene clpC 26206 23729 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_03700 26560 27162 gene locus_tag LOCUS_03710 26560 27162 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_03710 27542 27174 gene locus_tag LOCUS_03720 27542 27174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144172.1 protein_id gnl|my_center|LOCUS_03720 28033 27542 gene locus_tag LOCUS_03730 28033 27542 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR4 protein_id gnl|my_center|LOCUS_03730 28505 28083 gene locus_tag LOCUS_03740 28505 28083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056937.1 protein_id gnl|my_center|LOCUS_03740 29023 28520 gene locus_tag LOCUS_03750 29023 28520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142895.1 protein_id gnl|my_center|LOCUS_03750 29125 29367 gene locus_tag LOCUS_03760 29125 29367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 31594 29708 gene locus_tag LOCUS_03770 gene ftsH 31594 29708 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW7 protein_id gnl|my_center|LOCUS_03770 32070 33083 gene locus_tag LOCUS_03780 32070 33083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 33367 33876 gene locus_tag LOCUS_03790 33367 33876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 35596 33887 gene locus_tag LOCUS_03800 35596 33887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_03800 36166 35765 gene locus_tag LOCUS_03810 36166 35765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 37392 36268 gene locus_tag LOCUS_03820 37392 36268 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 protein_id gnl|my_center|LOCUS_03820 37651 38958 gene locus_tag LOCUS_03830 gene hisD 37651 38958 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR2 protein_id gnl|my_center|LOCUS_03830 39453 40535 gene locus_tag LOCUS_03840 39453 40535 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868908.1 protein_id gnl|my_center|LOCUS_03840 40654 42018 gene locus_tag LOCUS_03850 40654 42018 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_03850 42795 42046 gene locus_tag LOCUS_03860 42795 42046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 43472 42813 gene locus_tag LOCUS_03870 43472 42813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence010 1211 612 gene locus_tag LOCUS_03880 gene tpx 1211 612 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 protein_id gnl|my_center|LOCUS_03880 1585 1512 gene locus_tag LOCUS_t00030 1585 1512 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3787 1733 gene locus_tag LOCUS_03890 3787 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 4273 4503 gene locus_tag LOCUS_03900 4273 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4862 4401 gene locus_tag LOCUS_03910 4862 4401 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM1 protein_id gnl|my_center|LOCUS_03910 6167 5016 gene locus_tag LOCUS_03920 6167 5016 CDS product putative glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_03920 7132 6323 gene locus_tag LOCUS_03930 7132 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 8522 7563 gene locus_tag LOCUS_03940 gene alsR 8522 7563 CDS product HTH-type transcriptional regulator AlsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04778 protein_id gnl|my_center|LOCUS_03940 8779 12432 gene locus_tag LOCUS_03950 gene oplaH 8779 12432 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039974.1 protein_id gnl|my_center|LOCUS_03950 15090 12538 gene locus_tag LOCUS_03960 gene mutS2 15090 12538 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJD6 protein_id gnl|my_center|LOCUS_03960 15812 15285 gene locus_tag LOCUS_03970 15812 15285 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765622.1 protein_id gnl|my_center|LOCUS_03970 16314 15859 gene locus_tag LOCUS_03980 16314 15859 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125731.1 protein_id gnl|my_center|LOCUS_03980 17864 16557 gene locus_tag LOCUS_03990 gene pyrC 17864 16557 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057373.1 protein_id gnl|my_center|LOCUS_03990 19536 18175 gene locus_tag LOCUS_04000 19536 18175 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057372.1 protein_id gnl|my_center|LOCUS_04000 19830 21119 gene locus_tag LOCUS_04010 gene glgC 19830 21119 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057127.1 protein_id gnl|my_center|LOCUS_04010 22038 21328 gene locus_tag LOCUS_04020 22038 21328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 22666 22274 gene locus_tag LOCUS_04030 22666 22274 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140008.1 protein_id gnl|my_center|LOCUS_04030 23307 22696 gene locus_tag LOCUS_04040 23307 22696 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140009.1 protein_id gnl|my_center|LOCUS_04040 24471 23323 gene locus_tag LOCUS_04050 24471 23323 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_04050 24764 24510 gene locus_tag LOCUS_04060 24764 24510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 25494 25147 gene locus_tag LOCUS_04070 25494 25147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 26377 25652 gene locus_tag LOCUS_04080 26377 25652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 29452 26693 gene locus_tag LOCUS_04090 29452 26693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403128.1 protein_id gnl|my_center|LOCUS_04090 33522 30016 gene locus_tag LOCUS_04100 33522 30016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 34834 33656 gene locus_tag LOCUS_04110 34834 33656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 35091 35330 gene locus_tag LOCUS_04120 35091 35330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 35577 38738 gene locus_tag LOCUS_04130 gene ppc 35577 38738 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X5 protein_id gnl|my_center|LOCUS_04130 39788 39081 gene locus_tag LOCUS_04140 39788 39081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 40534 39785 gene locus_tag LOCUS_04150 40534 39785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04150 41124 40594 gene locus_tag LOCUS_04160 41124 40594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04160 >Feature sequence011 1315 377 gene locus_tag LOCUS_04170 1315 377 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143340.1 protein_id gnl|my_center|LOCUS_04170 2148 1390 gene locus_tag LOCUS_04180 gene parA 2148 1390 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_04180 3624 3427 gene locus_tag LOCUS_04190 3624 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3953 3576 gene locus_tag LOCUS_04200 3953 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144091.1 protein_id gnl|my_center|LOCUS_04200 4270 3953 gene locus_tag LOCUS_04210 4270 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144090.1 protein_id gnl|my_center|LOCUS_04210 4762 4277 gene locus_tag LOCUS_04220 4762 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144089.1 protein_id gnl|my_center|LOCUS_04220 5247 4789 gene locus_tag LOCUS_04230 5247 4789 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144087.1 protein_id gnl|my_center|LOCUS_04230 7013 5340 gene locus_tag LOCUS_04240 7013 5340 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144086.1 protein_id gnl|my_center|LOCUS_04240 7235 8485 gene locus_tag LOCUS_04250 7235 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258026.1 protein_id gnl|my_center|LOCUS_04250 8482 10467 gene locus_tag LOCUS_04260 8482 10467 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_04260 10502 10972 gene locus_tag LOCUS_04270 10502 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 11315 10938 gene locus_tag LOCUS_04280 11315 10938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 11587 11306 gene locus_tag LOCUS_04290 11587 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 11716 11588 gene locus_tag LOCUS_04300 11716 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 11943 16724 gene locus_tag LOCUS_04310 11943 16724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 16753 17367 gene locus_tag LOCUS_04320 16753 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 17991 17785 gene locus_tag LOCUS_04330 17991 17785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 18206 17988 gene locus_tag LOCUS_04340 18206 17988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 18237 18446 gene locus_tag LOCUS_04350 18237 18446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 18742 19284 gene locus_tag LOCUS_04360 18742 19284 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_04360 19520 20650 gene locus_tag LOCUS_04370 19520 20650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 20916 20710 gene locus_tag LOCUS_04380 20916 20710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 21892 21236 gene locus_tag LOCUS_04390 21892 21236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 22005 22427 gene locus_tag LOCUS_04400 22005 22427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141413.1 protein_id gnl|my_center|LOCUS_04400 22455 24794 gene locus_tag LOCUS_04410 22455 24794 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141412.1 protein_id gnl|my_center|LOCUS_04410 24815 25888 gene locus_tag LOCUS_04420 24815 25888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141411.1 protein_id gnl|my_center|LOCUS_04420 29009 26190 gene locus_tag LOCUS_04430 29009 26190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 31561 29039 gene locus_tag LOCUS_04440 31561 29039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 32943 31720 gene locus_tag LOCUS_04450 32943 31720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141410.1 protein_id gnl|my_center|LOCUS_04450 33761 32940 gene locus_tag LOCUS_04460 33761 32940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 34193 36376 gene locus_tag LOCUS_04470 34193 36376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 36420 38843 gene locus_tag LOCUS_04480 36420 38843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 38867 39019 gene locus_tag LOCUS_04490 38867 39019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 39019 39561 gene locus_tag LOCUS_04500 39019 39561 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140431.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence012 146 592 gene locus_tag LOCUS_04510 gene aroQ 146 592 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q48255 protein_id gnl|my_center|LOCUS_04510 570 1538 gene locus_tag LOCUS_04520 570 1538 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RWL5 protein_id gnl|my_center|LOCUS_04520 1903 3060 gene locus_tag LOCUS_04530 1903 3060 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_04530 3168 5684 gene locus_tag LOCUS_04540 gene priA 3168 5684 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLR3 protein_id gnl|my_center|LOCUS_04540 5722 6240 gene locus_tag LOCUS_04550 5722 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 6565 9456 gene locus_tag LOCUS_04560 6565 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 9472 11016 gene locus_tag LOCUS_04570 9472 11016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 11652 11473 gene locus_tag LOCUS_04580 11652 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 12960 12361 gene locus_tag LOCUS_04590 12960 12361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_04590 13546 14418 gene locus_tag LOCUS_04600 13546 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259386.1 protein_id gnl|my_center|LOCUS_04600 15090 14803 gene locus_tag LOCUS_04610 15090 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 15594 15403 gene locus_tag LOCUS_04620 15594 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 15686 16075 gene locus_tag LOCUS_04630 15686 16075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 17324 16194 gene locus_tag LOCUS_04640 17324 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 17549 18268 gene locus_tag LOCUS_04650 gene rph 17549 18268 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA4 protein_id gnl|my_center|LOCUS_04650 19269 18298 gene locus_tag LOCUS_04660 gene cysK 19269 18298 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI7 protein_id gnl|my_center|LOCUS_04660 20052 19498 gene locus_tag LOCUS_04670 gene dpsA 20052 19498 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056462.1 protein_id gnl|my_center|LOCUS_04670 21354 20191 gene locus_tag LOCUS_04680 21354 20191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 23075 21423 gene locus_tag LOCUS_04690 23075 21423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141468.1 protein_id gnl|my_center|LOCUS_04690 24240 25442 gene locus_tag LOCUS_04700 gene ftsW 24240 25442 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056295.1 protein_id gnl|my_center|LOCUS_04700 27392 25980 gene locus_tag LOCUS_04710 27392 25980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057642.1 protein_id gnl|my_center|LOCUS_04710 28258 27572 gene locus_tag LOCUS_04720 28258 27572 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_04720 29453 28281 gene locus_tag LOCUS_04730 gene bioF 29453 28281 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNL4 protein_id gnl|my_center|LOCUS_04730 29683 29468 gene locus_tag LOCUS_04740 29683 29468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 30001 29780 gene locus_tag LOCUS_04750 30001 29780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 32477 30135 gene locus_tag LOCUS_04760 32477 30135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 36436 32489 gene locus_tag LOCUS_04770 36436 32489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 37098 38108 gene locus_tag LOCUS_04780 gene trpS 37098 38108 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHG3 protein_id gnl|my_center|LOCUS_04780 38152 39042 gene locus_tag LOCUS_04790 38152 39042 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI21 protein_id gnl|my_center|LOCUS_04790 39560 39039 gene locus_tag LOCUS_04800 39560 39039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056576.1 protein_id gnl|my_center|LOCUS_04800 39840 41579 gene locus_tag LOCUS_04810 39840 41579 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225606.1 protein_id gnl|my_center|LOCUS_04810 >Feature sequence013 1184 1426 gene locus_tag LOCUS_04820 1184 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 1433 2143 gene locus_tag LOCUS_04830 1433 2143 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX7 protein_id gnl|my_center|LOCUS_04830 2835 2155 gene locus_tag LOCUS_04840 2835 2155 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142393.1 protein_id gnl|my_center|LOCUS_04840 6072 3010 gene locus_tag LOCUS_04850 6072 3010 CDS product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJM9 protein_id gnl|my_center|LOCUS_04850 6262 8787 gene locus_tag LOCUS_04860 6262 8787 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140924.1 protein_id gnl|my_center|LOCUS_04860 9015 10022 gene locus_tag LOCUS_04870 9015 10022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 10034 11068 gene locus_tag LOCUS_04880 10034 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 11074 11973 gene locus_tag LOCUS_04890 11074 11973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 13134 12010 gene locus_tag LOCUS_04900 13134 12010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 13418 13696 gene locus_tag LOCUS_04910 13418 13696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 15463 13715 gene locus_tag LOCUS_04920 15463 13715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 16627 16088 gene locus_tag LOCUS_04930 16627 16088 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140681.1 protein_id gnl|my_center|LOCUS_04930 16782 17828 gene locus_tag LOCUS_04940 16782 17828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 17904 18581 gene locus_tag LOCUS_04950 17904 18581 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_04950 18770 19066 gene locus_tag LOCUS_04960 18770 19066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 19553 19245 gene locus_tag LOCUS_04970 19553 19245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 20896 19760 gene locus_tag LOCUS_04980 20896 19760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057921.1 protein_id gnl|my_center|LOCUS_04980 21395 22471 gene locus_tag LOCUS_04990 21395 22471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 22488 23045 gene locus_tag LOCUS_05000 gene coaD 22488 23045 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ7 protein_id gnl|my_center|LOCUS_05000 22949 23608 gene locus_tag LOCUS_05010 22949 23608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057008.1 protein_id gnl|my_center|LOCUS_05010 23759 25159 gene locus_tag LOCUS_05020 23759 25159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 25187 25840 gene locus_tag LOCUS_05030 25187 25840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 25997 26821 gene locus_tag LOCUS_05040 25997 26821 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142046.1 protein_id gnl|my_center|LOCUS_05040 27160 26849 gene locus_tag LOCUS_05050 27160 26849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057985.1 protein_id gnl|my_center|LOCUS_05050 27502 29466 gene locus_tag LOCUS_05060 27502 29466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 29511 30404 gene locus_tag LOCUS_05070 29511 30404 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057510.1 protein_id gnl|my_center|LOCUS_05070 30463 30534 gene locus_tag LOCUS_t00040 30463 30534 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 30830 31393 gene locus_tag LOCUS_05080 30830 31393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 31390 32415 gene locus_tag LOCUS_05090 31390 32415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55579 protein_id gnl|my_center|LOCUS_05090 32435 34069 gene locus_tag LOCUS_05100 32435 34069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 34109 34453 gene locus_tag LOCUS_05110 34109 34453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 34532 35584 gene locus_tag LOCUS_05120 34532 35584 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861057.1 protein_id gnl|my_center|LOCUS_05120 35746 36243 gene locus_tag LOCUS_05130 35746 36243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 37717 36287 gene locus_tag LOCUS_05140 37717 36287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 38131 38526 gene locus_tag LOCUS_05150 38131 38526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 >Feature sequence014 2834 885 gene locus_tag LOCUS_05160 2834 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3488 3694 gene locus_tag LOCUS_05170 3488 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 5741 3708 gene locus_tag LOCUS_05180 gene ligA 5741 3708 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK2 protein_id gnl|my_center|LOCUS_05180 6714 5758 gene locus_tag LOCUS_05190 6714 5758 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085765.1 protein_id gnl|my_center|LOCUS_05190 7082 7891 gene locus_tag LOCUS_05200 7082 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 7916 8806 gene locus_tag LOCUS_05210 gene truB 7916 8806 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7MBB8 protein_id gnl|my_center|LOCUS_05210 9083 10249 gene locus_tag LOCUS_05220 9083 10249 CDS product glycine amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228026.1 protein_id gnl|my_center|LOCUS_05220 10269 10970 gene locus_tag LOCUS_05230 10269 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 12392 10986 gene locus_tag LOCUS_05240 12392 10986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057693.1 protein_id gnl|my_center|LOCUS_05240 12851 12414 gene locus_tag LOCUS_05250 12851 12414 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815124.1 protein_id gnl|my_center|LOCUS_05250 13059 13313 gene locus_tag LOCUS_05260 13059 13313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143542.1 protein_id gnl|my_center|LOCUS_05260 14324 13407 gene locus_tag LOCUS_05270 14324 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 14572 16908 gene locus_tag LOCUS_05280 14572 16908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 18071 17412 gene locus_tag LOCUS_05290 18071 17412 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_05290 19387 20223 gene locus_tag LOCUS_05300 19387 20223 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_05300 20342 21709 gene locus_tag LOCUS_05310 20342 21709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_05310 22149 23567 gene locus_tag LOCUS_05320 gene putP 22149 23567 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_05320 23626 24717 gene locus_tag LOCUS_05330 23626 24717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 24797 26236 gene locus_tag LOCUS_05340 gene putP 24797 26236 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_05340 26242 27363 gene locus_tag LOCUS_05350 26242 27363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 27427 28545 gene locus_tag LOCUS_05360 gene ribD 27427 28545 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH08 protein_id gnl|my_center|LOCUS_05360 31044 28549 gene locus_tag LOCUS_05370 31044 28549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057920.1 protein_id gnl|my_center|LOCUS_05370 37003 31355 gene locus_tag LOCUS_05380 37003 31355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 32680 32876 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttacaggcgggtttacaacaacttca 39124 37139 gene locus_tag LOCUS_05390 39124 37139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 39877 39698 gene locus_tag LOCUS_05400 39877 39698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 >Feature sequence015 1761 1021 gene locus_tag LOCUS_05410 gene purC 1761 1021 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIT5 protein_id gnl|my_center|LOCUS_05410 2331 4412 gene locus_tag LOCUS_05420 2331 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 4787 5629 gene locus_tag LOCUS_05430 4787 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 5654 7000 gene locus_tag LOCUS_05440 5654 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 9393 6997 gene locus_tag LOCUS_05450 9393 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056048.1 protein_id gnl|my_center|LOCUS_05450 10715 9957 gene locus_tag LOCUS_05460 10715 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 11808 10885 gene locus_tag LOCUS_05470 11808 10885 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085765.1 protein_id gnl|my_center|LOCUS_05470 12188 14107 gene locus_tag LOCUS_05480 12188 14107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 14159 17617 gene locus_tag LOCUS_05490 14159 17617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 18023 19078 gene locus_tag LOCUS_05500 18023 19078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 19722 19414 gene locus_tag LOCUS_05510 19722 19414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 20272 19946 gene locus_tag LOCUS_05520 20272 19946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 21342 20383 gene locus_tag LOCUS_05530 21342 20383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140054.1 protein_id gnl|my_center|LOCUS_05530 21667 22251 gene locus_tag LOCUS_05540 21667 22251 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_05540 24149 22248 gene locus_tag LOCUS_05550 24149 22248 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056974.1 protein_id gnl|my_center|LOCUS_05550 24542 25423 gene locus_tag LOCUS_05560 24542 25423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 25530 26876 gene locus_tag LOCUS_05570 25530 26876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143055.1 protein_id gnl|my_center|LOCUS_05570 27337 26897 gene locus_tag LOCUS_05580 27337 26897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056704.1 protein_id gnl|my_center|LOCUS_05580 29463 27550 gene locus_tag LOCUS_05590 29463 27550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 29594 30175 gene locus_tag LOCUS_05600 29594 30175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 30236 30724 gene locus_tag LOCUS_05610 30236 30724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 30774 31028 gene locus_tag LOCUS_05620 30774 31028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 33724 31070 gene locus_tag LOCUS_05630 33724 31070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence016 992 495 gene locus_tag LOCUS_05640 992 495 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_05640 1237 989 gene locus_tag LOCUS_05650 1237 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 1411 4848 gene locus_tag LOCUS_05660 1411 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 4941 6233 gene locus_tag LOCUS_05670 4941 6233 CDS product modulator of DNA gyrase PmbA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 protein_id gnl|my_center|LOCUS_05670 6449 7738 gene locus_tag LOCUS_05680 6449 7738 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_05680 8544 7888 gene locus_tag LOCUS_05690 8544 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 9849 8608 gene locus_tag LOCUS_05700 gene trpB 9849 8608 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG49 protein_id gnl|my_center|LOCUS_05700 11486 9927 gene locus_tag LOCUS_05710 11486 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 11868 13283 gene locus_tag LOCUS_05720 gene fum 11868 13283 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRE5 protein_id gnl|my_center|LOCUS_05720 14413 13307 gene locus_tag LOCUS_05730 14413 13307 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_05730 15693 14437 gene locus_tag LOCUS_05740 15693 14437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 16205 15774 gene locus_tag LOCUS_05750 16205 15774 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326711.1 protein_id gnl|my_center|LOCUS_05750 18627 16546 gene locus_tag LOCUS_05760 18627 16546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 19578 18793 gene locus_tag LOCUS_05770 19578 18793 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142678.1 protein_id gnl|my_center|LOCUS_05770 19679 20620 gene locus_tag LOCUS_05780 19679 20620 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079950.1 protein_id gnl|my_center|LOCUS_05780 21156 22472 gene locus_tag LOCUS_05790 gene thrA 21156 22472 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM46 protein_id gnl|my_center|LOCUS_05790 24037 22502 gene locus_tag LOCUS_05800 24037 22502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 protein_id gnl|my_center|LOCUS_05800 25430 24042 gene locus_tag LOCUS_05810 25430 24042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 protein_id gnl|my_center|LOCUS_05810 26343 25681 gene locus_tag LOCUS_05820 26343 25681 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 protein_id gnl|my_center|LOCUS_05820 28271 27444 gene locus_tag LOCUS_05830 28271 27444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05830 28713 28264 gene locus_tag LOCUS_05840 28713 28264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 29381 28968 gene locus_tag LOCUS_05850 29381 28968 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056992.1 protein_id gnl|my_center|LOCUS_05850 31411 30374 gene locus_tag LOCUS_05860 gene lpxD3 31411 30374 CDS product UDP-3-O-acylglucosamine N-acyltransferase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH24 protein_id gnl|my_center|LOCUS_05860 32556 31813 gene locus_tag LOCUS_05870 32556 31813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 protein_id gnl|my_center|LOCUS_05870 32804 33751 gene locus_tag LOCUS_05880 32804 33751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 34372 33794 gene locus_tag LOCUS_05890 34372 33794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_05890 35324 34713 gene locus_tag LOCUS_05900 35324 34713 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140022.1 protein_id gnl|my_center|LOCUS_05900 35668 37743 gene locus_tag LOCUS_05910 35668 37743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 39187 37790 gene locus_tag LOCUS_05920 39187 37790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 39554 39162 gene locus_tag LOCUS_05930 39554 39162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence017 364 555 gene locus_tag LOCUS_05940 364 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 1554 622 gene locus_tag LOCUS_05950 gene prk 1554 622 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND12 protein_id gnl|my_center|LOCUS_05950 2273 3640 gene locus_tag LOCUS_05960 2273 3640 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXK3 protein_id gnl|my_center|LOCUS_05960 3963 5174 gene locus_tag LOCUS_05970 3963 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 5315 8803 gene locus_tag LOCUS_05980 5315 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 9199 10506 gene locus_tag LOCUS_05990 9199 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 11013 10603 gene locus_tag LOCUS_06000 11013 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 11217 12089 gene locus_tag LOCUS_06010 11217 12089 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144354.1 protein_id gnl|my_center|LOCUS_06010 12181 12885 gene locus_tag LOCUS_06020 12181 12885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 protein_id gnl|my_center|LOCUS_06020 12956 15721 gene locus_tag LOCUS_06030 12956 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 15711 17054 gene locus_tag LOCUS_06040 15711 17054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 17484 17164 gene locus_tag LOCUS_06050 17484 17164 CDS product phosphoribosyl-ATP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966108.1 protein_id gnl|my_center|LOCUS_06050 17597 18286 gene locus_tag LOCUS_06060 17597 18286 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_06060 18394 19329 gene locus_tag LOCUS_06070 gene phnD 18394 19329 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_06070 21536 19356 gene locus_tag LOCUS_06080 21536 19356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 23354 21897 gene locus_tag LOCUS_06090 23354 21897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 24367 23537 gene locus_tag LOCUS_06100 24367 23537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143597.1 protein_id gnl|my_center|LOCUS_06100 24522 25103 gene locus_tag LOCUS_06110 24522 25103 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_06110 25189 27372 gene locus_tag LOCUS_06120 gene recQ 25189 27372 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142623.1 protein_id gnl|my_center|LOCUS_06120 28059 27382 gene locus_tag LOCUS_06130 28059 27382 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022855.1 protein_id gnl|my_center|LOCUS_06130 28567 28259 gene locus_tag LOCUS_06140 28567 28259 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058100.1 protein_id gnl|my_center|LOCUS_06140 29155 29637 gene locus_tag LOCUS_06150 29155 29637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 29713 30192 gene locus_tag LOCUS_06160 29713 30192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143485.1 protein_id gnl|my_center|LOCUS_06160 30454 30194 gene locus_tag LOCUS_06170 30454 30194 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 protein_id gnl|my_center|LOCUS_06170 31302 30484 gene locus_tag LOCUS_06180 31302 30484 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124881.1 protein_id gnl|my_center|LOCUS_06180 31575 31907 gene locus_tag LOCUS_06190 31575 31907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 32934 32095 gene locus_tag LOCUS_06200 32934 32095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 33086 34645 gene locus_tag LOCUS_06210 33086 34645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889466.1 protein_id gnl|my_center|LOCUS_06210 34843 35685 gene locus_tag LOCUS_06220 34843 35685 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_06220 35795 36526 gene locus_tag LOCUS_06230 35795 36526 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI83 protein_id gnl|my_center|LOCUS_06230 36624 36552 gene locus_tag LOCUS_t00050 36624 36552 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 37890 36748 gene locus_tag LOCUS_06240 37890 36748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057593.1 protein_id gnl|my_center|LOCUS_06240 38994 38269 gene locus_tag LOCUS_06250 38994 38269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence018 2573 816 gene locus_tag LOCUS_06260 2573 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3130 2762 gene locus_tag LOCUS_06270 3130 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3543 3289 gene locus_tag LOCUS_06280 3543 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3855 5264 gene locus_tag LOCUS_06290 3855 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 6502 5327 gene locus_tag LOCUS_06300 6502 5327 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_06300 8284 6827 gene locus_tag LOCUS_06310 8284 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_06310 8773 8474 gene locus_tag LOCUS_06320 8773 8474 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_06320 10266 8977 gene locus_tag LOCUS_06330 10266 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055996.1 protein_id gnl|my_center|LOCUS_06330 10694 12088 gene locus_tag LOCUS_06340 gene murF 10694 12088 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM9 protein_id gnl|my_center|LOCUS_06340 12175 12588 gene locus_tag LOCUS_06350 12175 12588 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496461.1 protein_id gnl|my_center|LOCUS_06350 12627 13658 gene locus_tag LOCUS_06360 gene mdh 12627 13658 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHJ3 protein_id gnl|my_center|LOCUS_06360 13690 14079 gene locus_tag LOCUS_tm00010 13690 14079 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 14211 14468 gene locus_tag LOCUS_06370 14211 14468 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_06370 14554 14883 gene locus_tag LOCUS_06380 gene ycf64 14554 14883 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI5 protein_id gnl|my_center|LOCUS_06380 15241 14993 gene locus_tag LOCUS_06390 15241 14993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 15939 17414 gene locus_tag LOCUS_06400 15939 17414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 18031 17789 gene locus_tag LOCUS_06410 18031 17789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 19530 18154 gene locus_tag LOCUS_06420 19530 18154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 20461 26160 gene locus_tag LOCUS_06430 20461 26160 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_06430 26754 26170 gene locus_tag LOCUS_06440 26754 26170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 27079 26762 gene locus_tag LOCUS_06450 gene trxM1 27079 26762 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGN0 protein_id gnl|my_center|LOCUS_06450 27255 28022 gene locus_tag LOCUS_06460 gene fabG 27255 28022 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_06460 29760 28024 gene locus_tag LOCUS_06470 29760 28024 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089656.1 protein_id gnl|my_center|LOCUS_06470 31825 29762 gene locus_tag LOCUS_06480 31825 29762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142898.1 protein_id gnl|my_center|LOCUS_06480 33571 31853 gene locus_tag LOCUS_06490 33571 31853 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089656.1 protein_id gnl|my_center|LOCUS_06490 33765 34229 gene locus_tag LOCUS_06500 33765 34229 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE5 protein_id gnl|my_center|LOCUS_06500 35226 34234 gene locus_tag LOCUS_06510 35226 34234 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 protein_id gnl|my_center|LOCUS_06510 35849 35331 gene locus_tag LOCUS_06520 gene apt 35849 35331 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH9 protein_id gnl|my_center|LOCUS_06520 36203 36811 gene locus_tag LOCUS_06530 36203 36811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056685.1 protein_id gnl|my_center|LOCUS_06530 36919 37116 gene locus_tag LOCUS_06540 36919 37116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 38268 37258 gene locus_tag LOCUS_06550 38268 37258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence019 1237 1410 gene locus_tag LOCUS_06560 1237 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06560 1554 1820 gene locus_tag LOCUS_06570 1554 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06570 2773 2144 gene locus_tag LOCUS_06580 2773 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 3504 2779 gene locus_tag LOCUS_06590 3504 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 4810 3854 gene locus_tag LOCUS_06600 gene cofG 4810 3854 CDS product FO synthase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR6 protein_id gnl|my_center|LOCUS_06600 4809 5594 gene locus_tag LOCUS_06610 4809 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 6462 8567 gene locus_tag LOCUS_06620 gene fus 6462 8567 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058192.1 protein_id gnl|my_center|LOCUS_06620 9847 8873 gene locus_tag LOCUS_06630 9847 8873 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140505.1 protein_id gnl|my_center|LOCUS_06630 10566 9859 gene locus_tag LOCUS_06640 10566 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 11126 10788 gene locus_tag LOCUS_06650 11126 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 11313 12344 gene locus_tag LOCUS_06660 gene fmt 11313 12344 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS1 protein_id gnl|my_center|LOCUS_06660 12620 13618 gene locus_tag LOCUS_06670 12620 13618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 13624 14064 gene locus_tag LOCUS_06680 13624 14064 CDS product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_06680 14176 14604 gene locus_tag LOCUS_06690 14176 14604 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891579.1 protein_id gnl|my_center|LOCUS_06690 14594 15541 gene locus_tag LOCUS_06700 14594 15541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_06700 16472 15579 gene locus_tag LOCUS_06710 gene gtaB 16472 15579 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6J3 protein_id gnl|my_center|LOCUS_06710 17520 16465 gene locus_tag LOCUS_06720 17520 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 19501 17522 gene locus_tag LOCUS_06730 gene speA 19501 17522 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY6 protein_id gnl|my_center|LOCUS_06730 19674 20123 gene locus_tag LOCUS_06740 gene ndk 19674 20123 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM56 protein_id gnl|my_center|LOCUS_06740 20848 20180 gene locus_tag LOCUS_06750 20848 20180 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 protein_id gnl|my_center|LOCUS_06750 26260 21233 gene locus_tag LOCUS_06760 26260 21233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 27184 29181 gene locus_tag LOCUS_06770 27184 29181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 29222 30619 gene locus_tag LOCUS_06780 29222 30619 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057215.1 protein_id gnl|my_center|LOCUS_06780 31591 30629 gene locus_tag LOCUS_06790 31591 30629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 32702 32064 gene locus_tag LOCUS_06800 32702 32064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 32787 33458 gene locus_tag LOCUS_06810 32787 33458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 protein_id gnl|my_center|LOCUS_06810 33545 34315 gene locus_tag LOCUS_06820 33545 34315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 35165 34437 gene locus_tag LOCUS_06830 35165 34437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 37892 35823 gene locus_tag LOCUS_06840 37892 35823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence020 692 57 gene locus_tag LOCUS_06850 692 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1085 1837 gene locus_tag LOCUS_06860 1085 1837 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGK9 protein_id gnl|my_center|LOCUS_06860 2808 3416 gene locus_tag LOCUS_06870 2808 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 protein_id gnl|my_center|LOCUS_06870 4638 3508 gene locus_tag LOCUS_06880 gene gcvT 4638 3508 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFJ5 protein_id gnl|my_center|LOCUS_06880 5772 5194 gene locus_tag LOCUS_06890 5772 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 7007 5784 gene locus_tag LOCUS_06900 gene ackA 7007 5784 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLW9 protein_id gnl|my_center|LOCUS_06900 7989 7351 gene locus_tag LOCUS_06910 7989 7351 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141001.1 protein_id gnl|my_center|LOCUS_06910 8331 10754 gene locus_tag LOCUS_06920 8331 10754 CDS product putative phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN6 protein_id gnl|my_center|LOCUS_06920 12819 10843 gene locus_tag LOCUS_06930 12819 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 13773 14882 gene locus_tag LOCUS_06940 gene bioB 13773 14882 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT7 protein_id gnl|my_center|LOCUS_06940 15186 15770 gene locus_tag LOCUS_06950 15186 15770 CDS product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056745.1 protein_id gnl|my_center|LOCUS_06950 16032 16544 gene locus_tag LOCUS_06960 gene lspA 16032 16544 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA3 protein_id gnl|my_center|LOCUS_06960 16727 18898 gene locus_tag LOCUS_06970 16727 18898 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057331.1 protein_id gnl|my_center|LOCUS_06970 19891 18938 gene locus_tag LOCUS_06980 19891 18938 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUG2 protein_id gnl|my_center|LOCUS_06980 20986 19916 gene locus_tag LOCUS_06990 20986 19916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 21562 21131 gene locus_tag LOCUS_07000 21562 21131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 22664 21678 gene locus_tag LOCUS_07010 gene moaA 22664 21678 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCF5 protein_id gnl|my_center|LOCUS_07010 23309 23602 gene locus_tag LOCUS_07020 23309 23602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 26758 23723 gene locus_tag LOCUS_07030 26758 23723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 27861 27217 gene locus_tag LOCUS_07040 27861 27217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_07040 28372 27902 gene locus_tag LOCUS_07050 28372 27902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 28891 28523 gene locus_tag LOCUS_07060 28891 28523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 29490 28888 gene locus_tag LOCUS_07070 gene sigH 29490 28888 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056172.1 protein_id gnl|my_center|LOCUS_07070 29770 31671 gene locus_tag LOCUS_07080 29770 31671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 protein_id gnl|my_center|LOCUS_07080 31935 33107 gene locus_tag LOCUS_07090 31935 33107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 33108 33812 gene locus_tag LOCUS_07100 33108 33812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 33834 34166 gene locus_tag LOCUS_07110 33834 34166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 36064 34232 gene locus_tag LOCUS_07120 36064 34232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 36739 36557 gene locus_tag LOCUS_07130 36739 36557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 <37889 36877 gene locus_tag LOCUS_07140 <37889 36877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DM14:DNA helicase >Feature sequence021 214 1014 gene locus_tag LOCUS_07150 214 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07150 1029 2396 gene locus_tag LOCUS_07160 1029 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 4149 2467 gene locus_tag LOCUS_07170 gene ansB 4149 2467 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 protein_id gnl|my_center|LOCUS_07170 4765 4331 gene locus_tag LOCUS_07180 4765 4331 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 protein_id gnl|my_center|LOCUS_07180 5002 5298 gene locus_tag LOCUS_07190 5002 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 5624 5920 gene locus_tag LOCUS_07200 5624 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 5971 7428 gene locus_tag LOCUS_07210 gene cobQ 5971 7428 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI74 protein_id gnl|my_center|LOCUS_07210 10279 7658 gene locus_tag LOCUS_07220 gene clpB1 10279 7658 CDS product chaperone protein ClpB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ40 protein_id gnl|my_center|LOCUS_07220 12445 10718 gene locus_tag LOCUS_07230 12445 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 20130 12592 gene locus_tag LOCUS_07240 20130 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 20579 21100 gene locus_tag LOCUS_07250 20579 21100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142303.1 protein_id gnl|my_center|LOCUS_07250 21605 21898 gene locus_tag LOCUS_07260 21605 21898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 22173 23015 gene locus_tag LOCUS_07270 22173 23015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 23162 24565 gene locus_tag LOCUS_07280 23162 24565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 25289 24555 gene locus_tag LOCUS_07290 gene glpQ 25289 24555 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048193.1 protein_id gnl|my_center|LOCUS_07290 26191 25313 gene locus_tag LOCUS_07300 26191 25313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 26313 27740 gene locus_tag LOCUS_07310 gene recQ 26313 27740 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056643.1 protein_id gnl|my_center|LOCUS_07310 27815 29008 gene locus_tag LOCUS_07320 27815 29008 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_07320 29181 29264 gene locus_tag LOCUS_t00060 29181 29264 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 29297 29368 gene locus_tag LOCUS_t00070 29297 29368 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31189 29510 gene locus_tag LOCUS_07330 31189 29510 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 protein_id gnl|my_center|LOCUS_07330 32504 31560 gene locus_tag LOCUS_07340 32504 31560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058107.1 protein_id gnl|my_center|LOCUS_07340 33789 32614 gene locus_tag LOCUS_07350 33789 32614 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 protein_id gnl|my_center|LOCUS_07350 33959 34828 gene locus_tag LOCUS_07360 33959 34828 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058023.1 protein_id gnl|my_center|LOCUS_07360 35090 36058 gene locus_tag LOCUS_07370 35090 36058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_07370 37303 36140 gene locus_tag LOCUS_07380 37303 36140 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_07380 >Feature sequence022 675 259 gene locus_tag LOCUS_07390 675 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 3234 748 gene locus_tag LOCUS_07400 3234 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 3441 4370 gene locus_tag LOCUS_07410 3441 4370 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057803.1 protein_id gnl|my_center|LOCUS_07410 5466 5233 gene locus_tag LOCUS_07420 5466 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 6923 5649 gene locus_tag LOCUS_07430 6923 5649 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056443.1 protein_id gnl|my_center|LOCUS_07430 8722 6920 gene locus_tag LOCUS_07440 8722 6920 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143414.1 protein_id gnl|my_center|LOCUS_07440 9312 8842 gene locus_tag LOCUS_07450 9312 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 11102 10509 gene locus_tag LOCUS_07460 gene sodC2 11102 10509 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ3 protein_id gnl|my_center|LOCUS_07460 11352 12020 gene locus_tag LOCUS_07470 11352 12020 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140026.1 protein_id gnl|my_center|LOCUS_07470 12665 18853 gene locus_tag LOCUS_07480 12665 18853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 20064 19027 gene locus_tag LOCUS_07490 20064 19027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 23289 20302 gene locus_tag LOCUS_07500 23289 20302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 24791 23493 gene locus_tag LOCUS_07510 gene aroA 24791 23493 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY3 protein_id gnl|my_center|LOCUS_07510 24938 25429 gene locus_tag LOCUS_07520 24938 25429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 25920 25423 gene locus_tag LOCUS_07530 25920 25423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 27353 26061 gene locus_tag LOCUS_07540 27353 26061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 27678 30683 gene locus_tag LOCUS_07550 gene uvrA 27678 30683 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD5 protein_id gnl|my_center|LOCUS_07550 30823 31065 gene locus_tag LOCUS_07560 30823 31065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 31686 31243 gene locus_tag LOCUS_07570 31686 31243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 32418 31690 gene locus_tag LOCUS_07580 gene tagA 32418 31690 CDS product acetyl-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 protein_id gnl|my_center|LOCUS_07580 33078 32800 gene locus_tag LOCUS_07590 33078 32800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143740.1 protein_id gnl|my_center|LOCUS_07590 33787 34005 gene locus_tag LOCUS_07600 33787 34005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 34099 34395 gene locus_tag LOCUS_07610 34099 34395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 34530 35129 gene locus_tag LOCUS_07620 34530 35129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 36425 35229 gene locus_tag LOCUS_07630 36425 35229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 36669 36842 gene locus_tag LOCUS_07640 36669 36842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 36928 37356 gene locus_tag LOCUS_07650 36928 37356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence023 373 209 gene locus_tag LOCUS_07660 373 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 2085 652 gene locus_tag LOCUS_07670 2085 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_07670 3175 2201 gene locus_tag LOCUS_07680 3175 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 5305 3653 gene locus_tag LOCUS_07690 5305 3653 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_07690 5923 5537 gene locus_tag LOCUS_07700 5923 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 7402 5927 gene locus_tag LOCUS_07710 7402 5927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 8628 7732 gene locus_tag LOCUS_07720 8628 7732 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086032.1 protein_id gnl|my_center|LOCUS_07720 8898 9506 gene locus_tag LOCUS_07730 8898 9506 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141157.1 protein_id gnl|my_center|LOCUS_07730 9702 10418 gene locus_tag LOCUS_07740 9702 10418 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_07740 10460 11122 gene locus_tag LOCUS_07750 10460 11122 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095411.1 protein_id gnl|my_center|LOCUS_07750 11126 12979 gene locus_tag LOCUS_07760 11126 12979 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879790.1 protein_id gnl|my_center|LOCUS_07760 13040 13603 gene locus_tag LOCUS_07770 13040 13603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 14537 13629 gene locus_tag LOCUS_07780 14537 13629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_07780 14572 15435 gene locus_tag LOCUS_07790 14572 15435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057503.1 protein_id gnl|my_center|LOCUS_07790 15596 15922 gene locus_tag LOCUS_07800 gene trxA1 15596 15922 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NF09 protein_id gnl|my_center|LOCUS_07800 16632 15967 gene locus_tag LOCUS_07810 16632 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143958.1 protein_id gnl|my_center|LOCUS_07810 17253 16696 gene locus_tag LOCUS_07820 gene gmk 17253 16696 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ7 protein_id gnl|my_center|LOCUS_07820 17574 17308 gene locus_tag LOCUS_07830 17574 17308 CDS product UPF0296 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ID1 protein_id gnl|my_center|LOCUS_07830 18018 18788 gene locus_tag LOCUS_07840 18018 18788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 19339 20664 gene locus_tag LOCUS_07850 19339 20664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 20932 21165 gene locus_tag LOCUS_07860 20932 21165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 21248 24064 gene locus_tag LOCUS_07870 21248 24064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 24198 25205 gene locus_tag LOCUS_07880 24198 25205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140531.1 protein_id gnl|my_center|LOCUS_07880 25768 25391 gene locus_tag LOCUS_07890 25768 25391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 26202 25993 gene locus_tag LOCUS_07900 26202 25993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 26402 28066 gene locus_tag LOCUS_07910 26402 28066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 28383 29861 gene locus_tag LOCUS_07920 28383 29861 CDS product regulator of sigma-B activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 protein_id gnl|my_center|LOCUS_07920 29839 30021 gene locus_tag LOCUS_07930 29839 30021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 30389 30835 gene locus_tag LOCUS_07940 30389 30835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 30924 32315 gene locus_tag LOCUS_07950 gene argH 30924 32315 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLW0 protein_id gnl|my_center|LOCUS_07950 32528 32779 gene locus_tag LOCUS_07960 32528 32779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 33010 33666 gene locus_tag LOCUS_07970 33010 33666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 33874 34350 gene locus_tag LOCUS_07980 33874 34350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 >Feature sequence024 1003 3726 gene locus_tag LOCUS_07990 1003 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 3744 5951 gene locus_tag LOCUS_08000 3744 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_08000 6023 7414 gene locus_tag LOCUS_08010 gene mviN 6023 7414 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183L8 protein_id gnl|my_center|LOCUS_08010 7426 8745 gene locus_tag LOCUS_08020 7426 8745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 8904 9725 gene locus_tag LOCUS_08030 8904 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 9785 10909 gene locus_tag LOCUS_08040 9785 10909 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_08040 10918 11763 gene locus_tag LOCUS_08050 10918 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 11806 12930 gene locus_tag LOCUS_08060 11806 12930 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202471.1 protein_id gnl|my_center|LOCUS_08060 12976 13677 gene locus_tag LOCUS_08070 12976 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975434.1 protein_id gnl|my_center|LOCUS_08070 13736 14563 gene locus_tag LOCUS_08080 13736 14563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 14714 15256 gene locus_tag LOCUS_08090 14714 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 15303 16457 gene locus_tag LOCUS_08100 15303 16457 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_08100 17072 16452 gene locus_tag LOCUS_08110 17072 16452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124316.1 protein_id gnl|my_center|LOCUS_08110 17184 18173 gene locus_tag LOCUS_08120 17184 18173 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946498.1 protein_id gnl|my_center|LOCUS_08120 18231 19217 gene locus_tag LOCUS_08130 gene rfe 18231 19217 CDS product UDP-N-acetylmuramyl pentapeptide phosphotransferase/UDP-N-acetylglucosamine-1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124832.1 protein_id gnl|my_center|LOCUS_08130 20478 19228 gene locus_tag LOCUS_08140 20478 19228 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143371.1 protein_id gnl|my_center|LOCUS_08140 21760 20591 gene locus_tag LOCUS_08150 21760 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058308.1 protein_id gnl|my_center|LOCUS_08150 22162 23100 gene locus_tag LOCUS_08160 22162 23100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056269.1 protein_id gnl|my_center|LOCUS_08160 23513 24178 gene locus_tag LOCUS_08170 23513 24178 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058278.1 protein_id gnl|my_center|LOCUS_08170 24369 24599 gene locus_tag LOCUS_08180 24369 24599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 24814 25815 gene locus_tag LOCUS_08190 gene mraY 24814 25815 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK95 protein_id gnl|my_center|LOCUS_08190 25929 26861 gene locus_tag LOCUS_08200 25929 26861 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902760.1 protein_id gnl|my_center|LOCUS_08200 27000 26925 gene locus_tag LOCUS_t00080 27000 26925 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 27449 28018 gene locus_tag LOCUS_08210 27449 28018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 27997 28707 gene locus_tag LOCUS_08220 27997 28707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 29916 28711 gene locus_tag LOCUS_08230 29916 28711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 30241 30651 gene locus_tag LOCUS_08240 30241 30651 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 protein_id gnl|my_center|LOCUS_08240 31044 33152 gene locus_tag LOCUS_08250 31044 33152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 33339 35144 gene locus_tag LOCUS_08260 gene ycf55 33339 35144 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058156.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence025 645 190 gene locus_tag LOCUS_08270 645 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1263 964 gene locus_tag LOCUS_08280 1263 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1434 1279 gene locus_tag LOCUS_08290 1434 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 3265 4065 gene locus_tag LOCUS_08300 3265 4065 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056155.1 protein_id gnl|my_center|LOCUS_08300 4755 4057 gene locus_tag LOCUS_08310 4755 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 protein_id gnl|my_center|LOCUS_08310 5080 5700 gene locus_tag LOCUS_08320 gene cobH 5080 5700 CDS product cobalt-precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056028.1 protein_id gnl|my_center|LOCUS_08320 5729 7078 gene locus_tag LOCUS_08330 gene cobL 5729 7078 CDS product precorrin-6Y C5,15-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056027.1 protein_id gnl|my_center|LOCUS_08330 7361 8749 gene locus_tag LOCUS_08340 7361 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 11623 9152 gene locus_tag LOCUS_08350 gene clpC 11623 9152 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_08350 12592 15378 gene locus_tag LOCUS_08360 gene secA 12592 15378 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHU4 protein_id gnl|my_center|LOCUS_08360 16139 15459 gene locus_tag LOCUS_08370 16139 15459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 17587 17925 gene locus_tag LOCUS_08380 17587 17925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 19348 17939 gene locus_tag LOCUS_08390 gene mnmE 19348 17939 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P1 protein_id gnl|my_center|LOCUS_08390 20500 19394 gene locus_tag LOCUS_08400 20500 19394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08400 20714 20430 gene locus_tag LOCUS_08410 20714 20430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 21113 20904 gene locus_tag LOCUS_08420 21113 20904 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358328.1 protein_id gnl|my_center|LOCUS_08420 21333 22193 gene locus_tag LOCUS_08430 21333 22193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 protein_id gnl|my_center|LOCUS_08430 23191 22496 gene locus_tag LOCUS_08440 23191 22496 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056649.1 protein_id gnl|my_center|LOCUS_08440 23878 23201 gene locus_tag LOCUS_08450 23878 23201 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_08450 25002 24169 gene locus_tag LOCUS_08460 25002 24169 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948304.1 protein_id gnl|my_center|LOCUS_08460 25561 25133 gene locus_tag LOCUS_08470 25561 25133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 26287 25661 gene locus_tag LOCUS_08480 26287 25661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 27275 26871 gene locus_tag LOCUS_08490 27275 26871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056319.1 protein_id gnl|my_center|LOCUS_08490 28241 27279 gene locus_tag LOCUS_08500 28241 27279 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 protein_id gnl|my_center|LOCUS_08500 28423 28238 gene locus_tag LOCUS_08510 28423 28238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08510 28682 28404 gene locus_tag LOCUS_08520 28682 28404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 29381 29034 gene locus_tag LOCUS_08530 29381 29034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 29700 29392 gene locus_tag LOCUS_08540 29700 29392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 31719 30253 gene locus_tag LOCUS_08550 gene ffh 31719 30253 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHI6 protein_id gnl|my_center|LOCUS_08550 31897 33774 gene locus_tag LOCUS_08560 31897 33774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143667.1 protein_id gnl|my_center|LOCUS_08560 33915 34472 gene locus_tag LOCUS_08570 33915 34472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence026 1559 291 gene locus_tag LOCUS_08580 1559 291 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086606.1 protein_id gnl|my_center|LOCUS_08580 1839 3053 gene locus_tag LOCUS_08590 gene solA 1839 3053 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLS3 protein_id gnl|my_center|LOCUS_08590 3064 4089 gene locus_tag LOCUS_08600 3064 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 5051 4182 gene locus_tag LOCUS_08610 5051 4182 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144410.1 protein_id gnl|my_center|LOCUS_08610 5394 5963 gene locus_tag LOCUS_08620 5394 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 6008 6358 gene locus_tag LOCUS_08630 6008 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 6378 6980 gene locus_tag LOCUS_08640 6378 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 7080 8180 gene locus_tag LOCUS_08650 7080 8180 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_08650 8304 9818 gene locus_tag LOCUS_08660 8304 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 9815 10264 gene locus_tag LOCUS_08670 9815 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 10310 12133 gene locus_tag LOCUS_08680 10310 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 12353 12697 gene locus_tag LOCUS_08690 gene btrV 12353 12697 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z841 protein_id gnl|my_center|LOCUS_08690 12681 13256 gene locus_tag LOCUS_08700 12681 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 13285 15402 gene locus_tag LOCUS_08710 gene glgX 13285 15402 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT9 protein_id gnl|my_center|LOCUS_08710 15438 15758 gene locus_tag LOCUS_08720 15438 15758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 15860 16303 gene locus_tag LOCUS_08730 15860 16303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 16475 17227 gene locus_tag LOCUS_08740 16475 17227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_08740 17228 17980 gene locus_tag LOCUS_08750 17228 17980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_08750 21664 18017 gene locus_tag LOCUS_08760 gene dnaE 21664 18017 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCI9 protein_id gnl|my_center|LOCUS_08760 21843 23621 gene locus_tag LOCUS_08770 gene menD 21843 23621 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI6 protein_id gnl|my_center|LOCUS_08770 23937 23623 gene locus_tag LOCUS_08780 23937 23623 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143672.1 protein_id gnl|my_center|LOCUS_08780 25169 24402 gene locus_tag LOCUS_08790 25169 24402 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057529.1 protein_id gnl|my_center|LOCUS_08790 26007 25327 gene locus_tag LOCUS_08800 gene pspA 26007 25327 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_08800 27129 26044 gene locus_tag LOCUS_08810 27129 26044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 28052 31186 gene locus_tag LOCUS_08820 28052 31186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 32015 31257 gene locus_tag LOCUS_08830 32015 31257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 34521 32008 gene locus_tag LOCUS_08840 34521 32008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 35038 34817 gene locus_tag LOCUS_08850 35038 34817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence027 857 507 gene locus_tag LOCUS_08860 857 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 949 1263 gene locus_tag LOCUS_08870 949 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1814 1365 gene locus_tag LOCUS_08880 1814 1365 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057301.1 protein_id gnl|my_center|LOCUS_08880 2647 3546 gene locus_tag LOCUS_08890 2647 3546 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_08890 3872 3540 gene locus_tag LOCUS_08900 3872 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 5764 4583 gene locus_tag LOCUS_08910 5764 4583 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028892.1 protein_id gnl|my_center|LOCUS_08910 6355 6065 gene locus_tag LOCUS_08920 6355 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 6921 6718 gene locus_tag LOCUS_08930 6921 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 7429 11874 gene locus_tag LOCUS_08940 7429 11874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 12430 12047 gene locus_tag LOCUS_08950 12430 12047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056602.1 protein_id gnl|my_center|LOCUS_08950 12980 12648 gene locus_tag LOCUS_08960 12980 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056733.1 protein_id gnl|my_center|LOCUS_08960 13711 13094 gene locus_tag LOCUS_08970 gene pyrE 13711 13094 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW5 protein_id gnl|my_center|LOCUS_08970 13826 14236 gene locus_tag LOCUS_08980 13826 14236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 14897 14346 gene locus_tag LOCUS_08990 gene adk 14897 14346 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D7W7 protein_id gnl|my_center|LOCUS_08990 15404 15093 gene locus_tag LOCUS_09000 15404 15093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 16961 15627 gene locus_tag LOCUS_09010 16961 15627 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_09010 17411 18637 gene locus_tag LOCUS_09020 17411 18637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 18653 21805 gene locus_tag LOCUS_09030 18653 21805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_09030 21885 22226 gene locus_tag LOCUS_09040 21885 22226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 24290 22215 gene locus_tag LOCUS_09050 24290 22215 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057481.1 protein_id gnl|my_center|LOCUS_09050 25180 24431 gene locus_tag LOCUS_09060 25180 24431 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_09060 25975 25229 gene locus_tag LOCUS_09070 25975 25229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 protein_id gnl|my_center|LOCUS_09070 27379 26207 gene locus_tag LOCUS_09080 gene uraA 27379 26207 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938325.1 protein_id gnl|my_center|LOCUS_09080 27547 28734 gene locus_tag LOCUS_09090 27547 28734 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 protein_id gnl|my_center|LOCUS_09090 30413 28731 gene locus_tag LOCUS_09100 30413 28731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 30471 30668 gene locus_tag LOCUS_09110 30471 30668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 31306 33996 gene locus_tag LOCUS_09120 31306 33996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence028 705 1235 gene locus_tag LOCUS_09130 705 1235 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93J09 protein_id gnl|my_center|LOCUS_09130 2566 1319 gene locus_tag LOCUS_09140 2566 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 4264 3536 gene locus_tag LOCUS_09150 4264 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 5295 4753 gene locus_tag LOCUS_09160 5295 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 5990 5445 gene locus_tag LOCUS_09170 5990 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 6724 7380 gene locus_tag LOCUS_09180 6724 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 7428 8357 gene locus_tag LOCUS_09190 7428 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 8384 10717 gene locus_tag LOCUS_09200 8384 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 10722 11543 gene locus_tag LOCUS_09210 10722 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 13258 11561 gene locus_tag LOCUS_09220 13258 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 13956 13534 gene locus_tag LOCUS_09230 13956 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 14155 15579 gene locus_tag LOCUS_09240 14155 15579 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLC0 protein_id gnl|my_center|LOCUS_09240 17616 15670 gene locus_tag LOCUS_09250 17616 15670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 18525 20177 gene locus_tag LOCUS_09260 18525 20177 CDS product fused response regulator/thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_09260 20210 21649 gene locus_tag LOCUS_09270 20210 21649 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142209.1 protein_id gnl|my_center|LOCUS_09270 22660 32976 gene locus_tag LOCUS_09280 22660 32976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 33044 33220 gene locus_tag LOCUS_09290 33044 33220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09290 33357 33998 gene locus_tag LOCUS_09300 gene pdxH 33357 33998 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZE19 protein_id gnl|my_center|LOCUS_09300 >Feature sequence029 1350 220 gene locus_tag LOCUS_09310 1350 220 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889292.1 protein_id gnl|my_center|LOCUS_09310 1524 2717 gene locus_tag LOCUS_09320 1524 2717 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057595.1 protein_id gnl|my_center|LOCUS_09320 3472 2858 gene locus_tag LOCUS_09330 3472 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_09330 3795 4310 gene locus_tag LOCUS_09340 3795 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 4936 4403 gene locus_tag LOCUS_09350 4936 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701028.1 protein_id gnl|my_center|LOCUS_09350 5933 6562 gene locus_tag LOCUS_09360 gene cobO 5933 6562 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056120.1 protein_id gnl|my_center|LOCUS_09360 7858 6671 gene locus_tag LOCUS_09370 7858 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 10153 7958 gene locus_tag LOCUS_09380 10153 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 10363 10809 gene locus_tag LOCUS_09390 10363 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 11052 10852 gene locus_tag LOCUS_09400 11052 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 11537 12142 gene locus_tag LOCUS_09410 11537 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 12466 12239 gene locus_tag LOCUS_09420 12466 12239 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYS0 protein_id gnl|my_center|LOCUS_09420 13294 12479 gene locus_tag LOCUS_09430 13294 12479 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_09430 14208 13621 gene locus_tag LOCUS_09440 gene psaF 14208 13621 CDS product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A401 protein_id gnl|my_center|LOCUS_09440 14436 15476 gene locus_tag LOCUS_09450 gene tsaD 14436 15476 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI9 protein_id gnl|my_center|LOCUS_09450 15795 16019 gene locus_tag LOCUS_09460 15795 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 16094 17179 gene locus_tag LOCUS_09470 16094 17179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057388.1 protein_id gnl|my_center|LOCUS_09470 19232 17256 gene locus_tag LOCUS_09480 gene htpG 19232 17256 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN1 protein_id gnl|my_center|LOCUS_09480 20086 19340 gene locus_tag LOCUS_09490 20086 19340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 21014 20208 gene locus_tag LOCUS_09500 21014 20208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 21091 22092 gene locus_tag LOCUS_09510 21091 22092 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_09510 23013 22075 gene locus_tag LOCUS_09520 23013 22075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 23159 24145 gene locus_tag LOCUS_09530 23159 24145 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_09530 25335 24169 gene locus_tag LOCUS_09540 25335 24169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 26308 25337 gene locus_tag LOCUS_09550 26308 25337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 27303 26341 gene locus_tag LOCUS_09560 27303 26341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 27612 28574 gene locus_tag LOCUS_09570 27612 28574 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_09570 28779 30206 gene locus_tag LOCUS_09580 28779 30206 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_09580 30377 31267 gene locus_tag LOCUS_09590 gene mrr 30377 31267 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053942.1 protein_id gnl|my_center|LOCUS_09590 31999 31280 gene locus_tag LOCUS_09600 gene ribC 31999 31280 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057523.1 protein_id gnl|my_center|LOCUS_09600 32112 32618 gene locus_tag LOCUS_09610 32112 32618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057876.1 protein_id gnl|my_center|LOCUS_09610 32655 33776 gene locus_tag LOCUS_09620 32655 33776 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence030 332 877 gene locus_tag LOCUS_09630 332 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 902 1849 gene locus_tag LOCUS_09640 902 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2100 2639 gene locus_tag LOCUS_09650 2100 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546171.1 protein_id gnl|my_center|LOCUS_09650 3741 2923 gene locus_tag LOCUS_09660 gene pstB 3741 2923 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCU7 protein_id gnl|my_center|LOCUS_09660 4695 3805 gene locus_tag LOCUS_09670 4695 3805 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG4 protein_id gnl|my_center|LOCUS_09670 5676 4717 gene locus_tag LOCUS_09680 gene pstC 5676 4717 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCZ1 protein_id gnl|my_center|LOCUS_09680 6914 5769 gene locus_tag LOCUS_09690 6914 5769 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIZ8 protein_id gnl|my_center|LOCUS_09690 7120 7509 gene locus_tag LOCUS_09700 7120 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 7698 9191 gene locus_tag LOCUS_09710 gene proS 7698 9191 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A988 protein_id gnl|my_center|LOCUS_09710 9578 12112 gene locus_tag LOCUS_09720 9578 12112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 12867 12133 gene locus_tag LOCUS_09730 12867 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141101.1 protein_id gnl|my_center|LOCUS_09730 13920 13069 gene locus_tag LOCUS_09740 13920 13069 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_09740 15900 13939 gene locus_tag LOCUS_09750 15900 13939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 16068 17285 gene locus_tag LOCUS_09760 16068 17285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 17407 17625 gene locus_tag LOCUS_09770 17407 17625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 17786 18460 gene locus_tag LOCUS_09780 17786 18460 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057765.1 protein_id gnl|my_center|LOCUS_09780 18852 18481 gene locus_tag LOCUS_09790 18852 18481 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 protein_id gnl|my_center|LOCUS_09790 20181 19039 gene locus_tag LOCUS_09800 20181 19039 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056200.1 protein_id gnl|my_center|LOCUS_09800 21106 22929 gene locus_tag LOCUS_09810 21106 22929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 22922 24271 gene locus_tag LOCUS_09820 22922 24271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 24268 25158 gene locus_tag LOCUS_09830 24268 25158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 25310 25786 gene locus_tag LOCUS_09840 25310 25786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 25824 28337 gene locus_tag LOCUS_09850 gene comE 25824 28337 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057539.1 protein_id gnl|my_center|LOCUS_09850 28384 28477 gene locus_tag LOCUS_t00090 28384 28477 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28968 30701 gene locus_tag LOCUS_09860 28968 30701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 30909 32015 gene locus_tag LOCUS_09870 gene hrcA 30909 32015 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU4 protein_id gnl|my_center|LOCUS_09870 32209 33132 gene locus_tag LOCUS_09880 32209 33132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence031 525 229 gene locus_tag LOCUS_09890 gene rplY 525 229 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG3 protein_id gnl|my_center|LOCUS_09890 1434 3746 gene locus_tag LOCUS_09900 gene glgB 1434 3746 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB8 protein_id gnl|my_center|LOCUS_09900 4046 4285 gene locus_tag LOCUS_09910 4046 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 4637 4564 gene locus_tag LOCUS_t00100 4637 4564 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5935 4829 gene locus_tag LOCUS_09920 5935 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 6551 5922 gene locus_tag LOCUS_09930 6551 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869506.1 protein_id gnl|my_center|LOCUS_09930 7572 7081 gene locus_tag LOCUS_09940 gene ycf52 7572 7081 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 protein_id gnl|my_center|LOCUS_09940 7703 8428 gene locus_tag LOCUS_09950 7703 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057518.1 protein_id gnl|my_center|LOCUS_09950 9429 8542 gene locus_tag LOCUS_09960 9429 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056085.1 protein_id gnl|my_center|LOCUS_09960 10039 9548 gene locus_tag LOCUS_09970 10039 9548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056084.1 protein_id gnl|my_center|LOCUS_09970 10394 10609 gene locus_tag LOCUS_09980 10394 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 10709 11743 gene locus_tag LOCUS_09990 10709 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 13888 11948 gene locus_tag LOCUS_10000 gene glmS 13888 11948 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJI6 protein_id gnl|my_center|LOCUS_10000 15252 14038 gene locus_tag LOCUS_10010 15252 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 15315 16907 gene locus_tag LOCUS_10020 15315 16907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 16913 18625 gene locus_tag LOCUS_10030 16913 18625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 18674 19369 gene locus_tag LOCUS_10040 18674 19369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261156.1 protein_id gnl|my_center|LOCUS_10040 21124 19373 gene locus_tag LOCUS_10050 21124 19373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 21211 22005 gene locus_tag LOCUS_10060 21211 22005 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705617.1 protein_id gnl|my_center|LOCUS_10060 22024 23757 gene locus_tag LOCUS_10070 22024 23757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 23766 25340 gene locus_tag LOCUS_10080 23766 25340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 25634 28249 gene locus_tag LOCUS_10090 25634 28249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 28757 28296 gene locus_tag LOCUS_10100 28757 28296 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_10100 <32996 28895 gene locus_tag LOCUS_10110 <32996 28895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence032 881 1282 gene locus_tag LOCUS_10120 881 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2364 1279 gene locus_tag LOCUS_10130 2364 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057198.1 protein_id gnl|my_center|LOCUS_10130 3399 2398 gene locus_tag LOCUS_10140 gene ntcB 3399 2398 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057199.1 protein_id gnl|my_center|LOCUS_10140 4768 3524 gene locus_tag LOCUS_10150 4768 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 4928 5374 gene locus_tag LOCUS_10160 4928 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 5970 5482 gene locus_tag LOCUS_10170 5970 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056672.1 protein_id gnl|my_center|LOCUS_10170 7800 6094 gene locus_tag LOCUS_10180 7800 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057437.1 protein_id gnl|my_center|LOCUS_10180 9462 8239 gene locus_tag LOCUS_10190 gene corA 9462 8239 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 protein_id gnl|my_center|LOCUS_10190 11564 9531 gene locus_tag LOCUS_10200 11564 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 12263 12811 gene locus_tag LOCUS_10210 12263 12811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 14100 13147 gene locus_tag LOCUS_10220 14100 13147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141888.1 protein_id gnl|my_center|LOCUS_10220 14823 16529 gene locus_tag LOCUS_10230 14823 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 17133 16534 gene locus_tag LOCUS_10240 17133 16534 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS3 protein_id gnl|my_center|LOCUS_10240 19466 18114 gene locus_tag LOCUS_10250 19466 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 20146 19667 gene locus_tag LOCUS_10260 20146 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 20476 20246 gene locus_tag LOCUS_10270 20476 20246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 20651 20463 gene locus_tag LOCUS_10280 20651 20463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 23759 20784 gene locus_tag LOCUS_10290 gene putA 23759 20784 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056271.1 protein_id gnl|my_center|LOCUS_10290 24169 23858 gene locus_tag LOCUS_10300 24169 23858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 24382 24999 gene locus_tag LOCUS_10310 24382 24999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 25736 25008 gene locus_tag LOCUS_10320 25736 25008 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939178.1 protein_id gnl|my_center|LOCUS_10320 25851 26270 gene locus_tag LOCUS_10330 25851 26270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 27087 26497 gene locus_tag LOCUS_10340 27087 26497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 27894 28334 gene locus_tag LOCUS_10350 27894 28334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 28696 31149 gene locus_tag LOCUS_10360 gene leuS 28696 31149 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH61 protein_id gnl|my_center|LOCUS_10360 31625 31182 gene locus_tag LOCUS_10370 31625 31182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence033 5726 2058 gene locus_tag LOCUS_10380 5726 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_10380 6175 7395 gene locus_tag LOCUS_10390 6175 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 7677 8069 gene locus_tag LOCUS_10400 7677 8069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 8387 8620 gene locus_tag LOCUS_10410 8387 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10410 8893 10587 gene locus_tag LOCUS_10420 8893 10587 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_10420 10970 10566 gene locus_tag LOCUS_10430 10970 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10430 11636 11037 gene locus_tag LOCUS_10440 11636 11037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 11722 12363 gene locus_tag LOCUS_10450 11722 12363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 12818 12456 gene locus_tag LOCUS_10460 12818 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 13659 15053 gene locus_tag LOCUS_10470 13659 15053 CDS product putative bicarbonate transporter, IctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058082.1 protein_id gnl|my_center|LOCUS_10470 15200 16990 gene locus_tag LOCUS_10480 15200 16990 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903944.1 protein_id gnl|my_center|LOCUS_10480 17506 20352 gene locus_tag LOCUS_10490 17506 20352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 21387 20707 gene locus_tag LOCUS_10500 21387 20707 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK42 protein_id gnl|my_center|LOCUS_10500 22230 21571 gene locus_tag LOCUS_10510 gene ycf39 22230 21571 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056872.1 protein_id gnl|my_center|LOCUS_10510 22374 23096 gene locus_tag LOCUS_10520 22374 23096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 23750 23313 gene locus_tag LOCUS_10530 23750 23313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144373.1 protein_id gnl|my_center|LOCUS_10530 24086 23781 gene locus_tag LOCUS_10540 24086 23781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 24366 25595 gene locus_tag LOCUS_10550 gene sbcD 24366 25595 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHI2 protein_id gnl|my_center|LOCUS_10550 25713 28160 gene locus_tag LOCUS_10560 25713 28160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 28900 28703 gene locus_tag LOCUS_10570 28900 28703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 28961 29206 gene locus_tag LOCUS_10580 28961 29206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 30954 29452 gene locus_tag LOCUS_10590 gene gatA 30954 29452 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK65 protein_id gnl|my_center|LOCUS_10590 >Feature sequence034 1990 899 gene locus_tag LOCUS_10600 1990 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3294 2023 gene locus_tag LOCUS_10610 3294 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 3894 3301 gene locus_tag LOCUS_10620 3894 3301 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_10620 5243 3903 gene locus_tag LOCUS_10630 gene lysA 5243 3903 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971789.1 protein_id gnl|my_center|LOCUS_10630 5676 5891 gene locus_tag LOCUS_10640 5676 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 6112 5942 gene locus_tag LOCUS_10650 6112 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10650 6266 7204 gene locus_tag LOCUS_10660 6266 7204 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125164.1 protein_id gnl|my_center|LOCUS_10660 11147 7224 gene locus_tag LOCUS_10670 11147 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 11788 12030 gene locus_tag LOCUS_10680 11788 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 13032 12040 gene locus_tag LOCUS_10690 gene pyrB 13032 12040 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM4 protein_id gnl|my_center|LOCUS_10690 13615 13130 gene locus_tag LOCUS_10700 13615 13130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140611.1 protein_id gnl|my_center|LOCUS_10700 14090 13857 gene locus_tag LOCUS_10710 14090 13857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 14746 14916 gene locus_tag LOCUS_10720 14746 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 15014 16237 gene locus_tag LOCUS_10730 15014 16237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10730 16215 16706 gene locus_tag LOCUS_10740 16215 16706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 17971 16874 gene locus_tag LOCUS_10750 gene thrC 17971 16874 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJJ6 protein_id gnl|my_center|LOCUS_10750 18226 18480 gene locus_tag LOCUS_10760 18226 18480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 19073 18795 gene locus_tag LOCUS_10770 gene ycf19 19073 18795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143529.1 protein_id gnl|my_center|LOCUS_10770 19464 19153 gene locus_tag LOCUS_10780 19464 19153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 20179 19529 gene locus_tag LOCUS_10790 20179 19529 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI28 protein_id gnl|my_center|LOCUS_10790 20246 21100 gene locus_tag LOCUS_10800 20246 21100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 21116 21466 gene locus_tag LOCUS_10810 21116 21466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 21538 22524 gene locus_tag LOCUS_10820 21538 22524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 22487 23776 gene locus_tag LOCUS_10830 22487 23776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 24693 24025 gene locus_tag LOCUS_10840 gene rsmG 24693 24025 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMQ7 protein_id gnl|my_center|LOCUS_10840 26196 24883 gene locus_tag LOCUS_10850 26196 24883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 30170 26235 gene locus_tag LOCUS_10860 30170 26235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence035 3227 870 gene locus_tag LOCUS_10870 3227 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 3383 4060 gene locus_tag LOCUS_10880 3383 4060 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 protein_id gnl|my_center|LOCUS_10880 4934 7360 gene locus_tag LOCUS_10890 4934 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 7976 7473 gene locus_tag LOCUS_10900 7976 7473 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944499.1 protein_id gnl|my_center|LOCUS_10900 8616 8020 gene locus_tag LOCUS_10910 8616 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 9047 8766 gene locus_tag LOCUS_10920 9047 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 9380 10558 gene locus_tag LOCUS_10930 9380 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 10831 11154 gene locus_tag LOCUS_10940 gene minE 10831 11154 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE1 protein_id gnl|my_center|LOCUS_10940 11403 12851 gene locus_tag LOCUS_10950 gene atpD 11403 12851 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG8 protein_id gnl|my_center|LOCUS_10950 12933 13346 gene locus_tag LOCUS_10960 gene atpC 12933 13346 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG7 protein_id gnl|my_center|LOCUS_10960 13721 13422 gene locus_tag LOCUS_10970 13721 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058081.1 protein_id gnl|my_center|LOCUS_10970 14465 13845 gene locus_tag LOCUS_10980 14465 13845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057787.1 protein_id gnl|my_center|LOCUS_10980 14803 14582 gene locus_tag LOCUS_10990 gene cp12 14803 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057657.1 protein_id gnl|my_center|LOCUS_10990 15064 16317 gene locus_tag LOCUS_11000 15064 16317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_11000 17273 16428 gene locus_tag LOCUS_11010 17273 16428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 17708 17379 gene locus_tag LOCUS_11020 17708 17379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 19052 17709 gene locus_tag LOCUS_11030 19052 17709 CDS product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704153.1 protein_id gnl|my_center|LOCUS_11030 19974 19339 gene locus_tag LOCUS_11040 gene trpF 19974 19339 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NML1 protein_id gnl|my_center|LOCUS_11040 20229 20510 gene locus_tag LOCUS_11050 gene psaK 20229 20510 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A425 protein_id gnl|my_center|LOCUS_11050 20714 21910 gene locus_tag LOCUS_11060 20714 21910 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057144.1 protein_id gnl|my_center|LOCUS_11060 22639 21893 gene locus_tag LOCUS_11070 22639 21893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056083.1 protein_id gnl|my_center|LOCUS_11070 22898 23512 gene locus_tag LOCUS_11080 22898 23512 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ09 protein_id gnl|my_center|LOCUS_11080 23706 23777 gene locus_tag LOCUS_t00110 23706 23777 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24536 23808 gene locus_tag LOCUS_11090 24536 23808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_11090 25839 24589 gene locus_tag LOCUS_11100 25839 24589 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176601.1 protein_id gnl|my_center|LOCUS_11100 27271 25949 gene locus_tag LOCUS_11110 27271 25949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 29002 27770 gene locus_tag LOCUS_11120 29002 27770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144202.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence036 1518 454 gene locus_tag LOCUS_11130 gene psbA1 1518 454 CDS product photosystem II protein D1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A444 protein_id gnl|my_center|LOCUS_11130 2600 1839 gene locus_tag LOCUS_11140 gene cpcG4 2600 1839 CDS product phycobilisome rod-core linker polypeptide CpcG4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50041 protein_id gnl|my_center|LOCUS_11140 3707 2925 gene locus_tag LOCUS_11150 3707 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 4049 4990 gene locus_tag LOCUS_11160 4049 4990 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_11160 5114 5650 gene locus_tag LOCUS_11170 5114 5650 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408503.1 protein_id gnl|my_center|LOCUS_11170 6120 6848 gene locus_tag LOCUS_11180 gene pyrH 6120 6848 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM63 protein_id gnl|my_center|LOCUS_11180 6835 7383 gene locus_tag LOCUS_11190 gene frr 6835 7383 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM64 protein_id gnl|my_center|LOCUS_11190 7775 8875 gene locus_tag LOCUS_11200 7775 8875 CDS product geranylgeranyl bacteriochlorophyll reductase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058112.1 protein_id gnl|my_center|LOCUS_11200 9686 9096 gene locus_tag LOCUS_11210 9686 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11210 9783 9580 gene locus_tag LOCUS_11220 9783 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 10596 11090 gene locus_tag LOCUS_11230 10596 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 11398 11478 gene locus_tag LOCUS_t00120 11398 11478 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11612 12712 gene locus_tag LOCUS_11240 gene chlI 11612 12712 CDS product Mg-protoporphyrin IX chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS0 protein_id gnl|my_center|LOCUS_11240 12743 13252 gene locus_tag LOCUS_11250 gene ruvC 12743 13252 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG73 protein_id gnl|my_center|LOCUS_11250 13224 13631 gene locus_tag LOCUS_11260 13224 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 14800 14225 gene locus_tag LOCUS_11270 14800 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 16491 14881 gene locus_tag LOCUS_11280 16491 14881 CDS product competence protein ComE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058172.1 protein_id gnl|my_center|LOCUS_11280 16915 17208 gene locus_tag LOCUS_11290 16915 17208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 17307 18482 gene locus_tag LOCUS_11300 gene nifS 17307 18482 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056757.1 protein_id gnl|my_center|LOCUS_11300 18687 18872 gene locus_tag LOCUS_11310 18687 18872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 20049 19165 gene locus_tag LOCUS_11320 20049 19165 CDS product acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203012.1 protein_id gnl|my_center|LOCUS_11320 21405 20122 gene locus_tag LOCUS_11330 21405 20122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 21486 22538 gene locus_tag LOCUS_11340 21486 22538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 22727 23779 gene locus_tag LOCUS_11350 22727 23779 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104357.1 protein_id gnl|my_center|LOCUS_11350 24745 23885 gene locus_tag LOCUS_11360 24745 23885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 26251 24752 gene locus_tag LOCUS_11370 26251 24752 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141779.1 protein_id gnl|my_center|LOCUS_11370 27623 26256 gene locus_tag LOCUS_11380 27623 26256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 28620 27745 gene locus_tag LOCUS_11390 28620 27745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143505.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence037 1437 256 gene locus_tag LOCUS_11400 1437 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2093 1482 gene locus_tag LOCUS_11410 2093 1482 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 protein_id gnl|my_center|LOCUS_11410 3812 2220 gene locus_tag LOCUS_11420 gene metG 3812 2220 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59081 protein_id gnl|my_center|LOCUS_11420 4617 5633 gene locus_tag LOCUS_11430 4617 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 5667 5954 gene locus_tag LOCUS_11440 5667 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 6007 7182 gene locus_tag LOCUS_11450 6007 7182 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_11450 7475 8428 gene locus_tag LOCUS_11460 7475 8428 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806945.1 protein_id gnl|my_center|LOCUS_11460 8702 9427 gene locus_tag LOCUS_11470 8702 9427 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142237.1 protein_id gnl|my_center|LOCUS_11470 10730 9465 gene locus_tag LOCUS_11480 10730 9465 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028668.1 protein_id gnl|my_center|LOCUS_11480 11185 12867 gene locus_tag LOCUS_11490 11185 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 13619 14761 gene locus_tag LOCUS_11500 13619 14761 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797113.1 protein_id gnl|my_center|LOCUS_11500 15255 16790 gene locus_tag LOCUS_11510 15255 16790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056025.1 protein_id gnl|my_center|LOCUS_11510 18508 16820 gene locus_tag LOCUS_11520 18508 16820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057554.1 protein_id gnl|my_center|LOCUS_11520 20381 18633 gene locus_tag LOCUS_11530 20381 18633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057554.1 protein_id gnl|my_center|LOCUS_11530 20361 20289 gene locus_tag LOCUS_t00130 20361 20289 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21103 21426 gene locus_tag LOCUS_11540 21103 21426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 22242 21976 gene locus_tag LOCUS_11550 gene psaK 22242 21976 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125081.1 protein_id gnl|my_center|LOCUS_11550 22475 23419 gene locus_tag LOCUS_11560 gene speE 22475 23419 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Z7 protein_id gnl|my_center|LOCUS_11560 23706 24776 gene locus_tag LOCUS_11570 23706 24776 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076036.1 protein_id gnl|my_center|LOCUS_11570 25727 25386 gene locus_tag LOCUS_11580 25727 25386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 26060 27958 gene locus_tag LOCUS_11590 26060 27958 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 protein_id gnl|my_center|LOCUS_11590 28193 29050 gene locus_tag LOCUS_11600 28193 29050 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142171.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence038 <1 550 gene locus_tag LOCUS_11610 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141007.1:carbon dioxide transporter 3053 813 gene locus_tag LOCUS_11620 3053 813 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141880.1 protein_id gnl|my_center|LOCUS_11620 4082 3171 gene locus_tag LOCUS_11630 4082 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_11630 4372 4593 gene locus_tag LOCUS_11640 4372 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 4514 7252 gene locus_tag LOCUS_11650 4514 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 8100 7261 gene locus_tag LOCUS_11660 8100 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057850.1 protein_id gnl|my_center|LOCUS_11660 8444 8283 gene locus_tag LOCUS_11670 8444 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 9990 8848 gene locus_tag LOCUS_11680 gene anmK 9990 8848 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC2 protein_id gnl|my_center|LOCUS_11680 10737 9994 gene locus_tag LOCUS_11690 10737 9994 CDS product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_11690 12944 11166 gene locus_tag LOCUS_11700 12944 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058075.1 protein_id gnl|my_center|LOCUS_11700 13424 13125 gene locus_tag LOCUS_11710 13424 13125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144163.1 protein_id gnl|my_center|LOCUS_11710 14581 13673 gene locus_tag LOCUS_11720 gene cdsA 14581 13673 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 protein_id gnl|my_center|LOCUS_11720 15296 14694 gene locus_tag LOCUS_11730 gene cobL 15296 14694 CDS product precorrin-6B methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 protein_id gnl|my_center|LOCUS_11730 16831 15320 gene locus_tag LOCUS_11740 16831 15320 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_11740 17246 17614 gene locus_tag LOCUS_11750 17246 17614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 17793 18917 gene locus_tag LOCUS_11760 gene tgt 17793 18917 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM7 protein_id gnl|my_center|LOCUS_11760 19836 19282 gene locus_tag LOCUS_11770 19836 19282 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031671.1 protein_id gnl|my_center|LOCUS_11770 20268 20050 gene locus_tag LOCUS_11780 20268 20050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 20791 23379 gene locus_tag LOCUS_11790 20791 23379 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122988.1 protein_id gnl|my_center|LOCUS_11790 23611 24159 gene locus_tag LOCUS_11800 23611 24159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 24159 24386 gene locus_tag LOCUS_11810 24159 24386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 24508 24909 gene locus_tag LOCUS_11820 24508 24909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 24946 25164 gene locus_tag LOCUS_11830 24946 25164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 25326 26720 gene locus_tag LOCUS_11840 25326 26720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence039 413 1162 gene locus_tag LOCUS_11850 413 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058095.1 protein_id gnl|my_center|LOCUS_11850 1293 2426 gene locus_tag LOCUS_11860 1293 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2642 3391 gene locus_tag LOCUS_11870 2642 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3658 4554 gene locus_tag LOCUS_11880 3658 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 5715 4663 gene locus_tag LOCUS_11890 5715 4663 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 protein_id gnl|my_center|LOCUS_11890 5817 8507 gene locus_tag LOCUS_11900 5817 8507 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_11900 10755 8509 gene locus_tag LOCUS_11910 10755 8509 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058113.1 protein_id gnl|my_center|LOCUS_11910 11654 10938 gene locus_tag LOCUS_11920 11654 10938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 12951 11815 gene locus_tag LOCUS_11930 12951 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 13715 13293 gene locus_tag LOCUS_11940 13715 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 14279 13800 gene locus_tag LOCUS_11950 14279 13800 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_11950 15678 14509 gene locus_tag LOCUS_11960 15678 14509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057105.1 protein_id gnl|my_center|LOCUS_11960 16114 15797 gene locus_tag LOCUS_11970 16114 15797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057859.1 protein_id gnl|my_center|LOCUS_11970 16985 16320 gene locus_tag LOCUS_11980 16985 16320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 17225 18559 gene locus_tag LOCUS_11990 17225 18559 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057131.1 protein_id gnl|my_center|LOCUS_11990 19057 19281 gene locus_tag LOCUS_12000 gene ftrV 19057 19281 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057357.1 protein_id gnl|my_center|LOCUS_12000 19880 19353 gene locus_tag LOCUS_12010 19880 19353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 20025 20372 gene locus_tag LOCUS_12020 gene psb28 20025 20372 CDS product photosystem II reaction center Psb28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ8 protein_id gnl|my_center|LOCUS_12020 20398 20916 gene locus_tag LOCUS_12030 gene moaB 20398 20916 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34457 protein_id gnl|my_center|LOCUS_12030 21501 21175 gene locus_tag LOCUS_12040 gene clpS 21501 21175 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJY3 protein_id gnl|my_center|LOCUS_12040 21673 22296 gene locus_tag LOCUS_12050 21673 22296 CDS product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 protein_id gnl|my_center|LOCUS_12050 22383 22595 gene locus_tag LOCUS_12060 22383 22595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058299.1 protein_id gnl|my_center|LOCUS_12060 22697 23944 gene locus_tag LOCUS_12070 22697 23944 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058298.1 protein_id gnl|my_center|LOCUS_12070 24264 24055 gene locus_tag LOCUS_12080 24264 24055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 24404 26119 gene locus_tag LOCUS_12090 gene groL2 24404 26119 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7MBB4 protein_id gnl|my_center|LOCUS_12090 26334 26251 gene locus_tag LOCUS_t00140 26334 26251 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27519 26458 gene locus_tag LOCUS_12100 gene glk 27519 26458 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIT6 protein_id gnl|my_center|LOCUS_12100 27957 27601 gene locus_tag LOCUS_12110 gene cccA 27957 27601 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124730.1 protein_id gnl|my_center|LOCUS_12110 28833 28531 gene locus_tag LOCUS_12120 28833 28531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 29190 28993 gene locus_tag LOCUS_12130 29190 28993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence040 2360 1866 gene locus_tag LOCUS_12140 gene purE 2360 1866 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB0 protein_id gnl|my_center|LOCUS_12140 2427 3641 gene locus_tag LOCUS_12150 2427 3641 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH66 protein_id gnl|my_center|LOCUS_12150 3717 3929 gene locus_tag LOCUS_12160 3717 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 protein_id gnl|my_center|LOCUS_12160 4387 4731 gene locus_tag LOCUS_12170 4387 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057900.1 protein_id gnl|my_center|LOCUS_12170 4878 5753 gene locus_tag LOCUS_12180 4878 5753 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057901.1 protein_id gnl|my_center|LOCUS_12180 6222 5962 gene locus_tag LOCUS_12190 6222 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 6399 7118 gene locus_tag LOCUS_12200 6399 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 7827 10889 gene locus_tag LOCUS_12210 7827 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 11104 12675 gene locus_tag LOCUS_12220 11104 12675 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975076.1 protein_id gnl|my_center|LOCUS_12220 12786 13154 gene locus_tag LOCUS_12230 12786 13154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 13575 14420 gene locus_tag LOCUS_12240 gene gcd1 13575 14420 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 protein_id gnl|my_center|LOCUS_12240 14583 16643 gene locus_tag LOCUS_12250 14583 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 16767 17549 gene locus_tag LOCUS_12260 16767 17549 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975514.1 protein_id gnl|my_center|LOCUS_12260 17543 19660 gene locus_tag LOCUS_12270 17543 19660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 19679 20506 gene locus_tag LOCUS_12280 19679 20506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 20852 22789 gene locus_tag LOCUS_12290 20852 22789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 23685 23074 gene locus_tag LOCUS_12300 23685 23074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 23903 24367 gene locus_tag LOCUS_12310 23903 24367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056684.1 protein_id gnl|my_center|LOCUS_12310 25665 24403 gene locus_tag LOCUS_12320 25665 24403 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403412.1 protein_id gnl|my_center|LOCUS_12320 25684 26046 gene locus_tag LOCUS_12330 25684 26046 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402975.1 protein_id gnl|my_center|LOCUS_12330 26199 26864 gene locus_tag LOCUS_12340 26199 26864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence041 516 106 gene locus_tag LOCUS_12350 516 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 713 513 gene locus_tag LOCUS_12360 713 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 804 1655 gene locus_tag LOCUS_12370 804 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056522.1 protein_id gnl|my_center|LOCUS_12370 1631 1903 gene locus_tag LOCUS_12380 1631 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2022 3797 gene locus_tag LOCUS_12390 gene feoB 2022 3797 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIY3 protein_id gnl|my_center|LOCUS_12390 4426 3794 gene locus_tag LOCUS_12400 4426 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 4778 5893 gene locus_tag LOCUS_12410 4778 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 6160 6888 gene locus_tag LOCUS_12420 6160 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12420 6906 7295 gene locus_tag LOCUS_12430 6906 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12430 7373 8749 gene locus_tag LOCUS_12440 7373 8749 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055871.1 protein_id gnl|my_center|LOCUS_12440 8818 10302 gene locus_tag LOCUS_12450 8818 10302 CDS product lignostilbene alpha-beta-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055870.1 protein_id gnl|my_center|LOCUS_12450 10558 12051 gene locus_tag LOCUS_12460 10558 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 14028 12136 gene locus_tag LOCUS_12470 14028 12136 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103521.1 protein_id gnl|my_center|LOCUS_12470 17547 16384 gene locus_tag LOCUS_12480 gene hemH 17547 16384 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGU6 protein_id gnl|my_center|LOCUS_12480 17651 18289 gene locus_tag LOCUS_12490 17651 18289 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057443.1 protein_id gnl|my_center|LOCUS_12490 18864 18304 gene locus_tag LOCUS_12500 18864 18304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 18967 19797 gene locus_tag LOCUS_12510 18967 19797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 21275 19803 gene locus_tag LOCUS_12520 21275 19803 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946526.1 protein_id gnl|my_center|LOCUS_12520 22283 21480 gene locus_tag LOCUS_12530 22283 21480 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_12530 22516 22863 gene locus_tag LOCUS_12540 gene ndhM 22516 22863 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLN5 protein_id gnl|my_center|LOCUS_12540 23433 25712 gene locus_tag LOCUS_12550 23433 25712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 26820 26086 gene locus_tag LOCUS_12560 gene ycf53 26820 26086 CDS product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057433.1 protein_id gnl|my_center|LOCUS_12560 27465 26989 gene locus_tag LOCUS_12570 27465 26989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12570 28028 27462 gene locus_tag LOCUS_12580 28028 27462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence042 1721 423 gene locus_tag LOCUS_12590 1721 423 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 protein_id gnl|my_center|LOCUS_12590 2065 3102 gene locus_tag LOCUS_12600 gene plsX 2065 3102 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL5 protein_id gnl|my_center|LOCUS_12600 3756 4748 gene locus_tag LOCUS_12610 gene fabH 3756 4748 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL4 protein_id gnl|my_center|LOCUS_12610 4901 5788 gene locus_tag LOCUS_12620 gene fabD 4901 5788 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMS0 protein_id gnl|my_center|LOCUS_12620 6141 5845 gene locus_tag LOCUS_12630 6141 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 6368 6138 gene locus_tag LOCUS_12640 6368 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 6656 6411 gene locus_tag LOCUS_12650 6656 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 7390 6737 gene locus_tag LOCUS_12660 7390 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 7649 7419 gene locus_tag LOCUS_12670 gene rpoZ 7649 7419 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGQ8 protein_id gnl|my_center|LOCUS_12670 8174 9133 gene locus_tag LOCUS_12680 gene sigD 8174 9133 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056119.1 protein_id gnl|my_center|LOCUS_12680 10854 9271 gene locus_tag LOCUS_12690 10854 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 12358 13251 gene locus_tag LOCUS_12700 12358 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 13532 15004 gene locus_tag LOCUS_12710 13532 15004 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 protein_id gnl|my_center|LOCUS_12710 15649 16476 gene locus_tag LOCUS_12720 15649 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 17262 18182 gene locus_tag LOCUS_12730 gene accD 17262 18182 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE7 protein_id gnl|my_center|LOCUS_12730 19718 18237 gene locus_tag LOCUS_12740 19718 18237 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_12740 20123 21217 gene locus_tag LOCUS_12750 20123 21217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 22557 21214 gene locus_tag LOCUS_12760 22557 21214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 23870 22554 gene locus_tag LOCUS_12770 23870 22554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 25075 23867 gene locus_tag LOCUS_12780 25075 23867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 25244 25080 gene locus_tag LOCUS_12790 25244 25080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_12790 25657 25244 gene locus_tag LOCUS_12800 25657 25244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 27700 25766 gene locus_tag LOCUS_12810 27700 25766 CDS product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence043 1926 538 gene locus_tag LOCUS_12820 1926 538 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056941.1 protein_id gnl|my_center|LOCUS_12820 2371 2934 gene locus_tag LOCUS_12830 gene rplJ 2371 2934 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM26 protein_id gnl|my_center|LOCUS_12830 2991 3398 gene locus_tag LOCUS_12840 gene rplL 2991 3398 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM25 protein_id gnl|my_center|LOCUS_12840 4693 3710 gene locus_tag LOCUS_12850 4693 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 5613 9206 gene locus_tag LOCUS_12860 5613 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 9223 10647 gene locus_tag LOCUS_12870 9223 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 10736 11134 gene locus_tag LOCUS_12880 10736 11134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 11127 12188 gene locus_tag LOCUS_12890 gene wspR 11127 12188 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103734.1 protein_id gnl|my_center|LOCUS_12890 12541 12218 gene locus_tag LOCUS_12900 12541 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 12826 13452 gene locus_tag LOCUS_12910 12826 13452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 13477 14421 gene locus_tag LOCUS_12920 13477 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 14443 17052 gene locus_tag LOCUS_12930 14443 17052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 17350 18096 gene locus_tag LOCUS_12940 17350 18096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 21181 18752 gene locus_tag LOCUS_12950 21181 18752 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU0 protein_id gnl|my_center|LOCUS_12950 21677 21904 gene locus_tag LOCUS_12960 21677 21904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12960 22581 22009 gene locus_tag LOCUS_12970 22581 22009 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055910.1 protein_id gnl|my_center|LOCUS_12970 23385 22588 gene locus_tag LOCUS_12980 23385 22588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 24099 23587 gene locus_tag LOCUS_12990 24099 23587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 26480 24216 gene locus_tag LOCUS_13000 26480 24216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 27105 27335 gene locus_tag LOCUS_13010 27105 27335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 27514 28020 gene locus_tag LOCUS_13020 27514 28020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence044 442 681 gene locus_tag LOCUS_13030 442 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 681 902 gene locus_tag LOCUS_13040 681 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1068 2492 gene locus_tag LOCUS_13050 gene merA 1068 2492 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_13050 3714 2683 gene locus_tag LOCUS_13060 3714 2683 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140956.1 protein_id gnl|my_center|LOCUS_13060 4316 4648 gene locus_tag LOCUS_13070 4316 4648 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_13070 4638 6329 gene locus_tag LOCUS_13080 4638 6329 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 protein_id gnl|my_center|LOCUS_13080 6842 7405 gene locus_tag LOCUS_13090 6842 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 7750 8553 gene locus_tag LOCUS_13100 7750 8553 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868648.1 protein_id gnl|my_center|LOCUS_13100 8578 9186 gene locus_tag LOCUS_13110 8578 9186 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140132.1 protein_id gnl|my_center|LOCUS_13110 9494 9261 gene locus_tag LOCUS_13120 9494 9261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13120 9659 9525 gene locus_tag LOCUS_13130 9659 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13130 9858 9646 gene locus_tag LOCUS_13140 9858 9646 CDS product DUF2191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142894.1 protein_id gnl|my_center|LOCUS_13140 10233 10496 gene locus_tag LOCUS_13150 10233 10496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 10613 11209 gene locus_tag LOCUS_13160 10613 11209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 11388 13400 gene locus_tag LOCUS_13170 11388 13400 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS5 protein_id gnl|my_center|LOCUS_13170 13674 14465 gene locus_tag LOCUS_13180 13674 14465 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478264.1 protein_id gnl|my_center|LOCUS_13180 14802 14614 gene locus_tag LOCUS_13190 14802 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 15748 14894 gene locus_tag LOCUS_13200 15748 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 16783 15755 gene locus_tag LOCUS_13210 16783 15755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 16959 18401 gene locus_tag LOCUS_13220 16959 18401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057693.1 protein_id gnl|my_center|LOCUS_13220 18730 19194 gene locus_tag LOCUS_13230 gene rimP 18730 19194 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHL1 protein_id gnl|my_center|LOCUS_13230 19421 20719 gene locus_tag LOCUS_13240 gene nusA 19421 20719 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHL2 protein_id gnl|my_center|LOCUS_13240 20795 21082 gene locus_tag LOCUS_13250 20795 21082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 21169 24366 gene locus_tag LOCUS_13260 gene infB 21169 24366 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK04 protein_id gnl|my_center|LOCUS_13260 25521 24460 gene locus_tag LOCUS_13270 gene argC 25521 24460 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59312 protein_id gnl|my_center|LOCUS_13270 26892 25684 gene locus_tag LOCUS_13280 26892 25684 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056224.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence045 1094 204 gene locus_tag LOCUS_13290 1094 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 2169 1135 gene locus_tag LOCUS_13300 2169 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 3138 2482 gene locus_tag LOCUS_13310 3138 2482 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141890.1 protein_id gnl|my_center|LOCUS_13310 4141 3593 gene locus_tag LOCUS_13320 4141 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143948.1 protein_id gnl|my_center|LOCUS_13320 4827 5450 gene locus_tag LOCUS_13330 4827 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 5520 5789 gene locus_tag LOCUS_13340 gene rpsO 5520 5789 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJL5 protein_id gnl|my_center|LOCUS_13340 5847 6377 gene locus_tag LOCUS_13350 5847 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6675 7736 gene locus_tag LOCUS_13360 gene ccmA 6675 7736 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_13360 9158 7794 gene locus_tag LOCUS_13370 gene suc1 9158 7794 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_13370 10183 9242 gene locus_tag LOCUS_13380 gene gpsA 10183 9242 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF59 protein_id gnl|my_center|LOCUS_13380 10601 10209 gene locus_tag LOCUS_13390 gene aroH 10601 10209 CDS product chorismate mutase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHZ0 protein_id gnl|my_center|LOCUS_13390 11538 10720 gene locus_tag LOCUS_13400 11538 10720 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 protein_id gnl|my_center|LOCUS_13400 11686 12666 gene locus_tag LOCUS_13410 11686 12666 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 protein_id gnl|my_center|LOCUS_13410 12769 14598 gene locus_tag LOCUS_13420 12769 14598 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHI0 protein_id gnl|my_center|LOCUS_13420 14852 17659 gene locus_tag LOCUS_13430 14852 17659 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393311.1 protein_id gnl|my_center|LOCUS_13430 18211 18432 gene locus_tag LOCUS_13440 18211 18432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 20175 18490 gene locus_tag LOCUS_13450 gene ilvD 20175 18490 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGK1 protein_id gnl|my_center|LOCUS_13450 20536 21366 gene locus_tag LOCUS_13460 20536 21366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022329.1 protein_id gnl|my_center|LOCUS_13460 21405 22313 gene locus_tag LOCUS_13470 21405 22313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 22630 23331 gene locus_tag LOCUS_13480 22630 23331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 23458 26220 gene locus_tag LOCUS_13490 23458 26220 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144168.1 protein_id gnl|my_center|LOCUS_13490 27671 26415 gene locus_tag LOCUS_13500 27671 26415 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence046 752 1828 gene locus_tag LOCUS_13510 gene recA 752 1828 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9V8 protein_id gnl|my_center|LOCUS_13510 2844 1891 gene locus_tag LOCUS_13520 gene gmd 2844 1891 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 protein_id gnl|my_center|LOCUS_13520 8444 3042 gene locus_tag LOCUS_13530 8444 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 8838 9440 gene locus_tag LOCUS_13540 gene coaE 8838 9440 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIP9 protein_id gnl|my_center|LOCUS_13540 10251 9580 gene locus_tag LOCUS_13550 10251 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 11160 10858 gene locus_tag LOCUS_13560 11160 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13560 11704 11330 gene locus_tag LOCUS_13570 11704 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 12019 13557 gene locus_tag LOCUS_13580 12019 13557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 14502 13561 gene locus_tag LOCUS_13590 14502 13561 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057897.1 protein_id gnl|my_center|LOCUS_13590 15180 14935 gene locus_tag LOCUS_13600 15180 14935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 15499 16284 gene locus_tag LOCUS_13610 15499 16284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143024.1 protein_id gnl|my_center|LOCUS_13610 16502 17134 gene locus_tag LOCUS_13620 16502 17134 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888318.1 protein_id gnl|my_center|LOCUS_13620 18440 17244 gene locus_tag LOCUS_13630 gene ndbB 18440 17244 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056978.1 protein_id gnl|my_center|LOCUS_13630 18941 19153 gene locus_tag LOCUS_13640 18941 19153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 20401 19352 gene locus_tag LOCUS_13650 20401 19352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 20755 21423 gene locus_tag LOCUS_13660 20755 21423 CDS product chitooligosaccharide deacetylase NodB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144237.1 protein_id gnl|my_center|LOCUS_13660 21440 23839 gene locus_tag LOCUS_13670 21440 23839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 24062 25048 gene locus_tag LOCUS_13680 gene nadA 24062 25048 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_13680 25063 26019 gene locus_tag LOCUS_13690 25063 26019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 26366 26845 gene locus_tag LOCUS_13700 26366 26845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058296.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence047 1871 201 gene locus_tag LOCUS_13710 gene pepM 1871 201 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188554.1 protein_id gnl|my_center|LOCUS_13710 3664 2525 gene locus_tag LOCUS_13720 3664 2525 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057271.1 protein_id gnl|my_center|LOCUS_13720 5365 3680 gene locus_tag LOCUS_13730 5365 3680 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_13730 6149 5517 gene locus_tag LOCUS_13740 gene ruvA 6149 5517 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG1 protein_id gnl|my_center|LOCUS_13740 6184 7461 gene locus_tag LOCUS_13750 6184 7461 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141544.1 protein_id gnl|my_center|LOCUS_13750 7490 7681 gene locus_tag LOCUS_13760 7490 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 7694 8437 gene locus_tag LOCUS_13770 7694 8437 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_13770 10123 8444 gene locus_tag LOCUS_13780 10123 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 14568 10360 gene locus_tag LOCUS_13790 14568 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 15135 14920 gene locus_tag LOCUS_13800 15135 14920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 15524 15766 gene locus_tag LOCUS_13810 15524 15766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142102.1 protein_id gnl|my_center|LOCUS_13810 16655 15768 gene locus_tag LOCUS_13820 16655 15768 CDS product phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258724.1 protein_id gnl|my_center|LOCUS_13820 18204 16678 gene locus_tag LOCUS_13830 gene trpE 18204 16678 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057509.1 protein_id gnl|my_center|LOCUS_13830 18740 18312 gene locus_tag LOCUS_13840 gene psaD 18740 18312 CDS product photosystem I reaction center subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A420 protein_id gnl|my_center|LOCUS_13840 20428 18923 gene locus_tag LOCUS_13850 gene crtH 20428 18923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 protein_id gnl|my_center|LOCUS_13850 20912 22576 gene locus_tag LOCUS_13860 20912 22576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 22588 23583 gene locus_tag LOCUS_13870 22588 23583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057700.1 protein_id gnl|my_center|LOCUS_13870 25619 23601 gene locus_tag LOCUS_13880 25619 23601 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_13880 25843 25628 gene locus_tag LOCUS_13890 gene rpsR 25843 25628 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH98 protein_id gnl|my_center|LOCUS_13890 26073 25885 gene locus_tag LOCUS_13900 gene rpmG 26073 25885 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH99 protein_id gnl|my_center|LOCUS_13900 26659 26114 gene locus_tag LOCUS_13910 26659 26114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence048 393 1346 gene locus_tag LOCUS_13920 gene speE 393 1346 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Z7 protein_id gnl|my_center|LOCUS_13920 1749 1378 gene locus_tag LOCUS_13930 1749 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 3656 2466 gene locus_tag LOCUS_13940 3656 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 4107 7673 gene locus_tag LOCUS_13950 gene metH 4107 7673 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056870.1 protein_id gnl|my_center|LOCUS_13950 9641 7860 gene locus_tag LOCUS_13960 9641 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 10298 9657 gene locus_tag LOCUS_13970 10298 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056199.1 protein_id gnl|my_center|LOCUS_13970 10557 10700 gene locus_tag LOCUS_13980 10557 10700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 12258 10810 gene locus_tag LOCUS_13990 12258 10810 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118712.1 protein_id gnl|my_center|LOCUS_13990 12716 13102 gene locus_tag LOCUS_14000 12716 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 13790 13110 gene locus_tag LOCUS_14010 gene plsY 13790 13110 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNE0 protein_id gnl|my_center|LOCUS_14010 15001 14720 gene locus_tag LOCUS_14020 15001 14720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122309.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14020 15327 18254 gene locus_tag LOCUS_14030 gene ileS 15327 18254 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI7 protein_id gnl|my_center|LOCUS_14030 18933 19364 gene locus_tag LOCUS_14040 18933 19364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 20137 20874 gene locus_tag LOCUS_14050 20137 20874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 22706 20871 gene locus_tag LOCUS_14060 22706 20871 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 protein_id gnl|my_center|LOCUS_14060 24163 23090 gene locus_tag LOCUS_14070 24163 23090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 24714 24169 gene locus_tag LOCUS_14080 24714 24169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 25973 24711 gene locus_tag LOCUS_14090 25973 24711 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM0 protein_id gnl|my_center|LOCUS_14090 26022 26705 gene locus_tag LOCUS_14100 26022 26705 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence049 <1 887 gene locus_tag LOCUS_14110 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764579.1:cytochrome c biogenesis protein 1042 1458 gene locus_tag LOCUS_14120 1042 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1446 1781 gene locus_tag LOCUS_14130 1446 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1966 1817 gene locus_tag LOCUS_14140 1966 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2559 1978 gene locus_tag LOCUS_14150 2559 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3859 2699 gene locus_tag LOCUS_14160 gene acsF1 3859 2699 CDS product magnesium-protoporphyrin IX monomethyl ester [oxidative] cyclase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ05 protein_id gnl|my_center|LOCUS_14160 4416 5399 gene locus_tag LOCUS_14170 gene ycf39 4416 5399 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056703.1 protein_id gnl|my_center|LOCUS_14170 5645 6562 gene locus_tag LOCUS_14180 gene nadK1 5645 6562 CDS product NAD kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK1 protein_id gnl|my_center|LOCUS_14180 6793 7983 gene locus_tag LOCUS_14190 6793 7983 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140589.1 protein_id gnl|my_center|LOCUS_14190 8100 8981 gene locus_tag LOCUS_14200 gene ubiA 8100 8981 CDS product 4-hydroxybenzoate solanesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFU6 protein_id gnl|my_center|LOCUS_14200 9475 10158 gene locus_tag LOCUS_14210 9475 10158 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896645.1 protein_id gnl|my_center|LOCUS_14210 10183 12072 gene locus_tag LOCUS_14220 10183 12072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 12367 12573 gene locus_tag LOCUS_14230 12367 12573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 13594 14820 gene locus_tag LOCUS_14240 13594 14820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 15060 15833 gene locus_tag LOCUS_14250 15060 15833 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056089.1 protein_id gnl|my_center|LOCUS_14250 16211 15837 gene locus_tag LOCUS_14260 16211 15837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 18814 16271 gene locus_tag LOCUS_14270 18814 16271 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLX1 protein_id gnl|my_center|LOCUS_14270 20240 19068 gene locus_tag LOCUS_14280 gene tal 20240 19068 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK81 protein_id gnl|my_center|LOCUS_14280 21675 20335 gene locus_tag LOCUS_14290 21675 20335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 22436 22783 gene locus_tag LOCUS_14300 22436 22783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 23052 22876 gene locus_tag LOCUS_14310 23052 22876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 23851 23369 gene locus_tag LOCUS_14320 gene petD 23851 23369 CDS product cytochrome b6-f complex subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N3 protein_id gnl|my_center|LOCUS_14320 24673 24005 gene locus_tag LOCUS_14330 gene petB 24673 24005 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8M7 protein_id gnl|my_center|LOCUS_14330 25124 26362 gene locus_tag LOCUS_14340 gene ctpA 25124 26362 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 protein_id gnl|my_center|LOCUS_14340 26741 26508 gene locus_tag LOCUS_14350 26741 26508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence050 <1 667 gene locus_tag LOCUS_14360 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003120048.1:two-component sensor histidine kinase 751 1998 gene locus_tag LOCUS_14370 751 1998 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058122.1 protein_id gnl|my_center|LOCUS_14370 2356 4125 gene locus_tag LOCUS_14380 2356 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142898.1 protein_id gnl|my_center|LOCUS_14380 4151 5032 gene locus_tag LOCUS_14390 gene aroE 4151 5032 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA6 protein_id gnl|my_center|LOCUS_14390 6570 5380 gene locus_tag LOCUS_14400 6570 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 7410 6754 gene locus_tag LOCUS_14410 gene lrtA 7410 6754 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_14410 7652 8344 gene locus_tag LOCUS_14420 gene lipB 7652 8344 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND22 protein_id gnl|my_center|LOCUS_14420 10284 8392 gene locus_tag LOCUS_14430 10284 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 11696 10302 gene locus_tag LOCUS_14440 11696 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 12710 11724 gene locus_tag LOCUS_14450 12710 11724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 13498 12725 gene locus_tag LOCUS_14460 13498 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 14646 13642 gene locus_tag LOCUS_14470 gene galE1 14646 13642 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837707.1 protein_id gnl|my_center|LOCUS_14470 16183 14678 gene locus_tag LOCUS_14480 16183 14678 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726H6 protein_id gnl|my_center|LOCUS_14480 18221 16314 gene locus_tag LOCUS_14490 gene asnB 18221 16314 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_14490 19108 18509 gene locus_tag LOCUS_14500 19108 18509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 19775 19176 gene locus_tag LOCUS_14510 19775 19176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 20626 19772 gene locus_tag LOCUS_14520 20626 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 21011 21898 gene locus_tag LOCUS_14530 21011 21898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_14530 22093 23484 gene locus_tag LOCUS_14540 gene asnS 22093 23484 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG51 protein_id gnl|my_center|LOCUS_14540 23996 24226 gene locus_tag LOCUS_14550 23996 24226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 24500 26359 gene locus_tag LOCUS_14560 24500 26359 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144195.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence051 3177 127 gene locus_tag LOCUS_14570 3177 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 4214 3213 gene locus_tag LOCUS_14580 4214 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 5101 4211 gene locus_tag LOCUS_14590 5101 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057104.1 protein_id gnl|my_center|LOCUS_14590 5640 5155 gene locus_tag LOCUS_14600 5640 5155 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057216.1 protein_id gnl|my_center|LOCUS_14600 6257 5658 gene locus_tag LOCUS_14610 6257 5658 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_14610 8038 6338 gene locus_tag LOCUS_14620 8038 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058118.1 protein_id gnl|my_center|LOCUS_14620 8389 9897 gene locus_tag LOCUS_14630 8389 9897 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ1 protein_id gnl|my_center|LOCUS_14630 9960 10637 gene locus_tag LOCUS_14640 9960 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 10656 10904 gene locus_tag LOCUS_14650 10656 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 11356 11700 gene locus_tag LOCUS_14660 11356 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056501.1 protein_id gnl|my_center|LOCUS_14660 12995 11799 gene locus_tag LOCUS_14670 12995 11799 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140589.1 protein_id gnl|my_center|LOCUS_14670 13154 13534 gene locus_tag LOCUS_14680 13154 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 13729 13980 gene locus_tag LOCUS_14690 13729 13980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 14172 13948 gene locus_tag LOCUS_14700 14172 13948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058280.1 protein_id gnl|my_center|LOCUS_14700 16166 14574 gene locus_tag LOCUS_14710 16166 14574 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056886.1 protein_id gnl|my_center|LOCUS_14710 16589 16185 gene locus_tag LOCUS_14720 gene rbfA 16589 16185 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF9 protein_id gnl|my_center|LOCUS_14720 16785 17300 gene locus_tag LOCUS_14730 16785 17300 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056346.1 protein_id gnl|my_center|LOCUS_14730 17308 18420 gene locus_tag LOCUS_14740 gene proB 17308 18420 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH42 protein_id gnl|my_center|LOCUS_14740 19232 18417 gene locus_tag LOCUS_14750 19232 18417 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056042.1 protein_id gnl|my_center|LOCUS_14750 19861 20556 gene locus_tag LOCUS_14760 19861 20556 CDS product aldehyde decarbonylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB4 protein_id gnl|my_center|LOCUS_14760 20782 21807 gene locus_tag LOCUS_14770 20782 21807 CDS product long-chain acyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057152.1 protein_id gnl|my_center|LOCUS_14770 23076 21790 gene locus_tag LOCUS_14780 23076 21790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 protein_id gnl|my_center|LOCUS_14780 23464 24273 gene locus_tag LOCUS_14790 23464 24273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 24598 25356 gene locus_tag LOCUS_14800 24598 25356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 25608 26108 gene locus_tag LOCUS_14810 25608 26108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence052 5731 5360 gene locus_tag LOCUS_14820 5731 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 5809 6570 gene locus_tag LOCUS_14830 5809 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 8415 6904 gene locus_tag LOCUS_14840 8415 6904 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949063.1 protein_id gnl|my_center|LOCUS_14840 9958 8903 gene locus_tag LOCUS_14850 9958 8903 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143449.1 protein_id gnl|my_center|LOCUS_14850 11079 10117 gene locus_tag LOCUS_14860 11079 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309936.1 protein_id gnl|my_center|LOCUS_14860 12089 11217 gene locus_tag LOCUS_14870 12089 11217 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_14870 12257 12799 gene locus_tag LOCUS_14880 12257 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143336.1 protein_id gnl|my_center|LOCUS_14880 13044 14309 gene locus_tag LOCUS_14890 13044 14309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 14324 15649 gene locus_tag LOCUS_14900 gene argD 14324 15649 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59322 protein_id gnl|my_center|LOCUS_14900 15956 17539 gene locus_tag LOCUS_14910 15956 17539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 17891 17553 gene locus_tag LOCUS_14920 17891 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 18821 18489 gene locus_tag LOCUS_14930 18821 18489 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_14930 19120 18818 gene locus_tag LOCUS_14940 19120 18818 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058066.1 protein_id gnl|my_center|LOCUS_14940 20678 19248 gene locus_tag LOCUS_14950 20678 19248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 21393 20989 gene locus_tag LOCUS_14960 21393 20989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 21472 21789 gene locus_tag LOCUS_14970 21472 21789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 21797 23926 gene locus_tag LOCUS_14980 21797 23926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 24879 24007 gene locus_tag LOCUS_14990 24879 24007 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056762.1 protein_id gnl|my_center|LOCUS_14990 25600 24995 gene locus_tag LOCUS_15000 25600 24995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence053 71 532 gene locus_tag LOCUS_15010 71 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2184 799 gene locus_tag LOCUS_15020 2184 799 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083861.1 protein_id gnl|my_center|LOCUS_15020 2377 2174 gene locus_tag LOCUS_15030 2377 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4902 2374 gene locus_tag LOCUS_15040 4902 2374 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143331.1 protein_id gnl|my_center|LOCUS_15040 6642 5173 gene locus_tag LOCUS_15050 6642 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 7644 6940 gene locus_tag LOCUS_15060 7644 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461631.1 protein_id gnl|my_center|LOCUS_15060 8419 7787 gene locus_tag LOCUS_15070 8419 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 9407 8586 gene locus_tag LOCUS_15080 9407 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_15080 10726 9440 gene locus_tag LOCUS_15090 10726 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 10986 11210 gene locus_tag LOCUS_15100 10986 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 12216 11218 gene locus_tag LOCUS_15110 12216 11218 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920469.1 protein_id gnl|my_center|LOCUS_15110 13965 12658 gene locus_tag LOCUS_15120 13965 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140821.1 protein_id gnl|my_center|LOCUS_15120 15308 13962 gene locus_tag LOCUS_15130 15308 13962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 15880 15437 gene locus_tag LOCUS_15140 15880 15437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 16807 15962 gene locus_tag LOCUS_15150 16807 15962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057453.1 protein_id gnl|my_center|LOCUS_15150 17203 16901 gene locus_tag LOCUS_15160 17203 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 17368 18765 gene locus_tag LOCUS_15170 gene menE 17368 18765 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057063.1 protein_id gnl|my_center|LOCUS_15170 19134 21416 gene locus_tag LOCUS_15180 19134 21416 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_15180 21388 21834 gene locus_tag LOCUS_15190 21388 21834 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_15190 21900 23060 gene locus_tag LOCUS_15200 21900 23060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 23190 24449 gene locus_tag LOCUS_15210 23190 24449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 24476 25858 gene locus_tag LOCUS_15220 gene cobB 24476 25858 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057685.1 protein_id gnl|my_center|LOCUS_15220 25968 25834 gene locus_tag LOCUS_15230 25968 25834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence054 283 1065 gene locus_tag LOCUS_15240 283 1065 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_15240 1224 1691 gene locus_tag LOCUS_15250 1224 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1807 2913 gene locus_tag LOCUS_15260 1807 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057888.1 protein_id gnl|my_center|LOCUS_15260 3342 4088 gene locus_tag LOCUS_15270 3342 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 4092 4568 gene locus_tag LOCUS_15280 4092 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 5085 4888 gene locus_tag LOCUS_15290 5085 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 7820 5139 gene locus_tag LOCUS_15300 gene alaS 7820 5139 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH56 protein_id gnl|my_center|LOCUS_15300 8418 8939 gene locus_tag LOCUS_15310 8418 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 9299 10750 gene locus_tag LOCUS_15320 9299 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 11103 12689 gene locus_tag LOCUS_15330 11103 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 12874 14151 gene locus_tag LOCUS_15340 12874 14151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 14533 15303 gene locus_tag LOCUS_15350 14533 15303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058307.1 protein_id gnl|my_center|LOCUS_15350 15761 15300 gene locus_tag LOCUS_15360 15761 15300 CDS product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_15360 16019 17158 gene locus_tag LOCUS_15370 16019 17158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_15370 17612 17283 gene locus_tag LOCUS_15380 17612 17283 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL6 protein_id gnl|my_center|LOCUS_15380 18470 17835 gene locus_tag LOCUS_15390 18470 17835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056016.1 protein_id gnl|my_center|LOCUS_15390 19028 18486 gene locus_tag LOCUS_15400 19028 18486 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_15400 19392 19132 gene locus_tag LOCUS_15410 19392 19132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056018.1 protein_id gnl|my_center|LOCUS_15410 19717 20550 gene locus_tag LOCUS_15420 gene murI 19717 20550 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM3 protein_id gnl|my_center|LOCUS_15420 21259 20639 gene locus_tag LOCUS_15430 21259 20639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 21384 21737 gene locus_tag LOCUS_15440 21384 21737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057416.1 protein_id gnl|my_center|LOCUS_15440 21887 22573 gene locus_tag LOCUS_15450 21887 22573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057488.1 protein_id gnl|my_center|LOCUS_15450 22762 23265 gene locus_tag LOCUS_15460 gene fur 22762 23265 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055903.1 protein_id gnl|my_center|LOCUS_15460 <25502 23327 gene locus_tag LOCUS_15470 <25502 23327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057604.1:succinoglycan transporter ExoP >Feature sequence055 221 1090 gene locus_tag LOCUS_15480 gene uppP 221 1090 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG92 protein_id gnl|my_center|LOCUS_15480 1252 1566 gene locus_tag LOCUS_15490 1252 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1505 2761 gene locus_tag LOCUS_15500 1505 2761 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865252.1 protein_id gnl|my_center|LOCUS_15500 3479 4810 gene locus_tag LOCUS_15510 3479 4810 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057484.1 protein_id gnl|my_center|LOCUS_15510 5644 5162 gene locus_tag LOCUS_15520 gene psaL 5644 5162 CDS product photosystem I reaction center subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGB4 protein_id gnl|my_center|LOCUS_15520 6142 5786 gene locus_tag LOCUS_15530 6142 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 7618 6176 gene locus_tag LOCUS_15540 7618 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 9162 8122 gene locus_tag LOCUS_15550 9162 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056254.1 protein_id gnl|my_center|LOCUS_15550 9347 9691 gene locus_tag LOCUS_15560 9347 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057537.1 protein_id gnl|my_center|LOCUS_15560 9969 10265 gene locus_tag LOCUS_15570 9969 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 protein_id gnl|my_center|LOCUS_15570 10534 11286 gene locus_tag LOCUS_15580 10534 11286 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 protein_id gnl|my_center|LOCUS_15580 11372 12070 gene locus_tag LOCUS_15590 11372 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142612.1 protein_id gnl|my_center|LOCUS_15590 12411 13127 gene locus_tag LOCUS_15600 gene cbiM 12411 13127 CDS product cobalt transport protein CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ53 protein_id gnl|my_center|LOCUS_15600 13169 13483 gene locus_tag LOCUS_15610 gene cbiN 13169 13483 CDS product cobalt transport protein CbiN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18D62 protein_id gnl|my_center|LOCUS_15610 13483 14286 gene locus_tag LOCUS_15620 13483 14286 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058272.1 protein_id gnl|my_center|LOCUS_15620 14270 15091 gene locus_tag LOCUS_15630 14270 15091 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG84 protein_id gnl|my_center|LOCUS_15630 16065 15442 gene locus_tag LOCUS_15640 16065 15442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056109.1 protein_id gnl|my_center|LOCUS_15640 17276 16062 gene locus_tag LOCUS_15650 17276 16062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 protein_id gnl|my_center|LOCUS_15650 17439 18707 gene locus_tag LOCUS_15660 17439 18707 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_15660 19195 18944 gene locus_tag LOCUS_15670 19195 18944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 19240 22002 gene locus_tag LOCUS_15680 gene apcE 19240 22002 CDS product photosystem I reaction center subunit X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058198.1 protein_id gnl|my_center|LOCUS_15680 <25458 22208 gene locus_tag LOCUS_15690 <25458 22208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973826.1:rhizobiocin/RTX toxin >Feature sequence056 <1 1456 gene locus_tag LOCUS_15700 <1 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947219.1:adenylate cyclase 1527 3083 gene locus_tag LOCUS_15710 1527 3083 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 protein_id gnl|my_center|LOCUS_15710 3501 3196 gene locus_tag LOCUS_15720 3501 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 4577 3651 gene locus_tag LOCUS_15730 4577 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 7077 6046 gene locus_tag LOCUS_15740 7077 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142279.1 protein_id gnl|my_center|LOCUS_15740 7584 9086 gene locus_tag LOCUS_15750 7584 9086 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_15750 10811 9075 gene locus_tag LOCUS_15760 10811 9075 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_15760 12485 10830 gene locus_tag LOCUS_15770 12485 10830 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 protein_id gnl|my_center|LOCUS_15770 12934 14283 gene locus_tag LOCUS_15780 12934 14283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 15289 14315 gene locus_tag LOCUS_15790 15289 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 15900 16472 gene locus_tag LOCUS_15800 15900 16472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 16567 17652 gene locus_tag LOCUS_15810 gene trpD 16567 17652 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI76 protein_id gnl|my_center|LOCUS_15810 18768 17872 gene locus_tag LOCUS_15820 gene argB 18768 17872 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59303 protein_id gnl|my_center|LOCUS_15820 19261 18788 gene locus_tag LOCUS_15830 19261 18788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15830 20332 19520 gene locus_tag LOCUS_15840 20332 19520 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056783.1 protein_id gnl|my_center|LOCUS_15840 21545 20538 gene locus_tag LOCUS_15850 21545 20538 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056782.1 protein_id gnl|my_center|LOCUS_15850 21998 22357 gene locus_tag LOCUS_15860 gene ssb 21998 22357 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIU1 protein_id gnl|my_center|LOCUS_15860 22363 22890 gene locus_tag LOCUS_15870 22363 22890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 23736 23032 gene locus_tag LOCUS_15880 gene tesA 23736 23032 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125174.1 protein_id gnl|my_center|LOCUS_15880 24168 24377 gene locus_tag LOCUS_15890 24168 24377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057972.1 protein_id gnl|my_center|LOCUS_15890 24423 24809 gene locus_tag LOCUS_15900 gene ycf35 24423 24809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_15900 24809 25237 gene locus_tag LOCUS_15910 24809 25237 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057974.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence057 512 1147 gene locus_tag LOCUS_15920 512 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 protein_id gnl|my_center|LOCUS_15920 1222 1461 gene locus_tag LOCUS_15930 1222 1461 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057133.1 protein_id gnl|my_center|LOCUS_15930 2219 1539 gene locus_tag LOCUS_15940 2219 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 4042 3605 gene locus_tag LOCUS_15950 4042 3605 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390954.1 protein_id gnl|my_center|LOCUS_15950 4553 4281 gene locus_tag LOCUS_15960 4553 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 4867 4646 gene locus_tag LOCUS_15970 4867 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058260.1 protein_id gnl|my_center|LOCUS_15970 5478 5693 gene locus_tag LOCUS_15980 5478 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 7063 5846 gene locus_tag LOCUS_15990 7063 5846 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970460.1 protein_id gnl|my_center|LOCUS_15990 7708 7385 gene locus_tag LOCUS_16000 7708 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 8388 7825 gene locus_tag LOCUS_16010 8388 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 9213 8533 gene locus_tag LOCUS_16020 9213 8533 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056716.1 protein_id gnl|my_center|LOCUS_16020 9397 10782 gene locus_tag LOCUS_16030 9397 10782 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056715.1 protein_id gnl|my_center|LOCUS_16030 11110 10913 gene locus_tag LOCUS_16040 gene rpsU1 11110 10913 CDS product 30S ribosomal protein S21 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHK6 protein_id gnl|my_center|LOCUS_16040 11751 11936 gene locus_tag LOCUS_16050 11751 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 13628 12126 gene locus_tag LOCUS_16060 13628 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 15743 14208 gene locus_tag LOCUS_16070 gene ggt 15743 14208 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_16070 16202 16735 gene locus_tag LOCUS_16080 16202 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 17223 18071 gene locus_tag LOCUS_16090 17223 18071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_16090 18527 19531 gene locus_tag LOCUS_16100 18527 19531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 21981 19627 gene locus_tag LOCUS_16110 21981 19627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 24071 22524 gene locus_tag LOCUS_16120 24071 22524 CDS product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124737.1 protein_id gnl|my_center|LOCUS_16120 24414 25031 gene locus_tag LOCUS_16130 24414 25031 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143281.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence058 <1 1084 gene locus_tag LOCUS_16140 <1 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530031.1:thiamine pyrophosphate enzyme 1137 2222 gene locus_tag LOCUS_16150 gene phnW 1137 2222 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63MZ1 protein_id gnl|my_center|LOCUS_16150 2315 2986 gene locus_tag LOCUS_16160 2315 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 3002 4006 gene locus_tag LOCUS_16170 3002 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 4009 4728 gene locus_tag LOCUS_16180 4009 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 4914 5561 gene locus_tag LOCUS_16190 4914 5561 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528866.1 protein_id gnl|my_center|LOCUS_16190 5552 6304 gene locus_tag LOCUS_16200 5552 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 6648 6301 gene locus_tag LOCUS_16210 6648 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 7623 6766 gene locus_tag LOCUS_16220 gene nadC 7623 6766 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057550.1 protein_id gnl|my_center|LOCUS_16220 7846 7743 gene locus_tag LOCUS_r00010 7846 7743 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 8016 8798 gene locus_tag LOCUS_16230 8016 8798 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_16230 8831 9784 gene locus_tag LOCUS_16240 8831 9784 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKP2 protein_id gnl|my_center|LOCUS_16240 10687 9806 gene locus_tag LOCUS_16250 10687 9806 CDS product 2-hydroxy-6-oxohepta-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143319.1 protein_id gnl|my_center|LOCUS_16250 11059 10688 gene locus_tag LOCUS_16260 11059 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 11770 11111 gene locus_tag LOCUS_16270 11770 11111 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056342.1 protein_id gnl|my_center|LOCUS_16270 12036 13472 gene locus_tag LOCUS_16280 gene ycf24 12036 13472 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_16280 13927 14709 gene locus_tag LOCUS_16290 13927 14709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_16290 14713 16059 gene locus_tag LOCUS_16300 14713 16059 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 protein_id gnl|my_center|LOCUS_16300 16235 17497 gene locus_tag LOCUS_16310 gene nifS 16235 17497 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH91 protein_id gnl|my_center|LOCUS_16310 17802 18353 gene locus_tag LOCUS_16320 17802 18353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 19165 18536 gene locus_tag LOCUS_16330 19165 18536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 19288 20682 gene locus_tag LOCUS_16340 19288 20682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_16340 20761 21024 gene locus_tag LOCUS_16350 20761 21024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 22173 21073 gene locus_tag LOCUS_16360 gene ruvB 22173 21073 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR1 protein_id gnl|my_center|LOCUS_16360 22326 23723 gene locus_tag LOCUS_16370 22326 23723 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143647.1 protein_id gnl|my_center|LOCUS_16370 <25315 23809 gene locus_tag LOCUS_16380 <25315 23809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545943.1:tetratricopeptide repeat domain protein >Feature sequence059 1238 957 gene locus_tag LOCUS_16390 1238 957 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW8 protein_id gnl|my_center|LOCUS_16390 1839 2144 gene locus_tag LOCUS_16400 gene rpsT 1839 2144 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN4 protein_id gnl|my_center|LOCUS_16400 2441 3265 gene locus_tag LOCUS_16410 gene tatD 2441 3265 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN5 protein_id gnl|my_center|LOCUS_16410 3377 6655 gene locus_tag LOCUS_16420 gene rpoB 3377 6655 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL55 protein_id gnl|my_center|LOCUS_16420 6886 8778 gene locus_tag LOCUS_16430 gene rpoC1 6886 8778 CDS product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL56 protein_id gnl|my_center|LOCUS_16430 8829 9143 gene locus_tag LOCUS_16440 8829 9143 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_16440 9359 13459 gene locus_tag LOCUS_16450 gene rpoC2 9359 13459 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDF7 protein_id gnl|my_center|LOCUS_16450 13674 14285 gene locus_tag LOCUS_16460 13674 14285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 14898 15782 gene locus_tag LOCUS_16470 14898 15782 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143200.1 protein_id gnl|my_center|LOCUS_16470 17277 16225 gene locus_tag LOCUS_16480 gene idiA 17277 16225 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_16480 17517 18065 gene locus_tag LOCUS_16490 17517 18065 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056727.1 protein_id gnl|my_center|LOCUS_16490 18272 18832 gene locus_tag LOCUS_16500 18272 18832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 20558 18834 gene locus_tag LOCUS_16510 20558 18834 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142325.1 protein_id gnl|my_center|LOCUS_16510 20917 20594 gene locus_tag LOCUS_16520 20917 20594 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056468.1 protein_id gnl|my_center|LOCUS_16520 21830 20937 gene locus_tag LOCUS_16530 21830 20937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 22506 22075 gene locus_tag LOCUS_16540 22506 22075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 24541 22577 gene locus_tag LOCUS_16550 24541 22577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence060 <1 4579 gene locus_tag LOCUS_16560 <1 4579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7USG5:protein-glutamate methylesterase 4722 6482 gene locus_tag LOCUS_16570 4722 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 7080 6769 gene locus_tag LOCUS_16580 7080 6769 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_16580 8602 7448 gene locus_tag LOCUS_16590 gene ndhH 8602 7448 CDS product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD9 protein_id gnl|my_center|LOCUS_16590 8932 9774 gene locus_tag LOCUS_16600 gene rsmH 8932 9774 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH87 protein_id gnl|my_center|LOCUS_16600 9838 10212 gene locus_tag LOCUS_16610 9838 10212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057705.1 protein_id gnl|my_center|LOCUS_16610 10331 11293 gene locus_tag LOCUS_16620 gene hemC 10331 11293 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE4 protein_id gnl|my_center|LOCUS_16620 12927 11503 gene locus_tag LOCUS_16630 12927 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 14254 13394 gene locus_tag LOCUS_16640 14254 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 15351 15683 gene locus_tag LOCUS_16650 15351 15683 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NM87 protein_id gnl|my_center|LOCUS_16650 15987 16928 gene locus_tag LOCUS_16660 15987 16928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057667.1 protein_id gnl|my_center|LOCUS_16660 17319 16933 gene locus_tag LOCUS_16670 17319 16933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 17949 18302 gene locus_tag LOCUS_16680 17949 18302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 18538 21714 gene locus_tag LOCUS_16690 18538 21714 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 protein_id gnl|my_center|LOCUS_16690 21992 21819 gene locus_tag LOCUS_16700 21992 21819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 22452 23543 gene locus_tag LOCUS_16710 gene aroB 22452 23543 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS3 protein_id gnl|my_center|LOCUS_16710 >Feature sequence061 581 5785 gene locus_tag LOCUS_16720 581 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 5950 7461 gene locus_tag LOCUS_16730 5950 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 7458 8090 gene locus_tag LOCUS_16740 7458 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 8568 8140 gene locus_tag LOCUS_16750 8568 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 9087 8662 gene locus_tag LOCUS_16760 9087 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 9333 10928 gene locus_tag LOCUS_16770 9333 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 10937 12655 gene locus_tag LOCUS_16780 10937 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 14215 15333 gene locus_tag LOCUS_16790 gene sigA 14215 15333 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL79 protein_id gnl|my_center|LOCUS_16790 15569 16228 gene locus_tag LOCUS_16800 gene msrA 15569 16228 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_16800 16604 16978 gene locus_tag LOCUS_16810 16604 16978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 17079 17390 gene locus_tag LOCUS_16820 17079 17390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 17541 17969 gene locus_tag LOCUS_16830 17541 17969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 18839 19189 gene locus_tag LOCUS_16840 18839 19189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 19385 19882 gene locus_tag LOCUS_16850 19385 19882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 21815 20751 gene locus_tag LOCUS_16860 gene proX 21815 20751 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418240.1 protein_id gnl|my_center|LOCUS_16860 23448 21922 gene locus_tag LOCUS_16870 gene chlB 23448 21922 CDS product light-independent protochlorophyllide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC6 protein_id gnl|my_center|LOCUS_16870 23844 24053 gene locus_tag LOCUS_16880 23844 24053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence062 1134 202 gene locus_tag LOCUS_16890 1134 202 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707005.1 protein_id gnl|my_center|LOCUS_16890 1917 1297 gene locus_tag LOCUS_16900 1917 1297 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533464.1 protein_id gnl|my_center|LOCUS_16900 2892 1984 gene locus_tag LOCUS_16910 2892 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 4411 2990 gene locus_tag LOCUS_16920 4411 2990 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460454.1 protein_id gnl|my_center|LOCUS_16920 5600 4431 gene locus_tag LOCUS_16930 5600 4431 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E6 protein_id gnl|my_center|LOCUS_16930 6788 5781 gene locus_tag LOCUS_16940 6788 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 7808 6981 gene locus_tag LOCUS_16950 7808 6981 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057495.1 protein_id gnl|my_center|LOCUS_16950 8669 7983 gene locus_tag LOCUS_16960 8669 7983 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140299.1 protein_id gnl|my_center|LOCUS_16960 8814 9206 gene locus_tag LOCUS_16970 8814 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 9383 9312 gene locus_tag LOCUS_t00150 9383 9312 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9476 10090 gene locus_tag LOCUS_16980 9476 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143393.1 protein_id gnl|my_center|LOCUS_16980 11058 10129 gene locus_tag LOCUS_16990 11058 10129 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057872.1 protein_id gnl|my_center|LOCUS_16990 11265 12965 gene locus_tag LOCUS_17000 11265 12965 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_17000 13130 14494 gene locus_tag LOCUS_17010 13130 14494 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056302.1 protein_id gnl|my_center|LOCUS_17010 14665 16767 gene locus_tag LOCUS_17020 14665 16767 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058305.1 protein_id gnl|my_center|LOCUS_17020 17071 17985 gene locus_tag LOCUS_17030 17071 17985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 19043 18114 gene locus_tag LOCUS_17040 19043 18114 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056888.1 protein_id gnl|my_center|LOCUS_17040 19234 19782 gene locus_tag LOCUS_17050 gene infC 19234 19782 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9N2 protein_id gnl|my_center|LOCUS_17050 20025 23066 gene locus_tag LOCUS_17060 20025 23066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 23151 23636 gene locus_tag LOCUS_17070 23151 23636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence063 128 460 gene locus_tag LOCUS_17080 gene ycf57 128 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142103.1 protein_id gnl|my_center|LOCUS_17080 791 1057 gene locus_tag LOCUS_17090 791 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1194 1664 gene locus_tag LOCUS_17100 gene rpsG 1194 1664 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI44 protein_id gnl|my_center|LOCUS_17100 1734 3815 gene locus_tag LOCUS_17110 gene fusA 1734 3815 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI43 protein_id gnl|my_center|LOCUS_17110 3966 5195 gene locus_tag LOCUS_17120 gene tufA 3966 5195 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50064 protein_id gnl|my_center|LOCUS_17120 5414 5731 gene locus_tag LOCUS_17130 gene rpsJ 5414 5731 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA06 protein_id gnl|my_center|LOCUS_17130 6016 6663 gene locus_tag LOCUS_17140 6016 6663 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_17140 7571 6726 gene locus_tag LOCUS_17150 gene pheA 7571 6726 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH54 protein_id gnl|my_center|LOCUS_17150 7921 8499 gene locus_tag LOCUS_17160 7921 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057548.1 protein_id gnl|my_center|LOCUS_17160 9120 8491 gene locus_tag LOCUS_17170 9120 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142405.1 protein_id gnl|my_center|LOCUS_17170 9768 9166 gene locus_tag LOCUS_17180 gene rnhB 9768 9166 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2G1 protein_id gnl|my_center|LOCUS_17180 11940 9769 gene locus_tag LOCUS_17190 gene rne 11940 9769 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056445.1 protein_id gnl|my_center|LOCUS_17190 13421 13819 gene locus_tag LOCUS_17200 gene psb27 13421 13819 CDS product photosystem II lipoprotein Psb27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG60 protein_id gnl|my_center|LOCUS_17200 14371 14096 gene locus_tag LOCUS_17210 14371 14096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 15781 14582 gene locus_tag LOCUS_17220 15781 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17220 18123 16510 gene locus_tag LOCUS_17230 18123 16510 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG7 protein_id gnl|my_center|LOCUS_17230 18546 19418 gene locus_tag LOCUS_17240 18546 19418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 19581 20303 gene locus_tag LOCUS_17250 gene sfsA 19581 20303 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJU8 protein_id gnl|my_center|LOCUS_17250 21411 23351 gene locus_tag LOCUS_17260 21411 23351 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056770.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence064 552 1565 gene locus_tag LOCUS_17270 552 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 1646 2722 gene locus_tag LOCUS_17280 1646 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 2830 3147 gene locus_tag LOCUS_17290 2830 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 3418 5163 gene locus_tag LOCUS_17300 3418 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 5396 6919 gene locus_tag LOCUS_17310 5396 6919 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480254.1 protein_id gnl|my_center|LOCUS_17310 7615 6887 gene locus_tag LOCUS_17320 7615 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058104.1 protein_id gnl|my_center|LOCUS_17320 7924 8703 gene locus_tag LOCUS_17330 7924 8703 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL42 protein_id gnl|my_center|LOCUS_17330 8772 9644 gene locus_tag LOCUS_17340 8772 9644 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_17340 10675 9767 gene locus_tag LOCUS_17350 gene lipA2 10675 9767 CDS product lipoyl synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLC2 protein_id gnl|my_center|LOCUS_17350 10865 11458 gene locus_tag LOCUS_17360 10865 11458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 11635 12666 gene locus_tag LOCUS_17370 11635 12666 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_17370 12853 12635 gene locus_tag LOCUS_17380 12853 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 13122 13889 gene locus_tag LOCUS_17390 13122 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 14861 14388 gene locus_tag LOCUS_17400 14861 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 15607 15167 gene locus_tag LOCUS_17410 15607 15167 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 protein_id gnl|my_center|LOCUS_17410 16398 15724 gene locus_tag LOCUS_17420 gene purQ 16398 15724 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL01 protein_id gnl|my_center|LOCUS_17420 16691 16407 gene locus_tag LOCUS_17430 gene purS 16691 16407 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG9 protein_id gnl|my_center|LOCUS_17430 16876 18204 gene locus_tag LOCUS_17440 16876 18204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 18570 18217 gene locus_tag LOCUS_17450 18570 18217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387861.1 protein_id gnl|my_center|LOCUS_17450 19190 18615 gene locus_tag LOCUS_17460 19190 18615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387862.1 protein_id gnl|my_center|LOCUS_17460 19379 20497 gene locus_tag LOCUS_17470 19379 20497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_17470 22333 21356 gene locus_tag LOCUS_17480 gene yedY 22333 21356 CDS product mononuclear molybdenum enzyme YedY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence065 144 812 gene locus_tag LOCUS_17490 144 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143006.1 protein_id gnl|my_center|LOCUS_17490 1390 1085 gene locus_tag LOCUS_17500 1390 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3401 1431 gene locus_tag LOCUS_17510 3401 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5234 3846 gene locus_tag LOCUS_17520 5234 3846 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKB7 protein_id gnl|my_center|LOCUS_17520 5435 5920 gene locus_tag LOCUS_17530 gene apcD 5435 5920 CDS product allophycocyanin-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057391.1 protein_id gnl|my_center|LOCUS_17530 6251 7618 gene locus_tag LOCUS_17540 6251 7618 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_17540 8279 9835 gene locus_tag LOCUS_17550 gene ilvB 8279 9835 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057661.1 protein_id gnl|my_center|LOCUS_17550 9916 10701 gene locus_tag LOCUS_17560 9916 10701 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057622.1 protein_id gnl|my_center|LOCUS_17560 13759 11555 gene locus_tag LOCUS_17570 13759 11555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 14730 13792 gene locus_tag LOCUS_17580 14730 13792 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 protein_id gnl|my_center|LOCUS_17580 15605 14781 gene locus_tag LOCUS_17590 15605 14781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142238.1 protein_id gnl|my_center|LOCUS_17590 15658 16437 gene locus_tag LOCUS_17600 15658 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 17059 16658 gene locus_tag LOCUS_17610 17059 16658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_17610 17526 17969 gene locus_tag LOCUS_17620 17526 17969 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 protein_id gnl|my_center|LOCUS_17620 18002 19048 gene locus_tag LOCUS_17630 gene cobD 18002 19048 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE1 protein_id gnl|my_center|LOCUS_17630 19108 19638 gene locus_tag LOCUS_17640 gene pyrR 19108 19638 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ7 protein_id gnl|my_center|LOCUS_17640 21602 19650 gene locus_tag LOCUS_17650 21602 19650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142700.1 protein_id gnl|my_center|LOCUS_17650 22812 21748 gene locus_tag LOCUS_17660 22812 21748 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence066 1604 558 gene locus_tag LOCUS_17670 gene asd 1604 558 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP2 protein_id gnl|my_center|LOCUS_17670 1902 3347 gene locus_tag LOCUS_17680 gene tig 1902 3347 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDP0 protein_id gnl|my_center|LOCUS_17680 3574 4356 gene locus_tag LOCUS_17690 gene clpP1 3574 4356 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI2 protein_id gnl|my_center|LOCUS_17690 4370 5716 gene locus_tag LOCUS_17700 gene clpX 4370 5716 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDN9 protein_id gnl|my_center|LOCUS_17700 6351 5713 gene locus_tag LOCUS_17710 6351 5713 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH13 protein_id gnl|my_center|LOCUS_17710 6896 7402 gene locus_tag LOCUS_17720 6896 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 8658 9779 gene locus_tag LOCUS_17730 8658 9779 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_17730 9787 12012 gene locus_tag LOCUS_17740 9787 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057041.1 protein_id gnl|my_center|LOCUS_17740 12083 13033 gene locus_tag LOCUS_17750 12083 13033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 13060 14907 gene locus_tag LOCUS_17760 13060 14907 CDS product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142193.1 protein_id gnl|my_center|LOCUS_17760 14958 15689 gene locus_tag LOCUS_17770 14958 15689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 15748 16806 gene locus_tag LOCUS_17780 15748 16806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 16812 17825 gene locus_tag LOCUS_17790 16812 17825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 17863 19386 gene locus_tag LOCUS_17800 17863 19386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 19392 20636 gene locus_tag LOCUS_17810 19392 20636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 20646 21788 gene locus_tag LOCUS_17820 20646 21788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 21834 22745 gene locus_tag LOCUS_17830 21834 22745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence067 1488 1123 gene locus_tag LOCUS_17840 1488 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2594 1656 gene locus_tag LOCUS_17850 2594 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 3065 4366 gene locus_tag LOCUS_17860 3065 4366 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143095.1 protein_id gnl|my_center|LOCUS_17860 4580 6385 gene locus_tag LOCUS_17870 4580 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 6694 7173 gene locus_tag LOCUS_17880 6694 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 7549 8310 gene locus_tag LOCUS_17890 7549 8310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057898.1 protein_id gnl|my_center|LOCUS_17890 8319 9149 gene locus_tag LOCUS_17900 8319 9149 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056352.1 protein_id gnl|my_center|LOCUS_17900 9350 9210 gene locus_tag LOCUS_17910 9350 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 9542 9384 gene locus_tag LOCUS_17920 9542 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17920 10966 9590 gene locus_tag LOCUS_17930 gene aldH 10966 9590 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0U1 protein_id gnl|my_center|LOCUS_17930 11091 13166 gene locus_tag LOCUS_17940 11091 13166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056981.1 protein_id gnl|my_center|LOCUS_17940 13734 13267 gene locus_tag LOCUS_17950 13734 13267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 15487 14252 gene locus_tag LOCUS_17960 15487 14252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057855.1 protein_id gnl|my_center|LOCUS_17960 15569 16384 gene locus_tag LOCUS_17970 gene desC1 15569 16384 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058212.1 protein_id gnl|my_center|LOCUS_17970 17006 17821 gene locus_tag LOCUS_17980 gene desC1 17006 17821 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058212.1 protein_id gnl|my_center|LOCUS_17980 19836 17995 gene locus_tag LOCUS_17990 19836 17995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 20359 20123 gene locus_tag LOCUS_18000 20359 20123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 20944 20381 gene locus_tag LOCUS_18010 20944 20381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 22633 21053 gene locus_tag LOCUS_18020 gene ndhB 22633 21053 CDS product NAD(P)H-quinone oxidoreductase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR6 protein_id gnl|my_center|LOCUS_18020 >Feature sequence068 49 540 gene locus_tag LOCUS_18030 49 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 616 1107 gene locus_tag LOCUS_18040 616 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2583 1342 gene locus_tag LOCUS_18050 2583 1342 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830748.1 protein_id gnl|my_center|LOCUS_18050 2851 3279 gene locus_tag LOCUS_18060 2851 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 3722 3516 gene locus_tag LOCUS_18070 3722 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 4665 4225 gene locus_tag LOCUS_18080 4665 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143379.1 protein_id gnl|my_center|LOCUS_18080 5515 6951 gene locus_tag LOCUS_18090 5515 6951 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252906.1 protein_id gnl|my_center|LOCUS_18090 7101 7637 gene locus_tag LOCUS_18100 7101 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331451.1 protein_id gnl|my_center|LOCUS_18100 7664 8977 gene locus_tag LOCUS_18110 7664 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 9277 9888 gene locus_tag LOCUS_18120 9277 9888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 11025 9895 gene locus_tag LOCUS_18130 gene pyrD 11025 9895 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB7 protein_id gnl|my_center|LOCUS_18130 11207 14092 gene locus_tag LOCUS_18140 11207 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057287.1 protein_id gnl|my_center|LOCUS_18140 14554 14105 gene locus_tag LOCUS_18150 14554 14105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142477.1 protein_id gnl|my_center|LOCUS_18150 16441 14705 gene locus_tag LOCUS_18160 16441 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 16974 16795 gene locus_tag LOCUS_18170 16974 16795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 17443 16976 gene locus_tag LOCUS_18180 17443 16976 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064873.1 protein_id gnl|my_center|LOCUS_18180 17527 18738 gene locus_tag LOCUS_18190 17527 18738 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 protein_id gnl|my_center|LOCUS_18190 19023 18715 gene locus_tag LOCUS_18200 19023 18715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 20454 19183 gene locus_tag LOCUS_18210 20454 19183 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAX0 protein_id gnl|my_center|LOCUS_18210 22909 20546 gene locus_tag LOCUS_18220 22909 20546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence069 1150 689 gene locus_tag LOCUS_18230 1150 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1639 3288 gene locus_tag LOCUS_18240 gene ppx 1639 3288 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057517.1 protein_id gnl|my_center|LOCUS_18240 3407 4975 gene locus_tag LOCUS_18250 3407 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 6533 5043 gene locus_tag LOCUS_18260 6533 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 6755 7837 gene locus_tag LOCUS_18270 6755 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_18270 8001 9215 gene locus_tag LOCUS_18280 8001 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_18280 9718 9227 gene locus_tag LOCUS_18290 9718 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 10274 9873 gene locus_tag LOCUS_18300 10274 9873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 10897 10388 gene locus_tag LOCUS_18310 10897 10388 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889035.1 protein_id gnl|my_center|LOCUS_18310 11357 11695 gene locus_tag LOCUS_18320 11357 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141134.1 protein_id gnl|my_center|LOCUS_18320 12461 11889 gene locus_tag LOCUS_18330 12461 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 14238 12490 gene locus_tag LOCUS_18340 14238 12490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056502.1 protein_id gnl|my_center|LOCUS_18340 14971 14240 gene locus_tag LOCUS_18350 14971 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143452.1 protein_id gnl|my_center|LOCUS_18350 16319 15144 gene locus_tag LOCUS_18360 16319 15144 CDS product carbon dioxide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057960.1 protein_id gnl|my_center|LOCUS_18360 17934 16417 gene locus_tag LOCUS_18370 gene ndhD 17934 16417 CDS product NAD(P)H-quinone oxidoreductase subunit D4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142080.1 protein_id gnl|my_center|LOCUS_18370 18440 18628 gene locus_tag LOCUS_18380 18440 18628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18380 18744 19352 gene locus_tag LOCUS_18390 18744 19352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18390 19330 20181 gene locus_tag LOCUS_18400 19330 20181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 20652 21821 gene locus_tag LOCUS_18410 20652 21821 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 protein_id gnl|my_center|LOCUS_18410 21858 22715 gene locus_tag LOCUS_18420 gene mmsB 21858 22715 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227993.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence070 353 1411 gene locus_tag LOCUS_18430 353 1411 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_18430 1439 1795 gene locus_tag LOCUS_18440 1439 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3996 1792 gene locus_tag LOCUS_18450 3996 1792 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056292.1 protein_id gnl|my_center|LOCUS_18450 5469 4177 gene locus_tag LOCUS_18460 gene purD 5469 4177 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHV4 protein_id gnl|my_center|LOCUS_18460 6246 5809 gene locus_tag LOCUS_18470 6246 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 6322 6516 gene locus_tag LOCUS_18480 6322 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 6631 7899 gene locus_tag LOCUS_18490 6631 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 8057 11302 gene locus_tag LOCUS_18500 8057 11302 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ61 protein_id gnl|my_center|LOCUS_18500 12589 11591 gene locus_tag LOCUS_18510 gene ilvC 12589 11591 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR0 protein_id gnl|my_center|LOCUS_18510 12687 13076 gene locus_tag LOCUS_18520 12687 13076 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087239.1 protein_id gnl|my_center|LOCUS_18520 15151 13088 gene locus_tag LOCUS_18530 15151 13088 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 protein_id gnl|my_center|LOCUS_18530 17030 15252 gene locus_tag LOCUS_18540 17030 15252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056767.1 protein_id gnl|my_center|LOCUS_18540 17320 17751 gene locus_tag LOCUS_18550 17320 17751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057975.1 protein_id gnl|my_center|LOCUS_18550 18083 19021 gene locus_tag LOCUS_18560 18083 19021 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058018.1 protein_id gnl|my_center|LOCUS_18560 19412 19125 gene locus_tag LOCUS_18570 19412 19125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 19594 19328 gene locus_tag LOCUS_18580 19594 19328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 20903 20139 gene locus_tag LOCUS_18590 20903 20139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 21643 21131 gene locus_tag LOCUS_18600 gene isiB 21643 21131 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNV1 protein_id gnl|my_center|LOCUS_18600 <22861 22171 gene locus_tag LOCUS_18610 <22861 22171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DK20:iron stress-induced chlorophyll-binding protein >Feature sequence071 1632 1180 gene locus_tag LOCUS_18620 1632 1180 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_18620 1898 1641 gene locus_tag LOCUS_18630 1898 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2041 2481 gene locus_tag LOCUS_18640 2041 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2744 2511 gene locus_tag LOCUS_18650 2744 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 3537 2851 gene locus_tag LOCUS_18660 gene queC 3537 2851 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI59 protein_id gnl|my_center|LOCUS_18660 3785 4306 gene locus_tag LOCUS_18670 3785 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 4486 5034 gene locus_tag LOCUS_18680 4486 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 5117 6217 gene locus_tag LOCUS_18690 5117 6217 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_18690 7805 6309 gene locus_tag LOCUS_18700 7805 6309 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124464.1 protein_id gnl|my_center|LOCUS_18700 7838 9010 gene locus_tag LOCUS_18710 7838 9010 CDS product cysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 protein_id gnl|my_center|LOCUS_18710 9178 9681 gene locus_tag LOCUS_18720 9178 9681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18720 10695 9691 gene locus_tag LOCUS_18730 gene menC 10695 9691 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP8 protein_id gnl|my_center|LOCUS_18730 11652 10834 gene locus_tag LOCUS_18740 gene menH 11652 10834 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBE3 protein_id gnl|my_center|LOCUS_18740 11855 11667 gene locus_tag LOCUS_18750 11855 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 12001 13464 gene locus_tag LOCUS_18760 12001 13464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140390.1 protein_id gnl|my_center|LOCUS_18760 13495 14571 gene locus_tag LOCUS_18770 13495 14571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 14698 15834 gene locus_tag LOCUS_18780 14698 15834 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8J4 protein_id gnl|my_center|LOCUS_18780 15904 16320 gene locus_tag LOCUS_18790 15904 16320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 16330 21957 gene locus_tag LOCUS_18800 16330 21957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence072 <1 787 gene locus_tag LOCUS_18810 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0PAS7:carboxy-S-adenosyl-L-methionine synthase 805 1788 gene locus_tag LOCUS_18820 gene cmoB 805 1788 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG5 protein_id gnl|my_center|LOCUS_18820 2694 1825 gene locus_tag LOCUS_18830 2694 1825 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192732.1 protein_id gnl|my_center|LOCUS_18830 3486 2701 gene locus_tag LOCUS_18840 3486 2701 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705863.1 protein_id gnl|my_center|LOCUS_18840 3891 5459 gene locus_tag LOCUS_18850 3891 5459 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 protein_id gnl|my_center|LOCUS_18850 5469 6650 gene locus_tag LOCUS_18860 gene sucC 5469 6650 CDS product succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762775.1 protein_id gnl|my_center|LOCUS_18860 6829 7800 gene locus_tag LOCUS_18870 6829 7800 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M8 protein_id gnl|my_center|LOCUS_18870 8418 10490 gene locus_tag LOCUS_18880 gene glgX-1 8418 10490 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKV9 protein_id gnl|my_center|LOCUS_18880 10825 13503 gene locus_tag LOCUS_18890 10825 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 13665 14720 gene locus_tag LOCUS_18900 13665 14720 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_18900 15994 15362 gene locus_tag LOCUS_18910 gene sepF 15994 15362 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK7 protein_id gnl|my_center|LOCUS_18910 16917 16246 gene locus_tag LOCUS_18920 16917 16246 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056880.1 protein_id gnl|my_center|LOCUS_18920 17197 16928 gene locus_tag LOCUS_18930 17197 16928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057448.1 protein_id gnl|my_center|LOCUS_18930 18468 17497 gene locus_tag LOCUS_18940 18468 17497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056139.1 protein_id gnl|my_center|LOCUS_18940 19976 18615 gene locus_tag LOCUS_18950 gene der 19976 18615 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI1 protein_id gnl|my_center|LOCUS_18950 20539 20048 gene locus_tag LOCUS_18960 20539 20048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143028.1 protein_id gnl|my_center|LOCUS_18960 21159 20545 gene locus_tag LOCUS_18970 gene queE 21159 20545 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCE3 protein_id gnl|my_center|LOCUS_18970 22315 21743 gene locus_tag LOCUS_18980 22315 21743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence073 4673 5143 gene locus_tag LOCUS_18990 4673 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 6793 5189 gene locus_tag LOCUS_19000 6793 5189 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_19000 8026 7256 gene locus_tag LOCUS_19010 8026 7256 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142000.1 protein_id gnl|my_center|LOCUS_19010 8847 8044 gene locus_tag LOCUS_19020 8847 8044 CDS product ketoacyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777089.1 protein_id gnl|my_center|LOCUS_19020 9511 10251 gene locus_tag LOCUS_19030 9511 10251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 10727 10957 gene locus_tag LOCUS_19040 10727 10957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 11862 12683 gene locus_tag LOCUS_19050 11862 12683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 13505 12744 gene locus_tag LOCUS_19060 13505 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 14455 13640 gene locus_tag LOCUS_19070 14455 13640 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058216.1 protein_id gnl|my_center|LOCUS_19070 14469 14906 gene locus_tag LOCUS_19080 14469 14906 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_19080 14990 16258 gene locus_tag LOCUS_19090 14990 16258 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039289.1 protein_id gnl|my_center|LOCUS_19090 17611 16694 gene locus_tag LOCUS_19100 17611 16694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 19859 17829 gene locus_tag LOCUS_19110 19859 17829 CDS product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142193.1 protein_id gnl|my_center|LOCUS_19110 20107 21033 gene locus_tag LOCUS_19120 20107 21033 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057997.1 protein_id gnl|my_center|LOCUS_19120 21647 21168 gene locus_tag LOCUS_19130 21647 21168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19130 22093 21644 gene locus_tag LOCUS_19140 22093 21644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19140 >Feature sequence074 115 732 gene locus_tag LOCUS_19150 115 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1507 791 gene locus_tag LOCUS_19160 1507 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2528 1551 gene locus_tag LOCUS_19170 2528 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 2760 4187 gene locus_tag LOCUS_19180 2760 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 4206 5120 gene locus_tag LOCUS_19190 4206 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 5211 7367 gene locus_tag LOCUS_19200 gene glyS 5211 7367 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGX0 protein_id gnl|my_center|LOCUS_19200 7427 7876 gene locus_tag LOCUS_19210 7427 7876 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082236.1 protein_id gnl|my_center|LOCUS_19210 8060 8800 gene locus_tag LOCUS_19220 gene ycf29 8060 8800 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 protein_id gnl|my_center|LOCUS_19220 9161 10672 gene locus_tag LOCUS_19230 9161 10672 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056473.1 protein_id gnl|my_center|LOCUS_19230 10712 11266 gene locus_tag LOCUS_19240 gene cobU 10712 11266 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 protein_id gnl|my_center|LOCUS_19240 11307 11522 gene locus_tag LOCUS_19250 11307 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 11944 11525 gene locus_tag LOCUS_19260 11944 11525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 14640 12073 gene locus_tag LOCUS_19270 14640 12073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 16359 14650 gene locus_tag LOCUS_19280 16359 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 17595 16762 gene locus_tag LOCUS_19290 17595 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 19052 17844 gene locus_tag LOCUS_19300 19052 17844 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 protein_id gnl|my_center|LOCUS_19300 20340 19195 gene locus_tag LOCUS_19310 gene gldA 20340 19195 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057886.1 protein_id gnl|my_center|LOCUS_19310 20721 21308 gene locus_tag LOCUS_19320 20721 21308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence075 <1 1596 gene locus_tag LOCUS_19330 <1 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001764195.1:membrane protein 2241 1600 gene locus_tag LOCUS_19340 2241 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2391 4838 gene locus_tag LOCUS_19350 2391 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142223.1 protein_id gnl|my_center|LOCUS_19350 6294 4852 gene locus_tag LOCUS_19360 6294 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 6541 7899 gene locus_tag LOCUS_19370 6541 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 10157 7908 gene locus_tag LOCUS_19380 10157 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 12040 10160 gene locus_tag LOCUS_19390 12040 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144229.1 protein_id gnl|my_center|LOCUS_19390 12161 13396 gene locus_tag LOCUS_19400 gene opuAA 12161 13396 CDS product glycine betaine transport ATP-binding protein OpuAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KIF7 protein_id gnl|my_center|LOCUS_19400 14972 13386 gene locus_tag LOCUS_19410 14972 13386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 15210 16088 gene locus_tag LOCUS_19420 gene mtnP 15210 16088 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE4 protein_id gnl|my_center|LOCUS_19420 16610 16158 gene locus_tag LOCUS_19430 16610 16158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 17643 16630 gene locus_tag LOCUS_19440 17643 16630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 17864 18490 gene locus_tag LOCUS_19450 gene rimM 17864 18490 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK05 protein_id gnl|my_center|LOCUS_19450 19424 18702 gene locus_tag LOCUS_19460 gene cysH 19424 18702 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNZ6 protein_id gnl|my_center|LOCUS_19460 20124 19486 gene locus_tag LOCUS_19470 20124 19486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 20443 20207 gene locus_tag LOCUS_19480 20443 20207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 21108 20524 gene locus_tag LOCUS_19490 21108 20524 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223840.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence076 1211 1765 gene locus_tag LOCUS_19500 gene cpcS 1211 1765 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU5 protein_id gnl|my_center|LOCUS_19500 3308 2130 gene locus_tag LOCUS_19510 3308 2130 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 protein_id gnl|my_center|LOCUS_19510 3378 3554 gene locus_tag LOCUS_19520 3378 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 3593 4036 gene locus_tag LOCUS_19530 3593 4036 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI8 protein_id gnl|my_center|LOCUS_19530 4166 4753 gene locus_tag LOCUS_19540 4166 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057704.1 protein_id gnl|my_center|LOCUS_19540 4800 5870 gene locus_tag LOCUS_19550 4800 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141130.1 protein_id gnl|my_center|LOCUS_19550 6250 6624 gene locus_tag LOCUS_19560 6250 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 9627 6655 gene locus_tag LOCUS_19570 9627 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 9808 12426 gene locus_tag LOCUS_19580 9808 12426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 12438 13058 gene locus_tag LOCUS_19590 12438 13058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142983.1 protein_id gnl|my_center|LOCUS_19590 13092 13364 gene locus_tag LOCUS_19600 13092 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 13361 13777 gene locus_tag LOCUS_19610 13361 13777 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141678.1 protein_id gnl|my_center|LOCUS_19610 13797 14156 gene locus_tag LOCUS_19620 13797 14156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 16448 14217 gene locus_tag LOCUS_19630 16448 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 17119 16589 gene locus_tag LOCUS_19640 17119 16589 CDS product pili assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056853.1 protein_id gnl|my_center|LOCUS_19640 20152 17417 gene locus_tag LOCUS_19650 gene valS 20152 17417 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS8 protein_id gnl|my_center|LOCUS_19650 >Feature sequence077 537 770 gene locus_tag LOCUS_19660 537 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 806 1312 gene locus_tag LOCUS_19670 806 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2165 1314 gene locus_tag LOCUS_19680 gene mutM 2165 1314 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59065 protein_id gnl|my_center|LOCUS_19680 2488 2258 gene locus_tag LOCUS_19690 gene psaE 2488 2258 CDS product photosystem I reaction center subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A423 protein_id gnl|my_center|LOCUS_19690 3223 2546 gene locus_tag LOCUS_19700 3223 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140118.1 protein_id gnl|my_center|LOCUS_19700 4083 3340 gene locus_tag LOCUS_19710 4083 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 5450 4143 gene locus_tag LOCUS_19720 5450 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 5764 7362 gene locus_tag LOCUS_19730 gene gpmI 5764 7362 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59177 protein_id gnl|my_center|LOCUS_19730 7508 7738 gene locus_tag LOCUS_19740 gene secG 7508 7738 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 protein_id gnl|my_center|LOCUS_19740 8358 7750 gene locus_tag LOCUS_19750 8358 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 8654 9247 gene locus_tag LOCUS_19760 8654 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058125.1 protein_id gnl|my_center|LOCUS_19760 11398 9524 gene locus_tag LOCUS_19770 11398 9524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 11846 11469 gene locus_tag LOCUS_19780 11846 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 12187 15156 gene locus_tag LOCUS_19790 gene gcvP 12187 15156 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 protein_id gnl|my_center|LOCUS_19790 16365 15478 gene locus_tag LOCUS_19800 16365 15478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 20368 16751 gene locus_tag LOCUS_19810 20368 16751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_19810 21279 20515 gene locus_tag LOCUS_19820 gene yegK 21279 20515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119099.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence078 1816 389 gene locus_tag LOCUS_19830 gene phrA 1816 389 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056280.1 protein_id gnl|my_center|LOCUS_19830 2534 1986 gene locus_tag LOCUS_19840 2534 1986 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056278.1 protein_id gnl|my_center|LOCUS_19840 3062 2553 gene locus_tag LOCUS_19850 3062 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 4947 3109 gene locus_tag LOCUS_19860 4947 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 5264 5449 gene locus_tag LOCUS_19870 5264 5449 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZC7 protein_id gnl|my_center|LOCUS_19870 6370 7098 gene locus_tag LOCUS_19880 gene pdxJ 6370 7098 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPF2 protein_id gnl|my_center|LOCUS_19880 7222 7551 gene locus_tag LOCUS_19890 gene ycf54 7222 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 protein_id gnl|my_center|LOCUS_19890 7619 8305 gene locus_tag LOCUS_19900 7619 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 8793 8335 gene locus_tag LOCUS_19910 8793 8335 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055874.1 protein_id gnl|my_center|LOCUS_19910 9758 8808 gene locus_tag LOCUS_19920 gene crtE 9758 8808 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_19920 10254 10721 gene locus_tag LOCUS_19930 10254 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 12771 10825 gene locus_tag LOCUS_19940 12771 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 13427 14935 gene locus_tag LOCUS_19950 13427 14935 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918532.1 protein_id gnl|my_center|LOCUS_19950 15626 14949 gene locus_tag LOCUS_19960 gene surE 15626 14949 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_19960 18176 15708 gene locus_tag LOCUS_19970 gene recG 18176 15708 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW6 protein_id gnl|my_center|LOCUS_19970 18693 19640 gene locus_tag LOCUS_19980 18693 19640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 19710 20228 gene locus_tag LOCUS_19990 19710 20228 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144323.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence079 5308 2021 gene locus_tag LOCUS_20000 5308 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 6821 5493 gene locus_tag LOCUS_20010 6821 5493 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058287.1 protein_id gnl|my_center|LOCUS_20010 7719 7027 gene locus_tag LOCUS_20020 7719 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140502.1 protein_id gnl|my_center|LOCUS_20020 8143 9336 gene locus_tag LOCUS_20030 8143 9336 CDS product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 protein_id gnl|my_center|LOCUS_20030 10374 9442 gene locus_tag LOCUS_20040 gene ghrA 10374 9442 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRR3 protein_id gnl|my_center|LOCUS_20040 13054 10493 gene locus_tag LOCUS_20050 13054 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 14396 15862 gene locus_tag LOCUS_20060 14396 15862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 15933 16523 gene locus_tag LOCUS_20070 15933 16523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20070 16585 16833 gene locus_tag LOCUS_20080 16585 16833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 16904 18133 gene locus_tag LOCUS_20090 16904 18133 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_20090 19438 18197 gene locus_tag LOCUS_20100 19438 18197 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_20100 20858 19638 gene locus_tag LOCUS_20110 gene ispG 20858 19638 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK70 protein_id gnl|my_center|LOCUS_20110 >Feature sequence080 1814 1149 gene locus_tag LOCUS_20120 1814 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 4394 2487 gene locus_tag LOCUS_20130 gene dxs 4394 2487 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL74 protein_id gnl|my_center|LOCUS_20130 5180 4941 gene locus_tag LOCUS_20140 5180 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20140 5603 5271 gene locus_tag LOCUS_20150 5603 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20150 7158 6238 gene locus_tag LOCUS_20160 7158 6238 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_20160 8175 7411 gene locus_tag LOCUS_20170 8175 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 9574 8696 gene locus_tag LOCUS_20180 9574 8696 CDS product tartronate semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_20180 9814 9984 gene locus_tag LOCUS_20190 9814 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 10254 12263 gene locus_tag LOCUS_20200 10254 12263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 12370 13071 gene locus_tag LOCUS_20210 12370 13071 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 protein_id gnl|my_center|LOCUS_20210 13983 13153 gene locus_tag LOCUS_20220 13983 13153 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL0 protein_id gnl|my_center|LOCUS_20220 14660 14052 gene locus_tag LOCUS_20230 14660 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 14773 15042 gene locus_tag LOCUS_20240 14773 15042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 15939 15064 gene locus_tag LOCUS_20250 15939 15064 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_20250 16784 16086 gene locus_tag LOCUS_20260 16784 16086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057309.1 protein_id gnl|my_center|LOCUS_20260 18445 17042 gene locus_tag LOCUS_20270 gene leuC 18445 17042 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFV7 protein_id gnl|my_center|LOCUS_20270 18546 21353 gene locus_tag LOCUS_20280 18546 21353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence081 2465 204 gene locus_tag LOCUS_20290 2465 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 3048 3818 gene locus_tag LOCUS_20300 3048 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 protein_id gnl|my_center|LOCUS_20300 4327 4890 gene locus_tag LOCUS_20310 4327 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 5665 4895 gene locus_tag LOCUS_20320 5665 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141382.1 protein_id gnl|my_center|LOCUS_20320 5832 7142 gene locus_tag LOCUS_20330 5832 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 7182 8357 gene locus_tag LOCUS_20340 7182 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 8363 10783 gene locus_tag LOCUS_20350 8363 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 10821 11603 gene locus_tag LOCUS_20360 10821 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 11942 12082 gene locus_tag LOCUS_20370 11942 12082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 12465 12130 gene locus_tag LOCUS_20380 12465 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 12767 12585 gene locus_tag LOCUS_20390 12767 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 13244 12981 gene locus_tag LOCUS_20400 13244 12981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 13380 17435 gene locus_tag LOCUS_20410 13380 17435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 17466 18095 gene locus_tag LOCUS_20420 17466 18095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142166.1 protein_id gnl|my_center|LOCUS_20420 21110 18111 gene locus_tag LOCUS_20430 21110 18111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_20430 21385 21179 gene locus_tag LOCUS_20440 21385 21179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence082 <1 522 gene locus_tag LOCUS_20450 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254604.1:transposase 1410 970 gene locus_tag LOCUS_20460 1410 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 1686 1614 gene locus_tag LOCUS_t00160 1686 1614 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1736 2104 gene locus_tag LOCUS_20470 1736 2104 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKV4 protein_id gnl|my_center|LOCUS_20470 2200 3354 gene locus_tag LOCUS_20480 2200 3354 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057305.1 protein_id gnl|my_center|LOCUS_20480 3674 3447 gene locus_tag LOCUS_20490 3674 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058211.1 protein_id gnl|my_center|LOCUS_20490 4923 4387 gene locus_tag LOCUS_20500 4923 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056117.1 protein_id gnl|my_center|LOCUS_20500 5753 5058 gene locus_tag LOCUS_20510 5753 5058 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056116.1 protein_id gnl|my_center|LOCUS_20510 5953 6687 gene locus_tag LOCUS_20520 5953 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057310.1 protein_id gnl|my_center|LOCUS_20520 6894 8153 gene locus_tag LOCUS_20530 gene metK 6894 8153 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK88 protein_id gnl|my_center|LOCUS_20530 8508 10316 gene locus_tag LOCUS_20540 8508 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 10400 12727 gene locus_tag LOCUS_20550 10400 12727 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056388.1 protein_id gnl|my_center|LOCUS_20550 12918 12706 gene locus_tag LOCUS_20560 12918 12706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 12946 13860 gene locus_tag LOCUS_20570 gene dapF 12946 13860 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM2 protein_id gnl|my_center|LOCUS_20570 13842 15035 gene locus_tag LOCUS_20580 13842 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 15960 15064 gene locus_tag LOCUS_20590 gene APA2 15960 15064 CDS product ATP adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125113.1 protein_id gnl|my_center|LOCUS_20590 16152 16067 gene locus_tag LOCUS_t00170 16152 16067 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16615 16367 gene locus_tag LOCUS_20600 16615 16367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 16822 17079 gene locus_tag LOCUS_20610 16822 17079 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 protein_id gnl|my_center|LOCUS_20610 17277 18527 gene locus_tag LOCUS_20620 17277 18527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 18589 19560 gene locus_tag LOCUS_20630 gene gshB 18589 19560 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKF1 protein_id gnl|my_center|LOCUS_20630 19596 20714 gene locus_tag LOCUS_20640 19596 20714 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144332.1 protein_id gnl|my_center|LOCUS_20640 >Feature sequence083 409 125 gene locus_tag LOCUS_20650 409 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1198 701 gene locus_tag LOCUS_20660 1198 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 1447 2067 gene locus_tag LOCUS_20670 1447 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2795 2169 gene locus_tag LOCUS_20680 2795 2169 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 protein_id gnl|my_center|LOCUS_20680 3402 2902 gene locus_tag LOCUS_20690 3402 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 3760 3419 gene locus_tag LOCUS_20700 3760 3419 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 protein_id gnl|my_center|LOCUS_20700 5390 3762 gene locus_tag LOCUS_20710 5390 3762 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056694.1 protein_id gnl|my_center|LOCUS_20710 5934 5533 gene locus_tag LOCUS_20720 5934 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 6077 6901 gene locus_tag LOCUS_20730 6077 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 8836 6908 gene locus_tag LOCUS_20740 8836 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 8924 10456 gene locus_tag LOCUS_20750 8924 10456 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142005.1 protein_id gnl|my_center|LOCUS_20750 10598 11044 gene locus_tag LOCUS_20760 10598 11044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 11095 12657 gene locus_tag LOCUS_20770 11095 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 12722 13663 gene locus_tag LOCUS_20780 gene wcaG 12722 13663 CDS product mRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 protein_id gnl|my_center|LOCUS_20780 13833 14255 gene locus_tag LOCUS_20790 13833 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 16203 14284 gene locus_tag LOCUS_20800 16203 14284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 16670 16212 gene locus_tag LOCUS_20810 16670 16212 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021290.1 protein_id gnl|my_center|LOCUS_20810 18968 16680 gene locus_tag LOCUS_20820 18968 16680 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_20820 19521 19096 gene locus_tag LOCUS_20830 19521 19096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 21211 19511 gene locus_tag LOCUS_20840 21211 19511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence084 1730 297 gene locus_tag LOCUS_20850 gene glgA 1730 297 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU2 protein_id gnl|my_center|LOCUS_20850 1945 2634 gene locus_tag LOCUS_20860 1945 2634 CDS product nitrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057403.1 protein_id gnl|my_center|LOCUS_20860 2865 3263 gene locus_tag LOCUS_20870 gene petE 2865 3263 CDS product plastocyanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125233.1 protein_id gnl|my_center|LOCUS_20870 3551 3901 gene locus_tag LOCUS_20880 gene petJ 3551 3901 CDS product cytochrome c6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X9 protein_id gnl|my_center|LOCUS_20880 3924 4709 gene locus_tag LOCUS_20890 3924 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142774.1 protein_id gnl|my_center|LOCUS_20890 4758 5042 gene locus_tag LOCUS_20900 4758 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141965.1 protein_id gnl|my_center|LOCUS_20900 5159 5983 gene locus_tag LOCUS_20910 gene dapB 5159 5983 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH2 protein_id gnl|my_center|LOCUS_20910 6284 8044 gene locus_tag LOCUS_20920 6284 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 8383 9159 gene locus_tag LOCUS_20930 gene panB 8383 9159 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMK3 protein_id gnl|my_center|LOCUS_20930 9542 10627 gene locus_tag LOCUS_20940 9542 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 11732 10926 gene locus_tag LOCUS_20950 11732 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 12512 11898 gene locus_tag LOCUS_20960 gene ubiX 12512 11898 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN84 protein_id gnl|my_center|LOCUS_20960 14302 12530 gene locus_tag LOCUS_20970 gene ggt 14302 12530 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805086.1 protein_id gnl|my_center|LOCUS_20970 16335 14347 gene locus_tag LOCUS_20980 16335 14347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 17537 16647 gene locus_tag LOCUS_20990 17537 16647 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057385.1 protein_id gnl|my_center|LOCUS_20990 17723 18358 gene locus_tag LOCUS_21000 gene purN 17723 18358 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ1 protein_id gnl|my_center|LOCUS_21000 18358 18546 gene locus_tag LOCUS_21010 18358 18546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 19457 18474 gene locus_tag LOCUS_21020 19457 18474 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_21020 20487 19387 gene locus_tag LOCUS_21030 gene aroC 20487 19387 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence085 2090 4081 gene locus_tag LOCUS_21040 2090 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878320.1 protein_id gnl|my_center|LOCUS_21040 5332 4481 gene locus_tag LOCUS_21050 5332 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 6704 5382 gene locus_tag LOCUS_21060 6704 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 7679 6708 gene locus_tag LOCUS_21070 7679 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 9902 7704 gene locus_tag LOCUS_21080 9902 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 10868 10656 gene locus_tag LOCUS_21090 10868 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21090 11557 11192 gene locus_tag LOCUS_21100 11557 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 14539 11840 gene locus_tag LOCUS_21110 14539 11840 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058103.1 protein_id gnl|my_center|LOCUS_21110 14943 16058 gene locus_tag LOCUS_21120 14943 16058 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_21120 16344 18317 gene locus_tag LOCUS_21130 16344 18317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 18351 18722 gene locus_tag LOCUS_21140 18351 18722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 18917 19897 gene locus_tag LOCUS_21150 18917 19897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence086 3514 2729 gene locus_tag LOCUS_21160 3514 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21160 4678 3527 gene locus_tag LOCUS_21170 4678 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21170 5345 5530 gene locus_tag LOCUS_21180 5345 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 5691 11216 gene locus_tag LOCUS_21190 5691 11216 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_21190 12455 12255 gene locus_tag LOCUS_21200 12455 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057514.1 protein_id gnl|my_center|LOCUS_21200 13049 12486 gene locus_tag LOCUS_21210 gene def 13049 12486 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIB4 protein_id gnl|my_center|LOCUS_21210 13596 13123 gene locus_tag LOCUS_21220 gene fcbC 13596 13123 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124513.1 protein_id gnl|my_center|LOCUS_21220 13761 14615 gene locus_tag LOCUS_21230 13761 14615 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057366.1 protein_id gnl|my_center|LOCUS_21230 15808 14903 gene locus_tag LOCUS_21240 gene rimK 15808 14903 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ2 protein_id gnl|my_center|LOCUS_21240 17159 16158 gene locus_tag LOCUS_21250 gene obg 17159 16158 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG4 protein_id gnl|my_center|LOCUS_21250 17938 17228 gene locus_tag LOCUS_21260 17938 17228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 protein_id gnl|my_center|LOCUS_21260 19292 18174 gene locus_tag LOCUS_21270 19292 18174 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_21270 20286 19366 gene locus_tag LOCUS_21280 gene nadK2 20286 19366 CDS product NAD kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RR32 protein_id gnl|my_center|LOCUS_21280 >Feature sequence087 1143 223 gene locus_tag LOCUS_21290 1143 223 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_21290 3011 1314 gene locus_tag LOCUS_21300 3011 1314 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_21300 3255 3040 gene locus_tag LOCUS_21310 3255 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 5526 3307 gene locus_tag LOCUS_21320 5526 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 protein_id gnl|my_center|LOCUS_21320 6344 5604 gene locus_tag LOCUS_21330 6344 5604 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056437.1 protein_id gnl|my_center|LOCUS_21330 6877 7245 gene locus_tag LOCUS_21340 6877 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21340 7205 7627 gene locus_tag LOCUS_21350 7205 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21350 7714 9006 gene locus_tag LOCUS_21360 gene serS 7714 9006 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN0 protein_id gnl|my_center|LOCUS_21360 9171 10799 gene locus_tag LOCUS_21370 9171 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 10944 12440 gene locus_tag LOCUS_21380 10944 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057727.1 protein_id gnl|my_center|LOCUS_21380 12537 13325 gene locus_tag LOCUS_21390 12537 13325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 14566 13355 gene locus_tag LOCUS_21400 14566 13355 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZD9 protein_id gnl|my_center|LOCUS_21400 15987 14584 gene locus_tag LOCUS_21410 15987 14584 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 protein_id gnl|my_center|LOCUS_21410 16142 17488 gene locus_tag LOCUS_21420 gene guaD 16142 17488 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76641 protein_id gnl|my_center|LOCUS_21420 18495 17485 gene locus_tag LOCUS_21430 gene add 18495 17485 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_21430 18616 19536 gene locus_tag LOCUS_21440 18616 19536 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL98 protein_id gnl|my_center|LOCUS_21440 >Feature sequence088 2619 883 gene locus_tag LOCUS_21450 2619 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 3547 2696 gene locus_tag LOCUS_21460 3547 2696 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_21460 3623 3826 gene locus_tag LOCUS_21470 3623 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 3885 4178 gene locus_tag LOCUS_21480 3885 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377382.1 protein_id gnl|my_center|LOCUS_21480 4208 5848 gene locus_tag LOCUS_21490 4208 5848 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 protein_id gnl|my_center|LOCUS_21490 5965 6753 gene locus_tag LOCUS_21500 gene wecG 5965 6753 CDS product UDP-N-acetyl-D-mannosaminuronic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123818.1 protein_id gnl|my_center|LOCUS_21500 6951 10715 gene locus_tag LOCUS_21510 gene bchH 6951 10715 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388379.1 protein_id gnl|my_center|LOCUS_21510 10803 11126 gene locus_tag LOCUS_21520 10803 11126 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140011.1 protein_id gnl|my_center|LOCUS_21520 11452 12243 gene locus_tag LOCUS_21530 11452 12243 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144148.1 protein_id gnl|my_center|LOCUS_21530 12650 12366 gene locus_tag LOCUS_21540 12650 12366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977125.1 protein_id gnl|my_center|LOCUS_21540 12813 13178 gene locus_tag LOCUS_21550 12813 13178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057913.1 protein_id gnl|my_center|LOCUS_21550 15073 13175 gene locus_tag LOCUS_21560 15073 13175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056078.1 protein_id gnl|my_center|LOCUS_21560 16085 15234 gene locus_tag LOCUS_21570 16085 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140730.1 protein_id gnl|my_center|LOCUS_21570 16411 16740 gene locus_tag LOCUS_21580 16411 16740 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_21580 16750 16947 gene locus_tag LOCUS_21590 16750 16947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 16949 18010 gene locus_tag LOCUS_21600 16949 18010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056519.1 protein_id gnl|my_center|LOCUS_21600 18053 18646 gene locus_tag LOCUS_21610 18053 18646 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056337.1 protein_id gnl|my_center|LOCUS_21610 19792 18755 gene locus_tag LOCUS_21620 gene cobW 19792 18755 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057463.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence089 640 155 gene locus_tag LOCUS_21630 640 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 846 2342 gene locus_tag LOCUS_21640 846 2342 CDS product dolichyl-phosphate-mannose-protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 protein_id gnl|my_center|LOCUS_21640 2594 2773 gene locus_tag LOCUS_21650 2594 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3008 3081 gene locus_tag LOCUS_t00180 3008 3081 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3158 3337 gene locus_tag LOCUS_21660 3158 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 3312 4175 gene locus_tag LOCUS_21670 3312 4175 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN7 protein_id gnl|my_center|LOCUS_21670 4274 5683 gene locus_tag LOCUS_21680 4274 5683 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532721.1 protein_id gnl|my_center|LOCUS_21680 5692 7008 gene locus_tag LOCUS_21690 5692 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 7138 8364 gene locus_tag LOCUS_21700 7138 8364 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_21700 8502 14774 gene locus_tag LOCUS_21710 8502 14774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 14784 16286 gene locus_tag LOCUS_21720 14784 16286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 16341 17606 gene locus_tag LOCUS_21730 16341 17606 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268208.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence090 1414 2205 gene locus_tag LOCUS_21740 1414 2205 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144315.1 protein_id gnl|my_center|LOCUS_21740 2267 3442 gene locus_tag LOCUS_21750 2267 3442 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141636.1 protein_id gnl|my_center|LOCUS_21750 3621 5024 gene locus_tag LOCUS_21760 3621 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 6023 5073 gene locus_tag LOCUS_21770 6023 5073 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP3 protein_id gnl|my_center|LOCUS_21770 7404 6157 gene locus_tag LOCUS_21780 gene tyrS 7404 6157 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR1 protein_id gnl|my_center|LOCUS_21780 7755 9680 gene locus_tag LOCUS_21790 7755 9680 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055904.1 protein_id gnl|my_center|LOCUS_21790 9920 10147 gene locus_tag LOCUS_21800 9920 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 10782 12614 gene locus_tag LOCUS_21810 10782 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 12836 12624 gene locus_tag LOCUS_21820 gene ndhO 12836 12624 CDS product NAD(P)H-quinone oxidoreductase subunit O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFI1 protein_id gnl|my_center|LOCUS_21820 13260 12991 gene locus_tag LOCUS_21830 13260 12991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 15084 13810 gene locus_tag LOCUS_21840 gene hemN2 15084 13810 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057034.1 protein_id gnl|my_center|LOCUS_21840 15427 16509 gene locus_tag LOCUS_21850 gene ycf81 15427 16509 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055863.1 protein_id gnl|my_center|LOCUS_21850 16530 17270 gene locus_tag LOCUS_21860 16530 17270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056977.1 protein_id gnl|my_center|LOCUS_21860 <19475 17248 gene locus_tag LOCUS_21870 <19475 17248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E2W3:histidine kinase >Feature sequence091 2377 3456 gene locus_tag LOCUS_21880 gene fbaA 2377 3456 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056231.1 protein_id gnl|my_center|LOCUS_21880 4544 3765 gene locus_tag LOCUS_21890 gene cpmA 4544 3765 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057031.1 protein_id gnl|my_center|LOCUS_21890 6277 4550 gene locus_tag LOCUS_21900 6277 4550 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_21900 6886 6407 gene locus_tag LOCUS_21910 gene ispF 6886 6407 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC4 protein_id gnl|my_center|LOCUS_21910 7099 7242 gene locus_tag LOCUS_21920 gene hli4 7099 7242 CDS product high light inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 protein_id gnl|my_center|LOCUS_21920 8688 7528 gene locus_tag LOCUS_21930 8688 7528 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119434.1 protein_id gnl|my_center|LOCUS_21930 9947 8697 gene locus_tag LOCUS_21940 9947 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 11162 9999 gene locus_tag LOCUS_21950 11162 9999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 12027 11455 gene locus_tag LOCUS_21960 12027 11455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 15074 12936 gene locus_tag LOCUS_21970 15074 12936 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058113.1 protein_id gnl|my_center|LOCUS_21970 16014 15235 gene locus_tag LOCUS_21980 16014 15235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057555.1 protein_id gnl|my_center|LOCUS_21980 16186 17124 gene locus_tag LOCUS_21990 16186 17124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_21990 17677 19305 gene locus_tag LOCUS_22000 gene prfC 17677 19305 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGV7 protein_id gnl|my_center|LOCUS_22000 >Feature sequence092 1421 834 gene locus_tag LOCUS_22010 1421 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056693.1 protein_id gnl|my_center|LOCUS_22010 2533 1760 gene locus_tag LOCUS_22020 2533 1760 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057801.1 protein_id gnl|my_center|LOCUS_22020 4383 3130 gene locus_tag LOCUS_22030 4383 3130 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y936 protein_id gnl|my_center|LOCUS_22030 4595 4987 gene locus_tag LOCUS_22040 4595 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 5855 4968 gene locus_tag LOCUS_22050 5855 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 6950 5967 gene locus_tag LOCUS_22060 6950 5967 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_22060 7805 6993 gene locus_tag LOCUS_22070 7805 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 9830 8028 gene locus_tag LOCUS_22080 9830 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 10932 9808 gene locus_tag LOCUS_22090 10932 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 12879 11317 gene locus_tag LOCUS_22100 12879 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 13363 14421 gene locus_tag LOCUS_22110 13363 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 14501 15214 gene locus_tag LOCUS_22120 14501 15214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 15391 16137 gene locus_tag LOCUS_22130 15391 16137 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_22130 16843 19203 gene locus_tag LOCUS_22140 gene purL 16843 19203 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA7 protein_id gnl|my_center|LOCUS_22140 >Feature sequence093 673 1560 gene locus_tag LOCUS_22150 673 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 2048 1557 gene locus_tag LOCUS_22160 gene psbV2 2048 1557 CDS product cytochrome c-550-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE2 protein_id gnl|my_center|LOCUS_22160 2830 2339 gene locus_tag LOCUS_22170 gene psbV 2830 2339 CDS product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A386 protein_id gnl|my_center|LOCUS_22170 3339 3136 gene locus_tag LOCUS_22180 3339 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 4665 3493 gene locus_tag LOCUS_22190 gene sasA 4665 3493 CDS product adaptive-response sensory-kinase SasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMT2 protein_id gnl|my_center|LOCUS_22190 4865 6505 gene locus_tag LOCUS_22200 4865 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 6525 8567 gene locus_tag LOCUS_22210 6525 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 10372 8498 gene locus_tag LOCUS_22220 10372 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 10683 11453 gene locus_tag LOCUS_22230 10683 11453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 12887 11589 gene locus_tag LOCUS_22240 12887 11589 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101511.1 protein_id gnl|my_center|LOCUS_22240 12940 13344 gene locus_tag LOCUS_22250 12940 13344 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402975.1 protein_id gnl|my_center|LOCUS_22250 14119 13415 gene locus_tag LOCUS_22260 14119 13415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 15367 14369 gene locus_tag LOCUS_22270 gene ldh 15367 14369 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG49 protein_id gnl|my_center|LOCUS_22270 16442 15627 gene locus_tag LOCUS_22280 16442 15627 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258316.1 protein_id gnl|my_center|LOCUS_22280 17322 16444 gene locus_tag LOCUS_22290 gene bcpA 17322 16444 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038963.1 protein_id gnl|my_center|LOCUS_22290 17728 18288 gene locus_tag LOCUS_22300 17728 18288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 18543 18331 gene locus_tag LOCUS_22310 18543 18331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22310 18914 19147 gene locus_tag LOCUS_22320 18914 19147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence094 246 1277 gene locus_tag LOCUS_22330 246 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144162.1 protein_id gnl|my_center|LOCUS_22330 2593 1352 gene locus_tag LOCUS_22340 2593 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22340 3247 2630 gene locus_tag LOCUS_22350 3247 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 4619 3342 gene locus_tag LOCUS_22360 4619 3342 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_22360 5549 4932 gene locus_tag LOCUS_22370 5549 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 6033 6656 gene locus_tag LOCUS_22380 gene thf1 6033 6656 CDS product protein Thf1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJT8 protein_id gnl|my_center|LOCUS_22380 7286 8176 gene locus_tag LOCUS_22390 7286 8176 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_22390 8345 10195 gene locus_tag LOCUS_22400 8345 10195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 11287 10343 gene locus_tag LOCUS_22410 11287 10343 CDS product glycosly transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056836.1 protein_id gnl|my_center|LOCUS_22410 11372 11590 gene locus_tag LOCUS_22420 11372 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 11820 12281 gene locus_tag LOCUS_22430 11820 12281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 13033 12350 gene locus_tag LOCUS_22440 13033 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 13195 14715 gene locus_tag LOCUS_22450 13195 14715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 15262 15819 gene locus_tag LOCUS_22460 15262 15819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 16233 16883 gene locus_tag LOCUS_22470 16233 16883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence095 2246 963 gene locus_tag LOCUS_22480 2246 963 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_22480 2751 3179 gene locus_tag LOCUS_22490 2751 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 3881 3516 gene locus_tag LOCUS_22500 3881 3516 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140204.1 protein_id gnl|my_center|LOCUS_22500 4218 5363 gene locus_tag LOCUS_22510 4218 5363 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_22510 5515 6405 gene locus_tag LOCUS_22520 5515 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 6543 7304 gene locus_tag LOCUS_22530 6543 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 7502 9151 gene locus_tag LOCUS_22540 7502 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 9189 11399 gene locus_tag LOCUS_22550 9189 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142199.1 protein_id gnl|my_center|LOCUS_22550 11504 12247 gene locus_tag LOCUS_22560 11504 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_22560 13023 12253 gene locus_tag LOCUS_22570 13023 12253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 13111 15840 gene locus_tag LOCUS_22580 13111 15840 CDS product tetratricopeptide repeat domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_22580 16514 15843 gene locus_tag LOCUS_22590 16514 15843 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407919.1 protein_id gnl|my_center|LOCUS_22590 16733 17554 gene locus_tag LOCUS_22600 16733 17554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence096 879 1820 gene locus_tag LOCUS_22610 879 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1825 2529 gene locus_tag LOCUS_22620 gene menG 1825 2529 CDS product 2-phytyl-1,4-naphtoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPC8 protein_id gnl|my_center|LOCUS_22620 2576 3808 gene locus_tag LOCUS_22630 2576 3808 CDS product UPF0754 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM9 protein_id gnl|my_center|LOCUS_22630 3857 4126 gene locus_tag LOCUS_22640 3857 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 4683 5957 gene locus_tag LOCUS_22650 4683 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 5964 7487 gene locus_tag LOCUS_22660 5964 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 7672 8178 gene locus_tag LOCUS_22670 7672 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 8318 8812 gene locus_tag LOCUS_22680 8318 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 9789 8818 gene locus_tag LOCUS_22690 9789 8818 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086130.1 protein_id gnl|my_center|LOCUS_22690 9748 9924 gene locus_tag LOCUS_22700 9748 9924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 9887 11332 gene locus_tag LOCUS_22710 9887 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056673.1 protein_id gnl|my_center|LOCUS_22710 11455 12468 gene locus_tag LOCUS_22720 11455 12468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435528.1 protein_id gnl|my_center|LOCUS_22720 13734 12682 gene locus_tag LOCUS_22730 gene murG 13734 12682 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY4 protein_id gnl|my_center|LOCUS_22730 13934 14455 gene locus_tag LOCUS_22740 13934 14455 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_22740 14781 14452 gene locus_tag LOCUS_22750 14781 14452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 16035 15154 gene locus_tag LOCUS_22760 16035 15154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 18190 16082 gene locus_tag LOCUS_22770 18190 16082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence097 325 927 gene locus_tag LOCUS_22780 gene leuD 325 927 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_22780 924 1394 gene locus_tag LOCUS_22790 924 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 1694 1981 gene locus_tag LOCUS_22800 1694 1981 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058100.1 protein_id gnl|my_center|LOCUS_22800 1984 3111 gene locus_tag LOCUS_22810 1984 3111 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058099.1 protein_id gnl|my_center|LOCUS_22810 3153 4601 gene locus_tag LOCUS_22820 3153 4601 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029001.1 protein_id gnl|my_center|LOCUS_22820 4555 5139 gene locus_tag LOCUS_22830 4555 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 5171 5830 gene locus_tag LOCUS_22840 5171 5830 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142341.1 protein_id gnl|my_center|LOCUS_22840 6133 6342 gene locus_tag LOCUS_22850 6133 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 6362 6667 gene locus_tag LOCUS_22860 6362 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 7600 6773 gene locus_tag LOCUS_22870 7600 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 7813 8379 gene locus_tag LOCUS_22880 7813 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_22880 8823 8380 gene locus_tag LOCUS_22890 8823 8380 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_22890 10795 8957 gene locus_tag LOCUS_22900 10795 8957 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_22900 12221 10998 gene locus_tag LOCUS_22910 12221 10998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 12929 14698 gene locus_tag LOCUS_22920 12929 14698 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_22920 14935 15414 gene locus_tag LOCUS_22930 14935 15414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 15411 16724 gene locus_tag LOCUS_22940 gene wcbT 15411 16724 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811240.1 protein_id gnl|my_center|LOCUS_22940 16928 18487 gene locus_tag LOCUS_22950 16928 18487 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence098 2279 3127 gene locus_tag LOCUS_22960 gene cysH 2279 3127 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUX2 protein_id gnl|my_center|LOCUS_22960 5646 3175 gene locus_tag LOCUS_22970 5646 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 6301 7887 gene locus_tag LOCUS_22980 6301 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 8184 9248 gene locus_tag LOCUS_22990 gene wcaA 8184 9248 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_22990 9645 9253 gene locus_tag LOCUS_23000 9645 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 11160 9865 gene locus_tag LOCUS_23010 gene purB 11160 9865 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW4 protein_id gnl|my_center|LOCUS_23010 11497 12105 gene locus_tag LOCUS_23020 gene cpcT1 11497 12105 CDS product chromophore lyase CpcT/CpeT 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNH3 protein_id gnl|my_center|LOCUS_23020 12815 13879 gene locus_tag LOCUS_23030 12815 13879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 13879 14859 gene locus_tag LOCUS_23040 13879 14859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 14856 16313 gene locus_tag LOCUS_23050 14856 16313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 16412 17509 gene locus_tag LOCUS_23060 gene isiA 16412 17509 CDS product iron stress-induced chlorophyll-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK20 protein_id gnl|my_center|LOCUS_23060 >Feature sequence099 1403 420 gene locus_tag LOCUS_23070 1403 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2299 1511 gene locus_tag LOCUS_23080 2299 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 3317 2454 gene locus_tag LOCUS_23090 3317 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 4451 3399 gene locus_tag LOCUS_23100 4451 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141800.1 protein_id gnl|my_center|LOCUS_23100 5172 6227 gene locus_tag LOCUS_23110 5172 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_23110 6673 6239 gene locus_tag LOCUS_23120 6673 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 6872 8044 gene locus_tag LOCUS_23130 gene sat 6872 8044 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK26 protein_id gnl|my_center|LOCUS_23130 8392 10764 gene locus_tag LOCUS_23140 8392 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057163.1 protein_id gnl|my_center|LOCUS_23140 11389 10817 gene locus_tag LOCUS_23150 11389 10817 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087881.1 protein_id gnl|my_center|LOCUS_23150 11462 12010 gene locus_tag LOCUS_23160 11462 12010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 12985 12062 gene locus_tag LOCUS_23170 12985 12062 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256682.1 protein_id gnl|my_center|LOCUS_23170 13955 12996 gene locus_tag LOCUS_23180 13955 12996 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256681.1 protein_id gnl|my_center|LOCUS_23180 15320 13971 gene locus_tag LOCUS_23190 15320 13971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 16309 15563 gene locus_tag LOCUS_23200 16309 15563 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMH9 protein_id gnl|my_center|LOCUS_23200 16541 16861 gene locus_tag LOCUS_23210 16541 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23210 18371 17805 gene locus_tag LOCUS_23220 gene ycf4 18371 17805 CDS product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ41 protein_id gnl|my_center|LOCUS_23220 >Feature sequence100 603 88 gene locus_tag LOCUS_23230 603 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 1958 600 gene locus_tag LOCUS_23240 gene miaB 1958 600 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB2 protein_id gnl|my_center|LOCUS_23240 2922 2089 gene locus_tag LOCUS_23250 2922 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 3071 3223 gene locus_tag LOCUS_23260 3071 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 4855 3215 gene locus_tag LOCUS_23270 4855 3215 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 protein_id gnl|my_center|LOCUS_23270 4939 5838 gene locus_tag LOCUS_23280 4939 5838 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065230.1 protein_id gnl|my_center|LOCUS_23280 5847 6869 gene locus_tag LOCUS_23290 5847 6869 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404758.1 protein_id gnl|my_center|LOCUS_23290 7755 6889 gene locus_tag LOCUS_23300 7755 6889 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810982.1 protein_id gnl|my_center|LOCUS_23300 8463 7822 gene locus_tag LOCUS_23310 8463 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 9738 8644 gene locus_tag LOCUS_23320 9738 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 10383 10006 gene locus_tag LOCUS_23330 10383 10006 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975235.1 protein_id gnl|my_center|LOCUS_23330 13784 10386 gene locus_tag LOCUS_23340 13784 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 15699 14563 gene locus_tag LOCUS_23350 15699 14563 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227848.1 protein_id gnl|my_center|LOCUS_23350 15976 18333 gene locus_tag LOCUS_23360 15976 18333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence101 402 1502 gene locus_tag LOCUS_23370 402 1502 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_23370 1584 7121 gene locus_tag LOCUS_23380 1584 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 8185 7118 gene locus_tag LOCUS_23390 gene ydjJ 8185 7118 CDS product putative membrane protein YdjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34733 protein_id gnl|my_center|LOCUS_23390 8804 8337 gene locus_tag LOCUS_23400 8804 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 9566 8850 gene locus_tag LOCUS_23410 9566 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142260.1 protein_id gnl|my_center|LOCUS_23410 9791 10615 gene locus_tag LOCUS_23420 9791 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 10803 11618 gene locus_tag LOCUS_23430 10803 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 11672 12481 gene locus_tag LOCUS_23440 11672 12481 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 protein_id gnl|my_center|LOCUS_23440 12688 13689 gene locus_tag LOCUS_23450 12688 13689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057303.1 protein_id gnl|my_center|LOCUS_23450 15088 13697 gene locus_tag LOCUS_23460 15088 13697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 17488 15275 gene locus_tag LOCUS_23470 gene narB 17488 15275 CDS product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057195.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence102 <1 1193 gene locus_tag LOCUS_23480 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KEX4:chromosome partition protein Smc 2107 1277 gene locus_tag LOCUS_23490 2107 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 3028 2261 gene locus_tag LOCUS_23500 3028 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 3932 3132 gene locus_tag LOCUS_23510 3932 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 4794 4012 gene locus_tag LOCUS_23520 4794 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 9015 4876 gene locus_tag LOCUS_23530 9015 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 12830 9267 gene locus_tag LOCUS_23540 12830 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 13753 12893 gene locus_tag LOCUS_23550 13753 12893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 14037 15599 gene locus_tag LOCUS_23560 14037 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 15808 16317 gene locus_tag LOCUS_23570 15808 16317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_23570 <18439 16309 gene locus_tag LOCUS_23580 <18439 16309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002378512.1:glycosyl transferase family 2 >Feature sequence103 2496 1615 gene locus_tag LOCUS_23590 gene rps1 2496 1615 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 protein_id gnl|my_center|LOCUS_23590 3424 2687 gene locus_tag LOCUS_23600 3424 2687 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_23600 3623 4606 gene locus_tag LOCUS_23610 3623 4606 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144236.1 protein_id gnl|my_center|LOCUS_23610 4707 6215 gene locus_tag LOCUS_23620 4707 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 6424 7065 gene locus_tag LOCUS_23630 6424 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141964.1 protein_id gnl|my_center|LOCUS_23630 7445 7795 gene locus_tag LOCUS_23640 7445 7795 CDS product period-extender gene product inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057790.1 protein_id gnl|my_center|LOCUS_23640 7823 8398 gene locus_tag LOCUS_23650 7823 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143752.1 protein_id gnl|my_center|LOCUS_23650 9065 8736 gene locus_tag LOCUS_23660 9065 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 9348 10730 gene locus_tag LOCUS_23670 9348 10730 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056050.1 protein_id gnl|my_center|LOCUS_23670 10840 11139 gene locus_tag LOCUS_23680 10840 11139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058283.1 protein_id gnl|my_center|LOCUS_23680 11287 13053 gene locus_tag LOCUS_23690 gene sdhA 11287 13053 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057217.1 protein_id gnl|my_center|LOCUS_23690 13254 14372 gene locus_tag LOCUS_23700 13254 14372 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_23700 14539 15891 gene locus_tag LOCUS_23710 14539 15891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence104 838 1068 gene locus_tag LOCUS_23720 838 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 1105 1746 gene locus_tag LOCUS_23730 gene hisH 1105 1746 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP5 protein_id gnl|my_center|LOCUS_23730 3285 1729 gene locus_tag LOCUS_23740 gene nnr 3285 1729 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC3 protein_id gnl|my_center|LOCUS_23740 4087 3653 gene locus_tag LOCUS_23750 4087 3653 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018151.1 protein_id gnl|my_center|LOCUS_23750 4272 5135 gene locus_tag LOCUS_23760 4272 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057260.1 protein_id gnl|my_center|LOCUS_23760 5240 5728 gene locus_tag LOCUS_23770 5240 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057259.1 protein_id gnl|my_center|LOCUS_23770 5733 6386 gene locus_tag LOCUS_23780 5733 6386 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057258.1 protein_id gnl|my_center|LOCUS_23780 6450 7265 gene locus_tag LOCUS_23790 6450 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 7279 8061 gene locus_tag LOCUS_23800 7279 8061 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DN5 protein_id gnl|my_center|LOCUS_23800 8084 8392 gene locus_tag LOCUS_23810 8084 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 9666 8500 gene locus_tag LOCUS_23820 gene potA 9666 8500 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBU2 protein_id gnl|my_center|LOCUS_23820 11034 9958 gene locus_tag LOCUS_23830 11034 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 11779 11177 gene locus_tag LOCUS_23840 gene drga 11779 11177 CDS product reductase DrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_23840 14097 12016 gene locus_tag LOCUS_23850 14097 12016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 15261 14815 gene locus_tag LOCUS_23860 15261 14815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 16060 15413 gene locus_tag LOCUS_23870 16060 15413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 17031 16132 gene locus_tag LOCUS_23880 gene rsmI 17031 16132 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR7 protein_id gnl|my_center|LOCUS_23880 17079 17939 gene locus_tag LOCUS_23890 17079 17939 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence105 1807 2037 gene locus_tag LOCUS_23900 1807 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2056 2427 gene locus_tag LOCUS_23910 2056 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23910 3154 2765 gene locus_tag LOCUS_23920 3154 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 3766 3578 gene locus_tag LOCUS_23930 3766 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 4156 3776 gene locus_tag LOCUS_23940 4156 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23940 4644 4474 gene locus_tag LOCUS_23950 4644 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 4927 7248 gene locus_tag LOCUS_23960 4927 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 7273 8019 gene locus_tag LOCUS_23970 7273 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 8177 9181 gene locus_tag LOCUS_23980 8177 9181 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI38 protein_id gnl|my_center|LOCUS_23980 9188 9388 gene locus_tag LOCUS_23990 9188 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 9880 9482 gene locus_tag LOCUS_24000 gene folK 9880 9482 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156774.1 protein_id gnl|my_center|LOCUS_24000 10247 9873 gene locus_tag LOCUS_24010 gene folX 10247 9873 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072826.1 protein_id gnl|my_center|LOCUS_24010 11111 10362 gene locus_tag LOCUS_24020 11111 10362 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139980.1 protein_id gnl|my_center|LOCUS_24020 12459 11191 gene locus_tag LOCUS_24030 12459 11191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 <18163 12786 gene locus_tag LOCUS_24040 <18163 12786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105890.1:RTX toxin >Feature sequence106 607 2 gene locus_tag LOCUS_24050 607 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 831 1790 gene locus_tag LOCUS_24060 831 1790 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_24060 1876 2385 gene locus_tag LOCUS_24070 1876 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2378 3118 gene locus_tag LOCUS_24080 2378 3118 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120671.1 protein_id gnl|my_center|LOCUS_24080 3646 3906 gene locus_tag LOCUS_24090 3646 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 5386 3941 gene locus_tag LOCUS_24100 5386 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 6159 6641 gene locus_tag LOCUS_24110 6159 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 6827 8326 gene locus_tag LOCUS_24120 6827 8326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 8304 9398 gene locus_tag LOCUS_24130 8304 9398 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_24130 9666 10325 gene locus_tag LOCUS_24140 9666 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 11071 12417 gene locus_tag LOCUS_24150 11071 12417 CDS product alpha-glucoside ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706893.1 protein_id gnl|my_center|LOCUS_24150 12604 13866 gene locus_tag LOCUS_24160 12604 13866 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_24160 13961 13888 gene locus_tag LOCUS_t00190 13961 13888 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14036 14596 gene locus_tag LOCUS_24170 gene moaC 14036 14596 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFZ6 protein_id gnl|my_center|LOCUS_24170 14813 15148 gene locus_tag LOCUS_24180 14813 15148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 15542 15312 gene locus_tag LOCUS_24190 15542 15312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 15716 17161 gene locus_tag LOCUS_24200 15716 17161 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056302.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence107 1697 513 gene locus_tag LOCUS_24210 1697 513 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_24210 2737 1808 gene locus_tag LOCUS_24220 2737 1808 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027083.1 protein_id gnl|my_center|LOCUS_24220 4198 2969 gene locus_tag LOCUS_24230 4198 2969 CDS product NDP-hexose methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975523.1 protein_id gnl|my_center|LOCUS_24230 5475 4246 gene locus_tag LOCUS_24240 5475 4246 CDS product NDP-hexose 3-C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_24240 6543 5491 gene locus_tag LOCUS_24250 6543 5491 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887434.1 protein_id gnl|my_center|LOCUS_24250 7562 6759 gene locus_tag LOCUS_24260 gene gcd1 7562 6759 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 protein_id gnl|my_center|LOCUS_24260 9648 8008 gene locus_tag LOCUS_24270 9648 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 9894 10943 gene locus_tag LOCUS_24280 gene pdxA 9894 10943 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHB4 protein_id gnl|my_center|LOCUS_24280 11965 10946 gene locus_tag LOCUS_24290 11965 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 13147 14337 gene locus_tag LOCUS_24300 13147 14337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 14880 15383 gene locus_tag LOCUS_24310 14880 15383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence108 866 48 gene locus_tag LOCUS_24320 866 48 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404883.1 protein_id gnl|my_center|LOCUS_24320 1661 1188 gene locus_tag LOCUS_24330 1661 1188 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_24330 1881 2126 gene locus_tag LOCUS_24340 1881 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 8687 2118 gene locus_tag LOCUS_24350 8687 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 11914 8684 gene locus_tag LOCUS_24360 11914 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 12192 14030 gene locus_tag LOCUS_24370 gene ftsH 12192 14030 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI5 protein_id gnl|my_center|LOCUS_24370 14506 16575 gene locus_tag LOCUS_24380 14506 16575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 16816 17589 gene locus_tag LOCUS_24390 gene gloB 16816 17589 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence109 4062 844 gene locus_tag LOCUS_24400 4062 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 4899 7127 gene locus_tag LOCUS_24410 4899 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056918.1 protein_id gnl|my_center|LOCUS_24410 7198 7767 gene locus_tag LOCUS_24420 7198 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 7926 9344 gene locus_tag LOCUS_24430 7926 9344 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_24430 9932 12076 gene locus_tag LOCUS_24440 9932 12076 CDS product bacteriocin cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681480.1 protein_id gnl|my_center|LOCUS_24440 12787 12137 gene locus_tag LOCUS_24450 12787 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057843.1 protein_id gnl|my_center|LOCUS_24450 12963 14123 gene locus_tag LOCUS_24460 12963 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058195.1 protein_id gnl|my_center|LOCUS_24460 15185 14109 gene locus_tag LOCUS_24470 15185 14109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 15833 16729 gene locus_tag LOCUS_24480 15833 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 protein_id gnl|my_center|LOCUS_24480 <17631 16965 gene locus_tag LOCUS_24490 <17631 16965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204628.1:histidine kinase >Feature sequence110 1272 106 gene locus_tag LOCUS_24500 gene ydcM 1272 106 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_24500 1932 1432 gene locus_tag LOCUS_24510 gene fabZ 1932 1432 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TV98 protein_id gnl|my_center|LOCUS_24510 2837 1980 gene locus_tag LOCUS_24520 gene lpxC 2837 1980 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI02 protein_id gnl|my_center|LOCUS_24520 3140 3358 gene locus_tag LOCUS_24530 3140 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 5504 3432 gene locus_tag LOCUS_24540 5504 3432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_24540 5743 5501 gene locus_tag LOCUS_24550 5743 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 7233 5836 gene locus_tag LOCUS_24560 7233 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 7676 7254 gene locus_tag LOCUS_24570 7676 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 8292 7858 gene locus_tag LOCUS_24580 8292 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 8647 8381 gene locus_tag LOCUS_24590 8647 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056560.1 protein_id gnl|my_center|LOCUS_24590 8867 9070 gene locus_tag LOCUS_24600 8867 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 10166 9189 gene locus_tag LOCUS_24610 gene cysM 10166 9189 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058144.1 protein_id gnl|my_center|LOCUS_24610 10932 10294 gene locus_tag LOCUS_24620 10932 10294 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_24620 11178 11894 gene locus_tag LOCUS_24630 11178 11894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 protein_id gnl|my_center|LOCUS_24630 12194 12015 gene locus_tag LOCUS_24640 12194 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 13048 12431 gene locus_tag LOCUS_24650 13048 12431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 13597 13100 gene locus_tag LOCUS_24660 13597 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 15305 13731 gene locus_tag LOCUS_24670 15305 13731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 15762 15457 gene locus_tag LOCUS_24680 15762 15457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 <17611 15914 gene locus_tag LOCUS_24690 <17611 15914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJK3:ribonuclease J >Feature sequence111 2 223 gene locus_tag LOCUS_24700 2 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 302 955 gene locus_tag LOCUS_24710 302 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_24710 3927 1075 gene locus_tag LOCUS_24720 3927 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 4995 4246 gene locus_tag LOCUS_24730 4995 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 6459 5848 gene locus_tag LOCUS_24740 6459 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058121.1 protein_id gnl|my_center|LOCUS_24740 7395 8819 gene locus_tag LOCUS_24750 7395 8819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 8856 9230 gene locus_tag LOCUS_24760 8856 9230 CDS product Fe-S cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056500.1 protein_id gnl|my_center|LOCUS_24760 10293 9241 gene locus_tag LOCUS_24770 10293 9241 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_24770 10391 11236 gene locus_tag LOCUS_24780 10391 11236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142803.1 protein_id gnl|my_center|LOCUS_24780 11788 11435 gene locus_tag LOCUS_24790 11788 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 13947 12598 gene locus_tag LOCUS_24800 13947 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 15391 13955 gene locus_tag LOCUS_24810 15391 13955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 15589 17157 gene locus_tag LOCUS_24820 15589 17157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence112 <1 861 gene locus_tag LOCUS_24830 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057166.1:serine/threonine protein kinase 2142 1108 gene locus_tag LOCUS_24840 2142 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 3683 2391 gene locus_tag LOCUS_24850 3683 2391 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_24850 4680 3775 gene locus_tag LOCUS_24860 4680 3775 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057233.1 protein_id gnl|my_center|LOCUS_24860 5934 10235 gene locus_tag LOCUS_24870 5934 10235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 10302 11147 gene locus_tag LOCUS_24880 10302 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 11125 11931 gene locus_tag LOCUS_24890 11125 11931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106510.1 protein_id gnl|my_center|LOCUS_24890 11979 13646 gene locus_tag LOCUS_24900 11979 13646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 13713 14651 gene locus_tag LOCUS_24910 13713 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 14709 16835 gene locus_tag LOCUS_24920 14709 16835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence113 267 1469 gene locus_tag LOCUS_24930 267 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057682.1 protein_id gnl|my_center|LOCUS_24930 2494 1532 gene locus_tag LOCUS_24940 2494 1532 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143363.1 protein_id gnl|my_center|LOCUS_24940 3039 2578 gene locus_tag LOCUS_24950 3039 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 3326 4444 gene locus_tag LOCUS_24960 3326 4444 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140208.1 protein_id gnl|my_center|LOCUS_24960 4508 5572 gene locus_tag LOCUS_24970 4508 5572 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056993.1 protein_id gnl|my_center|LOCUS_24970 5727 6149 gene locus_tag LOCUS_24980 5727 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 6414 7784 gene locus_tag LOCUS_24990 6414 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 8465 7968 gene locus_tag LOCUS_25000 8465 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 9686 8565 gene locus_tag LOCUS_25010 9686 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257558.1 protein_id gnl|my_center|LOCUS_25010 11358 9883 gene locus_tag LOCUS_25020 11358 9883 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480254.1 protein_id gnl|my_center|LOCUS_25020 11801 11583 gene locus_tag LOCUS_25030 11801 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 12013 11804 gene locus_tag LOCUS_25040 12013 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 12439 12912 gene locus_tag LOCUS_25050 12439 12912 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815307.1 protein_id gnl|my_center|LOCUS_25050 13206 12922 gene locus_tag LOCUS_25060 13206 12922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057417.1 protein_id gnl|my_center|LOCUS_25060 13579 13887 gene locus_tag LOCUS_25070 gene ccmK 13579 13887 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_25070 14026 14382 gene locus_tag LOCUS_25080 gene ccmK 14026 14382 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_25080 14624 15085 gene locus_tag LOCUS_25090 14624 15085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 16277 15090 gene locus_tag LOCUS_25100 gene bme6 16277 15090 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence114 608 1630 gene locus_tag LOCUS_25110 608 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 1663 2955 gene locus_tag LOCUS_25120 gene proA 1663 2955 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU1 protein_id gnl|my_center|LOCUS_25120 3431 2952 gene locus_tag LOCUS_25130 3431 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_25130 8993 3558 gene locus_tag LOCUS_25140 8993 3558 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_25140 9283 10857 gene locus_tag LOCUS_25150 9283 10857 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140811.1 protein_id gnl|my_center|LOCUS_25150 10979 11839 gene locus_tag LOCUS_25160 10979 11839 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404448.1 protein_id gnl|my_center|LOCUS_25160 12000 13685 gene locus_tag LOCUS_25170 12000 13685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 14260 13973 gene locus_tag LOCUS_25180 14260 13973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 14448 14260 gene locus_tag LOCUS_25190 14448 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 14900 17092 gene locus_tag LOCUS_25200 14900 17092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 >Feature sequence115 454 2355 gene locus_tag LOCUS_25210 454 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 2363 3247 gene locus_tag LOCUS_25220 2363 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530228.1 protein_id gnl|my_center|LOCUS_25220 3470 4675 gene locus_tag LOCUS_25230 3470 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 4931 5206 gene locus_tag LOCUS_25240 4931 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 5766 6251 gene locus_tag LOCUS_25250 5766 6251 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142985.1 protein_id gnl|my_center|LOCUS_25250 6256 7095 gene locus_tag LOCUS_25260 6256 7095 CDS product modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458962.1 protein_id gnl|my_center|LOCUS_25260 7102 7254 gene locus_tag LOCUS_25270 7102 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 7360 8421 gene locus_tag LOCUS_25280 7360 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458963.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25280 8706 9818 gene locus_tag LOCUS_25290 8706 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 9833 10972 gene locus_tag LOCUS_25300 9833 10972 CDS product putative MscS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66994 protein_id gnl|my_center|LOCUS_25300 11053 11565 gene locus_tag LOCUS_25310 11053 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 12095 15193 gene locus_tag LOCUS_25320 12095 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 16922 15243 gene locus_tag LOCUS_25330 16922 15243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence116 546 6158 gene locus_tag LOCUS_25340 546 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 6586 6188 gene locus_tag LOCUS_25350 6586 6188 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606463.1 protein_id gnl|my_center|LOCUS_25350 6732 7019 gene locus_tag LOCUS_25360 gene hup2 6732 7019 CDS product SPBc2 prophage-derived DNA-binding protein HU 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P68573 protein_id gnl|my_center|LOCUS_25360 7227 10226 gene locus_tag LOCUS_25370 7227 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 11411 10236 gene locus_tag LOCUS_25380 11411 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 12352 11444 gene locus_tag LOCUS_25390 12352 11444 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390103.1 protein_id gnl|my_center|LOCUS_25390 13158 12418 gene locus_tag LOCUS_25400 13158 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 14242 13178 gene locus_tag LOCUS_25410 14242 13178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 14787 16547 gene locus_tag LOCUS_25420 14787 16547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence117 376 1149 gene locus_tag LOCUS_25430 376 1149 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056899.1 protein_id gnl|my_center|LOCUS_25430 1820 1146 gene locus_tag LOCUS_25440 1820 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141414.1 protein_id gnl|my_center|LOCUS_25440 2920 1946 gene locus_tag LOCUS_25450 2920 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3483 2986 gene locus_tag LOCUS_25460 3483 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 4334 3498 gene locus_tag LOCUS_25470 4334 3498 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097842.1 protein_id gnl|my_center|LOCUS_25470 4496 4711 gene locus_tag LOCUS_25480 4496 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 4708 4845 gene locus_tag LOCUS_25490 4708 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 4871 5365 gene locus_tag LOCUS_25500 4871 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 5404 6657 gene locus_tag LOCUS_25510 gene codA 5404 6657 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986588.1 protein_id gnl|my_center|LOCUS_25510 7369 8265 gene locus_tag LOCUS_25520 7369 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 9693 8413 gene locus_tag LOCUS_25530 9693 8413 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250663.1 protein_id gnl|my_center|LOCUS_25530 10109 11590 gene locus_tag LOCUS_25540 10109 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 11878 12612 gene locus_tag LOCUS_25550 11878 12612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 12897 14057 gene locus_tag LOCUS_25560 12897 14057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 14126 14896 gene locus_tag LOCUS_25570 14126 14896 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DME3 protein_id gnl|my_center|LOCUS_25570 15210 14929 gene locus_tag LOCUS_25580 15210 14929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 15449 15231 gene locus_tag LOCUS_25590 15449 15231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 16171 15569 gene locus_tag LOCUS_25600 16171 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 >Feature sequence118 2334 1483 gene locus_tag LOCUS_25610 2334 1483 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404255.1 protein_id gnl|my_center|LOCUS_25610 3433 2381 gene locus_tag LOCUS_25620 3433 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 3621 4493 gene locus_tag LOCUS_25630 3621 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 6730 4565 gene locus_tag LOCUS_25640 6730 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 7147 6734 gene locus_tag LOCUS_25650 7147 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 7936 7259 gene locus_tag LOCUS_25660 7936 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 8322 7918 gene locus_tag LOCUS_25670 8322 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 8805 9152 gene locus_tag LOCUS_25680 8805 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 9149 9844 gene locus_tag LOCUS_25690 9149 9844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 10773 14666 gene locus_tag LOCUS_25700 10773 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 14760 15059 gene locus_tag LOCUS_25710 14760 15059 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_25710 15043 15441 gene locus_tag LOCUS_25720 15043 15441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 15604 15434 gene locus_tag LOCUS_25730 15604 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 16312 16001 gene locus_tag LOCUS_25740 16312 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence119 237 758 gene locus_tag LOCUS_25750 237 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056141.1 protein_id gnl|my_center|LOCUS_25750 2054 1047 gene locus_tag LOCUS_25760 2054 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2836 3948 gene locus_tag LOCUS_25770 gene ddl 2836 3948 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH0 protein_id gnl|my_center|LOCUS_25770 4107 7700 gene locus_tag LOCUS_25780 4107 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 8040 9035 gene locus_tag LOCUS_25790 gene sigD 8040 9035 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056119.1 protein_id gnl|my_center|LOCUS_25790 9104 9595 gene locus_tag LOCUS_25800 9104 9595 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_25800 9660 9866 gene locus_tag LOCUS_25810 9660 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057172.1 protein_id gnl|my_center|LOCUS_25810 10122 10799 gene locus_tag LOCUS_25820 gene sigG 10122 10799 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 protein_id gnl|my_center|LOCUS_25820 10961 11521 gene locus_tag LOCUS_25830 10961 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057944.1 protein_id gnl|my_center|LOCUS_25830 11922 11518 gene locus_tag LOCUS_25840 11922 11518 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056985.1 protein_id gnl|my_center|LOCUS_25840 12018 12608 gene locus_tag LOCUS_25850 12018 12608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 protein_id gnl|my_center|LOCUS_25850 12734 13573 gene locus_tag LOCUS_25860 gene rpsB 12734 13573 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA2 protein_id gnl|my_center|LOCUS_25860 13790 14452 gene locus_tag LOCUS_25870 gene tsf 13790 14452 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCB5 protein_id gnl|my_center|LOCUS_25870 14547 15425 gene locus_tag LOCUS_25880 14547 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence120 1971 307 gene locus_tag LOCUS_25890 1971 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057405.1 protein_id gnl|my_center|LOCUS_25890 2949 2287 gene locus_tag LOCUS_25900 gene hisB 2949 2287 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMJ6 protein_id gnl|my_center|LOCUS_25900 3848 3072 gene locus_tag LOCUS_25910 3848 3072 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI97 protein_id gnl|my_center|LOCUS_25910 4246 4911 gene locus_tag LOCUS_25920 gene ntcA 4246 4911 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057487.1 protein_id gnl|my_center|LOCUS_25920 5060 6604 gene locus_tag LOCUS_25930 5060 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 protein_id gnl|my_center|LOCUS_25930 6640 7050 gene locus_tag LOCUS_25940 6640 7050 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL47 protein_id gnl|my_center|LOCUS_25940 7386 7120 gene locus_tag LOCUS_25950 7386 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058048.1 protein_id gnl|my_center|LOCUS_25950 8022 7396 gene locus_tag LOCUS_25960 gene pth 8022 7396 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN75 protein_id gnl|my_center|LOCUS_25960 8511 8254 gene locus_tag LOCUS_25970 gene tatA 8511 8254 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ44 protein_id gnl|my_center|LOCUS_25970 8816 8613 gene locus_tag LOCUS_25980 gene psbH 8816 8613 CDS product photosystem II reaction center protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ43 protein_id gnl|my_center|LOCUS_25980 9229 9405 gene locus_tag LOCUS_25990 gene rpmF 9229 9405 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN1 protein_id gnl|my_center|LOCUS_25990 9492 10748 gene locus_tag LOCUS_26000 9492 10748 CDS product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808454.1 protein_id gnl|my_center|LOCUS_26000 12579 10858 gene locus_tag LOCUS_26010 12579 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 13313 14209 gene locus_tag LOCUS_26020 13313 14209 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037419.1 protein_id gnl|my_center|LOCUS_26020 >Feature sequence121 1514 483 gene locus_tag LOCUS_26030 gene pdhA 1514 483 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ3 protein_id gnl|my_center|LOCUS_26030 1788 4109 gene locus_tag LOCUS_26040 1788 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 4781 4167 gene locus_tag LOCUS_26050 4781 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 5679 4843 gene locus_tag LOCUS_26060 gene tatC 5679 4843 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA6 protein_id gnl|my_center|LOCUS_26060 7130 5913 gene locus_tag LOCUS_26070 gene tlpB 7130 5913 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861313.1 protein_id gnl|my_center|LOCUS_26070 7604 8113 gene locus_tag LOCUS_26080 7604 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 8805 8350 gene locus_tag LOCUS_26090 gene ywlE 8805 8350 CDS product protein-arginine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39155 protein_id gnl|my_center|LOCUS_26090 8902 9840 gene locus_tag LOCUS_26100 8902 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 10029 11852 gene locus_tag LOCUS_26110 10029 11852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 12400 13608 gene locus_tag LOCUS_26120 12400 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 13895 13704 gene locus_tag LOCUS_26130 13895 13704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 15040 14699 gene locus_tag LOCUS_26140 15040 14699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 15227 14976 gene locus_tag LOCUS_26150 15227 14976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 15557 15712 gene locus_tag LOCUS_26160 15557 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 15751 16200 gene locus_tag LOCUS_26170 15751 16200 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141725.1 protein_id gnl|my_center|LOCUS_26170 >Feature sequence122 1783 305 gene locus_tag LOCUS_26180 1783 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 3392 2127 gene locus_tag LOCUS_26190 3392 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 3617 6163 gene locus_tag LOCUS_26200 3617 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 6512 7750 gene locus_tag LOCUS_26210 6512 7750 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061719.1 protein_id gnl|my_center|LOCUS_26210 7765 8979 gene locus_tag LOCUS_26220 7765 8979 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_26220 9180 10208 gene locus_tag LOCUS_26230 9180 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 10330 12489 gene locus_tag LOCUS_26240 10330 12489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 13380 12562 gene locus_tag LOCUS_26250 13380 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence123 1284 655 gene locus_tag LOCUS_26260 gene satA 1284 655 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071891.1 protein_id gnl|my_center|LOCUS_26260 1917 1303 gene locus_tag LOCUS_26270 1917 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2896 1922 gene locus_tag LOCUS_26280 gene tas 2896 1922 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125344.1 protein_id gnl|my_center|LOCUS_26280 2962 3759 gene locus_tag LOCUS_26290 2962 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259390.1 protein_id gnl|my_center|LOCUS_26290 3775 4203 gene locus_tag LOCUS_26300 3775 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 4270 6186 gene locus_tag LOCUS_26310 4270 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 6494 7507 gene locus_tag LOCUS_26320 6494 7507 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143010.1 protein_id gnl|my_center|LOCUS_26320 7647 8372 gene locus_tag LOCUS_26330 gene coaX 7647 8372 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCI5 protein_id gnl|my_center|LOCUS_26330 8636 10225 gene locus_tag LOCUS_26340 8636 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 12735 10222 gene locus_tag LOCUS_26350 12735 10222 CDS product multiphosphoryl transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938280.1 protein_id gnl|my_center|LOCUS_26350 13289 13696 gene locus_tag LOCUS_26360 13289 13696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 14904 13711 gene locus_tag LOCUS_26370 14904 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence124 1676 399 gene locus_tag LOCUS_26380 1676 399 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461038.1 protein_id gnl|my_center|LOCUS_26380 2590 2369 gene locus_tag LOCUS_26390 2590 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 4666 3035 gene locus_tag LOCUS_26400 4666 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 4965 5435 gene locus_tag LOCUS_26410 4965 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057333.1 protein_id gnl|my_center|LOCUS_26410 6493 5660 gene locus_tag LOCUS_26420 6493 5660 CDS product TIGR00268 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057083.1 protein_id gnl|my_center|LOCUS_26420 7321 6557 gene locus_tag LOCUS_26430 7321 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_26430 7848 7336 gene locus_tag LOCUS_26440 7848 7336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 8328 7855 gene locus_tag LOCUS_26450 8328 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 8550 8792 gene locus_tag LOCUS_26460 8550 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 8987 9235 gene locus_tag LOCUS_26470 gene acpP 8987 9235 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43709 protein_id gnl|my_center|LOCUS_26470 9689 10942 gene locus_tag LOCUS_26480 9689 10942 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS4 protein_id gnl|my_center|LOCUS_26480 12535 11030 gene locus_tag LOCUS_26490 12535 11030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 13336 12821 gene locus_tag LOCUS_26500 13336 12821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 13973 13572 gene locus_tag LOCUS_26510 gene msrB 13973 13572 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE61 protein_id gnl|my_center|LOCUS_26510 >Feature sequence125 1785 232 gene locus_tag LOCUS_26520 1785 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 3243 1846 gene locus_tag LOCUS_26530 3243 1846 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566866.1 protein_id gnl|my_center|LOCUS_26530 3935 3324 gene locus_tag LOCUS_26540 3935 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 4864 4178 gene locus_tag LOCUS_26550 4864 4178 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_26550 5396 5938 gene locus_tag LOCUS_26560 5396 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 6093 7502 gene locus_tag LOCUS_26570 6093 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 7680 8087 gene locus_tag LOCUS_26580 7680 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 8192 9124 gene locus_tag LOCUS_26590 gene hslO 8192 9124 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKQ1 protein_id gnl|my_center|LOCUS_26590 9414 11693 gene locus_tag LOCUS_26600 9414 11693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057491.1 protein_id gnl|my_center|LOCUS_26600 13490 11733 gene locus_tag LOCUS_26610 gene argS 13490 11733 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKN4 protein_id gnl|my_center|LOCUS_26610 15552 13576 gene locus_tag LOCUS_26620 15552 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence126 3789 247 gene locus_tag LOCUS_26630 3789 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056863.1 protein_id gnl|my_center|LOCUS_26630 4606 3818 gene locus_tag LOCUS_26640 4606 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058126.1 protein_id gnl|my_center|LOCUS_26640 6429 4768 gene locus_tag LOCUS_26650 6429 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 7055 7834 gene locus_tag LOCUS_26660 7055 7834 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_26660 8284 10989 gene locus_tag LOCUS_26670 8284 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 12262 10997 gene locus_tag LOCUS_26680 gene folC 12262 10997 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056045.1 protein_id gnl|my_center|LOCUS_26680 12692 12387 gene locus_tag LOCUS_26690 12692 12387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056902.1 protein_id gnl|my_center|LOCUS_26690 13070 13798 gene locus_tag LOCUS_26700 gene psbO 13070 13798 CDS product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A431 protein_id gnl|my_center|LOCUS_26700 14376 15680 gene locus_tag LOCUS_26710 14376 15680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence127 2295 4076 gene locus_tag LOCUS_26720 2295 4076 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_26720 5109 4687 gene locus_tag LOCUS_26730 5109 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 5588 5127 gene locus_tag LOCUS_26740 5588 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 5707 7863 gene locus_tag LOCUS_26750 5707 7863 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144130.1 protein_id gnl|my_center|LOCUS_26750 8006 8695 gene locus_tag LOCUS_26760 8006 8695 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_26760 9844 8702 gene locus_tag LOCUS_26770 9844 8702 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870654.1 protein_id gnl|my_center|LOCUS_26770 10995 9856 gene locus_tag LOCUS_26780 10995 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 12102 11056 gene locus_tag LOCUS_26790 12102 11056 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258726.1 protein_id gnl|my_center|LOCUS_26790 12727 12197 gene locus_tag LOCUS_26800 12727 12197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 13486 13812 gene locus_tag LOCUS_26810 13486 13812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140556.1 protein_id gnl|my_center|LOCUS_26810 13870 14409 gene locus_tag LOCUS_26820 13870 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057421.1 protein_id gnl|my_center|LOCUS_26820 14794 14432 gene locus_tag LOCUS_26830 14794 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 15216 15019 gene locus_tag LOCUS_26840 15216 15019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence128 789 1889 gene locus_tag LOCUS_26850 789 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143082.1 protein_id gnl|my_center|LOCUS_26850 1987 3330 gene locus_tag LOCUS_26860 1987 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 4053 4607 gene locus_tag LOCUS_26870 4053 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 4635 5363 gene locus_tag LOCUS_26880 4635 5363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143254.1 protein_id gnl|my_center|LOCUS_26880 5360 6535 gene locus_tag LOCUS_26890 gene ycf84 5360 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143323.1 protein_id gnl|my_center|LOCUS_26890 9024 6859 gene locus_tag LOCUS_26900 gene ppk 9024 6859 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA8 protein_id gnl|my_center|LOCUS_26900 9755 9300 gene locus_tag LOCUS_26910 9755 9300 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140032.1 protein_id gnl|my_center|LOCUS_26910 10151 11764 gene locus_tag LOCUS_26920 10151 11764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056580.1 protein_id gnl|my_center|LOCUS_26920 12010 12615 gene locus_tag LOCUS_26930 12010 12615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 13856 12663 gene locus_tag LOCUS_26940 13856 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 14205 14975 gene locus_tag LOCUS_26950 14205 14975 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence129 16 2067 gene locus_tag LOCUS_26960 16 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 2878 2141 gene locus_tag LOCUS_26970 gene pcyA 2878 2141 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59288 protein_id gnl|my_center|LOCUS_26970 3046 3207 gene locus_tag LOCUS_26980 3046 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 3775 3308 gene locus_tag LOCUS_26990 3775 3308 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064873.1 protein_id gnl|my_center|LOCUS_26990 3980 5038 gene locus_tag LOCUS_27000 3980 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 7749 5116 gene locus_tag LOCUS_27010 7749 5116 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058004.1 protein_id gnl|my_center|LOCUS_27010 8951 8097 gene locus_tag LOCUS_27020 gene cphB 8951 8097 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P3 protein_id gnl|my_center|LOCUS_27020 9783 10520 gene locus_tag LOCUS_27030 gene trmD 9783 10520 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM2 protein_id gnl|my_center|LOCUS_27030 11319 10510 gene locus_tag LOCUS_27040 11319 10510 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124685.1 protein_id gnl|my_center|LOCUS_27040 11754 12038 gene locus_tag LOCUS_27050 11754 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 12140 12637 gene locus_tag LOCUS_27060 12140 12637 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057106.1 protein_id gnl|my_center|LOCUS_27060 13094 14269 gene locus_tag LOCUS_27070 13094 14269 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC5 protein_id gnl|my_center|LOCUS_27070 >Feature sequence130 1 1068 gene locus_tag LOCUS_27080 1 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 3759 1795 gene locus_tag LOCUS_27090 3759 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 3956 4441 gene locus_tag LOCUS_27100 3956 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27100 4736 4873 gene locus_tag LOCUS_27110 4736 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 5223 5849 gene locus_tag LOCUS_27120 5223 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 7129 6395 gene locus_tag LOCUS_27130 7129 6395 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 protein_id gnl|my_center|LOCUS_27130 7764 7177 gene locus_tag LOCUS_27140 gene nadD 7764 7177 CDS product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 protein_id gnl|my_center|LOCUS_27140 8157 9311 gene locus_tag LOCUS_27150 8157 9311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_27150 10321 9452 gene locus_tag LOCUS_27160 10321 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNH3 protein_id gnl|my_center|LOCUS_27160 11080 10613 gene locus_tag LOCUS_27170 11080 10613 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057290.1 protein_id gnl|my_center|LOCUS_27170 11569 11111 gene locus_tag LOCUS_27180 11569 11111 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057291.1 protein_id gnl|my_center|LOCUS_27180 12273 14804 gene locus_tag LOCUS_27190 gene mutS 12273 14804 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGS4 protein_id gnl|my_center|LOCUS_27190 >Feature sequence131 2376 1696 gene locus_tag LOCUS_27200 2376 1696 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056348.1 protein_id gnl|my_center|LOCUS_27200 3268 6363 gene locus_tag LOCUS_27210 3268 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 7260 6469 gene locus_tag LOCUS_27220 7260 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 7537 9426 gene locus_tag LOCUS_27230 gene cobJ 7537 9426 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057147.1 protein_id gnl|my_center|LOCUS_27230 9874 10734 gene locus_tag LOCUS_27240 9874 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 12035 10797 gene locus_tag LOCUS_27250 12035 10797 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056182.1 protein_id gnl|my_center|LOCUS_27250 13176 12304 gene locus_tag LOCUS_27260 13176 12304 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058215.1 protein_id gnl|my_center|LOCUS_27260 13940 13173 gene locus_tag LOCUS_27270 13940 13173 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170112.1 protein_id gnl|my_center|LOCUS_27270 14858 13998 gene locus_tag LOCUS_27280 14858 13998 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170110.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence132 861 1757 gene locus_tag LOCUS_27290 861 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 2802 1996 gene locus_tag LOCUS_27300 2802 1996 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889019.1 protein_id gnl|my_center|LOCUS_27300 4676 3234 gene locus_tag LOCUS_27310 4676 3234 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_27310 4969 4769 gene locus_tag LOCUS_27320 4969 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 5096 4911 gene locus_tag LOCUS_27330 5096 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 5288 5109 gene locus_tag LOCUS_27340 5288 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 6180 6980 gene locus_tag LOCUS_27350 6180 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 7112 8260 gene locus_tag LOCUS_27360 gene wecE 7112 8260 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124471.1 protein_id gnl|my_center|LOCUS_27360 8711 10381 gene locus_tag LOCUS_27370 8711 10381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057497.1 protein_id gnl|my_center|LOCUS_27370 10463 10873 gene locus_tag LOCUS_27380 10463 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057498.1 protein_id gnl|my_center|LOCUS_27380 11248 13269 gene locus_tag LOCUS_27390 11248 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 14245 14601 gene locus_tag LOCUS_27400 14245 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 14626 15270 gene locus_tag LOCUS_27410 14626 15270 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_27410 >Feature sequence133 1625 261 gene locus_tag LOCUS_27420 1625 261 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM2 protein_id gnl|my_center|LOCUS_27420 3044 1752 gene locus_tag LOCUS_27430 gene kmo 3044 1752 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX41 protein_id gnl|my_center|LOCUS_27430 3501 3151 gene locus_tag LOCUS_27440 3501 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 3749 5689 gene locus_tag LOCUS_27450 3749 5689 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_27450 5896 6120 gene locus_tag LOCUS_27460 5896 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 6689 8968 gene locus_tag LOCUS_27470 6689 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 9988 9053 gene locus_tag LOCUS_27480 9988 9053 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 protein_id gnl|my_center|LOCUS_27480 11170 10106 gene locus_tag LOCUS_27490 gene hemE 11170 10106 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBL3 protein_id gnl|my_center|LOCUS_27490 11371 11766 gene locus_tag LOCUS_27500 11371 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 protein_id gnl|my_center|LOCUS_27500 13166 12360 gene locus_tag LOCUS_27510 gene cysE 13166 12360 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK8 protein_id gnl|my_center|LOCUS_27510 14919 13492 gene locus_tag LOCUS_27520 14919 13492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence134 145 1176 gene locus_tag LOCUS_27530 145 1176 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403316.1 protein_id gnl|my_center|LOCUS_27530 1195 2760 gene locus_tag LOCUS_27540 1195 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701838.1 protein_id gnl|my_center|LOCUS_27540 2757 4757 gene locus_tag LOCUS_27550 2757 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701839.1 protein_id gnl|my_center|LOCUS_27550 5097 6557 gene locus_tag LOCUS_27560 5097 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 6595 8802 gene locus_tag LOCUS_27570 6595 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_27570 8832 10124 gene locus_tag LOCUS_27580 gene hfsI 8832 10124 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918387.1 protein_id gnl|my_center|LOCUS_27580 10523 12100 gene locus_tag LOCUS_27590 10523 12100 CDS product alginate O-acetylation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_27590 12144 13178 gene locus_tag LOCUS_27600 12144 13178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 13233 14537 gene locus_tag LOCUS_27610 13233 14537 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061290.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence135 <1 1780 gene locus_tag LOCUS_27620 <1 1780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072502.1:two-component sensor histidine kinase 3050 1875 gene locus_tag LOCUS_27630 3050 1875 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_27630 3780 3184 gene locus_tag LOCUS_27640 gene cpcT 3780 3184 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH04 protein_id gnl|my_center|LOCUS_27640 5283 3898 gene locus_tag LOCUS_27650 5283 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 5384 5740 gene locus_tag LOCUS_27660 5384 5740 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703865.1 protein_id gnl|my_center|LOCUS_27660 7001 5820 gene locus_tag LOCUS_27670 7001 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057862.1 protein_id gnl|my_center|LOCUS_27670 7472 8890 gene locus_tag LOCUS_27680 7472 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 12519 8932 gene locus_tag LOCUS_27690 12519 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 12580 13410 gene locus_tag LOCUS_27700 12580 13410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 14915 13512 gene locus_tag LOCUS_27710 14915 13512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence136 321 1730 gene locus_tag LOCUS_27720 321 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141410.1 protein_id gnl|my_center|LOCUS_27720 1727 3136 gene locus_tag LOCUS_27730 1727 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 3186 5393 gene locus_tag LOCUS_27740 3186 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141408.1 protein_id gnl|my_center|LOCUS_27740 5537 8710 gene locus_tag LOCUS_27750 5537 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 8756 9268 gene locus_tag LOCUS_27760 8756 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 9668 9276 gene locus_tag LOCUS_27770 9668 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 protein_id gnl|my_center|LOCUS_27770 10058 11230 gene locus_tag LOCUS_27780 gene queA 10058 11230 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKD7 protein_id gnl|my_center|LOCUS_27780 11670 11227 gene locus_tag LOCUS_27790 11670 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 12085 11681 gene locus_tag LOCUS_27800 12085 11681 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 protein_id gnl|my_center|LOCUS_27800 13892 12123 gene locus_tag LOCUS_27810 13892 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 14722 13952 gene locus_tag LOCUS_27820 14722 13952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence137 1473 268 gene locus_tag LOCUS_27830 gene petH 1473 268 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93RE3 protein_id gnl|my_center|LOCUS_27830 2746 1727 gene locus_tag LOCUS_27840 gene dnaJ 2746 1727 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_27840 3615 3980 gene locus_tag LOCUS_27850 gene ftrC 3615 3980 CDS product ferredoxin-thioredoxin reductase, catalytic chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK3 protein_id gnl|my_center|LOCUS_27850 4234 4605 gene locus_tag LOCUS_27860 4234 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 5030 5416 gene locus_tag LOCUS_27870 5030 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 6078 11960 gene locus_tag LOCUS_27880 6078 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 12357 13172 gene locus_tag LOCUS_27890 12357 13172 CDS product phosphonates-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016927.1 protein_id gnl|my_center|LOCUS_27890 13313 15019 gene locus_tag LOCUS_27900 13313 15019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 >Feature sequence138 <1 3304 gene locus_tag LOCUS_27910 <1 3304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204628.1:histidine kinase 3851 5701 gene locus_tag LOCUS_27920 gene ftsH 3851 5701 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW1 protein_id gnl|my_center|LOCUS_27920 6880 5690 gene locus_tag LOCUS_27930 6880 5690 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142255.1 protein_id gnl|my_center|LOCUS_27930 7639 13920 gene locus_tag LOCUS_27940 7639 13920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 14357 14515 gene locus_tag LOCUS_27950 14357 14515 CDS product proteolipid membrane potential modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 protein_id gnl|my_center|LOCUS_27950 >Feature sequence139 695 2320 gene locus_tag LOCUS_27960 gene yngK 695 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635991.1 protein_id gnl|my_center|LOCUS_27960 3179 4720 gene locus_tag LOCUS_27970 3179 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 5851 4961 gene locus_tag LOCUS_27980 gene pys 5851 4961 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057400.1 protein_id gnl|my_center|LOCUS_27980 7390 5978 gene locus_tag LOCUS_27990 gene pds 7390 5978 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124322.1 protein_id gnl|my_center|LOCUS_27990 >Feature sequence140 1636 311 gene locus_tag LOCUS_28000 1636 311 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058123.1 protein_id gnl|my_center|LOCUS_28000 2165 1800 gene locus_tag LOCUS_28010 2165 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 5905 2546 gene locus_tag LOCUS_28020 5905 2546 CDS product trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_28020 6268 6837 gene locus_tag LOCUS_28030 6268 6837 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 protein_id gnl|my_center|LOCUS_28030 6837 7325 gene locus_tag LOCUS_28040 6837 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 7419 9014 gene locus_tag LOCUS_28050 7419 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 9135 9371 gene locus_tag LOCUS_28060 9135 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 9388 11112 gene locus_tag LOCUS_28070 9388 11112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 11308 12342 gene locus_tag LOCUS_28080 11308 12342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412408.1 protein_id gnl|my_center|LOCUS_28080 12451 14637 gene locus_tag LOCUS_28090 12451 14637 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056777.1 protein_id gnl|my_center|LOCUS_28090 >Feature sequence141 1597 524 gene locus_tag LOCUS_28100 gene rfbA 1597 524 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_28100 2573 1689 gene locus_tag LOCUS_28110 gene rfbD 2573 1689 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 protein_id gnl|my_center|LOCUS_28110 3166 2573 gene locus_tag LOCUS_28120 gene rfbC-1 3166 2573 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 protein_id gnl|my_center|LOCUS_28120 4961 3180 gene locus_tag LOCUS_28130 4961 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 6987 5032 gene locus_tag LOCUS_28140 6987 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 10086 7090 gene locus_tag LOCUS_28150 10086 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 10832 10083 gene locus_tag LOCUS_28160 10832 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 11374 11706 gene locus_tag LOCUS_28170 gene trx 11374 11706 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6A2 protein_id gnl|my_center|LOCUS_28170 11722 12897 gene locus_tag LOCUS_28180 11722 12897 CDS product succinyldiaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143457.1 protein_id gnl|my_center|LOCUS_28180 14111 13251 gene locus_tag LOCUS_28190 14111 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28190 14480 14256 gene locus_tag LOCUS_28200 14480 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence142 2290 1688 gene locus_tag LOCUS_28210 2290 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 5342 2370 gene locus_tag LOCUS_28220 5342 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 5621 6811 gene locus_tag LOCUS_28230 5621 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 8445 6859 gene locus_tag LOCUS_28240 8445 6859 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_28240 10819 12159 gene locus_tag LOCUS_28250 10819 12159 CDS product K+ transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393256.1 protein_id gnl|my_center|LOCUS_28250 13061 12228 gene locus_tag LOCUS_28260 13061 12228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence143 554 1501 gene locus_tag LOCUS_28270 554 1501 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057245.1 protein_id gnl|my_center|LOCUS_28270 1543 3900 gene locus_tag LOCUS_28280 1543 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 4186 4461 gene locus_tag LOCUS_28290 4186 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 5307 13205 gene locus_tag LOCUS_28300 5307 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 13650 14246 gene locus_tag LOCUS_28310 13650 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 14319 14549 gene locus_tag LOCUS_28320 14319 14549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence144 <1 2242 gene locus_tag LOCUS_28330 <1 2242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P44969:immunoglobulin A1 protease autotransporter 2273 2848 gene locus_tag LOCUS_28340 2273 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 2901 4670 gene locus_tag LOCUS_28350 2901 4670 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140428.1 protein_id gnl|my_center|LOCUS_28350 7896 5161 gene locus_tag LOCUS_28360 7896 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 9591 8572 gene locus_tag LOCUS_28370 9591 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 10010 10366 gene locus_tag LOCUS_28380 10010 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 10592 12283 gene locus_tag LOCUS_28390 10592 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 13653 12721 gene locus_tag LOCUS_28400 13653 12721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 >Feature sequence145 2205 2639 gene locus_tag LOCUS_28410 2205 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 3246 3977 gene locus_tag LOCUS_28420 3246 3977 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058197.1 protein_id gnl|my_center|LOCUS_28420 4151 4870 gene locus_tag LOCUS_28430 4151 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 protein_id gnl|my_center|LOCUS_28430 5082 5591 gene locus_tag LOCUS_28440 gene ppa 5082 5591 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR2 protein_id gnl|my_center|LOCUS_28440 5772 6146 gene locus_tag LOCUS_28450 gene panD2 5772 6146 CDS product aspartate 1-decarboxylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDK7 protein_id gnl|my_center|LOCUS_28450 6353 7177 gene locus_tag LOCUS_28460 6353 7177 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_28460 7191 7742 gene locus_tag LOCUS_28470 7191 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 9715 7859 gene locus_tag LOCUS_28480 9715 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 10164 10000 gene locus_tag LOCUS_28490 10164 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 10658 11569 gene locus_tag LOCUS_28500 10658 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28500 13142 11613 gene locus_tag LOCUS_28510 13142 11613 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_28510 13886 14128 gene locus_tag LOCUS_28520 13886 14128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence146 <1 2341 gene locus_tag LOCUS_28530 <1 2341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83D72:replicative DNA helicase 2490 2735 gene locus_tag LOCUS_28540 2490 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 2719 3468 gene locus_tag LOCUS_28550 2719 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 4588 3431 gene locus_tag LOCUS_28560 4588 3431 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8J4 protein_id gnl|my_center|LOCUS_28560 5893 4646 gene locus_tag LOCUS_28570 5893 4646 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH31 protein_id gnl|my_center|LOCUS_28570 6965 5910 gene locus_tag LOCUS_28580 6965 5910 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_28580 8734 7250 gene locus_tag LOCUS_28590 gene glyA 8734 7250 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH33 protein_id gnl|my_center|LOCUS_28590 8802 8999 gene locus_tag LOCUS_28600 8802 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057807.1 protein_id gnl|my_center|LOCUS_28600 9107 9580 gene locus_tag LOCUS_28610 gene ycf60 9107 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056916.1 protein_id gnl|my_center|LOCUS_28610 9675 10019 gene locus_tag LOCUS_28620 gene rpsF 9675 10019 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNH7 protein_id gnl|my_center|LOCUS_28620 10538 11092 gene locus_tag LOCUS_28630 10538 11092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057906.1 protein_id gnl|my_center|LOCUS_28630 11690 11346 gene locus_tag LOCUS_28640 11690 11346 CDS product putative anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1F5 protein_id gnl|my_center|LOCUS_28640 12108 12731 gene locus_tag LOCUS_28650 12108 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 13891 12959 gene locus_tag LOCUS_28660 13891 12959 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006668.1 protein_id gnl|my_center|LOCUS_28660 >Feature sequence147 535 717 gene locus_tag LOCUS_28670 535 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 846 1109 gene locus_tag LOCUS_28680 846 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 2352 1114 gene locus_tag LOCUS_28690 2352 1114 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887610.1 protein_id gnl|my_center|LOCUS_28690 6164 3249 gene locus_tag LOCUS_28700 6164 3249 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975826.1 protein_id gnl|my_center|LOCUS_28700 6680 8044 gene locus_tag LOCUS_28710 6680 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 8479 8072 gene locus_tag LOCUS_28720 8479 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 10019 8667 gene locus_tag LOCUS_28730 10019 8667 CDS product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHJ8 protein_id gnl|my_center|LOCUS_28730 10434 11231 gene locus_tag LOCUS_28740 10434 11231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056183.1 protein_id gnl|my_center|LOCUS_28740 11357 12361 gene locus_tag LOCUS_28750 11357 12361 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461076.1 protein_id gnl|my_center|LOCUS_28750 13595 12390 gene locus_tag LOCUS_28760 13595 12390 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028668.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence148 1252 518 gene locus_tag LOCUS_28770 1252 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 3459 1342 gene locus_tag LOCUS_28780 3459 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 4831 3614 gene locus_tag LOCUS_28790 4831 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_28790 5791 4943 gene locus_tag LOCUS_28800 5791 4943 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056990.1 protein_id gnl|my_center|LOCUS_28800 6520 5888 gene locus_tag LOCUS_28810 gene ccmN 6520 5888 CDS product carbon dioxide concentrating mechanism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142090.1 protein_id gnl|my_center|LOCUS_28810 8215 6560 gene locus_tag LOCUS_28820 gene ccmM 8215 6560 CDS product carbon dioxide concentrating mechanism protein CcmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142091.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28820 8613 8311 gene locus_tag LOCUS_28830 gene ccmL 8613 8311 CDS product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_28830 9085 8744 gene locus_tag LOCUS_28840 gene ccmK1 9085 8744 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_28840 9678 9367 gene locus_tag LOCUS_28850 gene ccmK1 9678 9367 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_28850 10605 12353 gene locus_tag LOCUS_28860 10605 12353 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288137.1 protein_id gnl|my_center|LOCUS_28860 12437 13144 gene locus_tag LOCUS_28870 gene rnc 12437 13144 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819V8 protein_id gnl|my_center|LOCUS_28870 13268 13624 gene locus_tag LOCUS_28880 gene ycf57 13268 13624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056711.1 protein_id gnl|my_center|LOCUS_28880 <14311 13731 gene locus_tag LOCUS_28890 <14311 13731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023258.1:pentapeptide repeat protein >Feature sequence149 <1 967 gene locus_tag LOCUS_28900 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545777.1:adenylate/guanylate cyclase domain-containing protein 2550 1408 gene locus_tag LOCUS_28910 gene hisC 2550 1408 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM42 protein_id gnl|my_center|LOCUS_28910 2959 4131 gene locus_tag LOCUS_28920 2959 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 4178 5011 gene locus_tag LOCUS_28930 4178 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 5182 5490 gene locus_tag LOCUS_28940 5182 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 6223 5573 gene locus_tag LOCUS_28950 6223 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 6508 7209 gene locus_tag LOCUS_28960 6508 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 7218 7583 gene locus_tag LOCUS_28970 7218 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 7602 8447 gene locus_tag LOCUS_28980 7602 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 8544 8924 gene locus_tag LOCUS_28990 8544 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 8992 9753 gene locus_tag LOCUS_29000 8992 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 10155 9877 gene locus_tag LOCUS_29010 10155 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 10920 10684 gene locus_tag LOCUS_29020 10920 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 11146 11865 gene locus_tag LOCUS_29030 11146 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057734.1 protein_id gnl|my_center|LOCUS_29030 12801 11878 gene locus_tag LOCUS_29040 12801 11878 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058188.1 protein_id gnl|my_center|LOCUS_29040 13128 12871 gene locus_tag LOCUS_29050 13128 12871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056812.1 protein_id gnl|my_center|LOCUS_29050 >Feature sequence150 500 2182 gene locus_tag LOCUS_29060 500 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 protein_id gnl|my_center|LOCUS_29060 2385 3002 gene locus_tag LOCUS_29070 2385 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 3476 3264 gene locus_tag LOCUS_29080 3476 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 3649 4170 gene locus_tag LOCUS_29090 3649 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 4191 6941 gene locus_tag LOCUS_29100 4191 6941 CDS product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_29100 6971 8695 gene locus_tag LOCUS_29110 6971 8695 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257054.1 protein_id gnl|my_center|LOCUS_29110 8781 9536 gene locus_tag LOCUS_29120 8781 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 11621 9804 gene locus_tag LOCUS_29130 11621 9804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 12333 11692 gene locus_tag LOCUS_29140 12333 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 13524 12544 gene locus_tag LOCUS_29150 13524 12544 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254458.1 protein_id gnl|my_center|LOCUS_29150 13815 13627 gene locus_tag LOCUS_29160 13815 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 13858 14019 gene locus_tag LOCUS_29170 13858 14019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence151 465 920 gene locus_tag LOCUS_29180 465 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 952 2919 gene locus_tag LOCUS_29190 952 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 3784 2954 gene locus_tag LOCUS_29200 3784 2954 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260128.1 protein_id gnl|my_center|LOCUS_29200 4609 4088 gene locus_tag LOCUS_29210 gene ydeS 4609 4088 CDS product putative HTH-type transcriptional regulator YdeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96676 protein_id gnl|my_center|LOCUS_29210 5563 5030 gene locus_tag LOCUS_29220 5563 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 5884 6357 gene locus_tag LOCUS_29230 5884 6357 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710162.1 protein_id gnl|my_center|LOCUS_29230 6905 7822 gene locus_tag LOCUS_29240 6905 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 7861 9165 gene locus_tag LOCUS_29250 7861 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 9153 11681 gene locus_tag LOCUS_29260 9153 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 11678 13708 gene locus_tag LOCUS_29270 11678 13708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 >Feature sequence152 3500 4258 gene locus_tag LOCUS_29280 3500 4258 CDS product CDP-3, 6-dideoxy-D-glycero-L-glycero-4-hexulose-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056807.1 protein_id gnl|my_center|LOCUS_29280 4365 5393 gene locus_tag LOCUS_29290 4365 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 5553 7730 gene locus_tag LOCUS_29300 5553 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 8992 7727 gene locus_tag LOCUS_29310 8992 7727 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_29310 10789 9236 gene locus_tag LOCUS_29320 10789 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 11782 11276 gene locus_tag LOCUS_29330 gene ndhJ 11782 11276 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ01 protein_id gnl|my_center|LOCUS_29330 12503 11775 gene locus_tag LOCUS_29340 gene ndhK 12503 11775 CDS product NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ4 protein_id gnl|my_center|LOCUS_29340 12881 12519 gene locus_tag LOCUS_29350 gene ndhC 12881 12519 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ02 protein_id gnl|my_center|LOCUS_29350 13304 13693 gene locus_tag LOCUS_29360 gene rub 13304 13693 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI94 protein_id gnl|my_center|LOCUS_29360 >Feature sequence153 1742 864 gene locus_tag LOCUS_29370 1742 864 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868260.1 protein_id gnl|my_center|LOCUS_29370 1759 2259 gene locus_tag LOCUS_29380 gene tadA 1759 2259 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DME2 protein_id gnl|my_center|LOCUS_29380 3013 2330 gene locus_tag LOCUS_29390 3013 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 3742 3014 gene locus_tag LOCUS_29400 3742 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 4737 3760 gene locus_tag LOCUS_29410 4737 3760 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272452.1 protein_id gnl|my_center|LOCUS_29410 5117 6163 gene locus_tag LOCUS_29420 5117 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 6621 6421 gene locus_tag LOCUS_29430 6621 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 7054 6770 gene locus_tag LOCUS_29440 7054 6770 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_29440 7555 9606 gene locus_tag LOCUS_29450 7555 9606 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056593.1 protein_id gnl|my_center|LOCUS_29450 11576 9636 gene locus_tag LOCUS_29460 11576 9636 CDS product zinc-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393690.1 protein_id gnl|my_center|LOCUS_29460 12011 12535 gene locus_tag LOCUS_29470 12011 12535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 12713 13921 gene locus_tag LOCUS_29480 12713 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 >Feature sequence154 1720 311 gene locus_tag LOCUS_29490 1720 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143146.1 protein_id gnl|my_center|LOCUS_29490 2310 4436 gene locus_tag LOCUS_29500 2310 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 5031 9353 gene locus_tag LOCUS_29510 5031 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 10242 12056 gene locus_tag LOCUS_29520 10242 12056 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143414.1 protein_id gnl|my_center|LOCUS_29520 12206 12652 gene locus_tag LOCUS_29530 12206 12652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 13856 12660 gene locus_tag LOCUS_29540 13856 12660 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140568.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence155 204 1418 gene locus_tag LOCUS_29550 204 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 2146 1415 gene locus_tag LOCUS_29560 2146 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 2964 2221 gene locus_tag LOCUS_29570 2964 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 4287 3118 gene locus_tag LOCUS_29580 gene ydcM 4287 3118 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_29580 4873 4271 gene locus_tag LOCUS_29590 4873 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869506.1 protein_id gnl|my_center|LOCUS_29590 6542 4893 gene locus_tag LOCUS_29600 6542 4893 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389949.1 protein_id gnl|my_center|LOCUS_29600 6663 7382 gene locus_tag LOCUS_29610 6663 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 8015 9358 gene locus_tag LOCUS_29620 8015 9358 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 protein_id gnl|my_center|LOCUS_29620 9358 10305 gene locus_tag LOCUS_29630 9358 10305 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_29630 10450 10866 gene locus_tag LOCUS_29640 10450 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 11561 11226 gene locus_tag LOCUS_29650 11561 11226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 12929 11715 gene locus_tag LOCUS_29660 12929 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 13568 13032 gene locus_tag LOCUS_29670 13568 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759723.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence156 2656 3723 gene locus_tag LOCUS_29680 2656 3723 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140660.1 protein_id gnl|my_center|LOCUS_29680 4584 4240 gene locus_tag LOCUS_29690 4584 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144091.1 protein_id gnl|my_center|LOCUS_29690 4973 4671 gene locus_tag LOCUS_29700 4973 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144090.1 protein_id gnl|my_center|LOCUS_29700 5490 4987 gene locus_tag LOCUS_29710 5490 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144089.1 protein_id gnl|my_center|LOCUS_29710 6190 5693 gene locus_tag LOCUS_29720 6190 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 6617 6288 gene locus_tag LOCUS_29730 6617 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29730 7374 6811 gene locus_tag LOCUS_29740 7374 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 9193 7466 gene locus_tag LOCUS_29750 9193 7466 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144086.1 protein_id gnl|my_center|LOCUS_29750 11108 10536 gene locus_tag LOCUS_29760 11108 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 11379 12770 gene locus_tag LOCUS_29770 11379 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258026.1 protein_id gnl|my_center|LOCUS_29770 >Feature sequence157 642 1625 gene locus_tag LOCUS_29780 642 1625 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_29780 1799 2254 gene locus_tag LOCUS_29790 1799 2254 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461776.1 protein_id gnl|my_center|LOCUS_29790 3230 2223 gene locus_tag LOCUS_29800 3230 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 4390 3227 gene locus_tag LOCUS_29810 gene yxbC 4390 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46327 protein_id gnl|my_center|LOCUS_29810 4701 4549 gene locus_tag LOCUS_29820 4701 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 5008 6411 gene locus_tag LOCUS_29830 gene secD 5008 6411 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB8 protein_id gnl|my_center|LOCUS_29830 6464 7456 gene locus_tag LOCUS_29840 gene secF 6464 7456 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB9 protein_id gnl|my_center|LOCUS_29840 7647 7970 gene locus_tag LOCUS_29850 7647 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 8039 8563 gene locus_tag LOCUS_29860 8039 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 8905 9279 gene locus_tag LOCUS_29870 8905 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056714.1 protein_id gnl|my_center|LOCUS_29870 9379 10311 gene locus_tag LOCUS_29880 9379 10311 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_29880 10643 10873 gene locus_tag LOCUS_29890 10643 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 11180 12487 gene locus_tag LOCUS_29900 11180 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 12577 13755 gene locus_tag LOCUS_29910 12577 13755 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140589.1 protein_id gnl|my_center|LOCUS_29910 >Feature sequence158 410 2182 gene locus_tag LOCUS_29920 410 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 3147 2230 gene locus_tag LOCUS_29930 gene murQ 3147 2230 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ1 protein_id gnl|my_center|LOCUS_29930 3545 3165 gene locus_tag LOCUS_29940 3545 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056170.1 protein_id gnl|my_center|LOCUS_29940 3724 4839 gene locus_tag LOCUS_29950 3724 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 4960 5739 gene locus_tag LOCUS_29960 4960 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 5832 7208 gene locus_tag LOCUS_29970 5832 7208 CDS product Na+-transporting ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056159.1 protein_id gnl|my_center|LOCUS_29970 7219 7923 gene locus_tag LOCUS_29980 7219 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056267.1 protein_id gnl|my_center|LOCUS_29980 9288 8047 gene locus_tag LOCUS_29990 9288 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 9543 10268 gene locus_tag LOCUS_30000 9543 10268 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_30000 10361 11092 gene locus_tag LOCUS_30010 10361 11092 CDS product FraH protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057328.1 protein_id gnl|my_center|LOCUS_30010 11262 11762 gene locus_tag LOCUS_30020 11262 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 12190 12591 gene locus_tag LOCUS_30030 12190 12591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 12676 13623 gene locus_tag LOCUS_30040 gene dusA 12676 13623 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L85 protein_id gnl|my_center|LOCUS_30040 >Feature sequence159 3021 1699 gene locus_tag LOCUS_30050 gene glcE 3021 1699 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143064.1 protein_id gnl|my_center|LOCUS_30050 3158 3382 gene locus_tag LOCUS_30060 3158 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 3382 3600 gene locus_tag LOCUS_30070 3382 3600 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 protein_id gnl|my_center|LOCUS_30070 3674 4999 gene locus_tag LOCUS_30080 3674 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 5077 7074 gene locus_tag LOCUS_30090 5077 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 7137 8684 gene locus_tag LOCUS_30100 gene merA 7137 8684 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_30100 9391 8687 gene locus_tag LOCUS_30110 9391 8687 CDS product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_30110 10571 9444 gene locus_tag LOCUS_30120 10571 9444 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142475.1 protein_id gnl|my_center|LOCUS_30120 10851 11039 gene locus_tag LOCUS_30130 10851 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 11211 11429 gene locus_tag LOCUS_30140 11211 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 11525 12745 gene locus_tag LOCUS_30150 11525 12745 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NER0 protein_id gnl|my_center|LOCUS_30150 13271 12792 gene locus_tag LOCUS_30160 13271 12792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence160 <1 828 gene locus_tag LOCUS_30170 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143453.1:transketolase 1086 880 gene locus_tag LOCUS_30180 1086 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 1250 1582 gene locus_tag LOCUS_30190 1250 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 2268 1579 gene locus_tag LOCUS_30200 2268 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144357.1 protein_id gnl|my_center|LOCUS_30200 2618 3733 gene locus_tag LOCUS_30210 2618 3733 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USI0 protein_id gnl|my_center|LOCUS_30210 3896 5479 gene locus_tag LOCUS_30220 3896 5479 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085767.1 protein_id gnl|my_center|LOCUS_30220 5557 7119 gene locus_tag LOCUS_30230 5557 7119 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_30230 7165 8034 gene locus_tag LOCUS_30240 7165 8034 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142003.1 protein_id gnl|my_center|LOCUS_30240 8491 10062 gene locus_tag LOCUS_30250 gene dagA 8491 10062 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_30250 10378 10686 gene locus_tag LOCUS_30260 10378 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 10800 11837 gene locus_tag LOCUS_30270 10800 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 11851 12876 gene locus_tag LOCUS_30280 11851 12876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence161 1049 3970 gene locus_tag LOCUS_30290 1049 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 4156 4626 gene locus_tag LOCUS_30300 4156 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056683.1 protein_id gnl|my_center|LOCUS_30300 5055 7226 gene locus_tag LOCUS_30310 5055 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 9391 8039 gene locus_tag LOCUS_30320 9391 8039 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143683.1 protein_id gnl|my_center|LOCUS_30320 9614 10168 gene locus_tag LOCUS_30330 9614 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055993.1 protein_id gnl|my_center|LOCUS_30330 11587 10202 gene locus_tag LOCUS_30340 gene ccsB 11587 10202 CDS product cytochrome c biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL16 protein_id gnl|my_center|LOCUS_30340 12325 11591 gene locus_tag LOCUS_30350 gene ccdA 12325 11591 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055907.1 protein_id gnl|my_center|LOCUS_30350 12690 13289 gene locus_tag LOCUS_30360 12690 13289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 13506 13724 gene locus_tag LOCUS_30370 13506 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 >Feature sequence162 2414 1626 gene locus_tag LOCUS_30380 2414 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 2560 3459 gene locus_tag LOCUS_30390 gene crtR 2560 3459 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_30390 4182 3511 gene locus_tag LOCUS_30400 4182 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 4480 5772 gene locus_tag LOCUS_30410 4480 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 5904 6656 gene locus_tag LOCUS_30420 5904 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 7306 8643 gene locus_tag LOCUS_30430 7306 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 8711 10126 gene locus_tag LOCUS_30440 8711 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141950.1 protein_id gnl|my_center|LOCUS_30440 11984 10158 gene locus_tag LOCUS_30450 11984 10158 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_30450 13114 12116 gene locus_tag LOCUS_30460 13114 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 >Feature sequence163 725 270 gene locus_tag LOCUS_30470 725 270 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_30470 1489 788 gene locus_tag LOCUS_30480 1489 788 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143931.1 protein_id gnl|my_center|LOCUS_30480 2433 1681 gene locus_tag LOCUS_30490 2433 1681 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259141.1 protein_id gnl|my_center|LOCUS_30490 4098 2677 gene locus_tag LOCUS_30500 gene glnA 4098 2677 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ7 protein_id gnl|my_center|LOCUS_30500 4272 4781 gene locus_tag LOCUS_30510 gene apcF 4272 4781 CDS product phycobilisome core component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 protein_id gnl|my_center|LOCUS_30510 4948 5766 gene locus_tag LOCUS_30520 4948 5766 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057297.1 protein_id gnl|my_center|LOCUS_30520 5817 6506 gene locus_tag LOCUS_30530 5817 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 6784 7146 gene locus_tag LOCUS_30540 6784 7146 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140281.1 protein_id gnl|my_center|LOCUS_30540 7488 7883 gene locus_tag LOCUS_30550 7488 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 8035 8889 gene locus_tag LOCUS_30560 8035 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 11193 8944 gene locus_tag LOCUS_30570 11193 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 12712 11147 gene locus_tag LOCUS_30580 12712 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 13543 12785 gene locus_tag LOCUS_30590 13543 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 >Feature sequence164 672 1106 gene locus_tag LOCUS_30600 672 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 1217 2728 gene locus_tag LOCUS_30610 1217 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 protein_id gnl|my_center|LOCUS_30610 2758 3321 gene locus_tag LOCUS_30620 2758 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143717.1 protein_id gnl|my_center|LOCUS_30620 3473 5293 gene locus_tag LOCUS_30630 3473 5293 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057670.1 protein_id gnl|my_center|LOCUS_30630 5349 6785 gene locus_tag LOCUS_30640 5349 6785 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_30640 7040 8260 gene locus_tag LOCUS_30650 7040 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_30650 8344 9165 gene locus_tag LOCUS_30660 8344 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 protein_id gnl|my_center|LOCUS_30660 9838 9146 gene locus_tag LOCUS_30670 9838 9146 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024041.1 protein_id gnl|my_center|LOCUS_30670 10093 10731 gene locus_tag LOCUS_30680 gene tal 10093 10731 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66520 protein_id gnl|my_center|LOCUS_30680 >Feature sequence165 14 1021 gene locus_tag LOCUS_30690 14 1021 CDS product Ycf48-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI95 protein_id gnl|my_center|LOCUS_30690 1136 1387 gene locus_tag LOCUS_30700 gene psbE 1136 1387 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP0 protein_id gnl|my_center|LOCUS_30700 1410 1547 gene locus_tag LOCUS_30710 gene psbF 1410 1547 CDS product cytochrome b559 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN9 protein_id gnl|my_center|LOCUS_30710 2154 2082 gene locus_tag LOCUS_t00200 2154 2082 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3192 2299 gene locus_tag LOCUS_30720 3192 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142304.1 protein_id gnl|my_center|LOCUS_30720 3429 4133 gene locus_tag LOCUS_30730 3429 4133 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056649.1 protein_id gnl|my_center|LOCUS_30730 4185 4589 gene locus_tag LOCUS_30740 4185 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 5072 4845 gene locus_tag LOCUS_30750 5072 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 5613 5894 gene locus_tag LOCUS_30760 5613 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 6640 6858 gene locus_tag LOCUS_30770 6640 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 8768 7200 gene locus_tag LOCUS_30780 gene lysS 8768 7200 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37477 protein_id gnl|my_center|LOCUS_30780 9367 9600 gene locus_tag LOCUS_30790 9367 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 10355 9615 gene locus_tag LOCUS_30800 10355 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 10649 12925 gene locus_tag LOCUS_30810 10649 12925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 >Feature sequence166 374 78 gene locus_tag LOCUS_30820 374 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144013.1 protein_id gnl|my_center|LOCUS_30820 720 415 gene locus_tag LOCUS_30830 gene ycf49 720 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 protein_id gnl|my_center|LOCUS_30830 839 1888 gene locus_tag LOCUS_30840 839 1888 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140747.1 protein_id gnl|my_center|LOCUS_30840 2190 2429 gene locus_tag LOCUS_30850 2190 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 2423 2911 gene locus_tag LOCUS_30860 2423 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 2973 3632 gene locus_tag LOCUS_30870 gene trmB 2973 3632 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH6 protein_id gnl|my_center|LOCUS_30870 3738 4703 gene locus_tag LOCUS_30880 gene ubiA 3738 4703 CDS product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 protein_id gnl|my_center|LOCUS_30880 5464 4742 gene locus_tag LOCUS_30890 5464 4742 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC5 protein_id gnl|my_center|LOCUS_30890 6022 5483 gene locus_tag LOCUS_30900 gene psbP 6022 5483 CDS product photosystem II oxygen-evolving complex 23K protein PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 protein_id gnl|my_center|LOCUS_30900 6401 6607 gene locus_tag LOCUS_30910 6401 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 7483 6629 gene locus_tag LOCUS_30920 gene purU 7483 6629 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD6 protein_id gnl|my_center|LOCUS_30920 8368 7529 gene locus_tag LOCUS_30930 8368 7529 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887476.1 protein_id gnl|my_center|LOCUS_30930 9878 8427 gene locus_tag LOCUS_30940 9878 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 11417 10176 gene locus_tag LOCUS_30950 11417 10176 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259616.1 protein_id gnl|my_center|LOCUS_30950 13090 11576 gene locus_tag LOCUS_30960 gene glpK 13090 11576 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJT1 protein_id gnl|my_center|LOCUS_30960 >Feature sequence167 2436 3575 gene locus_tag LOCUS_30970 2436 3575 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837658.1 protein_id gnl|my_center|LOCUS_30970 3584 6250 gene locus_tag LOCUS_30980 3584 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 7444 6482 gene locus_tag LOCUS_30990 7444 6482 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057967.1 protein_id gnl|my_center|LOCUS_30990 7517 8209 gene locus_tag LOCUS_31000 gene ispD 7517 8209 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL91 protein_id gnl|my_center|LOCUS_31000 9075 8272 gene locus_tag LOCUS_31010 9075 8272 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_31010 9284 10519 gene locus_tag LOCUS_31020 9284 10519 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056017.1 protein_id gnl|my_center|LOCUS_31020 11208 11933 gene locus_tag LOCUS_31030 11208 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142915.1 protein_id gnl|my_center|LOCUS_31030 12289 12053 gene locus_tag LOCUS_31040 gene rpmB 12289 12053 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG62 protein_id gnl|my_center|LOCUS_31040 13141 12368 gene locus_tag LOCUS_31050 13141 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence168 2937 688 gene locus_tag LOCUS_31060 2937 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 3754 3227 gene locus_tag LOCUS_31070 3754 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3885 4229 gene locus_tag LOCUS_31080 3885 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 4311 4703 gene locus_tag LOCUS_31090 4311 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 4712 5590 gene locus_tag LOCUS_31100 4712 5590 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056885.1 protein_id gnl|my_center|LOCUS_31100 5804 6085 gene locus_tag LOCUS_31110 5804 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 7065 6250 gene locus_tag LOCUS_31120 7065 6250 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970319.1 protein_id gnl|my_center|LOCUS_31120 7259 8500 gene locus_tag LOCUS_31130 7259 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 8535 9335 gene locus_tag LOCUS_31140 gene hisA 8535 9335 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA5 protein_id gnl|my_center|LOCUS_31140 9855 9361 gene locus_tag LOCUS_31150 9855 9361 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706769.1 protein_id gnl|my_center|LOCUS_31150 10261 9848 gene locus_tag LOCUS_31160 10261 9848 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706770.1 protein_id gnl|my_center|LOCUS_31160 11194 10304 gene locus_tag LOCUS_31170 gene prmA 11194 10304 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM00 protein_id gnl|my_center|LOCUS_31170 13103 11502 gene locus_tag LOCUS_31180 gene serA 13103 11502 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM01 protein_id gnl|my_center|LOCUS_31180 >Feature sequence169 2070 1306 gene locus_tag LOCUS_31190 2070 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3987 2119 gene locus_tag LOCUS_31200 gene nirA 3987 2119 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_31200 5389 4382 gene locus_tag LOCUS_31210 5389 4382 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_31210 7374 5434 gene locus_tag LOCUS_31220 7374 5434 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058113.1 protein_id gnl|my_center|LOCUS_31220 7892 9142 gene locus_tag LOCUS_31230 7892 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 9249 11705 gene locus_tag LOCUS_31240 gene pheT 9249 11705 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL37 protein_id gnl|my_center|LOCUS_31240 12513 11869 gene locus_tag LOCUS_31250 12513 11869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 >Feature sequence170 4368 5225 gene locus_tag LOCUS_31260 4368 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057461.1 protein_id gnl|my_center|LOCUS_31260 6019 5222 gene locus_tag LOCUS_31270 6019 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057312.1 protein_id gnl|my_center|LOCUS_31270 6694 6089 gene locus_tag LOCUS_31280 gene trpG 6694 6089 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 protein_id gnl|my_center|LOCUS_31280 7211 6708 gene locus_tag LOCUS_31290 7211 6708 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ9 protein_id gnl|my_center|LOCUS_31290 7947 7387 gene locus_tag LOCUS_31300 7947 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 8167 7958 gene locus_tag LOCUS_31310 8167 7958 CDS product DUF3285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057423.1 protein_id gnl|my_center|LOCUS_31310 8954 8364 gene locus_tag LOCUS_31320 8954 8364 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057261.1 protein_id gnl|my_center|LOCUS_31320 9722 10207 gene locus_tag LOCUS_31330 gene apcA 9722 10207 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141246.1 protein_id gnl|my_center|LOCUS_31330 10294 10779 gene locus_tag LOCUS_31340 gene apcB 10294 10779 CDS product allophycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50031 protein_id gnl|my_center|LOCUS_31340 11041 11244 gene locus_tag LOCUS_31350 gene apcC 11041 11244 CDS product phycobilisome 7.8 kDa linker polypeptide, allophycocyanin-associated, core inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50036 protein_id gnl|my_center|LOCUS_31350 11650 12396 gene locus_tag LOCUS_31360 11650 12396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 12389 12871 gene locus_tag LOCUS_31370 12389 12871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence171 <1 531 gene locus_tag LOCUS_31380 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197907.1:FMN reductase 587 1399 gene locus_tag LOCUS_31390 587 1399 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240366.1 protein_id gnl|my_center|LOCUS_31390 1447 2190 gene locus_tag LOCUS_31400 1447 2190 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259746.1 protein_id gnl|my_center|LOCUS_31400 2398 3435 gene locus_tag LOCUS_31410 2398 3435 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104357.1 protein_id gnl|my_center|LOCUS_31410 3467 5224 gene locus_tag LOCUS_31420 gene nadB 3467 5224 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGB1 protein_id gnl|my_center|LOCUS_31420 6250 6693 gene locus_tag LOCUS_31430 gene hspA 6250 6693 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_31430 6908 7882 gene locus_tag LOCUS_31440 gene dnaJ 6908 7882 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_31440 8016 9233 gene locus_tag LOCUS_31450 8016 9233 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 protein_id gnl|my_center|LOCUS_31450 9281 9460 gene locus_tag LOCUS_31460 9281 9460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 12090 9940 gene locus_tag LOCUS_31470 12090 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 12864 12523 gene locus_tag LOCUS_31480 12864 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 >Feature sequence172 <1 736 gene locus_tag LOCUS_31490 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DG65:DNA helicase 1787 1398 gene locus_tag LOCUS_31500 1787 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142480.1 protein_id gnl|my_center|LOCUS_31500 1988 3274 gene locus_tag LOCUS_31510 gene gdhA 1988 3274 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P03 protein_id gnl|my_center|LOCUS_31510 4475 3357 gene locus_tag LOCUS_31520 4475 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 5039 7297 gene locus_tag LOCUS_31530 5039 7297 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RH18 protein_id gnl|my_center|LOCUS_31530 7425 7631 gene locus_tag LOCUS_31540 7425 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 8157 8864 gene locus_tag LOCUS_31550 8157 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 9587 8976 gene locus_tag LOCUS_31560 9587 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932590.1 protein_id gnl|my_center|LOCUS_31560 10795 9608 gene locus_tag LOCUS_31570 10795 9608 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_31570 11734 11057 gene locus_tag LOCUS_31580 11734 11057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 11974 12426 gene locus_tag LOCUS_31590 gene crcB 11974 12426 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHY7 protein_id gnl|my_center|LOCUS_31590 12436 12756 gene locus_tag LOCUS_31600 12436 12756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 >Feature sequence173 949 662 gene locus_tag LOCUS_31610 949 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 1520 1302 gene locus_tag LOCUS_31620 1520 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 1634 1912 gene locus_tag LOCUS_31630 1634 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 2085 2336 gene locus_tag LOCUS_31640 2085 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 2395 2538 gene locus_tag LOCUS_31650 2395 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 2629 2847 gene locus_tag LOCUS_31660 2629 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 3206 3703 gene locus_tag LOCUS_31670 3206 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055990.1 protein_id gnl|my_center|LOCUS_31670 3897 4271 gene locus_tag LOCUS_31680 3897 4271 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_31680 4913 6259 gene locus_tag LOCUS_31690 4913 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 6362 6514 gene locus_tag LOCUS_31700 6362 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 9080 6612 gene locus_tag LOCUS_31710 9080 6612 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_31710 9315 9022 gene locus_tag LOCUS_31720 9315 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 9893 9444 gene locus_tag LOCUS_31730 9893 9444 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391796.1 protein_id gnl|my_center|LOCUS_31730 10138 9896 gene locus_tag LOCUS_31740 10138 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 11676 10135 gene locus_tag LOCUS_31750 11676 10135 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_31750 11940 11859 gene locus_tag LOCUS_t00210 11940 11859 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <13037 12057 gene locus_tag LOCUS_31760 <13037 12057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGI5:carbamoyl-phosphate synthase (glutamine-hydrolyzing) >Feature sequence174 477 944 gene locus_tag LOCUS_31770 gene smpB 477 944 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM0 protein_id gnl|my_center|LOCUS_31770 1350 2021 gene locus_tag LOCUS_31780 1350 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 2174 3217 gene locus_tag LOCUS_31790 2174 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 4364 3522 gene locus_tag LOCUS_31800 gene potB 4364 3522 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_31800 4576 5244 gene locus_tag LOCUS_31810 4576 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 5799 5260 gene locus_tag LOCUS_31820 5799 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 6251 6027 gene locus_tag LOCUS_31830 6251 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 6250 7341 gene locus_tag LOCUS_31840 gene pilM 6250 7341 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058174.1 protein_id gnl|my_center|LOCUS_31840 7503 8324 gene locus_tag LOCUS_31850 7503 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058175.1 protein_id gnl|my_center|LOCUS_31850 8324 9133 gene locus_tag LOCUS_31860 8324 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 10633 10415 gene locus_tag LOCUS_31870 10633 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 10814 11311 gene locus_tag LOCUS_31880 10814 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 <12934 11578 gene locus_tag LOCUS_31890 <12934 11578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140079.1:nuclease >Feature sequence175 1274 222 gene locus_tag LOCUS_31900 gene fni 1274 222 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ26 protein_id gnl|my_center|LOCUS_31900 1945 1343 gene locus_tag LOCUS_31910 1945 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 5116 2093 gene locus_tag LOCUS_31920 5116 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 10363 5285 gene locus_tag LOCUS_31930 10363 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 10555 11019 gene locus_tag LOCUS_31940 10555 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 11268 11609 gene locus_tag LOCUS_31950 11268 11609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence176 1199 414 gene locus_tag LOCUS_31960 1199 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 6960 1282 gene locus_tag LOCUS_31970 6960 1282 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_31970 8695 7571 gene locus_tag LOCUS_31980 8695 7571 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_31980 9685 8861 gene locus_tag LOCUS_31990 9685 8861 CDS product N-acylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_31990 9848 9660 gene locus_tag LOCUS_32000 9848 9660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 9928 11199 gene locus_tag LOCUS_32010 9928 11199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 11257 11808 gene locus_tag LOCUS_32020 11257 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 11920 12261 gene locus_tag LOCUS_32030 11920 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 <12921 12399 gene locus_tag LOCUS_32040 <12921 12399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P07788:spore coat protein A >Feature sequence177 241 492 gene locus_tag LOCUS_32050 241 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 873 2195 gene locus_tag LOCUS_32060 873 2195 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_32060 2323 3489 gene locus_tag LOCUS_32070 2323 3489 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056963.1 protein_id gnl|my_center|LOCUS_32070 3486 4628 gene locus_tag LOCUS_32080 3486 4628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_32080 4631 5773 gene locus_tag LOCUS_32090 4631 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 5770 6522 gene locus_tag LOCUS_32100 5770 6522 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_32100 7119 6511 gene locus_tag LOCUS_32110 7119 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 7228 7046 gene locus_tag LOCUS_32120 7228 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 7879 7436 gene locus_tag LOCUS_32130 7879 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142477.1 protein_id gnl|my_center|LOCUS_32130 8402 7923 gene locus_tag LOCUS_32140 8402 7923 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_32140 8512 9369 gene locus_tag LOCUS_32150 8512 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 9403 9897 gene locus_tag LOCUS_32160 9403 9897 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSK0 protein_id gnl|my_center|LOCUS_32160 10079 10381 gene locus_tag LOCUS_32170 10079 10381 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057702.1 protein_id gnl|my_center|LOCUS_32170 10409 10705 gene locus_tag LOCUS_32180 10409 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057701.1 protein_id gnl|my_center|LOCUS_32180 10785 12065 gene locus_tag LOCUS_32190 gene hisS 10785 12065 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHP7 protein_id gnl|my_center|LOCUS_32190 >Feature sequence178 3653 2304 gene locus_tag LOCUS_32200 3653 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056607.1 protein_id gnl|my_center|LOCUS_32200 4012 3650 gene locus_tag LOCUS_32210 4012 3650 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 protein_id gnl|my_center|LOCUS_32210 4565 4260 gene locus_tag LOCUS_32220 4565 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125696.1 protein_id gnl|my_center|LOCUS_32220 4762 6126 gene locus_tag LOCUS_32230 4762 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_32230 6402 8147 gene locus_tag LOCUS_32240 6402 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057930.1 protein_id gnl|my_center|LOCUS_32240 8767 9768 gene locus_tag LOCUS_32250 gene sigB 8767 9768 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056675.1 protein_id gnl|my_center|LOCUS_32250 >Feature sequence179 34 283 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccctagcttcttctttgaagctgaattaatggaaac 438 1010 gene locus_tag LOCUS_32260 438 1010 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228408.1 protein_id gnl|my_center|LOCUS_32260 1018 1563 gene locus_tag LOCUS_32270 1018 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 1782 1979 gene locus_tag LOCUS_32280 1782 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 1986 2471 gene locus_tag LOCUS_32290 1986 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 2842 4194 gene locus_tag LOCUS_32300 2842 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 5717 4170 gene locus_tag LOCUS_32310 5717 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 7627 5750 gene locus_tag LOCUS_32320 7627 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 8168 7620 gene locus_tag LOCUS_32330 8168 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 9155 8304 gene locus_tag LOCUS_32340 9155 8304 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082339.1 protein_id gnl|my_center|LOCUS_32340 10342 9152 gene locus_tag LOCUS_32350 10342 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 <12834 10342 gene locus_tag LOCUS_32360 <12834 10342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865405.1:type III-B CRISPR-associated protein Cas10/Cmr2 >Feature sequence180 2203 1862 gene locus_tag LOCUS_32370 2203 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 3286 2525 gene locus_tag LOCUS_32380 3286 2525 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058197.1 protein_id gnl|my_center|LOCUS_32380 3614 3856 gene locus_tag LOCUS_32390 3614 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 4351 4932 gene locus_tag LOCUS_32400 4351 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 5929 5297 gene locus_tag LOCUS_32410 5929 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 6823 6515 gene locus_tag LOCUS_32420 6823 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 7159 8301 gene locus_tag LOCUS_32430 7159 8301 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32430 10416 8626 gene locus_tag LOCUS_32440 10416 8626 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_32440 10706 12058 gene locus_tag LOCUS_32450 gene accC 10706 12058 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_32450 >Feature sequence181 317 1078 gene locus_tag LOCUS_32460 317 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 1356 1772 gene locus_tag LOCUS_32470 1356 1772 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971227.1 protein_id gnl|my_center|LOCUS_32470 1783 3228 gene locus_tag LOCUS_32480 1783 3228 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858205.1 protein_id gnl|my_center|LOCUS_32480 3279 3569 gene locus_tag LOCUS_32490 3279 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 3596 4129 gene locus_tag LOCUS_32500 gene copG 3596 4129 CDS product copper amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261477.1 protein_id gnl|my_center|LOCUS_32500 4132 6375 gene locus_tag LOCUS_32510 4132 6375 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_32510 6335 6613 gene locus_tag LOCUS_32520 6335 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 7939 6968 gene locus_tag LOCUS_32530 7939 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 8402 9787 gene locus_tag LOCUS_32540 8402 9787 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_32540 >Feature sequence182 65 673 gene locus_tag LOCUS_32550 gene ndhI 65 673 CDS product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL31 protein_id gnl|my_center|LOCUS_32550 759 1382 gene locus_tag LOCUS_32560 gene ndhG 759 1382 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 protein_id gnl|my_center|LOCUS_32560 1401 1712 gene locus_tag LOCUS_32570 gene ndhE 1401 1712 CDS product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL29 protein_id gnl|my_center|LOCUS_32570 2193 4334 gene locus_tag LOCUS_32580 2193 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056792.1 protein_id gnl|my_center|LOCUS_32580 5352 4396 gene locus_tag LOCUS_32590 5352 4396 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119887.1 protein_id gnl|my_center|LOCUS_32590 5845 7083 gene locus_tag LOCUS_32600 gene wcaA 5845 7083 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124879.1 protein_id gnl|my_center|LOCUS_32600 7616 8479 gene locus_tag LOCUS_32610 7616 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_32610 >Feature sequence183 1599 3365 gene locus_tag LOCUS_32620 1599 3365 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP1 protein_id gnl|my_center|LOCUS_32620 3509 4405 gene locus_tag LOCUS_32630 3509 4405 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228102.1 protein_id gnl|my_center|LOCUS_32630 4459 5340 gene locus_tag LOCUS_32640 4459 5340 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_32640 5517 5729 gene locus_tag LOCUS_32650 5517 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 6294 5794 gene locus_tag LOCUS_32660 6294 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057148.1 protein_id gnl|my_center|LOCUS_32660 7305 6418 gene locus_tag LOCUS_32670 gene miaA 7305 6418 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM5 protein_id gnl|my_center|LOCUS_32670 7501 9438 gene locus_tag LOCUS_32680 gene gyrB 7501 9438 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL50 protein_id gnl|my_center|LOCUS_32680 9643 10392 gene locus_tag LOCUS_32690 9643 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_32690 >Feature sequence184 2373 1756 gene locus_tag LOCUS_32700 2373 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 2972 4426 gene locus_tag LOCUS_32710 2972 4426 CDS product neopullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143635.1 protein_id gnl|my_center|LOCUS_32710 5563 4703 gene locus_tag LOCUS_32720 5563 4703 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 protein_id gnl|my_center|LOCUS_32720 7007 6000 gene locus_tag LOCUS_32730 7007 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 7235 8335 gene locus_tag LOCUS_32740 7235 8335 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_32740 8416 9552 gene locus_tag LOCUS_32750 8416 9552 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_32750 12128 9564 gene locus_tag LOCUS_32760 12128 9564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence185 645 325 gene locus_tag LOCUS_32770 645 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 2370 1306 gene locus_tag LOCUS_32780 2370 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_32780 2572 2393 gene locus_tag LOCUS_32790 2572 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 2823 5492 gene locus_tag LOCUS_32800 2823 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 7734 5587 gene locus_tag LOCUS_32810 7734 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 10817 7977 gene locus_tag LOCUS_32820 10817 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 11805 12026 gene locus_tag LOCUS_32830 11805 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 12064 12396 gene locus_tag LOCUS_32840 12064 12396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 >Feature sequence186 295 558 gene locus_tag LOCUS_32850 295 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 621 1484 gene locus_tag LOCUS_32860 621 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 1920 2255 gene locus_tag LOCUS_32870 1920 2255 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057655.1 protein_id gnl|my_center|LOCUS_32870 2252 3688 gene locus_tag LOCUS_32880 gene ndhD5 2252 3688 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057654.1 protein_id gnl|my_center|LOCUS_32880 3853 5307 gene locus_tag LOCUS_32890 gene ndhD5 3853 5307 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057654.1 protein_id gnl|my_center|LOCUS_32890 5280 5693 gene locus_tag LOCUS_32900 5280 5693 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057653.1 protein_id gnl|my_center|LOCUS_32900 5695 5994 gene locus_tag LOCUS_32910 5695 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 protein_id gnl|my_center|LOCUS_32910 5991 6278 gene locus_tag LOCUS_32920 5991 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057651.1 protein_id gnl|my_center|LOCUS_32920 6367 6927 gene locus_tag LOCUS_32930 6367 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057650.1 protein_id gnl|my_center|LOCUS_32930 6927 7589 gene locus_tag LOCUS_32940 6927 7589 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 protein_id gnl|my_center|LOCUS_32940 8212 8898 gene locus_tag LOCUS_32950 8212 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 <12510 9355 gene locus_tag LOCUS_32960 <12510 9355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331491.1:hemolysin-type calcium-binding protein >Feature sequence187 178 867 gene locus_tag LOCUS_32970 178 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 1323 862 gene locus_tag LOCUS_32980 1323 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32980 1831 1277 gene locus_tag LOCUS_32990 1831 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32990 2199 2014 gene locus_tag LOCUS_33000 2199 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141741.1 protein_id gnl|my_center|LOCUS_33000 3108 5303 gene locus_tag LOCUS_33010 3108 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 5556 5954 gene locus_tag LOCUS_33020 5556 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 6125 6601 gene locus_tag LOCUS_33030 6125 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057567.1 protein_id gnl|my_center|LOCUS_33030 6718 8757 gene locus_tag LOCUS_33040 6718 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056794.1 protein_id gnl|my_center|LOCUS_33040 10280 8901 gene locus_tag LOCUS_33050 10280 8901 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 protein_id gnl|my_center|LOCUS_33050 11890 10427 gene locus_tag LOCUS_33060 11890 10427 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057178.1 protein_id gnl|my_center|LOCUS_33060 >Feature sequence188 1001 120 gene locus_tag LOCUS_33070 1001 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022329.1 protein_id gnl|my_center|LOCUS_33070 1668 1027 gene locus_tag LOCUS_33080 1668 1027 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056166.1 protein_id gnl|my_center|LOCUS_33080 2389 1808 gene locus_tag LOCUS_33090 2389 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141116.1 protein_id gnl|my_center|LOCUS_33090 3396 2665 gene locus_tag LOCUS_33100 3396 2665 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140670.1 protein_id gnl|my_center|LOCUS_33100 3519 4832 gene locus_tag LOCUS_33110 3519 4832 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057883.1 protein_id gnl|my_center|LOCUS_33110 4836 5402 gene locus_tag LOCUS_33120 4836 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_33120 6371 5418 gene locus_tag LOCUS_33130 6371 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 8312 6474 gene locus_tag LOCUS_33140 8312 6474 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057611.1 protein_id gnl|my_center|LOCUS_33140 8462 9829 gene locus_tag LOCUS_33150 8462 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 10138 9848 gene locus_tag LOCUS_33160 10138 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 10537 10292 gene locus_tag LOCUS_33170 10537 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 >Feature sequence189 343 489 gene locus_tag LOCUS_33180 343 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 5224 716 gene locus_tag LOCUS_33190 5224 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 5572 6132 gene locus_tag LOCUS_33200 5572 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 6557 10804 gene locus_tag LOCUS_33210 6557 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 11503 10823 gene locus_tag LOCUS_33220 gene trmH 11503 10823 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_33220 >Feature sequence190 611 1318 gene locus_tag LOCUS_33230 611 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057176.1 protein_id gnl|my_center|LOCUS_33230 1640 2572 gene locus_tag LOCUS_33240 1640 2572 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_33240 4101 2686 gene locus_tag LOCUS_33250 4101 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 4329 5657 gene locus_tag LOCUS_33260 4329 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056681.1 protein_id gnl|my_center|LOCUS_33260 5776 6099 gene locus_tag LOCUS_33270 5776 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143090.1 protein_id gnl|my_center|LOCUS_33270 6179 7345 gene locus_tag LOCUS_33280 gene dnaN 6179 7345 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG8 protein_id gnl|my_center|LOCUS_33280 8036 7428 gene locus_tag LOCUS_33290 gene rpsD 8036 7428 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59134 protein_id gnl|my_center|LOCUS_33290 8890 8240 gene locus_tag LOCUS_33300 8890 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 11059 9566 gene locus_tag LOCUS_33310 gene murE 11059 9566 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJI4 protein_id gnl|my_center|LOCUS_33310 11430 11155 gene locus_tag LOCUS_33320 11430 11155 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 protein_id gnl|my_center|LOCUS_33320 >Feature sequence191 491 2041 gene locus_tag LOCUS_33330 491 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 2139 3395 gene locus_tag LOCUS_33340 gene pimB 2139 3395 CDS product GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R043 protein_id gnl|my_center|LOCUS_33340 3392 4585 gene locus_tag LOCUS_33350 3392 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 5198 4644 gene locus_tag LOCUS_33360 5198 4644 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056062.1 protein_id gnl|my_center|LOCUS_33360 5421 6323 gene locus_tag LOCUS_33370 5421 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142149.1 protein_id gnl|my_center|LOCUS_33370 6320 6733 gene locus_tag LOCUS_33380 6320 6733 CDS product TIGR02588 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142148.1 protein_id gnl|my_center|LOCUS_33380 6789 7013 gene locus_tag LOCUS_33390 6789 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 7300 6914 gene locus_tag LOCUS_33400 7300 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 7484 7305 gene locus_tag LOCUS_33410 7484 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 7887 7546 gene locus_tag LOCUS_33420 7887 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057677.1 protein_id gnl|my_center|LOCUS_33420 8846 7905 gene locus_tag LOCUS_33430 gene ispE 8846 7905 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ1 protein_id gnl|my_center|LOCUS_33430 9682 8852 gene locus_tag LOCUS_33440 gene rsmA 9682 8852 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59157 protein_id gnl|my_center|LOCUS_33440 9776 10441 gene locus_tag LOCUS_33450 9776 10441 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876386.1 protein_id gnl|my_center|LOCUS_33450 10464 11147 gene locus_tag LOCUS_33460 10464 11147 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_33460 11239 11391 gene locus_tag LOCUS_33470 11239 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 11511 12209 gene locus_tag LOCUS_33480 11511 12209 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873009.1 protein_id gnl|my_center|LOCUS_33480 >Feature sequence192 439 816 gene locus_tag LOCUS_33490 439 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 1730 927 gene locus_tag LOCUS_33500 1730 927 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_33500 2198 2806 gene locus_tag LOCUS_33510 2198 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 2803 3579 gene locus_tag LOCUS_33520 2803 3579 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945815.1 protein_id gnl|my_center|LOCUS_33520 3619 4347 gene locus_tag LOCUS_33530 3619 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 4692 4408 gene locus_tag LOCUS_33540 4692 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 5941 4979 gene locus_tag LOCUS_33550 gene cdd 5941 4979 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSM5 protein_id gnl|my_center|LOCUS_33550 6969 6082 gene locus_tag LOCUS_33560 6969 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 10738 7016 gene locus_tag LOCUS_33570 10738 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 11347 10940 gene locus_tag LOCUS_33580 11347 10940 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703865.1 protein_id gnl|my_center|LOCUS_33580 11490 11708 gene locus_tag LOCUS_33590 11490 11708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence193 5255 3831 gene locus_tag LOCUS_33600 gene icd 5255 3831 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9S5 protein_id gnl|my_center|LOCUS_33600 6182 8248 gene locus_tag LOCUS_33610 gene ndhF 6182 8248 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124327.1 protein_id gnl|my_center|LOCUS_33610 8939 8385 gene locus_tag LOCUS_33620 8939 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_33620 10550 9000 gene locus_tag LOCUS_33630 10550 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 >Feature sequence194 996 118 gene locus_tag LOCUS_33640 996 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 1423 1007 gene locus_tag LOCUS_33650 1423 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 2300 1671 gene locus_tag LOCUS_33660 gene cpcF 2300 1671 CDS product phycocyanobilin lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50038 protein_id gnl|my_center|LOCUS_33660 2312 2530 gene locus_tag LOCUS_33670 2312 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 3227 2616 gene locus_tag LOCUS_33680 3227 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 4400 3570 gene locus_tag LOCUS_33690 gene cpcE 4400 3570 CDS product phycocyanobilin lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50037 protein_id gnl|my_center|LOCUS_33690 4750 4451 gene locus_tag LOCUS_33700 gene cpcD 4750 4451 CDS product phycobilisome 8.9 kDa linker polypeptide, phycocyanin-associated, rod inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50035 protein_id gnl|my_center|LOCUS_33700 5715 4867 gene locus_tag LOCUS_33710 gene cpcC 5715 4867 CDS product phycobilisome 32.1 kDa linker polypeptide, phycocyanin-associated, rod inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50034 protein_id gnl|my_center|LOCUS_33710 6393 5905 gene locus_tag LOCUS_33720 gene cpcA 6393 5905 CDS product C-phycocyanin alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50032 protein_id gnl|my_center|LOCUS_33720 7024 6506 gene locus_tag LOCUS_33730 gene cpcB 7024 6506 CDS product C-phycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50033 protein_id gnl|my_center|LOCUS_33730 8767 7400 gene locus_tag LOCUS_33740 gene murD 8767 7400 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN8 protein_id gnl|my_center|LOCUS_33740 9518 9060 gene locus_tag LOCUS_33750 9518 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 9941 9621 gene locus_tag LOCUS_33760 9941 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 9996 10202 gene locus_tag LOCUS_33770 9996 10202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 10344 10553 gene locus_tag LOCUS_33780 10344 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 10686 11843 gene locus_tag LOCUS_33790 10686 11843 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence195 1056 166 gene locus_tag LOCUS_33800 1056 166 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227777.1 protein_id gnl|my_center|LOCUS_33800 947 1150 gene locus_tag LOCUS_33810 947 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 1147 1944 gene locus_tag LOCUS_33820 1147 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 3511 2189 gene locus_tag LOCUS_33830 3511 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 3621 5009 gene locus_tag LOCUS_33840 gene sun 3621 5009 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB2 protein_id gnl|my_center|LOCUS_33840 5146 5382 gene locus_tag LOCUS_33850 5146 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 5633 8386 gene locus_tag LOCUS_33860 5633 8386 CDS product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056370.1 protein_id gnl|my_center|LOCUS_33860 9930 8785 gene locus_tag LOCUS_33870 9930 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 10263 10093 gene locus_tag LOCUS_33880 10263 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057753.1 protein_id gnl|my_center|LOCUS_33880 11573 10398 gene locus_tag LOCUS_33890 11573 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 12066 11845 gene locus_tag LOCUS_33900 12066 11845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 >Feature sequence196 1765 1388 gene locus_tag LOCUS_33910 1765 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 4382 1806 gene locus_tag LOCUS_33920 gene gyrA 4382 1806 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ59 protein_id gnl|my_center|LOCUS_33920 4576 5511 gene locus_tag LOCUS_33930 4576 5511 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 protein_id gnl|my_center|LOCUS_33930 5723 6718 gene locus_tag LOCUS_33940 5723 6718 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941435.1 protein_id gnl|my_center|LOCUS_33940 7473 6715 gene locus_tag LOCUS_33950 7473 6715 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 protein_id gnl|my_center|LOCUS_33950 8703 7486 gene locus_tag LOCUS_33960 8703 7486 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_33960 10361 8700 gene locus_tag LOCUS_33970 10361 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140350.1 protein_id gnl|my_center|LOCUS_33970 >Feature sequence197 944 1216 gene locus_tag LOCUS_33980 944 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 2140 1325 gene locus_tag LOCUS_33990 gene proC 2140 1325 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMR1 protein_id gnl|my_center|LOCUS_33990 3076 2435 gene locus_tag LOCUS_34000 3076 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 3961 9090 gene locus_tag LOCUS_34010 3961 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 10133 9381 gene locus_tag LOCUS_34020 10133 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 11699 10419 gene locus_tag LOCUS_34030 11699 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 >Feature sequence198 1342 953 gene locus_tag LOCUS_34040 1342 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 1493 4957 gene locus_tag LOCUS_34050 1493 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 5742 7040 gene locus_tag LOCUS_34060 5742 7040 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056868.1 protein_id gnl|my_center|LOCUS_34060 7099 7461 gene locus_tag LOCUS_34070 7099 7461 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_34070 7466 8044 gene locus_tag LOCUS_34080 7466 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 >Feature sequence199 1799 600 gene locus_tag LOCUS_34090 1799 600 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 protein_id gnl|my_center|LOCUS_34090 3047 2067 gene locus_tag LOCUS_34100 3047 2067 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_34100 3712 3089 gene locus_tag LOCUS_34110 3712 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142458.1 protein_id gnl|my_center|LOCUS_34110 5122 3722 gene locus_tag LOCUS_34120 5122 3722 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141482.1 protein_id gnl|my_center|LOCUS_34120 5453 6058 gene locus_tag LOCUS_34130 5453 6058 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_34130 6108 6656 gene locus_tag LOCUS_34140 6108 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 7708 6674 gene locus_tag LOCUS_34150 7708 6674 CDS product 3-chlorobenzoate-3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141920.1 protein_id gnl|my_center|LOCUS_34150 9647 7734 gene locus_tag LOCUS_34160 9647 7734 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141921.1 protein_id gnl|my_center|LOCUS_34160 11539 9854 gene locus_tag LOCUS_34170 11539 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 11580 11900 gene locus_tag LOCUS_34180 11580 11900 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_34180 >Feature sequence200 497 132 gene locus_tag LOCUS_34190 497 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 2449 983 gene locus_tag LOCUS_34200 gene cry 2449 983 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_34200 2984 2517 gene locus_tag LOCUS_34210 2984 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 4634 3060 gene locus_tag LOCUS_34220 4634 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_34220 5385 4750 gene locus_tag LOCUS_34230 5385 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 5672 5744 gene locus_tag LOCUS_t00220 5672 5744 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5904 7277 gene locus_tag LOCUS_34240 gene pcxA 5904 7277 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59112 protein_id gnl|my_center|LOCUS_34240 7896 7300 gene locus_tag LOCUS_34250 7896 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939177.1 protein_id gnl|my_center|LOCUS_34250 8917 7979 gene locus_tag LOCUS_34260 8917 7979 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 protein_id gnl|my_center|LOCUS_34260 9869 9048 gene locus_tag LOCUS_34270 9869 9048 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090538.1 protein_id gnl|my_center|LOCUS_34270 10948 9944 gene locus_tag LOCUS_34280 10948 9944 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533363.1 protein_id gnl|my_center|LOCUS_34280 11212 11730 gene locus_tag LOCUS_34290 11212 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 >Feature sequence201 1569 412 gene locus_tag LOCUS_34300 1569 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 protein_id gnl|my_center|LOCUS_34300 3014 1644 gene locus_tag LOCUS_34310 3014 1644 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_34310 4117 3191 gene locus_tag LOCUS_34320 gene rfbB 4117 3191 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 protein_id gnl|my_center|LOCUS_34320 6533 4719 gene locus_tag LOCUS_34330 gene lepA 6533 4719 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM20 protein_id gnl|my_center|LOCUS_34330 7066 6740 gene locus_tag LOCUS_34340 7066 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057879.1 protein_id gnl|my_center|LOCUS_34340 7950 7306 gene locus_tag LOCUS_34350 gene hisG 7950 7306 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD9 protein_id gnl|my_center|LOCUS_34350 8050 8712 gene locus_tag LOCUS_34360 8050 8712 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143439.1 protein_id gnl|my_center|LOCUS_34360 8742 9422 gene locus_tag LOCUS_34370 8742 9422 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_34370 10801 9464 gene locus_tag LOCUS_34380 10801 9464 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_34380 11410 10850 gene locus_tag LOCUS_34390 11410 10850 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_34390 >Feature sequence202 828 2243 gene locus_tag LOCUS_34400 828 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 3942 2395 gene locus_tag LOCUS_34410 gene purH 3942 2395 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN5 protein_id gnl|my_center|LOCUS_34410 4183 4434 gene locus_tag LOCUS_34420 4183 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 5407 4535 gene locus_tag LOCUS_34430 5407 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141513.1 protein_id gnl|my_center|LOCUS_34430 6045 5446 gene locus_tag LOCUS_34440 6045 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141514.1 protein_id gnl|my_center|LOCUS_34440 6174 7598 gene locus_tag LOCUS_34450 6174 7598 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057361.1 protein_id gnl|my_center|LOCUS_34450 8077 7595 gene locus_tag LOCUS_34460 8077 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_34460 8449 8937 gene locus_tag LOCUS_34470 8449 8937 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210231.1 protein_id gnl|my_center|LOCUS_34470 >Feature sequence203 <1 724 gene locus_tag LOCUS_34480 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DI00:acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase 721 1896 gene locus_tag LOCUS_34490 gene lpxB 721 1896 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056176.1 protein_id gnl|my_center|LOCUS_34490 1907 2476 gene locus_tag LOCUS_34500 1907 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_34500 2564 3154 gene locus_tag LOCUS_34510 2564 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_34510 3269 4144 gene locus_tag LOCUS_34520 3269 4144 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141460.1 protein_id gnl|my_center|LOCUS_34520 4606 7149 gene locus_tag LOCUS_34530 4606 7149 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLX1 protein_id gnl|my_center|LOCUS_34530 7743 7300 gene locus_tag LOCUS_34540 7743 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 8317 7859 gene locus_tag LOCUS_34550 8317 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 9081 9776 gene locus_tag LOCUS_34560 gene fabG 9081 9776 CDS product 3-oxoacyl-(ACP) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144338.1 protein_id gnl|my_center|LOCUS_34560 11532 9856 gene locus_tag LOCUS_34570 11532 9856 CDS product preprotein translocase subunit Tim44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_34570 >Feature sequence204 585 2222 gene locus_tag LOCUS_34580 585 2222 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056296.1 protein_id gnl|my_center|LOCUS_34580 5520 2356 gene locus_tag LOCUS_34590 5520 2356 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 protein_id gnl|my_center|LOCUS_34590 5883 8042 gene locus_tag LOCUS_34600 gene pnp 5883 8042 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW9 protein_id gnl|my_center|LOCUS_34600 9442 8258 gene locus_tag LOCUS_34610 9442 8258 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056455.1 protein_id gnl|my_center|LOCUS_34610 11061 9526 gene locus_tag LOCUS_34620 11061 9526 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020815.1 protein_id gnl|my_center|LOCUS_34620 <11804 11226 gene locus_tag LOCUS_34630 <11804 11226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJF2:ribose-5-phosphate isomerase A >Feature sequence205 1290 1964 gene locus_tag LOCUS_34640 1290 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 2366 1968 gene locus_tag LOCUS_34650 2366 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876854.1 protein_id gnl|my_center|LOCUS_34650 2428 3498 gene locus_tag LOCUS_34660 2428 3498 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405523.1 protein_id gnl|my_center|LOCUS_34660 3510 5219 gene locus_tag LOCUS_34670 3510 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 7535 5421 gene locus_tag LOCUS_34680 7535 5421 CDS product UDP-glucose-beta-D-glucan glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057632.1 protein_id gnl|my_center|LOCUS_34680 9846 7975 gene locus_tag LOCUS_34690 9846 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 10604 9948 gene locus_tag LOCUS_34700 10604 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 10733 11311 gene locus_tag LOCUS_34710 10733 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056251.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence206 1358 354 gene locus_tag LOCUS_34720 1358 354 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142814.1 protein_id gnl|my_center|LOCUS_34720 1768 1391 gene locus_tag LOCUS_34730 1768 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057511.1 protein_id gnl|my_center|LOCUS_34730 2971 1823 gene locus_tag LOCUS_34740 2971 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 3187 3738 gene locus_tag LOCUS_34750 3187 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 protein_id gnl|my_center|LOCUS_34750 5768 4173 gene locus_tag LOCUS_34760 gene leuA 5768 4173 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ32 protein_id gnl|my_center|LOCUS_34760 6458 5937 gene locus_tag LOCUS_34770 6458 5937 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 protein_id gnl|my_center|LOCUS_34770 7734 7084 gene locus_tag LOCUS_34780 7734 7084 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 protein_id gnl|my_center|LOCUS_34780 8515 8078 gene locus_tag LOCUS_34790 8515 8078 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056015.1 protein_id gnl|my_center|LOCUS_34790 8765 9076 gene locus_tag LOCUS_34800 gene groS 8765 9076 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TV92 protein_id gnl|my_center|LOCUS_34800 9184 10815 gene locus_tag LOCUS_34810 gene groL 9184 10815 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD4 protein_id gnl|my_center|LOCUS_34810 >Feature sequence207 1781 765 gene locus_tag LOCUS_34820 1781 765 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG6 protein_id gnl|my_center|LOCUS_34820 3040 1937 gene locus_tag LOCUS_34830 3040 1937 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_34830 3936 3259 gene locus_tag LOCUS_34840 3936 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 4303 5394 gene locus_tag LOCUS_34850 gene ychF 4303 5394 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ8 protein_id gnl|my_center|LOCUS_34850 5428 5640 gene locus_tag LOCUS_34860 5428 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34860 5598 5834 gene locus_tag LOCUS_34870 5598 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34870 6986 5946 gene locus_tag LOCUS_34880 6986 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 7399 7710 gene locus_tag LOCUS_34890 7399 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 8707 7874 gene locus_tag LOCUS_34900 gene menB 8707 7874 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG66 protein_id gnl|my_center|LOCUS_34900 9803 8778 gene locus_tag LOCUS_34910 gene purM 9803 8778 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY2 protein_id gnl|my_center|LOCUS_34910 10249 11259 gene locus_tag LOCUS_34920 10249 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 >Feature sequence208 <1 1645 gene locus_tag LOCUS_34930 <1 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:peptide transporter 1927 3657 gene locus_tag LOCUS_34940 1927 3657 CDS product diflavin flavoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141773.1 protein_id gnl|my_center|LOCUS_34940 3884 4519 gene locus_tag LOCUS_34950 3884 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 4554 6284 gene locus_tag LOCUS_34960 4554 6284 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141774.1 protein_id gnl|my_center|LOCUS_34960 >Feature sequence209 562 134 gene locus_tag LOCUS_34970 562 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 1059 757 gene locus_tag LOCUS_34980 1059 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 1808 1320 gene locus_tag LOCUS_34990 1808 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 2079 2390 gene locus_tag LOCUS_35000 2079 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 2408 2800 gene locus_tag LOCUS_35010 2408 2800 CDS product IS1 transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402895.1 protein_id gnl|my_center|LOCUS_35010 4487 3561 gene locus_tag LOCUS_35020 4487 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 4833 4507 gene locus_tag LOCUS_35030 4833 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 5094 5666 gene locus_tag LOCUS_35040 5094 5666 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142113.1 protein_id gnl|my_center|LOCUS_35040 5963 7060 gene locus_tag LOCUS_35050 5963 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 7109 8551 gene locus_tag LOCUS_35060 7109 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 9258 8722 gene locus_tag LOCUS_35070 9258 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 10148 9378 gene locus_tag LOCUS_35080 10148 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 >Feature sequence210 861 2078 gene locus_tag LOCUS_35090 861 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056550.1 protein_id gnl|my_center|LOCUS_35090 4482 2266 gene locus_tag LOCUS_35100 4482 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 4892 5308 gene locus_tag LOCUS_35110 4892 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 6638 5418 gene locus_tag LOCUS_35120 6638 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 7137 7358 gene locus_tag LOCUS_35130 7137 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 8759 7632 gene locus_tag LOCUS_35140 8759 7632 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056246.1 protein_id gnl|my_center|LOCUS_35140 8895 9842 gene locus_tag LOCUS_35150 gene rnz 8895 9842 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKE4 protein_id gnl|my_center|LOCUS_35150 10579 10803 gene locus_tag LOCUS_35160 10579 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 >Feature sequence211 1082 258 gene locus_tag LOCUS_35170 1082 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141258.1 protein_id gnl|my_center|LOCUS_35170 1140 1748 gene locus_tag LOCUS_35180 gene cpcS 1140 1748 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL67 protein_id gnl|my_center|LOCUS_35180 2102 1797 gene locus_tag LOCUS_35190 gene cpeR 2102 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141186.1 protein_id gnl|my_center|LOCUS_35190 2695 2105 gene locus_tag LOCUS_35200 gene cpcT3 2695 2105 CDS product chromophore lyase CpcT/CpeT 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD3 protein_id gnl|my_center|LOCUS_35200 3255 2722 gene locus_tag LOCUS_35210 gene cpeS 3255 2722 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD4 protein_id gnl|my_center|LOCUS_35210 4179 3415 gene locus_tag LOCUS_35220 gene cpeE 4179 3415 CDS product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141265.1 protein_id gnl|my_center|LOCUS_35220 5138 4371 gene locus_tag LOCUS_35230 gene cpeD 5138 4371 CDS product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141264.1 protein_id gnl|my_center|LOCUS_35230 6159 5284 gene locus_tag LOCUS_35240 gene cpeC 6159 5284 CDS product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141263.1 protein_id gnl|my_center|LOCUS_35240 6493 6732 gene locus_tag LOCUS_35250 6493 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 6725 7642 gene locus_tag LOCUS_35260 6725 7642 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141255.1 protein_id gnl|my_center|LOCUS_35260 8460 7744 gene locus_tag LOCUS_35270 8460 7744 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_35270 10045 8873 gene locus_tag LOCUS_35280 10045 8873 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_35280 11523 10135 gene locus_tag LOCUS_35290 11523 10135 CDS product devB secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_35290 >Feature sequence212 1205 630 gene locus_tag LOCUS_35300 1205 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 1291 2385 gene locus_tag LOCUS_35310 1291 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 3334 3258 gene locus_tag LOCUS_t00230 3334 3258 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4363 3410 gene locus_tag LOCUS_35320 4363 3410 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056905.1 protein_id gnl|my_center|LOCUS_35320 4878 4360 gene locus_tag LOCUS_35330 gene ycf36 4878 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056906.1 protein_id gnl|my_center|LOCUS_35330 5457 5014 gene locus_tag LOCUS_35340 gene rsfS 5457 5014 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK1 protein_id gnl|my_center|LOCUS_35340 7428 5599 gene locus_tag LOCUS_35350 7428 5599 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_35350 7831 9123 gene locus_tag LOCUS_35360 7831 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 10158 9244 gene locus_tag LOCUS_35370 10158 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 10822 10457 gene locus_tag LOCUS_35380 10822 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 11299 11003 gene locus_tag LOCUS_35390 11299 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35390 >Feature sequence213 1709 381 gene locus_tag LOCUS_35400 1709 381 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL33 protein_id gnl|my_center|LOCUS_35400 2260 1925 gene locus_tag LOCUS_35410 gene rbcS 2260 1925 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057344.1 protein_id gnl|my_center|LOCUS_35410 2717 2307 gene locus_tag LOCUS_35420 gene rbcX 2717 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142154.1 protein_id gnl|my_center|LOCUS_35420 4239 2809 gene locus_tag LOCUS_35430 gene cbbL 4239 2809 CDS product ribulose bisphosphate carboxylase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS5 protein_id gnl|my_center|LOCUS_35430 6152 4986 gene locus_tag LOCUS_35440 gene aspC 6152 4986 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG0 protein_id gnl|my_center|LOCUS_35440 6577 9192 gene locus_tag LOCUS_35450 6577 9192 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_35450 9501 10973 gene locus_tag LOCUS_35460 gene crtQ 9501 10973 CDS product Zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY9 protein_id gnl|my_center|LOCUS_35460 10997 11446 gene locus_tag LOCUS_35470 10997 11446 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 protein_id gnl|my_center|LOCUS_35470 >Feature sequence214 230 910 gene locus_tag LOCUS_35480 230 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35480 944 1306 gene locus_tag LOCUS_35490 944 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 1451 1933 gene locus_tag LOCUS_35500 1451 1933 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125105.1 protein_id gnl|my_center|LOCUS_35500 1950 2369 gene locus_tag LOCUS_35510 1950 2369 CDS product phenylpyruvate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125356.1 protein_id gnl|my_center|LOCUS_35510 2506 3348 gene locus_tag LOCUS_35520 2506 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 3932 3345 gene locus_tag LOCUS_35530 gene ribH 3932 3345 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP4 protein_id gnl|my_center|LOCUS_35530 4544 4353 gene locus_tag LOCUS_35540 gene psbZ 4544 4353 CDS product photosystem II reaction center protein Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHJ2 protein_id gnl|my_center|LOCUS_35540 5056 5610 gene locus_tag LOCUS_35550 5056 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_35550 5806 5877 gene locus_tag LOCUS_t00240 5806 5877 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6514 5981 gene locus_tag LOCUS_35560 6514 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 9151 6938 gene locus_tag LOCUS_35570 gene katG 9151 6938 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066164.1 protein_id gnl|my_center|LOCUS_35570 9953 9654 gene locus_tag LOCUS_35580 9953 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 10143 10003 gene locus_tag LOCUS_35590 10143 10003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 10276 10539 gene locus_tag LOCUS_35600 10276 10539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074398.1 protein_id gnl|my_center|LOCUS_35600 10571 10792 gene locus_tag LOCUS_35610 10571 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 11339 10917 gene locus_tag LOCUS_35620 11339 10917 CDS product putative toxin-antitoxin system toxin component, PIN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393815.1 protein_id gnl|my_center|LOCUS_35620 >Feature sequence215 521 1120 gene locus_tag LOCUS_35630 521 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 2012 1101 gene locus_tag LOCUS_35640 2012 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 5400 2035 gene locus_tag LOCUS_35650 5400 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 6313 5417 gene locus_tag LOCUS_35660 6313 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 7032 6310 gene locus_tag LOCUS_35670 7032 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 7616 10930 gene locus_tag LOCUS_35680 7616 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 >Feature sequence216 1053 4247 gene locus_tag LOCUS_35690 1053 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 4437 5927 gene locus_tag LOCUS_35700 gene panC/cmk 4437 5927 CDS product bifunctional pantoate ligase/cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG73 protein_id gnl|my_center|LOCUS_35700 8000 5916 gene locus_tag LOCUS_35710 8000 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 8175 9623 gene locus_tag LOCUS_35720 8175 9623 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058184.1 protein_id gnl|my_center|LOCUS_35720 9940 9620 gene locus_tag LOCUS_35730 9940 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 10417 10130 gene locus_tag LOCUS_35740 10417 10130 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125139.1 protein_id gnl|my_center|LOCUS_35740 10837 10418 gene locus_tag LOCUS_35750 10837 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 >Feature sequence217 385 2232 gene locus_tag LOCUS_35760 385 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 3902 2238 gene locus_tag LOCUS_35770 gene radA 3902 2238 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJW7 protein_id gnl|my_center|LOCUS_35770 4039 4560 gene locus_tag LOCUS_35780 4039 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 8657 4602 gene locus_tag LOCUS_35790 8657 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 10511 10888 gene locus_tag LOCUS_35800 10511 10888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 >Feature sequence218 3125 2718 gene locus_tag LOCUS_35810 3125 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 3341 3577 gene locus_tag LOCUS_35820 3341 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 4746 3772 gene locus_tag LOCUS_35830 4746 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 5096 4917 gene locus_tag LOCUS_35840 5096 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 5676 5149 gene locus_tag LOCUS_35850 5676 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 5920 5726 gene locus_tag LOCUS_35860 5920 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 6621 5977 gene locus_tag LOCUS_35870 6621 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 6884 6684 gene locus_tag LOCUS_35880 6884 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 7168 7452 gene locus_tag LOCUS_35890 7168 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 7449 7652 gene locus_tag LOCUS_35900 7449 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 8197 7649 gene locus_tag LOCUS_35910 8197 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 8503 8799 gene locus_tag LOCUS_35920 8503 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 9097 8759 gene locus_tag LOCUS_35930 9097 8759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 9519 9094 gene locus_tag LOCUS_35940 9519 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 10269 9706 gene locus_tag LOCUS_35950 10269 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 >Feature sequence219 979 56 gene locus_tag LOCUS_35960 979 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 1255 2511 gene locus_tag LOCUS_35970 1255 2511 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_35970 2822 4525 gene locus_tag LOCUS_35980 2822 4525 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056162.1 protein_id gnl|my_center|LOCUS_35980 4772 4909 gene locus_tag LOCUS_35990 4772 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 5865 4906 gene locus_tag LOCUS_36000 gene dnaX 5865 4906 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056369.1 protein_id gnl|my_center|LOCUS_36000 6016 7005 gene locus_tag LOCUS_36010 6016 7005 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057358.1 protein_id gnl|my_center|LOCUS_36010 7086 8816 gene locus_tag LOCUS_36020 7086 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 9386 9132 gene locus_tag LOCUS_36030 9386 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence220 1517 744 gene locus_tag LOCUS_36040 1517 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36040 2183 1686 gene locus_tag LOCUS_36050 2183 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 3378 2158 gene locus_tag LOCUS_36060 3378 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 3618 4118 gene locus_tag LOCUS_36070 3618 4118 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142214.1 protein_id gnl|my_center|LOCUS_36070 5041 5346 gene locus_tag LOCUS_36080 5041 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 5484 7076 gene locus_tag LOCUS_36090 5484 7076 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_36090 7375 7100 gene locus_tag LOCUS_36100 7375 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36100 8069 7452 gene locus_tag LOCUS_36110 8069 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36110 8957 8070 gene locus_tag LOCUS_36120 8957 8070 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5M7 protein_id gnl|my_center|LOCUS_36120 9538 9152 gene locus_tag LOCUS_36130 9538 9152 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142884.1 protein_id gnl|my_center|LOCUS_36130 9703 10290 gene locus_tag LOCUS_36140 9703 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056251.1 protein_id gnl|my_center|LOCUS_36140 10469 10780 gene locus_tag LOCUS_36150 10469 10780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 >Feature sequence221 381 923 gene locus_tag LOCUS_36160 381 923 CDS product putative REP-associated tyrosine transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43965 protein_id gnl|my_center|LOCUS_36160 1085 2143 gene locus_tag LOCUS_36170 1085 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 2184 4601 gene locus_tag LOCUS_36180 2184 4601 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140434.1 protein_id gnl|my_center|LOCUS_36180 4619 4843 gene locus_tag LOCUS_36190 4619 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 4888 5478 gene locus_tag LOCUS_36200 4888 5478 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140431.1 protein_id gnl|my_center|LOCUS_36200 5513 7414 gene locus_tag LOCUS_36210 5513 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 7660 7475 gene locus_tag LOCUS_36220 7660 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 7650 8444 gene locus_tag LOCUS_36230 7650 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140429.1 protein_id gnl|my_center|LOCUS_36230 8468 10534 gene locus_tag LOCUS_36240 8468 10534 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140428.1 protein_id gnl|my_center|LOCUS_36240 >Feature sequence222 101 304 gene locus_tag LOCUS_36250 101 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36250 1397 291 gene locus_tag LOCUS_36260 1397 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 2605 1613 gene locus_tag LOCUS_36270 2605 1613 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058242.1 protein_id gnl|my_center|LOCUS_36270 3400 2819 gene locus_tag LOCUS_36280 3400 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143744.1 protein_id gnl|my_center|LOCUS_36280 3869 5047 gene locus_tag LOCUS_36290 3869 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056951.1 protein_id gnl|my_center|LOCUS_36290 5296 5973 gene locus_tag LOCUS_36300 5296 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 6188 6012 gene locus_tag LOCUS_36310 6188 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36310 6479 6300 gene locus_tag LOCUS_36320 6479 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36320 7619 6780 gene locus_tag LOCUS_36330 7619 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 8840 7668 gene locus_tag LOCUS_36340 8840 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 9677 8865 gene locus_tag LOCUS_36350 9677 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 10554 9775 gene locus_tag LOCUS_36360 10554 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 >Feature sequence223 832 1770 gene locus_tag LOCUS_36370 832 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 1848 2927 gene locus_tag LOCUS_36380 gene odh 1848 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891455.1 protein_id gnl|my_center|LOCUS_36380 3476 3021 gene locus_tag LOCUS_36390 3476 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 3598 3858 gene locus_tag LOCUS_36400 3598 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 3941 5179 gene locus_tag LOCUS_36410 3941 5179 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_36410 5907 7610 gene locus_tag LOCUS_36420 5907 7610 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262022.1 protein_id gnl|my_center|LOCUS_36420 8104 7910 gene locus_tag LOCUS_36430 8104 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 8133 9002 gene locus_tag LOCUS_36440 8133 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087510.1 protein_id gnl|my_center|LOCUS_36440 9241 10539 gene locus_tag LOCUS_36450 9241 10539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 >Feature sequence224 445 2817 gene locus_tag LOCUS_36460 445 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 2804 3616 gene locus_tag LOCUS_36470 2804 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 3796 4200 gene locus_tag LOCUS_36480 3796 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057546.1 protein_id gnl|my_center|LOCUS_36480 4205 5473 gene locus_tag LOCUS_36490 gene proA 4205 5473 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ6 protein_id gnl|my_center|LOCUS_36490 5947 5468 gene locus_tag LOCUS_36500 5947 5468 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707090.1 protein_id gnl|my_center|LOCUS_36500 6155 6859 gene locus_tag LOCUS_36510 6155 6859 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057817.1 protein_id gnl|my_center|LOCUS_36510 6883 7086 gene locus_tag LOCUS_36520 6883 7086 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140229.1 protein_id gnl|my_center|LOCUS_36520 8003 7098 gene locus_tag LOCUS_36530 gene menA 8003 7098 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW6 protein_id gnl|my_center|LOCUS_36530 9623 8193 gene locus_tag LOCUS_36540 9623 8193 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 protein_id gnl|my_center|LOCUS_36540 10251 9760 gene locus_tag LOCUS_36550 10251 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 >Feature sequence225 400 1584 gene locus_tag LOCUS_36560 400 1584 CDS product protoporphyrin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP87 protein_id gnl|my_center|LOCUS_36560 1928 2101 gene locus_tag LOCUS_36570 1928 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 3192 2275 gene locus_tag LOCUS_36580 3192 2275 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700054.1 protein_id gnl|my_center|LOCUS_36580 3415 3696 gene locus_tag LOCUS_36590 3415 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 4443 5447 gene locus_tag LOCUS_36600 gene prk 4443 5447 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN2 protein_id gnl|my_center|LOCUS_36600 6319 5525 gene locus_tag LOCUS_36610 6319 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_36610 6984 6469 gene locus_tag LOCUS_36620 6984 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 8891 7287 gene locus_tag LOCUS_36630 8891 7287 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_36630 9807 9109 gene locus_tag LOCUS_36640 9807 9109 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_36640 9922 10245 gene locus_tag LOCUS_36650 gene hxlR 9922 10245 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940853.1 protein_id gnl|my_center|LOCUS_36650 >Feature sequence226 2341 1514 gene locus_tag LOCUS_36660 2341 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 4214 2748 gene locus_tag LOCUS_36670 4214 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057082.1 protein_id gnl|my_center|LOCUS_36670 5949 4393 gene locus_tag LOCUS_36680 5949 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 7620 6067 gene locus_tag LOCUS_36690 7620 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 7902 8810 gene locus_tag LOCUS_36700 gene tyrA 7902 8810 CDS product arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058267.1 protein_id gnl|my_center|LOCUS_36700 9986 8844 gene locus_tag LOCUS_36710 gene jmjD5 9986 8844 CDS product aspartate beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207486.1 protein_id gnl|my_center|LOCUS_36710 10469 10023 gene locus_tag LOCUS_36720 10469 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 >Feature sequence227 <1 1083 gene locus_tag LOCUS_36730 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403760.1:sulfotransferase 1206 3764 gene locus_tag LOCUS_36740 1206 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 3778 5793 gene locus_tag LOCUS_36750 3778 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 5843 7996 gene locus_tag LOCUS_36760 5843 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 8044 9876 gene locus_tag LOCUS_36770 8044 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence228 756 118 gene locus_tag LOCUS_36780 756 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_36780 2115 913 gene locus_tag LOCUS_36790 gene pgk 2115 913 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP7 protein_id gnl|my_center|LOCUS_36790 2292 2708 gene locus_tag LOCUS_36800 2292 2708 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 protein_id gnl|my_center|LOCUS_36800 2723 3622 gene locus_tag LOCUS_36810 2723 3622 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS4 protein_id gnl|my_center|LOCUS_36810 3655 4308 gene locus_tag LOCUS_36820 3655 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142612.1 protein_id gnl|my_center|LOCUS_36820 5369 4305 gene locus_tag LOCUS_36830 gene mnmA 5369 4305 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM0 protein_id gnl|my_center|LOCUS_36830 5438 6406 gene locus_tag LOCUS_36840 5438 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 6447 6953 gene locus_tag LOCUS_36850 6447 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125002.1 protein_id gnl|my_center|LOCUS_36850 7075 7662 gene locus_tag LOCUS_36860 7075 7662 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_36860 7666 9150 gene locus_tag LOCUS_36870 7666 9150 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403192.1 protein_id gnl|my_center|LOCUS_36870 9605 9147 gene locus_tag LOCUS_36880 9605 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 9743 10024 gene locus_tag LOCUS_36890 9743 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 >Feature sequence229 1253 369 gene locus_tag LOCUS_36900 1253 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 2242 1262 gene locus_tag LOCUS_36910 2242 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 2845 2558 gene locus_tag LOCUS_36920 2845 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 3237 3491 gene locus_tag LOCUS_36930 3237 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 3564 4016 gene locus_tag LOCUS_36940 3564 4016 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_36940 4098 4568 gene locus_tag LOCUS_36950 4098 4568 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143783.1 protein_id gnl|my_center|LOCUS_36950 6608 4863 gene locus_tag LOCUS_36960 6608 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057893.1 protein_id gnl|my_center|LOCUS_36960 7086 6925 gene locus_tag LOCUS_36970 7086 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 7597 7908 gene locus_tag LOCUS_36980 7597 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 >Feature sequence230 9708 8410 gene locus_tag LOCUS_36990 gene hemL 9708 8410 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLK8 protein_id gnl|my_center|LOCUS_36990 >Feature sequence231 1725 619 gene locus_tag LOCUS_37000 1725 619 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056195.1 protein_id gnl|my_center|LOCUS_37000 4913 1884 gene locus_tag LOCUS_37010 4913 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 5720 8038 gene locus_tag LOCUS_37020 5720 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 8446 8090 gene locus_tag LOCUS_37030 8446 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37030 8926 10071 gene locus_tag LOCUS_37040 8926 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 >Feature sequence232 4145 171 gene locus_tag LOCUS_37050 4145 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 4591 6537 gene locus_tag LOCUS_37060 gene dnaG 4591 6537 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB0 protein_id gnl|my_center|LOCUS_37060 7748 6534 gene locus_tag LOCUS_37070 7748 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 9476 8688 gene locus_tag LOCUS_37080 gene yoxD 9476 8688 CDS product putative oxidoreductase YoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14802 protein_id gnl|my_center|LOCUS_37080 9669 9463 gene locus_tag LOCUS_37090 9669 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 >Feature sequence233 62 1864 gene locus_tag LOCUS_37100 62 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 1935 2228 gene locus_tag LOCUS_37110 1935 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 2436 2798 gene locus_tag LOCUS_37120 2436 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 5308 2921 gene locus_tag LOCUS_37130 5308 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 6608 6309 gene locus_tag LOCUS_37140 6608 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057560.1 protein_id gnl|my_center|LOCUS_37140 7092 8624 gene locus_tag LOCUS_37150 7092 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 8910 8647 gene locus_tag LOCUS_37160 8910 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 protein_id gnl|my_center|LOCUS_37160 9648 10037 gene locus_tag LOCUS_37170 9648 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 >Feature sequence234 242 1216 gene locus_tag LOCUS_37180 242 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 1304 2506 gene locus_tag LOCUS_37190 1304 2506 CDS product putative ABC transporter-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUE8 protein_id gnl|my_center|LOCUS_37190 2589 3947 gene locus_tag LOCUS_37200 2589 3947 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_37200 3999 5150 gene locus_tag LOCUS_37210 3999 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 5436 5945 gene locus_tag LOCUS_37220 gene ycf51 5436 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056935.1 protein_id gnl|my_center|LOCUS_37220 5984 6499 gene locus_tag LOCUS_37230 5984 6499 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256072.1 protein_id gnl|my_center|LOCUS_37230 6725 7858 gene locus_tag LOCUS_37240 6725 7858 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_37240 9208 7868 gene locus_tag LOCUS_37250 9208 7868 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_37250 >Feature sequence235 1247 1879 gene locus_tag LOCUS_37260 1247 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 1976 2203 gene locus_tag LOCUS_37270 1976 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 2200 2652 gene locus_tag LOCUS_37280 2200 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37280 2754 3794 gene locus_tag LOCUS_37290 2754 3794 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 protein_id gnl|my_center|LOCUS_37290 3917 4378 gene locus_tag LOCUS_37300 3917 4378 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421494.1 protein_id gnl|my_center|LOCUS_37300 4392 5003 gene locus_tag LOCUS_37310 4392 5003 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_37310 5166 6008 gene locus_tag LOCUS_37320 5166 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 6005 7321 gene locus_tag LOCUS_37330 6005 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 8700 7894 gene locus_tag LOCUS_37340 8700 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 9918 8737 gene locus_tag LOCUS_37350 gene spsC 9918 8737 CDS product spore coat polysaccharide biosynthesis protein SpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39623 protein_id gnl|my_center|LOCUS_37350 >Feature sequence236 489 70 gene locus_tag LOCUS_37360 489 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141871.1 protein_id gnl|my_center|LOCUS_37360 1139 3274 gene locus_tag LOCUS_37370 1139 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 4605 3283 gene locus_tag LOCUS_37380 4605 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 5518 4598 gene locus_tag LOCUS_37390 5518 4598 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846932.1 protein_id gnl|my_center|LOCUS_37390 6703 5615 gene locus_tag LOCUS_37400 6703 5615 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057982.1 protein_id gnl|my_center|LOCUS_37400 6769 7587 gene locus_tag LOCUS_37410 6769 7587 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_37410 7696 7926 gene locus_tag LOCUS_37420 7696 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 7923 8288 gene locus_tag LOCUS_37430 7923 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 8651 8376 gene locus_tag LOCUS_37440 8651 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389752.1 protein_id gnl|my_center|LOCUS_37440 8979 8614 gene locus_tag LOCUS_37450 8979 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 >Feature sequence237 <1 608 gene locus_tag LOCUS_37460 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NCA7:glycolate oxidase iron-sulfur subunit 1534 776 gene locus_tag LOCUS_37470 1534 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 3946 1691 gene locus_tag LOCUS_37480 3946 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 4829 4185 gene locus_tag LOCUS_37490 4829 4185 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404693.1 protein_id gnl|my_center|LOCUS_37490 4940 6214 gene locus_tag LOCUS_37500 4940 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057390.1 protein_id gnl|my_center|LOCUS_37500 7185 6211 gene locus_tag LOCUS_37510 7185 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 protein_id gnl|my_center|LOCUS_37510 7462 7695 gene locus_tag LOCUS_37520 7462 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 7805 8710 gene locus_tag LOCUS_37530 7805 8710 CDS product heterodisulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056823.1 protein_id gnl|my_center|LOCUS_37530 8840 9811 gene locus_tag LOCUS_37540 8840 9811 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_37540 >Feature sequence238 357 2480 gene locus_tag LOCUS_37550 gene glgX 357 2480 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6D2 protein_id gnl|my_center|LOCUS_37550 4298 2517 gene locus_tag LOCUS_37560 4298 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 4525 5838 gene locus_tag LOCUS_37570 gene rimO 4525 5838 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL8 protein_id gnl|my_center|LOCUS_37570 6273 7571 gene locus_tag LOCUS_37580 gene eno 6273 7571 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIR1 protein_id gnl|my_center|LOCUS_37580 7690 8667 gene locus_tag LOCUS_37590 7690 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056735.1 protein_id gnl|my_center|LOCUS_37590 8844 9731 gene locus_tag LOCUS_37600 gene trpC 8844 9731 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL01 protein_id gnl|my_center|LOCUS_37600 >Feature sequence239 1332 925 gene locus_tag LOCUS_37610 1332 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 1512 1907 gene locus_tag LOCUS_37620 1512 1907 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_37620 2897 2001 gene locus_tag LOCUS_37630 gene gspF 2897 2001 CDS product general secretion pathway protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708819.1 protein_id gnl|my_center|LOCUS_37630 3194 3994 gene locus_tag LOCUS_37640 3194 3994 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142000.1 protein_id gnl|my_center|LOCUS_37640 4045 5742 gene locus_tag LOCUS_37650 4045 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 5985 6674 gene locus_tag LOCUS_37660 5985 6674 CDS product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_37660 8604 6925 gene locus_tag LOCUS_37670 8604 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 9136 9501 gene locus_tag LOCUS_37680 9136 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 >Feature sequence240 1421 495 gene locus_tag LOCUS_37690 1421 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 1994 1470 gene locus_tag LOCUS_37700 1994 1470 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141571.1 protein_id gnl|my_center|LOCUS_37700 2462 2010 gene locus_tag LOCUS_37710 2462 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 3086 2478 gene locus_tag LOCUS_37720 3086 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 3871 3203 gene locus_tag LOCUS_37730 3871 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_37730 5031 4015 gene locus_tag LOCUS_37740 5031 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 5675 5028 gene locus_tag LOCUS_37750 5675 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 6698 5685 gene locus_tag LOCUS_37760 6698 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 7249 9063 gene locus_tag LOCUS_37770 7249 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 >Feature sequence241 1099 2370 gene locus_tag LOCUS_37780 1099 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 2527 2439 gene locus_tag LOCUS_t00250 2527 2439 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2867 3172 gene locus_tag LOCUS_37790 2867 3172 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 protein_id gnl|my_center|LOCUS_37790 3210 3728 gene locus_tag LOCUS_37800 3210 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 3735 4547 gene locus_tag LOCUS_37810 3735 4547 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 protein_id gnl|my_center|LOCUS_37810 4853 6343 gene locus_tag LOCUS_37820 4853 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 6455 7054 gene locus_tag LOCUS_37830 6455 7054 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144254.1 protein_id gnl|my_center|LOCUS_37830 7225 8154 gene locus_tag LOCUS_37840 7225 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_37840 8280 9527 gene locus_tag LOCUS_37850 gene hisZ 8280 9527 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD8 protein_id gnl|my_center|LOCUS_37850 >Feature sequence242 255 701 gene locus_tag LOCUS_37860 gene dut 255 701 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97J61 protein_id gnl|my_center|LOCUS_37860 713 1282 gene locus_tag LOCUS_37870 713 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 2206 1304 gene locus_tag LOCUS_37880 2206 1304 CDS product lactose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_37880 3777 2308 gene locus_tag LOCUS_37890 3777 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055916.1 protein_id gnl|my_center|LOCUS_37890 3895 4506 gene locus_tag LOCUS_37900 3895 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 4671 5888 gene locus_tag LOCUS_37910 4671 5888 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_37910 6128 6508 gene locus_tag LOCUS_37920 6128 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142323.1 protein_id gnl|my_center|LOCUS_37920 6767 7750 gene locus_tag LOCUS_37930 6767 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 8478 7861 gene locus_tag LOCUS_37940 8478 7861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 8657 9082 gene locus_tag LOCUS_37950 gene queF 8657 9082 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA3 protein_id gnl|my_center|LOCUS_37950 9273 9079 gene locus_tag LOCUS_37960 9273 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_37960 >Feature sequence243 316 885 gene locus_tag LOCUS_37970 316 885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056429.1 protein_id gnl|my_center|LOCUS_37970 2125 1268 gene locus_tag LOCUS_37980 2125 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37980 2908 2255 gene locus_tag LOCUS_37990 2908 2255 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056611.1 protein_id gnl|my_center|LOCUS_37990 3473 3006 gene locus_tag LOCUS_38000 3473 3006 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421362.1 protein_id gnl|my_center|LOCUS_38000 3932 4870 gene locus_tag LOCUS_38010 gene era 3932 4870 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ5 protein_id gnl|my_center|LOCUS_38010 5139 7517 gene locus_tag LOCUS_38020 5139 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 8279 8746 gene locus_tag LOCUS_38030 8279 8746 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057352.1 protein_id gnl|my_center|LOCUS_38030 9312 9931 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cctgaggtagtcaagcccatacc >Feature sequence244 1149 142 gene locus_tag LOCUS_38040 gene ycf30 1149 142 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 protein_id gnl|my_center|LOCUS_38040 1759 2436 gene locus_tag LOCUS_38050 1759 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056001.1 protein_id gnl|my_center|LOCUS_38050 2479 3174 gene locus_tag LOCUS_38060 gene rpe 2479 3174 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE8 protein_id gnl|my_center|LOCUS_38060 4436 3243 gene locus_tag LOCUS_38070 4436 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 protein_id gnl|my_center|LOCUS_38070 6409 4472 gene locus_tag LOCUS_38080 6409 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 6816 8675 gene locus_tag LOCUS_38090 6816 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55493 protein_id gnl|my_center|LOCUS_38090 9222 8836 gene locus_tag LOCUS_38100 gene gloA 9222 8836 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027458.1 protein_id gnl|my_center|LOCUS_38100 9691 9870 gene locus_tag LOCUS_38110 9691 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 >Feature sequence245 1293 712 gene locus_tag LOCUS_38120 1293 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 1465 1253 gene locus_tag LOCUS_38130 1465 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 1646 1434 gene locus_tag LOCUS_38140 1646 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 1905 1627 gene locus_tag LOCUS_38150 1905 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 2167 1982 gene locus_tag LOCUS_38160 2167 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 2773 2498 gene locus_tag LOCUS_38170 2773 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 3216 2779 gene locus_tag LOCUS_38180 3216 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 3687 4052 gene locus_tag LOCUS_38190 3687 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 4420 4148 gene locus_tag LOCUS_38200 4420 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 5226 4426 gene locus_tag LOCUS_38210 5226 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 5660 5250 gene locus_tag LOCUS_38220 5660 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 6025 6291 gene locus_tag LOCUS_38230 6025 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 6430 6771 gene locus_tag LOCUS_38240 6430 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 7011 7862 gene locus_tag LOCUS_38250 gene trmJ 7011 7862 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIP3 protein_id gnl|my_center|LOCUS_38250 7988 9616 gene locus_tag LOCUS_38260 7988 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 >Feature sequence246 649 221 gene locus_tag LOCUS_38270 649 221 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_38270 1263 679 gene locus_tag LOCUS_38280 gene aroK 1263 679 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH7 protein_id gnl|my_center|LOCUS_38280 1939 1250 gene locus_tag LOCUS_38290 gene tmk 1939 1250 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHA4 protein_id gnl|my_center|LOCUS_38290 2150 2497 gene locus_tag LOCUS_38300 2150 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 6357 2515 gene locus_tag LOCUS_38310 6357 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 6946 6443 gene locus_tag LOCUS_38320 6946 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 7002 7919 gene locus_tag LOCUS_38330 7002 7919 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_38330 9006 7969 gene locus_tag LOCUS_38340 9006 7969 CDS product Appr-1-p processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_38340 9674 9024 gene locus_tag LOCUS_38350 9674 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_38350 >Feature sequence247 677 51 gene locus_tag LOCUS_38360 677 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 1354 1620 gene locus_tag LOCUS_38370 1354 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 4735 1628 gene locus_tag LOCUS_38380 4735 1628 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 protein_id gnl|my_center|LOCUS_38380 6285 4762 gene locus_tag LOCUS_38390 6285 4762 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142834.1 protein_id gnl|my_center|LOCUS_38390 6941 6405 gene locus_tag LOCUS_38400 6941 6405 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228782.1 protein_id gnl|my_center|LOCUS_38400 7040 7429 gene locus_tag LOCUS_38410 7040 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057286.1 protein_id gnl|my_center|LOCUS_38410 9721 7457 gene locus_tag LOCUS_38420 9721 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 7472 7545 gene locus_tag LOCUS_t00260 7472 7545 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence248 3329 396 gene locus_tag LOCUS_38430 gene polA 3329 396 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057179.1 protein_id gnl|my_center|LOCUS_38430 3669 3397 gene locus_tag LOCUS_38440 3669 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 protein_id gnl|my_center|LOCUS_38440 4157 3684 gene locus_tag LOCUS_38450 gene dnaJ 4157 3684 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055973.1 protein_id gnl|my_center|LOCUS_38450 4481 5341 gene locus_tag LOCUS_38460 4481 5341 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_38460 5413 5724 gene locus_tag LOCUS_38470 5413 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 6018 6392 gene locus_tag LOCUS_38480 6018 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 6532 8952 gene locus_tag LOCUS_38490 6532 8952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 9472 8963 gene locus_tag LOCUS_38500 9472 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 9630 9469 gene locus_tag LOCUS_38510 9630 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 >Feature sequence249 1386 2873 gene locus_tag LOCUS_38520 1386 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143058.1 protein_id gnl|my_center|LOCUS_38520 2939 4609 gene locus_tag LOCUS_38530 2939 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 4619 5221 gene locus_tag LOCUS_38540 4619 5221 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 protein_id gnl|my_center|LOCUS_38540 6869 5211 gene locus_tag LOCUS_38550 6869 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 7056 7745 gene locus_tag LOCUS_38560 7056 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 8768 7740 gene locus_tag LOCUS_38570 8768 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184801.1 protein_id gnl|my_center|LOCUS_38570 <9843 8797 gene locus_tag LOCUS_38580 <9843 8797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947388.1:membrane protein >Feature sequence250 2 1504 gene locus_tag LOCUS_38590 2 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 1526 2044 gene locus_tag LOCUS_38600 1526 2044 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_38600 2111 3982 gene locus_tag LOCUS_38610 2111 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 4560 3991 gene locus_tag LOCUS_38620 gene recR 4560 3991 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGV8 protein_id gnl|my_center|LOCUS_38620 5349 4729 gene locus_tag LOCUS_38630 5349 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144203.1 protein_id gnl|my_center|LOCUS_38630 5786 5385 gene locus_tag LOCUS_38640 5786 5385 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_38640 5998 5783 gene locus_tag LOCUS_38650 5998 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 6201 7436 gene locus_tag LOCUS_38660 gene dapL 6201 7436 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH57 protein_id gnl|my_center|LOCUS_38660 <9829 7757 gene locus_tag LOCUS_38670 <9829 7757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKA7:transcription-repair-coupling factor >Feature sequence251 1012 656 gene locus_tag LOCUS_38680 1012 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 1578 1144 gene locus_tag LOCUS_38690 1578 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 1943 1629 gene locus_tag LOCUS_38700 1943 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 2654 2319 gene locus_tag LOCUS_38710 gene gatC 2654 2319 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58817 protein_id gnl|my_center|LOCUS_38710 3196 2675 gene locus_tag LOCUS_38720 gene ycf3 3196 2675 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ6 protein_id gnl|my_center|LOCUS_38720 3570 4916 gene locus_tag LOCUS_38730 3570 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057293.1 protein_id gnl|my_center|LOCUS_38730 5105 5275 gene locus_tag LOCUS_38740 5105 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 5840 8542 gene locus_tag LOCUS_38750 gene topA 5840 8542 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR4 protein_id gnl|my_center|LOCUS_38750 9672 8743 gene locus_tag LOCUS_38760 9672 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 >Feature sequence252 1309 695 gene locus_tag LOCUS_38770 1309 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143183.1 protein_id gnl|my_center|LOCUS_38770 2770 1376 gene locus_tag LOCUS_38780 2770 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143184.1 protein_id gnl|my_center|LOCUS_38780 5186 2838 gene locus_tag LOCUS_38790 5186 2838 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056828.1 protein_id gnl|my_center|LOCUS_38790 6301 5270 gene locus_tag LOCUS_38800 6301 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 7379 6294 gene locus_tag LOCUS_38810 7379 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 7692 8189 gene locus_tag LOCUS_38820 7692 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057499.1 protein_id gnl|my_center|LOCUS_38820 <9756 8229 gene locus_tag LOCUS_38830 <9756 8229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256308.1:histidine kinase >Feature sequence253 4121 3120 gene locus_tag LOCUS_38840 4121 3120 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_38840 5669 4377 gene locus_tag LOCUS_38850 5669 4377 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC8 protein_id gnl|my_center|LOCUS_38850 6233 5784 gene locus_tag LOCUS_38860 6233 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141484.1 protein_id gnl|my_center|LOCUS_38860 8182 6293 gene locus_tag LOCUS_38870 8182 6293 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 protein_id gnl|my_center|LOCUS_38870 >Feature sequence254 310 876 gene locus_tag LOCUS_38880 310 876 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK86 protein_id gnl|my_center|LOCUS_38880 873 1718 gene locus_tag LOCUS_38890 873 1718 CDS product lactose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_38890 3994 1727 gene locus_tag LOCUS_38900 3994 1727 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143682.1 protein_id gnl|my_center|LOCUS_38900 5221 4442 gene locus_tag LOCUS_38910 5221 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 5939 5475 gene locus_tag LOCUS_38920 gene aroQ 5939 5475 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ7 protein_id gnl|my_center|LOCUS_38920 6115 5975 gene locus_tag LOCUS_38930 6115 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 7467 6895 gene locus_tag LOCUS_38940 7467 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 7853 7530 gene locus_tag LOCUS_38950 7853 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056944.1 protein_id gnl|my_center|LOCUS_38950 9196 8963 gene locus_tag LOCUS_38960 9196 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 >Feature sequence255 160 381 gene locus_tag LOCUS_38970 160 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 884 1204 gene locus_tag LOCUS_38980 884 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 1545 1754 gene locus_tag LOCUS_38990 1545 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 1824 2354 gene locus_tag LOCUS_39000 1824 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 5123 2532 gene locus_tag LOCUS_39010 5123 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 5516 5127 gene locus_tag LOCUS_39020 5516 5127 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356374.1 protein_id gnl|my_center|LOCUS_39020 7040 5595 gene locus_tag LOCUS_39030 7040 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 8654 7281 gene locus_tag LOCUS_39040 8654 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_39040 9259 9035 gene locus_tag LOCUS_39050 9259 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 >Feature sequence256 713 360 gene locus_tag LOCUS_39060 713 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057714.1 protein_id gnl|my_center|LOCUS_39060 2414 894 gene locus_tag LOCUS_39070 2414 894 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057713.1 protein_id gnl|my_center|LOCUS_39070 2879 2529 gene locus_tag LOCUS_39080 2879 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057712.1 protein_id gnl|my_center|LOCUS_39080 3588 5000 gene locus_tag LOCUS_39090 3588 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142503.1 protein_id gnl|my_center|LOCUS_39090 6879 5110 gene locus_tag LOCUS_39100 6879 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140407.1 protein_id gnl|my_center|LOCUS_39100 7750 8517 gene locus_tag LOCUS_39110 7750 8517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 8571 8972 gene locus_tag LOCUS_39120 8571 8972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 >Feature sequence257 1255 377 gene locus_tag LOCUS_39130 1255 377 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143340.1 protein_id gnl|my_center|LOCUS_39130 1889 1248 gene locus_tag LOCUS_39140 1889 1248 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 protein_id gnl|my_center|LOCUS_39140 2701 5949 gene locus_tag LOCUS_39150 2701 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228376.1 protein_id gnl|my_center|LOCUS_39150 6404 6832 gene locus_tag LOCUS_39160 6404 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 6935 7162 gene locus_tag LOCUS_39170 6935 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 7196 7513 gene locus_tag LOCUS_39180 7196 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 >Feature sequence258 <1 788 gene locus_tag LOCUS_39190 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097917.1:2,4-diaminobutyrate decarboxylase 1135 791 gene locus_tag LOCUS_39200 1135 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 1266 1982 gene locus_tag LOCUS_39210 1266 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 2059 2427 gene locus_tag LOCUS_39220 2059 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39220 3150 2449 gene locus_tag LOCUS_39230 3150 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 3865 3209 gene locus_tag LOCUS_39240 3865 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 4816 3914 gene locus_tag LOCUS_39250 4816 3914 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614684.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39250 5032 4820 gene locus_tag LOCUS_39260 5032 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39260 6233 5103 gene locus_tag LOCUS_39270 6233 5103 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_39270 6920 7993 gene locus_tag LOCUS_39280 6920 7993 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938278.1 protein_id gnl|my_center|LOCUS_39280 8003 8875 gene locus_tag LOCUS_39290 8003 8875 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385602.1 protein_id gnl|my_center|LOCUS_39290 8881 9516 gene locus_tag LOCUS_39300 8881 9516 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159131.1 protein_id gnl|my_center|LOCUS_39300 >Feature sequence259 1710 919 gene locus_tag LOCUS_39310 gene sigF 1710 919 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_39310 2361 1885 gene locus_tag LOCUS_39320 2361 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 3429 3145 gene locus_tag LOCUS_39330 3429 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 4448 4020 gene locus_tag LOCUS_39340 4448 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 protein_id gnl|my_center|LOCUS_39340 4572 6131 gene locus_tag LOCUS_39350 4572 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 6588 7676 gene locus_tag LOCUS_39360 6588 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141362.1 protein_id gnl|my_center|LOCUS_39360 7877 8137 gene locus_tag LOCUS_39370 7877 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 8773 8186 gene locus_tag LOCUS_39380 gene ycf58 8773 8186 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD5 protein_id gnl|my_center|LOCUS_39380 >Feature sequence260 3691 4752 gene locus_tag LOCUS_39390 3691 4752 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141179.1 protein_id gnl|my_center|LOCUS_39390 4803 5504 gene locus_tag LOCUS_39400 4803 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 5527 6261 gene locus_tag LOCUS_39410 5527 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 >Feature sequence261 485 1138 gene locus_tag LOCUS_39420 485 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142667.1 protein_id gnl|my_center|LOCUS_39420 1372 2964 gene locus_tag LOCUS_39430 gene pgi 1372 2964 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY2 protein_id gnl|my_center|LOCUS_39430 3057 4259 gene locus_tag LOCUS_39440 3057 4259 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057854.1 protein_id gnl|my_center|LOCUS_39440 5016 4684 gene locus_tag LOCUS_39450 5016 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 5270 6244 gene locus_tag LOCUS_39460 5270 6244 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057238.1 protein_id gnl|my_center|LOCUS_39460 6689 6468 gene locus_tag LOCUS_39470 6689 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 6829 6677 gene locus_tag LOCUS_39480 6829 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 7139 6876 gene locus_tag LOCUS_39490 gene yoeB 7139 6876 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64529 protein_id gnl|my_center|LOCUS_39490 7404 7114 gene locus_tag LOCUS_39500 7404 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 7539 7787 gene locus_tag LOCUS_39510 7539 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 7787 8209 gene locus_tag LOCUS_39520 7787 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 8696 8430 gene locus_tag LOCUS_39530 8696 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 >Feature sequence262 2301 709 gene locus_tag LOCUS_39540 2301 709 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259102.1 protein_id gnl|my_center|LOCUS_39540 2787 2431 gene locus_tag LOCUS_39550 2787 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 3139 3762 gene locus_tag LOCUS_39560 3139 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 4004 3849 gene locus_tag LOCUS_39570 4004 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 4362 4174 gene locus_tag LOCUS_39580 4362 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 5123 4578 gene locus_tag LOCUS_39590 5123 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 5627 5244 gene locus_tag LOCUS_39600 5627 5244 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_39600 9123 5617 gene locus_tag LOCUS_39610 9123 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39610 >Feature sequence263 <1 1864 gene locus_tag LOCUS_39620 <1 1864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003014989.1:aminotransferase DegT 2092 2298 gene locus_tag LOCUS_39630 2092 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 2629 3735 gene locus_tag LOCUS_39640 2629 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 3800 4885 gene locus_tag LOCUS_39650 3800 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 5059 6390 gene locus_tag LOCUS_39660 5059 6390 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 protein_id gnl|my_center|LOCUS_39660 6549 8240 gene locus_tag LOCUS_39670 gene atsA 6549 8240 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51691 protein_id gnl|my_center|LOCUS_39670 8351 9163 gene locus_tag LOCUS_39680 8351 9163 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038034.1 protein_id gnl|my_center|LOCUS_39680 >Feature sequence264 1031 321 gene locus_tag LOCUS_39690 1031 321 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_39690 1700 3121 gene locus_tag LOCUS_39700 1700 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 3501 3193 gene locus_tag LOCUS_39710 3501 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_39710 3734 4273 gene locus_tag LOCUS_39720 gene petC 3734 4273 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N8 protein_id gnl|my_center|LOCUS_39720 4349 5338 gene locus_tag LOCUS_39730 gene petA 4349 5338 CDS product cytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N5 protein_id gnl|my_center|LOCUS_39730 5501 6535 gene locus_tag LOCUS_39740 5501 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 8095 6548 gene locus_tag LOCUS_39750 gene guaA 8095 6548 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA5 protein_id gnl|my_center|LOCUS_39750 <9243 8418 gene locus_tag LOCUS_39760 <9243 8418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKT8:cobalt-precorrin-5B C(1)-methyltransferase >Feature sequence265 1523 882 gene locus_tag LOCUS_39770 1523 882 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143820.1 protein_id gnl|my_center|LOCUS_39770 2575 3315 gene locus_tag LOCUS_39780 2575 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140639.1 protein_id gnl|my_center|LOCUS_39780 3863 3384 gene locus_tag LOCUS_39790 3863 3384 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_39790 5042 3933 gene locus_tag LOCUS_39800 5042 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 5605 6153 gene locus_tag LOCUS_39810 5605 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 6715 7377 gene locus_tag LOCUS_39820 6715 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003198.1 protein_id gnl|my_center|LOCUS_39820 7440 8732 gene locus_tag LOCUS_39830 7440 8732 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476549.1 protein_id gnl|my_center|LOCUS_39830 >Feature sequence266 305 90 gene locus_tag LOCUS_39840 305 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 2444 534 gene locus_tag LOCUS_39850 2444 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 3733 2861 gene locus_tag LOCUS_39860 3733 2861 CDS product 6-pyruvoyltetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056938.1 protein_id gnl|my_center|LOCUS_39860 4475 5410 gene locus_tag LOCUS_39870 4475 5410 CDS product isoaspartyl peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_39870 5571 5771 gene locus_tag LOCUS_39880 5571 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 5772 6095 gene locus_tag LOCUS_39890 5772 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 6181 7398 gene locus_tag LOCUS_39900 6181 7398 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875692.1 protein_id gnl|my_center|LOCUS_39900 7401 7796 gene locus_tag LOCUS_39910 7401 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39910 7857 8366 gene locus_tag LOCUS_39920 7857 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39920 8889 8398 gene locus_tag LOCUS_39930 8889 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 >Feature sequence267 713 288 gene locus_tag LOCUS_39940 713 288 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142135.1 protein_id gnl|my_center|LOCUS_39940 1798 6504 gene locus_tag LOCUS_39950 gene glsF 1798 6504 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057208.1 protein_id gnl|my_center|LOCUS_39950 <8917 6683 gene locus_tag LOCUS_39960 <8917 6683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012602842.1:outer membrane autotransporter barrel domain-containing protein >Feature sequence268 650 1747 gene locus_tag LOCUS_39970 650 1747 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE8 protein_id gnl|my_center|LOCUS_39970 1770 2468 gene locus_tag LOCUS_39980 gene nth 1770 2468 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE9 protein_id gnl|my_center|LOCUS_39980 2592 2879 gene locus_tag LOCUS_39990 gene rpsN 2592 2879 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW7 protein_id gnl|my_center|LOCUS_39990 3265 2936 gene locus_tag LOCUS_40000 3265 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056249.1 protein_id gnl|my_center|LOCUS_40000 3760 3335 gene locus_tag LOCUS_40010 3760 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 3813 4388 gene locus_tag LOCUS_40020 gene aat 3813 4388 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKJ8 protein_id gnl|my_center|LOCUS_40020 5310 4429 gene locus_tag LOCUS_40030 5310 4429 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056948.1 protein_id gnl|my_center|LOCUS_40030 5590 5826 gene locus_tag LOCUS_40040 5590 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 5863 6960 gene locus_tag LOCUS_40050 5863 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 <8904 7072 gene locus_tag LOCUS_40060 <8904 7072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973240.1:non-ribosomal peptide synthetase >Feature sequence269 278 673 gene locus_tag LOCUS_40070 278 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 674 1342 gene locus_tag LOCUS_40080 674 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 1685 2512 gene locus_tag LOCUS_40090 1685 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055987.1 protein_id gnl|my_center|LOCUS_40090 2771 3052 gene locus_tag LOCUS_40100 2771 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 3504 3635 gene locus_tag LOCUS_40110 3504 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 3920 4078 gene locus_tag LOCUS_40120 3920 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 4321 4725 gene locus_tag LOCUS_40130 gene folP 4321 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124278.1 protein_id gnl|my_center|LOCUS_40130 7148 5061 gene locus_tag LOCUS_40140 gene fusA2 7148 5061 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPM5 protein_id gnl|my_center|LOCUS_40140 >Feature sequence270 2103 253 gene locus_tag LOCUS_40150 2103 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 3964 2783 gene locus_tag LOCUS_40160 3964 2783 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_40160 5472 3988 gene locus_tag LOCUS_40170 5472 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 5893 5600 gene locus_tag LOCUS_40180 5893 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 6832 6053 gene locus_tag LOCUS_40190 gene cobA 6832 6053 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142574.1 protein_id gnl|my_center|LOCUS_40190 6983 7444 gene locus_tag LOCUS_40200 6983 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 8711 7986 gene locus_tag LOCUS_40210 8711 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 >Feature sequence271 568 149 gene locus_tag LOCUS_40220 568 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 1655 981 gene locus_tag LOCUS_40230 1655 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140697.1 protein_id gnl|my_center|LOCUS_40230 2836 1754 gene locus_tag LOCUS_40240 2836 1754 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865294.1 protein_id gnl|my_center|LOCUS_40240 3716 2868 gene locus_tag LOCUS_40250 3716 2868 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976103.1 protein_id gnl|my_center|LOCUS_40250 4626 3718 gene locus_tag LOCUS_40260 4626 3718 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_40260 5840 4632 gene locus_tag LOCUS_40270 5840 4632 CDS product putative ABC transporter-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUE8 protein_id gnl|my_center|LOCUS_40270 6443 6910 gene locus_tag LOCUS_40280 6443 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 8357 7035 gene locus_tag LOCUS_40290 8357 7035 CDS product carbon dioxide concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_40290 >Feature sequence272 464 1336 gene locus_tag LOCUS_40300 464 1336 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 protein_id gnl|my_center|LOCUS_40300 2267 1392 gene locus_tag LOCUS_40310 2267 1392 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_40310 3023 4213 gene locus_tag LOCUS_40320 3023 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 4854 5633 gene locus_tag LOCUS_40330 4854 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 6982 6569 gene locus_tag LOCUS_40340 6982 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 7677 7063 gene locus_tag LOCUS_40350 gene ycf21 7677 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057402.1 protein_id gnl|my_center|LOCUS_40350 <8790 7750 gene locus_tag LOCUS_40360 <8790 7750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125444.1:glycosyl transferase >Feature sequence273 1258 878 gene locus_tag LOCUS_40370 1258 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 2427 1318 gene locus_tag LOCUS_40380 2427 1318 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_40380 2592 2915 gene locus_tag LOCUS_40390 2592 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 3011 5101 gene locus_tag LOCUS_40400 3011 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 5101 6663 gene locus_tag LOCUS_40410 5101 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 6790 7038 gene locus_tag LOCUS_40420 6790 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 7076 7651 gene locus_tag LOCUS_40430 7076 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 7641 7991 gene locus_tag LOCUS_40440 7641 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 8026 8325 gene locus_tag LOCUS_40450 8026 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 8318 8548 gene locus_tag LOCUS_40460 8318 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 8505 8717 gene locus_tag LOCUS_40470 8505 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 >Feature sequence274 <1 1813 gene locus_tag LOCUS_40480 <1 1813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118003.1:peroxidase 2427 1876 gene locus_tag LOCUS_40490 2427 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 2909 2553 gene locus_tag LOCUS_40500 gene rplT 2909 2553 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH02 protein_id gnl|my_center|LOCUS_40500 3146 2949 gene locus_tag LOCUS_40510 gene rpmI 3146 2949 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9L2 protein_id gnl|my_center|LOCUS_40510 3276 4088 gene locus_tag LOCUS_40520 3276 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125038.1 protein_id gnl|my_center|LOCUS_40520 4214 6358 gene locus_tag LOCUS_40530 4214 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 <8720 6386 gene locus_tag LOCUS_40540 <8720 6386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704132.1:hemagglutinin-like protein >Feature sequence275 405 2438 gene locus_tag LOCUS_40550 405 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 2565 2834 gene locus_tag LOCUS_40560 2565 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 3124 2846 gene locus_tag LOCUS_40570 3124 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 3819 3340 gene locus_tag LOCUS_40580 3819 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40580 4236 3871 gene locus_tag LOCUS_40590 4236 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 5009 5977 gene locus_tag LOCUS_40600 5009 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 6487 6044 gene locus_tag LOCUS_40610 6487 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 6649 6984 gene locus_tag LOCUS_40620 gene ycf20 6649 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 protein_id gnl|my_center|LOCUS_40620 6986 8029 gene locus_tag LOCUS_40630 6986 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 >Feature sequence276 2871 2113 gene locus_tag LOCUS_40640 2871 2113 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480002.1 protein_id gnl|my_center|LOCUS_40640 3844 3059 gene locus_tag LOCUS_40650 3844 3059 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056208.1 protein_id gnl|my_center|LOCUS_40650 4929 3847 gene locus_tag LOCUS_40660 4929 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_40660 5110 5532 gene locus_tag LOCUS_40670 5110 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 5544 5696 gene locus_tag LOCUS_40680 5544 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 6259 5678 gene locus_tag LOCUS_40690 6259 5678 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057675.1 protein_id gnl|my_center|LOCUS_40690 6650 7732 gene locus_tag LOCUS_40700 6650 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 7882 8130 gene locus_tag LOCUS_40710 7882 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 >Feature sequence277 2001 973 gene locus_tag LOCUS_40720 2001 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 2400 2227 gene locus_tag LOCUS_40730 2400 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 3902 2526 gene locus_tag LOCUS_40740 3902 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 4337 4110 gene locus_tag LOCUS_40750 4337 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 5074 4457 gene locus_tag LOCUS_40760 5074 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 5220 5483 gene locus_tag LOCUS_40770 5220 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 5539 5709 gene locus_tag LOCUS_40780 5539 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 6053 6277 gene locus_tag LOCUS_40790 6053 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 6810 6463 gene locus_tag LOCUS_40800 6810 6463 CDS product antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_40800 7277 7029 gene locus_tag LOCUS_40810 7277 7029 CDS product hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259386.1 protein_id gnl|my_center|LOCUS_40810 7754 8119 gene locus_tag LOCUS_40820 7754 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 >Feature sequence278 1440 586 gene locus_tag LOCUS_40830 1440 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 protein_id gnl|my_center|LOCUS_40830 1680 3254 gene locus_tag LOCUS_40840 1680 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142479.1 protein_id gnl|my_center|LOCUS_40840 3457 4551 gene locus_tag LOCUS_40850 3457 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 5818 4598 gene locus_tag LOCUS_40860 gene chlP 5818 4598 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056005.1 protein_id gnl|my_center|LOCUS_40860 6118 7593 gene locus_tag LOCUS_40870 gene glgA 6118 7593 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E079 protein_id gnl|my_center|LOCUS_40870 8387 7692 gene locus_tag LOCUS_40880 8387 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 >Feature sequence279 1824 136 gene locus_tag LOCUS_40890 gene nadE 1824 136 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_40890 2240 2407 gene locus_tag LOCUS_40900 2240 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 4743 2551 gene locus_tag LOCUS_40910 4743 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 4985 4785 gene locus_tag LOCUS_40920 4985 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 5258 6256 gene locus_tag LOCUS_40930 5258 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 7019 7822 gene locus_tag LOCUS_40940 7019 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 <8554 7857 gene locus_tag LOCUS_40950 <8554 7857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NCW4:nuclease SbcCD subunit C >Feature sequence280 1010 369 gene locus_tag LOCUS_40960 1010 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 2048 1062 gene locus_tag LOCUS_40970 2048 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 2779 2036 gene locus_tag LOCUS_40980 2779 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 7780 2882 gene locus_tag LOCUS_40990 7780 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 >Feature sequence281 721 1320 gene locus_tag LOCUS_41000 721 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 1356 2561 gene locus_tag LOCUS_41010 1356 2561 CDS product S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_41010 2572 3318 gene locus_tag LOCUS_41020 gene ubiE 2572 3318 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117867.1 protein_id gnl|my_center|LOCUS_41020 4294 3785 gene locus_tag LOCUS_41030 4294 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 protein_id gnl|my_center|LOCUS_41030 4572 5714 gene locus_tag LOCUS_41040 gene pntA 4572 5714 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_41040 5789 6085 gene locus_tag LOCUS_41050 5789 6085 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_41050 6082 7488 gene locus_tag LOCUS_41060 gene pntB 6082 7488 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 protein_id gnl|my_center|LOCUS_41060 7716 8330 gene locus_tag LOCUS_41070 7716 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 >Feature sequence282 3037 1904 gene locus_tag LOCUS_41080 3037 1904 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_41080 3864 3163 gene locus_tag LOCUS_41090 3864 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 4158 3973 gene locus_tag LOCUS_41100 4158 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 4382 4741 gene locus_tag LOCUS_41110 4382 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 4922 5986 gene locus_tag LOCUS_41120 4922 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142156.1 protein_id gnl|my_center|LOCUS_41120 >Feature sequence283 1651 518 gene locus_tag LOCUS_41130 1651 518 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614684.1 protein_id gnl|my_center|LOCUS_41130 3222 2386 gene locus_tag LOCUS_41140 3222 2386 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_41140 4284 5903 gene locus_tag LOCUS_41150 4284 5903 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530815.1 protein_id gnl|my_center|LOCUS_41150 5944 6270 gene locus_tag LOCUS_41160 5944 6270 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530816.1 protein_id gnl|my_center|LOCUS_41160 7601 6333 gene locus_tag LOCUS_41170 7601 6333 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826404.1 protein_id gnl|my_center|LOCUS_41170 >Feature sequence284 41 1303 gene locus_tag LOCUS_41180 41 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 1408 1659 gene locus_tag LOCUS_41190 gene yisB 1408 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06715 protein_id gnl|my_center|LOCUS_41190 1977 2201 gene locus_tag LOCUS_41200 1977 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 3993 2401 gene locus_tag LOCUS_41210 3993 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 5357 5665 gene locus_tag LOCUS_41220 5357 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 7205 6402 gene locus_tag LOCUS_41230 gene trpA 7205 6402 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLN9 protein_id gnl|my_center|LOCUS_41230 7592 7254 gene locus_tag LOCUS_41240 7592 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056554.1 protein_id gnl|my_center|LOCUS_41240 7882 7592 gene locus_tag LOCUS_41250 gene ndhL 7882 7592 CDS product NAD(P)H-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ3 protein_id gnl|my_center|LOCUS_41250 >Feature sequence285 823 347 gene locus_tag LOCUS_41260 823 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 1178 2263 gene locus_tag LOCUS_41270 gene thiE 1178 2263 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHK2 protein_id gnl|my_center|LOCUS_41270 2296 2508 gene locus_tag LOCUS_41280 gene ycf40 2296 2508 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056654.1 protein_id gnl|my_center|LOCUS_41280 2717 2586 gene locus_tag LOCUS_41290 2717 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 3810 2740 gene locus_tag LOCUS_41300 3810 2740 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948100.1 protein_id gnl|my_center|LOCUS_41300 4221 3979 gene locus_tag LOCUS_41310 4221 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 4410 5300 gene locus_tag LOCUS_41320 4410 5300 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387903.1 protein_id gnl|my_center|LOCUS_41320 5778 6572 gene locus_tag LOCUS_41330 5778 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 protein_id gnl|my_center|LOCUS_41330 >Feature sequence286 309 734 gene locus_tag LOCUS_41340 309 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41340 1204 2208 gene locus_tag LOCUS_41350 gene thiL 1204 2208 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGF1 protein_id gnl|my_center|LOCUS_41350 3370 2354 gene locus_tag LOCUS_41360 gene gap1 3370 2354 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN83 protein_id gnl|my_center|LOCUS_41360 3763 5268 gene locus_tag LOCUS_41370 gene murC 3763 5268 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV5 protein_id gnl|my_center|LOCUS_41370 5406 6359 gene locus_tag LOCUS_41380 gene murB 5406 6359 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV6 protein_id gnl|my_center|LOCUS_41380 6713 7063 gene locus_tag LOCUS_41390 6713 7063 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKX6 protein_id gnl|my_center|LOCUS_41390 7196 7687 gene locus_tag LOCUS_41400 7196 7687 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_41400 >Feature sequence287 5827 4658 gene locus_tag LOCUS_41410 5827 4658 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEW6 protein_id gnl|my_center|LOCUS_41410 7551 6676 gene locus_tag LOCUS_41420 gene lipA1 7551 6676 CDS product lipoyl synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL83 protein_id gnl|my_center|LOCUS_41420 >Feature sequence288 1853 582 gene locus_tag LOCUS_41430 gene cpeY 1853 582 CDS product phycocyanin operon protein Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141188.1 protein_id gnl|my_center|LOCUS_41430 2501 2007 gene locus_tag LOCUS_41440 gene cpeA 2501 2007 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141189.1 protein_id gnl|my_center|LOCUS_41440 3129 2575 gene locus_tag LOCUS_41450 gene cpeB 3129 2575 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141190.1 protein_id gnl|my_center|LOCUS_41450 3547 4281 gene locus_tag LOCUS_41460 gene pebA 3547 4281 CDS product 15,16-dihydrobiliverdin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL66 protein_id gnl|my_center|LOCUS_41460 4302 5042 gene locus_tag LOCUS_41470 gene pebB 4302 5042 CDS product phycoerythrobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL65 protein_id gnl|my_center|LOCUS_41470 5053 5628 gene locus_tag LOCUS_41480 5053 5628 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141254.1 protein_id gnl|my_center|LOCUS_41480 6071 5661 gene locus_tag LOCUS_41490 6071 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 7234 6068 gene locus_tag LOCUS_41500 7234 6068 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 protein_id gnl|my_center|LOCUS_41500 7757 7245 gene locus_tag LOCUS_41510 7757 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 >Feature sequence289 173 412 gene locus_tag LOCUS_41520 173 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 637 1509 gene locus_tag LOCUS_41530 637 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 4067 1680 gene locus_tag LOCUS_41540 4067 1680 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144195.1 protein_id gnl|my_center|LOCUS_41540 5178 4222 gene locus_tag LOCUS_41550 5178 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057334.1 protein_id gnl|my_center|LOCUS_41550 7545 5338 gene locus_tag LOCUS_41560 7545 5338 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_41560 >Feature sequence290 599 859 gene locus_tag LOCUS_41570 599 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 1755 3065 gene locus_tag LOCUS_41580 1755 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 4125 3217 gene locus_tag LOCUS_41590 gene btpA 4125 3217 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 protein_id gnl|my_center|LOCUS_41590 4254 5213 gene locus_tag LOCUS_41600 4254 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 5365 5904 gene locus_tag LOCUS_41610 5365 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 6924 6166 gene locus_tag LOCUS_41620 6924 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140639.1 protein_id gnl|my_center|LOCUS_41620 >Feature sequence291 382 918 gene locus_tag LOCUS_41630 382 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080669.1 protein_id gnl|my_center|LOCUS_41630 924 3668 gene locus_tag LOCUS_41640 924 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 5119 3983 gene locus_tag LOCUS_41650 5119 3983 CDS product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014966182.1 protein_id gnl|my_center|LOCUS_41650 5257 5451 gene locus_tag LOCUS_41660 5257 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 5468 5710 gene locus_tag LOCUS_41670 5468 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 5992 5717 gene locus_tag LOCUS_41680 5992 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 6275 5937 gene locus_tag LOCUS_41690 6275 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 >Feature sequence292 <1 1362 gene locus_tag LOCUS_41700 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKZ1:4-alpha-glucanotransferase 2207 1455 gene locus_tag LOCUS_41710 gene uppS 2207 1455 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI29 protein_id gnl|my_center|LOCUS_41710 3121 2204 gene locus_tag LOCUS_41720 3121 2204 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057599.1 protein_id gnl|my_center|LOCUS_41720 5146 3902 gene locus_tag LOCUS_41730 gene lysA 5146 3902 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI31 protein_id gnl|my_center|LOCUS_41730 6188 7093 gene locus_tag LOCUS_41740 6188 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 >Feature sequence293 988 1719 gene locus_tag LOCUS_41750 988 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41750 1726 2532 gene locus_tag LOCUS_41760 1726 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41760 6118 2555 gene locus_tag LOCUS_41770 6118 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 6687 7205 gene locus_tag LOCUS_41780 6687 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 >Feature sequence294 <1 2607 gene locus_tag LOCUS_41790 <1 2607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118003.1:peroxidase 3328 2666 gene locus_tag LOCUS_41800 gene nblB 3328 2666 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141257.1 protein_id gnl|my_center|LOCUS_41800 3574 4746 gene locus_tag LOCUS_41810 gene recF 3574 4746 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG79 protein_id gnl|my_center|LOCUS_41810 5334 4795 gene locus_tag LOCUS_41820 5334 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 6137 5766 gene locus_tag LOCUS_41830 6137 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 7478 6153 gene locus_tag LOCUS_41840 7478 6153 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476585.1 protein_id gnl|my_center|LOCUS_41840 >Feature sequence295 1121 1516 gene locus_tag LOCUS_41850 1121 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 1782 2870 gene locus_tag LOCUS_41860 1782 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 3260 2949 gene locus_tag LOCUS_41870 3260 2949 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141908.1 protein_id gnl|my_center|LOCUS_41870 3526 3257 gene locus_tag LOCUS_41880 3526 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 3848 3663 gene locus_tag LOCUS_41890 3848 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 4212 3784 gene locus_tag LOCUS_41900 4212 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 5626 4505 gene locus_tag LOCUS_41910 5626 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 >Feature sequence296 258 800 gene locus_tag LOCUS_41920 258 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 929 2314 gene locus_tag LOCUS_41930 929 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 4076 2343 gene locus_tag LOCUS_41940 gene hflX 4076 2343 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDU0 protein_id gnl|my_center|LOCUS_41940 >Feature sequence297 556 248 gene locus_tag LOCUS_41950 556 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 858 655 gene locus_tag LOCUS_41960 858 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 2218 1028 gene locus_tag LOCUS_41970 2218 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 3444 2344 gene locus_tag LOCUS_41980 gene potA 3444 2344 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBU2 protein_id gnl|my_center|LOCUS_41980 6840 3670 gene locus_tag LOCUS_41990 6840 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 >Feature sequence298 <1 583 gene locus_tag LOCUS_42000 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJZ1:deoxyribose-phosphate aldolase 642 1877 gene locus_tag LOCUS_42010 642 1877 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056970.1 protein_id gnl|my_center|LOCUS_42010 2211 1993 gene locus_tag LOCUS_42020 2211 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 2570 2498 gene locus_tag LOCUS_t00270 2570 2498 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2897 2694 gene locus_tag LOCUS_42030 2897 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 3792 3016 gene locus_tag LOCUS_42040 gene hisF 3792 3016 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN7 protein_id gnl|my_center|LOCUS_42040 4582 3875 gene locus_tag LOCUS_42050 4582 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 4989 5178 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcattactattttcaggagtttctg 7277 6477 gene locus_tag LOCUS_42060 7277 6477 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057314.1 protein_id gnl|my_center|LOCUS_42060 >Feature sequence299 536 1606 gene locus_tag LOCUS_42070 gene fbp 536 1606 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF2 protein_id gnl|my_center|LOCUS_42070 1685 2830 gene locus_tag LOCUS_42080 gene tal 1685 2830 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFZ7 protein_id gnl|my_center|LOCUS_42080 2974 4503 gene locus_tag LOCUS_42090 gene zwf 2974 4503 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF3 protein_id gnl|my_center|LOCUS_42090 4693 6024 gene locus_tag LOCUS_42100 gene opcA 4693 6024 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 protein_id gnl|my_center|LOCUS_42100 6257 7054 gene locus_tag LOCUS_42110 6257 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 6943 7410 gene locus_tag LOCUS_42120 6943 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 >Feature sequence300 4151 3375 gene locus_tag LOCUS_42130 gene sigF 4151 3375 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_42130 4593 4850 gene locus_tag LOCUS_42140 4593 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 4905 5831 gene locus_tag LOCUS_42150 gene thrB 4905 5831 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI27 protein_id gnl|my_center|LOCUS_42150 >Feature sequence301 463 218 gene locus_tag LOCUS_42160 463 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 813 463 gene locus_tag LOCUS_42170 813 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 1429 929 gene locus_tag LOCUS_42180 1429 929 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249869.1 protein_id gnl|my_center|LOCUS_42180 1671 1426 gene locus_tag LOCUS_42190 1671 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 2418 1726 gene locus_tag LOCUS_42200 2418 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 2740 2408 gene locus_tag LOCUS_42210 2740 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 2943 3161 gene locus_tag LOCUS_42220 2943 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 3601 4146 gene locus_tag LOCUS_42230 3601 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 4053 4877 gene locus_tag LOCUS_42240 4053 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 5765 6163 gene locus_tag LOCUS_42250 5765 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 >Feature sequence302 1045 140 gene locus_tag LOCUS_42260 1045 140 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056436.1 protein_id gnl|my_center|LOCUS_42260 1342 1133 gene locus_tag LOCUS_42270 1342 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 3728 1371 gene locus_tag LOCUS_42280 3728 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 4785 3778 gene locus_tag LOCUS_42290 gene chlG 4785 3778 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057379.1 protein_id gnl|my_center|LOCUS_42290 5968 4871 gene locus_tag LOCUS_42300 5968 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 protein_id gnl|my_center|LOCUS_42300 6425 6222 gene locus_tag LOCUS_42310 6425 6222 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056374.1 protein_id gnl|my_center|LOCUS_42310 6645 7172 gene locus_tag LOCUS_42320 gene cpcS 6645 7172 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI91 protein_id gnl|my_center|LOCUS_42320 >Feature sequence303 923 3031 gene locus_tag LOCUS_42330 923 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056358.1 protein_id gnl|my_center|LOCUS_42330 7097 3537 gene locus_tag LOCUS_42340 7097 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 >Feature sequence304 3182 3586 gene locus_tag LOCUS_42350 3182 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 4192 3785 gene locus_tag LOCUS_42360 4192 3785 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142135.1 protein_id gnl|my_center|LOCUS_42360 5275 4256 gene locus_tag LOCUS_42370 5275 4256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_42370 5352 5561 gene locus_tag LOCUS_42380 5352 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 6542 5562 gene locus_tag LOCUS_42390 6542 5562 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_42390 >Feature sequence305 1710 862 gene locus_tag LOCUS_42400 1710 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140768.1 protein_id gnl|my_center|LOCUS_42400 2132 1710 gene locus_tag LOCUS_42410 2132 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140769.1 protein_id gnl|my_center|LOCUS_42410 2462 2656 gene locus_tag LOCUS_42420 2462 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 2894 3754 gene locus_tag LOCUS_42430 2894 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 >Feature sequence306 596 1330 gene locus_tag LOCUS_42440 596 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 protein_id gnl|my_center|LOCUS_42440 1455 2087 gene locus_tag LOCUS_42450 gene nusB 1455 2087 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKZ0 protein_id gnl|my_center|LOCUS_42450 2147 3916 gene locus_tag LOCUS_42460 gene recN 2147 3916 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNY7 protein_id gnl|my_center|LOCUS_42460 4735 4022 gene locus_tag LOCUS_42470 4735 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 4887 5591 gene locus_tag LOCUS_42480 4887 5591 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_42480 5603 6016 gene locus_tag LOCUS_42490 5603 6016 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_42490 6223 6969 gene locus_tag LOCUS_42500 gene aqpZ 6223 6969 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNP3 protein_id gnl|my_center|LOCUS_42500 >Feature sequence307 454 1632 gene locus_tag LOCUS_42510 454 1632 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252784.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42510 1691 1876 gene locus_tag LOCUS_42520 1691 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 2626 1907 gene locus_tag LOCUS_42530 2626 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029459.1 protein_id gnl|my_center|LOCUS_42530 3306 4253 gene locus_tag LOCUS_42540 3306 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141161.1 protein_id gnl|my_center|LOCUS_42540 6477 4384 gene locus_tag LOCUS_42550 6477 4384 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_42550 >Feature sequence308 913 278 gene locus_tag LOCUS_42560 913 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 1216 1401 gene locus_tag LOCUS_42570 1216 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143955.1 protein_id gnl|my_center|LOCUS_42570 1795 2490 gene locus_tag LOCUS_42580 gene tpiA 1795 2490 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA0 protein_id gnl|my_center|LOCUS_42580 2551 3402 gene locus_tag LOCUS_42590 gene folP 2551 3402 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ9 protein_id gnl|my_center|LOCUS_42590 4199 3393 gene locus_tag LOCUS_42600 4199 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 4732 5811 gene locus_tag LOCUS_42610 4732 5811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_42610 6769 5846 gene locus_tag LOCUS_42620 6769 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 >Feature sequence309 434 1372 gene locus_tag LOCUS_42630 gene queG 434 1372 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA9 protein_id gnl|my_center|LOCUS_42630 2268 1591 gene locus_tag LOCUS_42640 2268 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 4158 2731 gene locus_tag LOCUS_42650 4158 2731 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_42650 6359 4272 gene locus_tag LOCUS_42660 6359 4272 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087242.1 protein_id gnl|my_center|LOCUS_42660 7047 6397 gene locus_tag LOCUS_42670 7047 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056209.1 protein_id gnl|my_center|LOCUS_42670 >Feature sequence310 712 185 gene locus_tag LOCUS_42680 712 185 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_42680 1374 784 gene locus_tag LOCUS_42690 1374 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 1816 3321 gene locus_tag LOCUS_42700 1816 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 4657 3329 gene locus_tag LOCUS_42710 gene purA 4657 3329 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG2 protein_id gnl|my_center|LOCUS_42710 5791 4895 gene locus_tag LOCUS_42720 5791 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 6586 5864 gene locus_tag LOCUS_42730 gene bioD 6586 5864 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB5 protein_id gnl|my_center|LOCUS_42730 >Feature sequence311 3323 2832 gene locus_tag LOCUS_42740 3323 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 4014 3415 gene locus_tag LOCUS_42750 4014 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 4122 5270 gene locus_tag LOCUS_42760 4122 5270 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIN0 protein_id gnl|my_center|LOCUS_42760 5638 5372 gene locus_tag LOCUS_42770 5638 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 5724 6203 gene locus_tag LOCUS_42780 5724 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 6710 6204 gene locus_tag LOCUS_42790 6710 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058114.1 protein_id gnl|my_center|LOCUS_42790 >Feature sequence312 1137 1 gene locus_tag LOCUS_42800 1137 1 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057332.1 protein_id gnl|my_center|LOCUS_42800 1285 2931 gene locus_tag LOCUS_42810 1285 2931 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_42810 3321 4631 gene locus_tag LOCUS_42820 3321 4631 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_42820 5776 4694 gene locus_tag LOCUS_42830 gene pfkA 5776 4694 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ7 protein_id gnl|my_center|LOCUS_42830 5881 6204 gene locus_tag LOCUS_42840 5881 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 6421 6615 gene locus_tag LOCUS_42850 6421 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 >Feature sequence313 823 3417 gene locus_tag LOCUS_42860 823 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 3631 4932 gene locus_tag LOCUS_42870 3631 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 5087 6085 gene locus_tag LOCUS_42880 gene hemB 5087 6085 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_42880 6319 6750 gene locus_tag LOCUS_42890 6319 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 >Feature sequence314 412 245 gene locus_tag LOCUS_42900 412 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 519 3242 gene locus_tag LOCUS_42910 519 3242 CDS product DNA modification methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888895.1 protein_id gnl|my_center|LOCUS_42910 3850 3464 gene locus_tag LOCUS_42920 3850 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 4918 4085 gene locus_tag LOCUS_42930 4918 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057694.1 protein_id gnl|my_center|LOCUS_42930 <6894 4932 gene locus_tag LOCUS_42940 <6894 4932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057626.1:outer membrane protein assembly factor >Feature sequence315 2802 1714 gene locus_tag LOCUS_42950 gene leuB 2802 1714 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59029 protein_id gnl|my_center|LOCUS_42950 3732 3253 gene locus_tag LOCUS_42960 3732 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 3818 4159 gene locus_tag LOCUS_42970 3818 4159 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 protein_id gnl|my_center|LOCUS_42970 5247 4180 gene locus_tag LOCUS_42980 5247 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55584 protein_id gnl|my_center|LOCUS_42980 6700 5258 gene locus_tag LOCUS_42990 6700 5258 CDS product putative GMC-type oxidoreductase y4nJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55582 protein_id gnl|my_center|LOCUS_42990 >Feature sequence316 47 496 gene locus_tag LOCUS_43000 47 496 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810818.1 protein_id gnl|my_center|LOCUS_43000 1635 493 gene locus_tag LOCUS_43010 gene carA 1635 493 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU5 protein_id gnl|my_center|LOCUS_43010 3010 1790 gene locus_tag LOCUS_43020 3010 1790 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403015.1 protein_id gnl|my_center|LOCUS_43020 3382 3636 gene locus_tag LOCUS_43030 3382 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 3796 5289 gene locus_tag LOCUS_43040 3796 5289 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 protein_id gnl|my_center|LOCUS_43040 5657 6202 gene locus_tag LOCUS_43050 gene cysC 5657 6202 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN99 protein_id gnl|my_center|LOCUS_43050 >Feature sequence317 259 573 gene locus_tag LOCUS_43060 259 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 896 1294 gene locus_tag LOCUS_43070 896 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 1456 2880 gene locus_tag LOCUS_43080 1456 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 2899 4383 gene locus_tag LOCUS_43090 2899 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 5664 4486 gene locus_tag LOCUS_43100 5664 4486 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F7G9 protein_id gnl|my_center|LOCUS_43100 6308 5661 gene locus_tag LOCUS_43110 6308 5661 CDS product type II restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_208279.1 protein_id gnl|my_center|LOCUS_43110 >Feature sequence318 586 1239 gene locus_tag LOCUS_43120 586 1239 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055917.1 protein_id gnl|my_center|LOCUS_43120 1584 1372 gene locus_tag LOCUS_43130 1584 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 2090 3325 gene locus_tag LOCUS_43140 2090 3325 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_43140 3594 4856 gene locus_tag LOCUS_43150 3594 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 >Feature sequence319 372 1136 gene locus_tag LOCUS_43160 372 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 1813 1331 gene locus_tag LOCUS_43170 1813 1331 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142677.1 protein_id gnl|my_center|LOCUS_43170 3071 1869 gene locus_tag LOCUS_43180 3071 1869 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_43180 5155 3200 gene locus_tag LOCUS_43190 gene ftsH 5155 3200 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGM7 protein_id gnl|my_center|LOCUS_43190 5834 5175 gene locus_tag LOCUS_43200 5834 5175 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946895.1 protein_id gnl|my_center|LOCUS_43200 6424 6203 gene locus_tag LOCUS_43210 6424 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43210 >Feature sequence320 823 149 gene locus_tag LOCUS_43220 823 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141416.1 protein_id gnl|my_center|LOCUS_43220 1473 1105 gene locus_tag LOCUS_43230 1473 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 2073 3155 gene locus_tag LOCUS_43240 2073 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 3289 4965 gene locus_tag LOCUS_43250 3289 4965 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057298.1 protein_id gnl|my_center|LOCUS_43250 >Feature sequence321 1143 2918 gene locus_tag LOCUS_43260 1143 2918 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_43260 2968 3687 gene locus_tag LOCUS_43270 2968 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 3700 4887 gene locus_tag LOCUS_43280 3700 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 4907 6034 gene locus_tag LOCUS_43290 4907 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 >Feature sequence322 2950 74 gene locus_tag LOCUS_43300 2950 74 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142684.1 protein_id gnl|my_center|LOCUS_43300 4594 3032 gene locus_tag LOCUS_43310 gene kaiC 4594 3032 CDS product circadian clock protein kinase KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V60 protein_id gnl|my_center|LOCUS_43310 5116 4802 gene locus_tag LOCUS_43320 gene kaiB 5116 4802 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V61 protein_id gnl|my_center|LOCUS_43320 6333 5386 gene locus_tag LOCUS_43330 gene kaiA 6333 5386 CDS product circadian clock protein KaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V62 protein_id gnl|my_center|LOCUS_43330 >Feature sequence323 790 431 gene locus_tag LOCUS_43340 790 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 2240 900 gene locus_tag LOCUS_43350 2240 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 2421 2972 gene locus_tag LOCUS_43360 2421 2972 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 protein_id gnl|my_center|LOCUS_43360 5742 3469 gene locus_tag LOCUS_43370 5742 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_43370 >Feature sequence324 <1 1008 gene locus_tag LOCUS_43380 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLF8:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG 1349 2035 gene locus_tag LOCUS_43390 gene chlM 1349 2035 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056304.1 protein_id gnl|my_center|LOCUS_43390 2522 2124 gene locus_tag LOCUS_43400 2522 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 3461 2694 gene locus_tag LOCUS_43410 gene map 3461 2694 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX4 protein_id gnl|my_center|LOCUS_43410 3951 3577 gene locus_tag LOCUS_43420 3951 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144314.1 protein_id gnl|my_center|LOCUS_43420 4917 4552 gene locus_tag LOCUS_43430 4917 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 5942 4914 gene locus_tag LOCUS_43440 gene ccsA 5942 4914 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIH3 protein_id gnl|my_center|LOCUS_43440 >Feature sequence325 527 457 gene locus_tag LOCUS_t00280 527 457 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 749 2758 gene locus_tag LOCUS_43450 gene dnaK3 749 2758 CDS product chaperone protein dnaK3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH10 protein_id gnl|my_center|LOCUS_43450 3007 4005 gene locus_tag LOCUS_43460 gene dnaJ 3007 4005 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057983.1 protein_id gnl|my_center|LOCUS_43460 4217 4921 gene locus_tag LOCUS_43470 4217 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 4959 5315 gene locus_tag LOCUS_43480 4959 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 5360 6193 gene locus_tag LOCUS_43490 5360 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 >Feature sequence326 874 1077 gene locus_tag LOCUS_43500 874 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 1330 2478 gene locus_tag LOCUS_43510 1330 2478 CDS product UPF0284 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGL0 protein_id gnl|my_center|LOCUS_43510 2939 2544 gene locus_tag LOCUS_43520 2939 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055984.1 protein_id gnl|my_center|LOCUS_43520 3783 4322 gene locus_tag LOCUS_43530 gene cpcS 3783 4322 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKE7 protein_id gnl|my_center|LOCUS_43530 4328 5455 gene locus_tag LOCUS_43540 4328 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056563.1 protein_id gnl|my_center|LOCUS_43540 5540 5977 gene locus_tag LOCUS_43550 5540 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 >Feature sequence327 357 737 gene locus_tag LOCUS_43560 357 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 1111 902 gene locus_tag LOCUS_43570 1111 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 3160 1529 gene locus_tag LOCUS_43580 3160 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_43580 3266 3454 gene locus_tag LOCUS_43590 3266 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 <6540 3473 gene locus_tag LOCUS_43600 <6540 3473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257272.1:Na-Ca exchanger/integrin-beta4 >Feature sequence328 1503 739 gene locus_tag LOCUS_43610 1503 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 1984 1493 gene locus_tag LOCUS_43620 1984 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142174.1 protein_id gnl|my_center|LOCUS_43620 2120 2941 gene locus_tag LOCUS_43630 2120 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 3202 3558 gene locus_tag LOCUS_43640 3202 3558 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141611.1 protein_id gnl|my_center|LOCUS_43640 3790 3960 gene locus_tag LOCUS_43650 3790 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43650 3908 4132 gene locus_tag LOCUS_43660 3908 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43660 5295 6245 gene locus_tag LOCUS_43670 5295 6245 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087234.1 protein_id gnl|my_center|LOCUS_43670 >Feature sequence329 563 96 gene locus_tag LOCUS_43680 563 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 1116 1358 gene locus_tag LOCUS_43690 1116 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 2829 1438 gene locus_tag LOCUS_43700 2829 1438 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP5 protein_id gnl|my_center|LOCUS_43700 4538 3087 gene locus_tag LOCUS_43710 gene gatA 4538 3087 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK65 protein_id gnl|my_center|LOCUS_43710 4718 5587 gene locus_tag LOCUS_43720 4718 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 >Feature sequence330 703 1317 gene locus_tag LOCUS_43730 703 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 1610 1350 gene locus_tag LOCUS_43740 1610 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 1760 2449 gene locus_tag LOCUS_43750 1760 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 2542 3213 gene locus_tag LOCUS_43760 2542 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 3669 3124 gene locus_tag LOCUS_43770 3669 3124 CDS product IS607 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404760.1 protein_id gnl|my_center|LOCUS_43770 3894 5078 gene locus_tag LOCUS_43780 gene dxr 3894 5078 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK30 protein_id gnl|my_center|LOCUS_43780 5711 5199 gene locus_tag LOCUS_43790 5711 5199 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 protein_id gnl|my_center|LOCUS_43790 <6523 5929 gene locus_tag LOCUS_43800 <6523 5929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143084.1:4-hydroxyphenylpyruvate dioxygenase >Feature sequence331 <1 1345 gene locus_tag LOCUS_43810 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257974.1:teicoplanin resistance protein VanZ 1404 1706 gene locus_tag LOCUS_43820 1404 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 1697 1939 gene locus_tag LOCUS_43830 1697 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 2952 1978 gene locus_tag LOCUS_43840 2952 1978 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_43840 3469 4743 gene locus_tag LOCUS_43850 3469 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 4785 5768 gene locus_tag LOCUS_43860 4785 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 >Feature sequence332 <1 736 gene locus_tag LOCUS_43870 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085968.1:branched-chain amino acid ABC transporter permease 1698 2705 gene locus_tag LOCUS_43880 gene uge 1698 2705 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_43880 2896 3138 gene locus_tag LOCUS_43890 2896 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 3735 3169 gene locus_tag LOCUS_43900 3735 3169 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141084.1 protein_id gnl|my_center|LOCUS_43900 3856 4593 gene locus_tag LOCUS_43910 3856 4593 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_43910 4989 4627 gene locus_tag LOCUS_43920 4989 4627 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHW4 protein_id gnl|my_center|LOCUS_43920 5715 5059 gene locus_tag LOCUS_43930 5715 5059 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_43930 6122 6460 gene locus_tag LOCUS_43940 gene glnB 6122 6460 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140260.1 protein_id gnl|my_center|LOCUS_43940 >Feature sequence333 883 518 gene locus_tag LOCUS_43950 883 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 992 2182 gene locus_tag LOCUS_43960 992 2182 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403015.1 protein_id gnl|my_center|LOCUS_43960 2509 2255 gene locus_tag LOCUS_43970 2509 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 4518 2647 gene locus_tag LOCUS_43980 gene ndhF4 4518 2647 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057958.1 protein_id gnl|my_center|LOCUS_43980 >Feature sequence334 2855 522 gene locus_tag LOCUS_43990 2855 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 4786 3524 gene locus_tag LOCUS_44000 4786 3524 CDS product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056562.1 protein_id gnl|my_center|LOCUS_44000 4903 5151 gene locus_tag LOCUS_44010 gene ycf34 4903 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 protein_id gnl|my_center|LOCUS_44010 >Feature sequence335 1495 1199 gene locus_tag LOCUS_44020 1495 1199 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_44020 3318 1609 gene locus_tag LOCUS_44030 3318 1609 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057909.1 protein_id gnl|my_center|LOCUS_44030 4288 3719 gene locus_tag LOCUS_44040 4288 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 >Feature sequence336 2356 1931 gene locus_tag LOCUS_44050 2356 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 2598 3089 gene locus_tag LOCUS_44060 2598 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 3274 3426 gene locus_tag LOCUS_44070 3274 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 3534 3722 gene locus_tag LOCUS_44080 3534 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 3913 4107 gene locus_tag LOCUS_44090 3913 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 4104 4436 gene locus_tag LOCUS_44100 4104 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 4424 4711 gene locus_tag LOCUS_44110 4424 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 4906 5148 gene locus_tag LOCUS_44120 4906 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 6260 5322 gene locus_tag LOCUS_44130 6260 5322 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143340.1 protein_id gnl|my_center|LOCUS_44130 >Feature sequence337 1189 2469 gene locus_tag LOCUS_44140 1189 2469 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_44140 2483 3016 gene locus_tag LOCUS_44150 gene def2 2483 3016 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGB1 protein_id gnl|my_center|LOCUS_44150 3102 3671 gene locus_tag LOCUS_44160 3102 3671 CDS product tellurium resistance protein TerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116680.1 protein_id gnl|my_center|LOCUS_44160 3714 4286 gene locus_tag LOCUS_44170 3714 4286 CDS product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116677.1 protein_id gnl|my_center|LOCUS_44170 4527 5522 gene locus_tag LOCUS_44180 4527 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 >Feature sequence338 <1 1347 gene locus_tag LOCUS_44190 <1 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056194.1:sulfite reductase subunit beta 1457 2242 gene locus_tag LOCUS_44200 1457 2242 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI45 protein_id gnl|my_center|LOCUS_44200 2562 3032 gene locus_tag LOCUS_44210 2562 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 3204 4073 gene locus_tag LOCUS_44220 3204 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 4393 6000 gene locus_tag LOCUS_44230 4393 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_44230 >Feature sequence339 >Feature sequence340 1592 810 gene locus_tag LOCUS_44240 1592 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 2923 1622 gene locus_tag LOCUS_44250 2923 1622 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338730.1 protein_id gnl|my_center|LOCUS_44250 5969 2952 gene locus_tag LOCUS_44260 5969 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 >Feature sequence341 1258 662 gene locus_tag LOCUS_44270 gene ureG 1258 662 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ4 protein_id gnl|my_center|LOCUS_44270 1981 1304 gene locus_tag LOCUS_44280 gene ureF 1981 1304 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ63 protein_id gnl|my_center|LOCUS_44280 2429 1992 gene locus_tag LOCUS_44290 gene ureE 2429 1992 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ62 protein_id gnl|my_center|LOCUS_44290 2573 3796 gene locus_tag LOCUS_44300 2573 3796 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058279.1 protein_id gnl|my_center|LOCUS_44300 3899 4450 gene locus_tag LOCUS_44310 3899 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144066.1 protein_id gnl|my_center|LOCUS_44310 >Feature sequence342 1140 364 gene locus_tag LOCUS_44320 1140 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 1176 2177 gene locus_tag LOCUS_44330 1176 2177 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057413.1 protein_id gnl|my_center|LOCUS_44330 2607 3641 gene locus_tag LOCUS_44340 2607 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 4292 3705 gene locus_tag LOCUS_44350 4292 3705 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674343.1 protein_id gnl|my_center|LOCUS_44350 5020 4382 gene locus_tag LOCUS_44360 5020 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 5684 5010 gene locus_tag LOCUS_44370 5684 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 >Feature sequence343 1520 1188 gene locus_tag LOCUS_44380 1520 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 3167 2982 gene locus_tag LOCUS_44390 3167 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 3452 3255 gene locus_tag LOCUS_44400 3452 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 4216 4506 gene locus_tag LOCUS_44410 4216 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 4524 4961 gene locus_tag LOCUS_44420 4524 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 5001 5186 gene locus_tag LOCUS_44430 5001 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 5329 5889 gene locus_tag LOCUS_44440 5329 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 >Feature sequence344 513 2585 gene locus_tag LOCUS_44450 513 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 2813 3250 gene locus_tag LOCUS_44460 2813 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 4024 4239 gene locus_tag LOCUS_44470 4024 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 5336 5599 gene locus_tag LOCUS_44480 5336 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 >Feature sequence345 667 2187 gene locus_tag LOCUS_44490 gene psbB 667 2187 CDS product photosystem II CP47 reaction center protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ1 protein_id gnl|my_center|LOCUS_44490 2679 3260 gene locus_tag LOCUS_44500 gene nrdR 2679 3260 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHT4 protein_id gnl|my_center|LOCUS_44500 4105 5301 gene locus_tag LOCUS_44510 gene rps1 4105 5301 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 protein_id gnl|my_center|LOCUS_44510 5610 5948 gene locus_tag LOCUS_44520 5610 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 >Feature sequence346 254 499 gene locus_tag LOCUS_44530 254 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 1079 585 gene locus_tag LOCUS_44540 1079 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 1525 1142 gene locus_tag LOCUS_44550 1525 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 1719 1958 gene locus_tag LOCUS_44560 1719 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 2017 2193 gene locus_tag LOCUS_44570 2017 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 4408 2483 gene locus_tag LOCUS_44580 4408 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 >Feature sequence347 1430 174 gene locus_tag LOCUS_44590 1430 174 CDS product serine protease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_44590 2231 2620 gene locus_tag LOCUS_44600 2231 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44600 3036 3197 gene locus_tag LOCUS_44610 3036 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 5541 5960 gene locus_tag LOCUS_44620 5541 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 >Feature sequence348 1565 228 gene locus_tag LOCUS_44630 1565 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 1910 2287 gene locus_tag LOCUS_44640 1910 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 2534 2277 gene locus_tag LOCUS_44650 2534 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 5662 2777 gene locus_tag LOCUS_44660 5662 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 >Feature sequence349 2640 1672 gene locus_tag LOCUS_44670 2640 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 3756 2644 gene locus_tag LOCUS_44680 3756 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_44680 4889 3753 gene locus_tag LOCUS_44690 4889 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_44690 5093 4920 gene locus_tag LOCUS_44700 5093 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 5032 5637 gene locus_tag LOCUS_44710 5032 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144203.1 protein_id gnl|my_center|LOCUS_44710 >Feature sequence350 563 1705 gene locus_tag LOCUS_44720 563 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 1806 2387 gene locus_tag LOCUS_44730 1806 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 2414 3019 gene locus_tag LOCUS_44740 2414 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 3019 3399 gene locus_tag LOCUS_44750 3019 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 3396 3659 gene locus_tag LOCUS_44760 3396 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 3659 3838 gene locus_tag LOCUS_44770 3659 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 3879 4052 gene locus_tag LOCUS_44780 3879 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 4228 4055 gene locus_tag LOCUS_44790 4228 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 4227 4820 gene locus_tag LOCUS_44800 4227 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 5293 4937 gene locus_tag LOCUS_44810 5293 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 >Feature sequence351 1452 856 gene locus_tag LOCUS_44820 gene wcaJ 1452 856 CDS product galactosyl-1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125542.1 protein_id gnl|my_center|LOCUS_44820 2969 1791 gene locus_tag LOCUS_44830 2969 1791 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_44830 3663 5702 gene locus_tag LOCUS_44840 3663 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 >Feature sequence352 481 3432 gene locus_tag LOCUS_44850 481 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 3864 3502 gene locus_tag LOCUS_44860 3864 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 4918 3902 gene locus_tag LOCUS_44870 4918 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022977.1 protein_id gnl|my_center|LOCUS_44870 5409 5161 gene locus_tag LOCUS_44880 5409 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 >Feature sequence353 >Feature sequence354 1181 507 gene locus_tag LOCUS_44890 gene nfi 1181 507 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGM4 protein_id gnl|my_center|LOCUS_44890 1816 1178 gene locus_tag LOCUS_44900 1816 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144275.1 protein_id gnl|my_center|LOCUS_44900 2665 1823 gene locus_tag LOCUS_44910 2665 1823 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110291.1 protein_id gnl|my_center|LOCUS_44910 3231 2662 gene locus_tag LOCUS_44920 3231 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104398.1 protein_id gnl|my_center|LOCUS_44920 3797 3237 gene locus_tag LOCUS_44930 gene kptA 3797 3237 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW7 protein_id gnl|my_center|LOCUS_44930 3917 5260 gene locus_tag LOCUS_44940 3917 5260 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 protein_id gnl|my_center|LOCUS_44940 >Feature sequence355 1175 450 gene locus_tag LOCUS_44950 1175 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 2914 1208 gene locus_tag LOCUS_44960 2914 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143446.1 protein_id gnl|my_center|LOCUS_44960 3126 2929 gene locus_tag LOCUS_44970 3126 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 3125 3310 gene locus_tag LOCUS_44980 3125 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 3702 4556 gene locus_tag LOCUS_44990 3702 4556 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583420.1 protein_id gnl|my_center|LOCUS_44990 4672 4872 gene locus_tag LOCUS_45000 4672 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 5139 5588 gene locus_tag LOCUS_45010 gene hspA 5139 5588 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_45010 >Feature sequence356 402 178 gene locus_tag LOCUS_45020 402 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_45020 658 392 gene locus_tag LOCUS_45030 658 392 CDS product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_45030 1571 846 gene locus_tag LOCUS_45040 1571 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_45040 3932 1581 gene locus_tag LOCUS_45050 3932 1581 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057757.1 protein_id gnl|my_center|LOCUS_45050 4341 4634 gene locus_tag LOCUS_45060 4341 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 >Feature sequence357 72 818 gene locus_tag LOCUS_45070 gene comB 72 818 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS5 protein_id gnl|my_center|LOCUS_45070 1041 2048 gene locus_tag LOCUS_45080 1041 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 2259 2468 gene locus_tag LOCUS_45090 2259 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 2622 2894 gene locus_tag LOCUS_45100 2622 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 >Feature sequence358 127 687 gene locus_tag LOCUS_45110 127 687 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141816.1 protein_id gnl|my_center|LOCUS_45110 2314 806 gene locus_tag LOCUS_45120 gene ycf46 2314 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_45120 2817 2311 gene locus_tag LOCUS_45130 2817 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055932.1 protein_id gnl|my_center|LOCUS_45130 3336 2851 gene locus_tag LOCUS_45140 3336 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056447.1 protein_id gnl|my_center|LOCUS_45140 4632 3529 gene locus_tag LOCUS_45150 gene yidC 4632 3529 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL96 protein_id gnl|my_center|LOCUS_45150 5205 4813 gene locus_tag LOCUS_45160 5205 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45160 5633 5205 gene locus_tag LOCUS_45170 5633 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45170 >Feature sequence359 1783 980 gene locus_tag LOCUS_45180 1783 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986634.1 protein_id gnl|my_center|LOCUS_45180 1847 2272 gene locus_tag LOCUS_45190 1847 2272 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143244.1 protein_id gnl|my_center|LOCUS_45190 3574 2342 gene locus_tag LOCUS_45200 3574 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 4504 4067 gene locus_tag LOCUS_45210 gene psbU 4504 4067 CDS product photosystem II 12 kDa extrinsic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F1L5 protein_id gnl|my_center|LOCUS_45210 >Feature sequence360 326 1606 gene locus_tag LOCUS_45220 326 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 1628 2215 gene locus_tag LOCUS_45230 1628 2215 CDS product TIGR04376 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140547.1 protein_id gnl|my_center|LOCUS_45230 2308 2841 gene locus_tag LOCUS_45240 2308 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 2895 3923 gene locus_tag LOCUS_45250 2895 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 5229 4123 gene locus_tag LOCUS_45260 5229 4123 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_45260 >Feature sequence361 <1 4671 gene locus_tag LOCUS_45270 <1 4671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142295.1:sugar-non-specific nuclease NucA-like protein 5486 4851 gene locus_tag LOCUS_45280 5486 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 >Feature sequence362 1394 1324 gene locus_tag LOCUS_t00290 1394 1324 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4926 1459 gene locus_tag LOCUS_45290 4926 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 >Feature sequence363 <1 1732 gene locus_tag LOCUS_45300 <1 1732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056417.1:methyl-accepting chemotaxis protein 1954 4716 gene locus_tag LOCUS_45310 1954 4716 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056416.1 protein_id gnl|my_center|LOCUS_45310 5033 4815 gene locus_tag LOCUS_45320 5033 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 >Feature sequence364 900 184 gene locus_tag LOCUS_45330 900 184 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144247.1 protein_id gnl|my_center|LOCUS_45330 1840 1073 gene locus_tag LOCUS_45340 1840 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058247.1 protein_id gnl|my_center|LOCUS_45340 2418 1879 gene locus_tag LOCUS_45350 2418 1879 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_45350 3212 4015 gene locus_tag LOCUS_45360 3212 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 4648 4490 gene locus_tag LOCUS_45370 4648 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 4839 5600 gene locus_tag LOCUS_45380 4839 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 >Feature sequence365 3 818 gene locus_tag LOCUS_45390 3 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 1753 998 gene locus_tag LOCUS_45400 1753 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 2237 1800 gene locus_tag LOCUS_45410 2237 1800 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057581.1 protein_id gnl|my_center|LOCUS_45410 2800 2297 gene locus_tag LOCUS_45420 2800 2297 CDS product TIGR02652 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058200.1 protein_id gnl|my_center|LOCUS_45420 2912 3457 gene locus_tag LOCUS_45430 2912 3457 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056687.1 protein_id gnl|my_center|LOCUS_45430 3669 3511 gene locus_tag LOCUS_45440 3669 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 >Feature sequence366 871 1806 gene locus_tag LOCUS_45450 871 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 3028 2012 gene locus_tag LOCUS_45460 gene prs 3028 2012 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN6 protein_id gnl|my_center|LOCUS_45460 3268 3726 gene locus_tag LOCUS_45470 3268 3726 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_45470 >Feature sequence367 2881 4563 gene locus_tag LOCUS_45480 2881 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 4576 5475 gene locus_tag LOCUS_45490 4576 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 >Feature sequence368 334 2013 gene locus_tag LOCUS_45500 334 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 4024 2672 gene locus_tag LOCUS_45510 gene ndh 4024 2672 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_45510 4374 4198 gene locus_tag LOCUS_45520 4374 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 4949 4749 gene locus_tag LOCUS_45530 4949 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 5361 5170 gene locus_tag LOCUS_45540 5361 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 >Feature sequence369 486 938 gene locus_tag LOCUS_45550 gene hspA 486 938 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_45550 1174 2478 gene locus_tag LOCUS_45560 1174 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 3040 2654 gene locus_tag LOCUS_45570 3040 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 3467 5044 gene locus_tag LOCUS_45580 3467 5044 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 protein_id gnl|my_center|LOCUS_45580 >Feature sequence370 634 191 gene locus_tag LOCUS_45590 634 191 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_45590 1560 871 gene locus_tag LOCUS_45600 1560 871 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_45600 4284 1639 gene locus_tag LOCUS_45610 4284 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 >Feature sequence371 366 599 gene locus_tag LOCUS_45620 366 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 667 1041 gene locus_tag LOCUS_45630 667 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 1310 1633 gene locus_tag LOCUS_45640 1310 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 1784 2017 gene locus_tag LOCUS_45650 1784 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 3259 2306 gene locus_tag LOCUS_45660 3259 2306 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087234.1 protein_id gnl|my_center|LOCUS_45660 3616 4128 gene locus_tag LOCUS_45670 3616 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 4132 4746 gene locus_tag LOCUS_45680 4132 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 >Feature sequence372 172 405 gene locus_tag LOCUS_45690 172 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 466 759 gene locus_tag LOCUS_45700 466 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 822 1058 gene locus_tag LOCUS_45710 822 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 1021 1314 gene locus_tag LOCUS_45720 1021 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 1345 1941 gene locus_tag LOCUS_45730 gene wgeA 1345 1941 CDS product hemolysin expression modulating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529018.1 protein_id gnl|my_center|LOCUS_45730 2274 2035 gene locus_tag LOCUS_45740 2274 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 3184 2648 gene locus_tag LOCUS_45750 gene accB 3184 2648 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124182.1 protein_id gnl|my_center|LOCUS_45750 3838 3275 gene locus_tag LOCUS_45760 gene efp 3838 3275 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD3 protein_id gnl|my_center|LOCUS_45760 3983 5113 gene locus_tag LOCUS_45770 3983 5113 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 protein_id gnl|my_center|LOCUS_45770 >Feature sequence373 793 551 gene locus_tag LOCUS_45780 793 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45780 1454 2443 gene locus_tag LOCUS_45790 1454 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45790 2412 3656 gene locus_tag LOCUS_45800 2412 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45800 3735 4172 gene locus_tag LOCUS_45810 3735 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45810 4266 4454 gene locus_tag LOCUS_45820 4266 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 4575 4880 gene locus_tag LOCUS_45830 4575 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45830 4965 5153 gene locus_tag LOCUS_45840 4965 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45840 >Feature sequence374 865 494 gene locus_tag LOCUS_45850 865 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 954 2051 gene locus_tag LOCUS_45860 954 2051 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058201.1 protein_id gnl|my_center|LOCUS_45860 2100 2696 gene locus_tag LOCUS_45870 2100 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 3210 3464 gene locus_tag LOCUS_45880 3210 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 4914 3649 gene locus_tag LOCUS_45890 4914 3649 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_45890 >Feature sequence375 1444 1854 gene locus_tag LOCUS_45900 1444 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141413.1 protein_id gnl|my_center|LOCUS_45900 1887 4064 gene locus_tag LOCUS_45910 1887 4064 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141412.1 protein_id gnl|my_center|LOCUS_45910 4061 5113 gene locus_tag LOCUS_45920 4061 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141411.1 protein_id gnl|my_center|LOCUS_45920 >Feature sequence376 1198 1797 gene locus_tag LOCUS_45930 1198 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_45930 >Feature sequence377 1007 183 gene locus_tag LOCUS_45940 gene pstB2 1007 183 CDS product phosphate import ATP-binding protein PstB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG3 protein_id gnl|my_center|LOCUS_45940 2131 1241 gene locus_tag LOCUS_45950 2131 1241 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG4 protein_id gnl|my_center|LOCUS_45950 3201 2263 gene locus_tag LOCUS_45960 3201 2263 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG5 protein_id gnl|my_center|LOCUS_45960 3724 4077 gene locus_tag LOCUS_45970 3724 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 <5244 4551 gene locus_tag LOCUS_45980 <5244 4551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKY0:NAD(P)H-quinone oxidoreductase chain 4 1 >Feature sequence378 <1 1164 gene locus_tag LOCUS_45990 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257167.1:glycosyl transferase family 1 1237 2583 gene locus_tag LOCUS_46000 1237 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540305.1 protein_id gnl|my_center|LOCUS_46000 2705 3910 gene locus_tag LOCUS_46010 2705 3910 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_46010 3995 4834 gene locus_tag LOCUS_46020 3995 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 >Feature sequence379 878 543 gene locus_tag LOCUS_46030 878 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 3207 1132 gene locus_tag LOCUS_46040 3207 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 4606 3209 gene locus_tag LOCUS_46050 4606 3209 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089836.1 protein_id gnl|my_center|LOCUS_46050 4934 5107 gene locus_tag LOCUS_46060 4934 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 >Feature sequence380 1135 278 gene locus_tag LOCUS_46070 1135 278 CDS product primosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057597.1 protein_id gnl|my_center|LOCUS_46070 1346 2050 gene locus_tag LOCUS_46080 1346 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142612.1 protein_id gnl|my_center|LOCUS_46080 3119 2085 gene locus_tag LOCUS_46090 3119 2085 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705723.1 protein_id gnl|my_center|LOCUS_46090 4009 3224 gene locus_tag LOCUS_46100 4009 3224 CDS product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056065.1 protein_id gnl|my_center|LOCUS_46100 4417 4136 gene locus_tag LOCUS_46110 gene clpS 4417 4136 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056066.1 protein_id gnl|my_center|LOCUS_46110 4663 5217 gene locus_tag LOCUS_46120 4663 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057284.1 protein_id gnl|my_center|LOCUS_46120 >Feature sequence381 220 744 gene locus_tag LOCUS_46130 220 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 737 1654 gene locus_tag LOCUS_46140 737 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 1655 3493 gene locus_tag LOCUS_46150 1655 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 3519 3959 gene locus_tag LOCUS_46160 3519 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 3956 4669 gene locus_tag LOCUS_46170 3956 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 >Feature sequence382 723 355 gene locus_tag LOCUS_46180 723 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 1669 1169 gene locus_tag LOCUS_46190 1669 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 2003 2464 gene locus_tag LOCUS_46200 2003 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46200 2457 2627 gene locus_tag LOCUS_46210 2457 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 2683 3597 gene locus_tag LOCUS_46220 2683 3597 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056436.1 protein_id gnl|my_center|LOCUS_46220 >Feature sequence383 3352 2381 gene locus_tag LOCUS_46230 3352 2381 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_46230 3399 4010 gene locus_tag LOCUS_46240 3399 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_46240 >Feature sequence384 3826 3203 gene locus_tag LOCUS_46250 3826 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 4647 4126 gene locus_tag LOCUS_46260 4647 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 >Feature sequence385 902 186 gene locus_tag LOCUS_46270 902 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 1049 4255 gene locus_tag LOCUS_46280 1049 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 4303 5001 gene locus_tag LOCUS_46290 gene wgeA 4303 5001 CDS product hemolysin expression modulating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529018.1 protein_id gnl|my_center|LOCUS_46290 >Feature sequence386 148 76 gene locus_tag LOCUS_t00300 148 76 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3538 581 gene locus_tag LOCUS_46300 3538 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 4389 3817 gene locus_tag LOCUS_46310 4389 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_46310 5046 4657 gene locus_tag LOCUS_46320 5046 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 >Feature sequence387 672 872 gene locus_tag LOCUS_46330 672 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 863 1255 gene locus_tag LOCUS_46340 863 1255 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_46340 1334 3436 gene locus_tag LOCUS_46350 1334 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 4447 3830 gene locus_tag LOCUS_46360 4447 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 4682 4807 gene locus_tag LOCUS_46370 4682 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 >Feature sequence388 2289 1057 gene locus_tag LOCUS_46380 2289 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393799.1 protein_id gnl|my_center|LOCUS_46380 2792 3109 gene locus_tag LOCUS_46390 2792 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 3556 3173 gene locus_tag LOCUS_46400 3556 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 >Feature sequence389 1047 1949 gene locus_tag LOCUS_46410 1047 1949 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_46410 3464 1983 gene locus_tag LOCUS_46420 3464 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 3702 4418 gene locus_tag LOCUS_46430 3702 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 4761 4444 gene locus_tag LOCUS_46440 4761 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 >Feature sequence390 110 1279 gene locus_tag LOCUS_46450 gene ydcM 110 1279 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_46450 1355 1885 gene locus_tag LOCUS_46460 gene ilvH 1355 1885 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 protein_id gnl|my_center|LOCUS_46460 2145 2588 gene locus_tag LOCUS_46470 2145 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 2578 3249 gene locus_tag LOCUS_46480 2578 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 4400 3300 gene locus_tag LOCUS_46490 4400 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058193.1 protein_id gnl|my_center|LOCUS_46490 4535 4921 gene locus_tag LOCUS_46500 4535 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140146.1 protein_id gnl|my_center|LOCUS_46500 >Feature sequence391 851 633 gene locus_tag LOCUS_46510 851 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 1056 853 gene locus_tag LOCUS_46520 1056 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 2382 3026 gene locus_tag LOCUS_46530 2382 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056026.1 protein_id gnl|my_center|LOCUS_46530 <4932 3093 gene locus_tag LOCUS_46540 <4932 3093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140079.1:nuclease >Feature sequence392 548 2386 gene locus_tag LOCUS_46550 548 2386 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_46550 3176 3340 gene locus_tag LOCUS_46560 3176 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 3423 4640 gene locus_tag LOCUS_46570 3423 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 >Feature sequence393 605 2035 gene locus_tag LOCUS_46580 605 2035 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 protein_id gnl|my_center|LOCUS_46580 2072 3241 gene locus_tag LOCUS_46590 2072 3241 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056491.1 protein_id gnl|my_center|LOCUS_46590 3255 3926 gene locus_tag LOCUS_46600 3255 3926 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_46600 <4908 3938 gene locus_tag LOCUS_46610 <4908 3938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UFZ7:histidine kinase >Feature sequence394 375 2108 gene locus_tag LOCUS_46620 375 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 2637 3518 gene locus_tag LOCUS_46630 2637 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 >Feature sequence395 1976 351 gene locus_tag LOCUS_46640 1976 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 4094 2187 gene locus_tag LOCUS_46650 4094 2187 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057278.1 protein_id gnl|my_center|LOCUS_46650 >Feature sequence396 491 1003 gene locus_tag LOCUS_46660 491 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104142.1 protein_id gnl|my_center|LOCUS_46660 2955 1174 gene locus_tag LOCUS_46670 2955 1174 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_46670 3206 3295 gene locus_tag LOCUS_t00310 3206 3295 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <4853 3425 gene locus_tag LOCUS_46680 <4853 3425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DL06:aconitate hydratase B >Feature sequence397 2356 2601 gene locus_tag LOCUS_46690 2356 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 3570 2773 gene locus_tag LOCUS_46700 3570 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 3841 3662 gene locus_tag LOCUS_46710 3841 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 4417 3890 gene locus_tag LOCUS_46720 4417 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 4666 4466 gene locus_tag LOCUS_46730 4666 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 >Feature sequence398 961 1359 gene locus_tag LOCUS_46740 961 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 1347 1997 gene locus_tag LOCUS_46750 1347 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 2286 3110 gene locus_tag LOCUS_46760 2286 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 >Feature sequence399 2025 418 gene locus_tag LOCUS_46770 2025 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 2486 3532 gene locus_tag LOCUS_46780 gene potD 2486 3532 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725674.1 protein_id gnl|my_center|LOCUS_46780 3683 4600 gene locus_tag LOCUS_46790 gene potB 3683 4600 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715491.1 protein_id gnl|my_center|LOCUS_46790 >Feature sequence400 866 2350 gene locus_tag LOCUS_46800 gene gatB 866 2350 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC4 protein_id gnl|my_center|LOCUS_46800 2719 3426 gene locus_tag LOCUS_46810 2719 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 >Feature sequence401 363 2189 gene locus_tag LOCUS_46820 363 2189 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141553.1 protein_id gnl|my_center|LOCUS_46820 2375 3022 gene locus_tag LOCUS_46830 2375 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 3252 4454 gene locus_tag LOCUS_46840 gene argG 3252 4454 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY7 protein_id gnl|my_center|LOCUS_46840 >Feature sequence402 703 446 gene locus_tag LOCUS_46850 703 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 1389 1240 gene locus_tag LOCUS_46860 1389 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46860 2253 1537 gene locus_tag LOCUS_46870 gene rplA 2253 1537 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM27 protein_id gnl|my_center|LOCUS_46870 2765 2340 gene locus_tag LOCUS_46880 gene rplK 2765 2340 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM28 protein_id gnl|my_center|LOCUS_46880 3404 2769 gene locus_tag LOCUS_46890 gene nusG 3404 2769 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM29 protein_id gnl|my_center|LOCUS_46890 3655 3431 gene locus_tag LOCUS_46900 gene secE 3655 3431 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM30 protein_id gnl|my_center|LOCUS_46900 3929 3856 gene locus_tag LOCUS_t00320 3929 3856 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4441 4055 gene locus_tag LOCUS_46910 4441 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 >Feature sequence403 2040 436 gene locus_tag LOCUS_46920 2040 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_820157.2 protein_id gnl|my_center|LOCUS_46920 4203 2149 gene locus_tag LOCUS_46930 4203 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 >Feature sequence404 1460 813 gene locus_tag LOCUS_46940 1460 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110705.1 protein_id gnl|my_center|LOCUS_46940 1692 2009 gene locus_tag LOCUS_46950 1692 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 2902 2186 gene locus_tag LOCUS_46960 2902 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 3061 3993 gene locus_tag LOCUS_46970 3061 3993 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729469.1 protein_id gnl|my_center|LOCUS_46970 4409 4185 gene locus_tag LOCUS_46980 4409 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 >Feature sequence405 267 2612 gene locus_tag LOCUS_46990 267 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 >Feature sequence406 <1 2521 gene locus_tag LOCUS_47000 <1 2521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056126.1:magnesium chelatase subunit H 2771 3352 gene locus_tag LOCUS_47010 2771 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44014 protein_id gnl|my_center|LOCUS_47010 3456 3761 gene locus_tag LOCUS_47020 3456 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 3758 4264 gene locus_tag LOCUS_47030 3758 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 >Feature sequence407 676 3141 gene locus_tag LOCUS_47040 676 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 3205 3477 gene locus_tag LOCUS_47050 3205 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 >Feature sequence408 942 1220 gene locus_tag LOCUS_47060 942 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 1731 1222 gene locus_tag LOCUS_47070 1731 1222 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457554.1 protein_id gnl|my_center|LOCUS_47070 2298 1954 gene locus_tag LOCUS_47080 2298 1954 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_47080 >Feature sequence409 456 94 gene locus_tag LOCUS_47090 456 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 1430 549 gene locus_tag LOCUS_47100 gene ycf38 1430 549 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJA3 protein_id gnl|my_center|LOCUS_47100 1614 1868 gene locus_tag LOCUS_47110 1614 1868 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NP7 protein_id gnl|my_center|LOCUS_47110 1861 2076 gene locus_tag LOCUS_47120 1861 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 2762 2499 gene locus_tag LOCUS_47130 2762 2499 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_47130 3440 3658 gene locus_tag LOCUS_47140 3440 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 <4408 3803 gene locus_tag LOCUS_47150 <4408 3803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055865.1:ABC transporter ATP-binding protein >Feature sequence410 1106 1657 gene locus_tag LOCUS_47160 1106 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 2428 2811 gene locus_tag LOCUS_47170 2428 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 2828 3307 gene locus_tag LOCUS_47180 2828 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 3602 3315 gene locus_tag LOCUS_47190 3602 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 >Feature sequence411 224 1375 gene locus_tag LOCUS_47200 224 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 1523 2746 gene locus_tag LOCUS_47210 1523 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 4000 2936 gene locus_tag LOCUS_47220 4000 2936 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057568.1 protein_id gnl|my_center|LOCUS_47220 >Feature sequence412 3083 153 gene locus_tag LOCUS_47230 gene clpB1 3083 153 CDS product chaperone protein ClpB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ40 protein_id gnl|my_center|LOCUS_47230 3780 3328 gene locus_tag LOCUS_47240 3780 3328 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143550.1 protein_id gnl|my_center|LOCUS_47240 >Feature sequence413 499 2316 gene locus_tag LOCUS_47250 499 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 2464 3063 gene locus_tag LOCUS_47260 2464 3063 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141762.1 protein_id gnl|my_center|LOCUS_47260 3065 3856 gene locus_tag LOCUS_47270 3065 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 >Feature sequence414 >Feature sequence415 3837 202 gene locus_tag LOCUS_47280 3837 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_47280 >Feature sequence416 1687 356 gene locus_tag LOCUS_47290 1687 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 3250 2531 gene locus_tag LOCUS_47300 3250 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 3952 3605 gene locus_tag LOCUS_47310 3952 3605 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_47310 >Feature sequence417 677 258 gene locus_tag LOCUS_47320 677 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 949 1890 gene locus_tag LOCUS_47330 gene recO 949 1890 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGS9 protein_id gnl|my_center|LOCUS_47330 2263 3639 gene locus_tag LOCUS_47340 2263 3639 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058069.1 protein_id gnl|my_center|LOCUS_47340 3823 3650 gene locus_tag LOCUS_47350 3823 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 >Feature sequence418 341 1843 gene locus_tag LOCUS_47360 341 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 2218 3018 gene locus_tag LOCUS_47370 gene cobS 2218 3018 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ91 protein_id gnl|my_center|LOCUS_47370 >Feature sequence419 251 1726 gene locus_tag LOCUS_47380 gene glcD 251 1726 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_47380 2865 2083 gene locus_tag LOCUS_47390 2865 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 3101 2949 gene locus_tag LOCUS_47400 3101 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 4123 3509 gene locus_tag LOCUS_47410 4123 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 >Feature sequence420 534 1931 gene locus_tag LOCUS_47420 534 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 2343 2179 gene locus_tag LOCUS_47430 2343 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 >Feature sequence421 469 275 gene locus_tag LOCUS_47440 469 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 1661 591 gene locus_tag LOCUS_47450 1661 591 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA4 protein_id gnl|my_center|LOCUS_47450 2259 3305 gene locus_tag LOCUS_47460 gene hemF 2259 3305 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL15 protein_id gnl|my_center|LOCUS_47460 3368 3730 gene locus_tag LOCUS_47470 gene rsbV 3368 3730 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D91 protein_id gnl|my_center|LOCUS_47470 >Feature sequence422 3024 1945 gene locus_tag LOCUS_47480 3024 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 >Feature sequence423 2773 1232 gene locus_tag LOCUS_47490 2773 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 2874 3701 gene locus_tag LOCUS_47500 2874 3701 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403316.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47500 >Feature sequence424 328 74 gene locus_tag LOCUS_47510 328 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 586 1725 gene locus_tag LOCUS_47520 586 1725 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056956.1 protein_id gnl|my_center|LOCUS_47520 1781 3310 gene locus_tag LOCUS_47530 1781 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 >Feature sequence425 150 1337 gene locus_tag LOCUS_47540 150 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 1357 1980 gene locus_tag LOCUS_47550 1357 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 2028 2654 gene locus_tag LOCUS_47560 2028 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 3529 2660 gene locus_tag LOCUS_47570 3529 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 3868 3542 gene locus_tag LOCUS_47580 3868 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 >Feature sequence426 1289 879 gene locus_tag LOCUS_47590 1289 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_47590 1656 1799 gene locus_tag LOCUS_47600 1656 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 1800 2039 gene locus_tag LOCUS_47610 1800 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 3583 2147 gene locus_tag LOCUS_47620 3583 2147 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF6 protein_id gnl|my_center|LOCUS_47620 >Feature sequence427 1610 138 gene locus_tag LOCUS_47630 gene glmM 1610 138 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI20 protein_id gnl|my_center|LOCUS_47630 1761 2279 gene locus_tag LOCUS_47640 1761 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 2276 3706 gene locus_tag LOCUS_47650 2276 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 >Feature sequence428 1787 159 gene locus_tag LOCUS_47660 1787 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 2661 1903 gene locus_tag LOCUS_47670 gene cobI 2661 1903 CDS product precorrin-2 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057289.1 protein_id gnl|my_center|LOCUS_47670 >Feature sequence429 1906 1556 gene locus_tag LOCUS_47680 1906 1556 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_47680 2207 1893 gene locus_tag LOCUS_47690 2207 1893 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_47690 3380 2226 gene locus_tag LOCUS_47700 3380 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 3714 3866 gene locus_tag LOCUS_47710 3714 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 >Feature sequence430 2967 349 gene locus_tag LOCUS_47720 2967 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 3583 3425 gene locus_tag LOCUS_47730 3583 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 >Feature sequence431 2740 2985 gene locus_tag LOCUS_47740 2740 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47740 >Feature sequence432 >Feature sequence433 353 2785 gene locus_tag LOCUS_47750 353 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544679.1 protein_id gnl|my_center|LOCUS_47750 >Feature sequence434 388 152 gene locus_tag LOCUS_47760 388 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47760 593 390 gene locus_tag LOCUS_47770 593 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 872 615 gene locus_tag LOCUS_47780 872 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 <3962 1242 gene locus_tag LOCUS_47790 <3962 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890482.1:helicase >Feature sequence435 3508 452 gene locus_tag LOCUS_47800 3508 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 >Feature sequence436 1524 658 gene locus_tag LOCUS_47810 gene chlL 1524 658 CDS product light-independent protochlorophyllide reductase iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH0 protein_id gnl|my_center|LOCUS_47810 2990 2181 gene locus_tag LOCUS_47820 2990 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 >Feature sequence437 2909 2523 gene locus_tag LOCUS_47830 2909 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 3450 2929 gene locus_tag LOCUS_47840 3450 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 >Feature sequence438 264 37 gene locus_tag LOCUS_47850 264 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 456 1007 gene locus_tag LOCUS_47860 456 1007 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_47860 1303 1052 gene locus_tag LOCUS_47870 1303 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 1789 1517 gene locus_tag LOCUS_47880 1789 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 2592 2365 gene locus_tag LOCUS_47890 2592 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 3527 2940 gene locus_tag LOCUS_47900 3527 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 >Feature sequence439 52 239 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatagttatatctactcaagagttacagcg 1800 592 gene locus_tag LOCUS_47910 gene ispH 1800 592 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK29 protein_id gnl|my_center|LOCUS_47910 2142 3128 gene locus_tag LOCUS_47920 2142 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 3128 3487 gene locus_tag LOCUS_47930 3128 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 >Feature sequence440 362 1162 gene locus_tag LOCUS_47940 362 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 1616 1377 gene locus_tag LOCUS_47950 1616 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 2445 2518 gene locus_tag LOCUS_t00330 2445 2518 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2638 3531 gene locus_tag LOCUS_47960 gene lgt 2638 3531 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH03 protein_id gnl|my_center|LOCUS_47960 >Feature sequence441 641 267 gene locus_tag LOCUS_47970 641 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 833 2341 gene locus_tag LOCUS_47980 833 2341 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058059.1 protein_id gnl|my_center|LOCUS_47980 >Feature sequence442 811 1209 gene locus_tag LOCUS_47990 811 1209 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_47990 1503 2210 gene locus_tag LOCUS_48000 1503 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 2577 3188 gene locus_tag LOCUS_48010 2577 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 3657 3319 gene locus_tag LOCUS_48020 3657 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 >Feature sequence443 236 1060 gene locus_tag LOCUS_48030 236 1060 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083253.1 protein_id gnl|my_center|LOCUS_48030 2553 1075 gene locus_tag LOCUS_48040 2553 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 >Feature sequence444 2 1216 gene locus_tag LOCUS_48050 2 1216 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056941.1 protein_id gnl|my_center|LOCUS_48050 3039 1246 gene locus_tag LOCUS_48060 3039 1246 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403575.1 protein_id gnl|my_center|LOCUS_48060 3615 3175 gene locus_tag LOCUS_48070 3615 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 >Feature sequence445 698 2008 gene locus_tag LOCUS_48080 gene thrC 698 2008 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056826.1 protein_id gnl|my_center|LOCUS_48080 2045 2371 gene locus_tag LOCUS_48090 2045 2371 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_48090 2533 3525 gene locus_tag LOCUS_48100 2533 3525 CDS product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057563.1 protein_id gnl|my_center|LOCUS_48100 >Feature sequence446 827 477 gene locus_tag LOCUS_48110 827 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48110 1205 942 gene locus_tag LOCUS_48120 1205 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48120 2700 1462 gene locus_tag LOCUS_48130 2700 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 protein_id gnl|my_center|LOCUS_48130 2883 3458 gene locus_tag LOCUS_48140 gene clpP 2883 3458 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VAS0 protein_id gnl|my_center|LOCUS_48140 >Feature sequence447 639 319 gene locus_tag LOCUS_48150 639 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 1184 900 gene locus_tag LOCUS_48160 1184 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 2781 1201 gene locus_tag LOCUS_48170 2781 1201 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142505.1 protein_id gnl|my_center|LOCUS_48170 >Feature sequence448 270 2084 gene locus_tag LOCUS_48180 270 2084 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142666.1 protein_id gnl|my_center|LOCUS_48180 2139 2888 gene locus_tag LOCUS_48190 gene ycf23 2139 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_48190 >Feature sequence449 1338 1907 gene locus_tag LOCUS_48200 1338 1907 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FA0 protein_id gnl|my_center|LOCUS_48200 2046 3056 gene locus_tag LOCUS_48210 2046 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 >Feature sequence450 3489 2797 gene locus_tag LOCUS_48220 3489 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 >Feature sequence451 <1 784 gene locus_tag LOCUS_48230 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NLU9:DNA topoisomerase 1 1351 1013 gene locus_tag LOCUS_48240 1351 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 1758 1339 gene locus_tag LOCUS_48250 1758 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 2495 1803 gene locus_tag LOCUS_48260 2495 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_48260 3409 2813 gene locus_tag LOCUS_48270 3409 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 3689 3399 gene locus_tag LOCUS_48280 3689 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 >Feature sequence452 488 1297 gene locus_tag LOCUS_48290 gene cobM 488 1297 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056411.1 protein_id gnl|my_center|LOCUS_48290 1315 2118 gene locus_tag LOCUS_48300 gene rkpH 1315 2118 CDS product ribitol type dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968672.1 protein_id gnl|my_center|LOCUS_48300 2964 2155 gene locus_tag LOCUS_48310 2964 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055925.1 protein_id gnl|my_center|LOCUS_48310 >Feature sequence453 >Feature sequence454 961 1185 gene locus_tag LOCUS_48320 961 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 1448 3127 gene locus_tag LOCUS_48330 1448 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 >Feature sequence455 1459 1235 gene locus_tag LOCUS_48340 1459 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 3074 1524 gene locus_tag LOCUS_48350 gene cysS 3074 1524 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW6 protein_id gnl|my_center|LOCUS_48350 3532 3191 gene locus_tag LOCUS_48360 3532 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 >Feature sequence456 2044 794 gene locus_tag LOCUS_48370 2044 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_48370 >Feature sequence457 2789 1836 gene locus_tag LOCUS_48380 gene fcl 2789 1836 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL64 protein_id gnl|my_center|LOCUS_48380 <3506 2815 gene locus_tag LOCUS_48390 <3506 2815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DL63:GDP-mannose 4,6-dehydratase >Feature sequence458 <3501 1350 gene locus_tag LOCUS_48400 <3501 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057626.1:outer membrane protein assembly factor >Feature sequence459 1994 228 gene locus_tag LOCUS_48410 1994 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 2386 1991 gene locus_tag LOCUS_48420 2386 1991 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356374.1 protein_id gnl|my_center|LOCUS_48420 3256 2618 gene locus_tag LOCUS_48430 3256 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 >Feature sequence460 <1 1002 gene locus_tag LOCUS_48440 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705426.1:(2Fe-2S)-binding protein 2378 1716 gene locus_tag LOCUS_48450 2378 1716 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010728555.1 protein_id gnl|my_center|LOCUS_48450 2544 2383 gene locus_tag LOCUS_48460 2544 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 3063 2758 gene locus_tag LOCUS_48470 3063 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 >Feature sequence461 767 1642 gene locus_tag LOCUS_48480 767 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 protein_id gnl|my_center|LOCUS_48480 >Feature sequence462 852 334 gene locus_tag LOCUS_48490 852 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 2013 1012 gene locus_tag LOCUS_48500 gene pheS 2013 1012 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL09 protein_id gnl|my_center|LOCUS_48500 2149 2964 gene locus_tag LOCUS_48510 gene surE 2149 2964 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI06 protein_id gnl|my_center|LOCUS_48510 3158 3382 gene locus_tag LOCUS_48520 3158 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 >Feature sequence463 2628 595 gene locus_tag LOCUS_48530 2628 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 >Feature sequence464 <3462 1021 gene locus_tag LOCUS_48540 <3462 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DIH1:DNA topoisomerase (ATP-hydrolyzing) >Feature sequence465 >Feature sequence466 838 431 gene locus_tag LOCUS_48550 838 431 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703865.1 protein_id gnl|my_center|LOCUS_48550 894 1253 gene locus_tag LOCUS_48560 894 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 1367 2629 gene locus_tag LOCUS_48570 1367 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 2771 3166 gene locus_tag LOCUS_48580 2771 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48580 >Feature sequence467 931 329 gene locus_tag LOCUS_48590 931 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 1995 943 gene locus_tag LOCUS_48600 1995 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 2632 2342 gene locus_tag LOCUS_48610 2632 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 >Feature sequence468 >Feature sequence469 403 176 gene locus_tag LOCUS_48620 403 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 1193 660 gene locus_tag LOCUS_48630 1193 660 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143257.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48630 1631 1437 gene locus_tag LOCUS_48640 1631 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 2074 1700 gene locus_tag LOCUS_48650 2074 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 2442 2206 gene locus_tag LOCUS_48660 2442 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 3206 2895 gene locus_tag LOCUS_48670 3206 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 >Feature sequence470 717 247 gene locus_tag LOCUS_48680 717 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 966 2933 gene locus_tag LOCUS_48690 gene acsA 966 2933 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH2 protein_id gnl|my_center|LOCUS_48690 >Feature sequence471 685 170 gene locus_tag LOCUS_48700 685 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 977 705 gene locus_tag LOCUS_48710 977 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 1555 1316 gene locus_tag LOCUS_48720 1555 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 1872 2252 gene locus_tag LOCUS_48730 1872 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 2360 2770 gene locus_tag LOCUS_48740 2360 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 >Feature sequence472 756 1166 gene locus_tag LOCUS_48750 756 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 1141 1812 gene locus_tag LOCUS_48760 1141 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 2148 2870 gene locus_tag LOCUS_48770 2148 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 >Feature sequence473 635 33 gene locus_tag LOCUS_48780 635 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 1065 697 gene locus_tag LOCUS_48790 1065 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 1254 1493 gene locus_tag LOCUS_48800 1254 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 <3130 1970 gene locus_tag LOCUS_48810 <3130 1970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706440.1:ATP-dependent helicase >Feature sequence474 43 756 gene locus_tag LOCUS_48820 43 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48820 2530 1208 gene locus_tag LOCUS_48830 2530 1208 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_48830 >Feature sequence475 2435 210 gene locus_tag LOCUS_48840 2435 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 3043 2456 gene locus_tag LOCUS_48850 3043 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 >Feature sequence476 954 364 gene locus_tag LOCUS_48860 954 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_48860 >Feature sequence477 1355 651 gene locus_tag LOCUS_48870 1355 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 2238 1531 gene locus_tag LOCUS_48880 2238 1531 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142403.1 protein_id gnl|my_center|LOCUS_48880 >Feature sequence478 316 1332 gene locus_tag LOCUS_48890 316 1332 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK75 protein_id gnl|my_center|LOCUS_48890 1475 2398 gene locus_tag LOCUS_48900 gene argF 1475 2398 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJW4 protein_id gnl|my_center|LOCUS_48900 2641 2946 gene locus_tag LOCUS_48910 2641 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 >Feature sequence479 2414 912 gene locus_tag LOCUS_48920 gene ndhD 2414 912 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141006.1 protein_id gnl|my_center|LOCUS_48920 <3059 2472 gene locus_tag LOCUS_48930 <3059 2472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056748.1:oxidoreductase >Feature sequence480 494 736 gene locus_tag LOCUS_48940 494 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 1035 742 gene locus_tag LOCUS_48950 1035 742 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958388.1 protein_id gnl|my_center|LOCUS_48950 2846 1251 gene locus_tag LOCUS_48960 2846 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 >Feature sequence481 1559 1801 gene locus_tag LOCUS_48970 1559 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 >Feature sequence482 1223 2464 gene locus_tag LOCUS_48980 gene argJ 1223 2464 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN4 protein_id gnl|my_center|LOCUS_48980 2897 2607 gene locus_tag LOCUS_48990 2897 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 >Feature sequence483 268 1059 gene locus_tag LOCUS_49000 268 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 <3031 2163 gene locus_tag LOCUS_49010 <3031 2163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405421.1:MATE family efflux transporter >Feature sequence484 1084 1746 gene locus_tag LOCUS_49020 1084 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 >Feature sequence485 <1 1249 gene locus_tag LOCUS_49030 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920930.1:diguanylate cyclase 1545 1697 gene locus_tag LOCUS_49040 1545 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 2126 2404 gene locus_tag LOCUS_49050 2126 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 >Feature sequence486 288 584 gene locus_tag LOCUS_49060 288 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056692.1 protein_id gnl|my_center|LOCUS_49060 877 1944 gene locus_tag LOCUS_49070 877 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 2820 1924 gene locus_tag LOCUS_49080 2820 1924 CDS product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_49080 >Feature sequence487 1418 534 gene locus_tag LOCUS_49090 gene glyQ 1418 534 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK36 protein_id gnl|my_center|LOCUS_49090 1842 2060 gene locus_tag LOCUS_49100 1842 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 2549 2103 gene locus_tag LOCUS_49110 2549 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 2757 2542 gene locus_tag LOCUS_49120 2757 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 >Feature sequence488 2254 2469 gene locus_tag LOCUS_49130 2254 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 >Feature sequence489 488 925 gene locus_tag LOCUS_49140 488 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 1395 1012 gene locus_tag LOCUS_49150 1395 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 1724 1392 gene locus_tag LOCUS_49160 1724 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 2214 1900 gene locus_tag LOCUS_49170 2214 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 2454 2257 gene locus_tag LOCUS_49180 2454 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 2565 2918 gene locus_tag LOCUS_49190 2565 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 >Feature sequence490 1423 347 gene locus_tag LOCUS_49200 1423 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119264.1 protein_id gnl|my_center|LOCUS_49200 1989 1423 gene locus_tag LOCUS_49210 1989 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 2471 1989 gene locus_tag LOCUS_49220 2471 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142174.1 protein_id gnl|my_center|LOCUS_49220 >Feature sequence491 458 2848 gene locus_tag LOCUS_49230 458 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 >Feature sequence492 <1 936 gene locus_tag LOCUS_49240 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004544567.1:glycosyl transferase 983 1903 gene locus_tag LOCUS_49250 983 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141312.1 protein_id gnl|my_center|LOCUS_49250 >Feature sequence493 >Feature sequence494 <1 898 gene locus_tag LOCUS_49260 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056586.1:4Fe-4S ferredoxin 962 2713 gene locus_tag LOCUS_49270 gene ycf45 962 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 protein_id gnl|my_center|LOCUS_49270 >Feature sequence495 622 371 gene locus_tag LOCUS_49280 622 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 763 1266 gene locus_tag LOCUS_49290 763 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 2383 2796 gene locus_tag LOCUS_49300 2383 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 >Feature sequence496 678 821 gene locus_tag LOCUS_49310 678 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 1933 1499 gene locus_tag LOCUS_49320 gene mvpA 1933 1499 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IV79 protein_id gnl|my_center|LOCUS_49320 2145 1930 gene locus_tag LOCUS_49330 2145 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 2297 2461 gene locus_tag LOCUS_49340 2297 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 2449 2778 gene locus_tag LOCUS_49350 2449 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 >Feature sequence497 <1 1436 gene locus_tag LOCUS_49360 <1 1436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056743.1:sensor histidine kinase 1492 2205 gene locus_tag LOCUS_49370 gene nanE 1492 2205 CDS product putative N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGQ5 protein_id gnl|my_center|LOCUS_49370 <2821 2279 gene locus_tag LOCUS_49380 <2821 2279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057458.1:multidrug transporter >Feature sequence498 187 648 gene locus_tag LOCUS_49390 187 648 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128238.1 protein_id gnl|my_center|LOCUS_49390 868 1446 gene locus_tag LOCUS_49400 868 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_49400 >Feature sequence499 1525 8 gene locus_tag LOCUS_49410 1525 8 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057032.1 protein_id gnl|my_center|LOCUS_49410 1708 2166 gene locus_tag LOCUS_49420 gene rplI 1708 2166 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9J9 protein_id gnl|my_center|LOCUS_49420 >Feature sequence500 >Feature sequence501 1260 2360 gene locus_tag LOCUS_49430 1260 2360 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056239.1 protein_id gnl|my_center|LOCUS_49430 >Feature sequence502 537 752 gene locus_tag LOCUS_49440 537 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 >Feature sequence503 286 678 gene locus_tag LOCUS_49450 286 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056846.1 protein_id gnl|my_center|LOCUS_49450 818 2305 gene locus_tag LOCUS_49460 818 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058187.1 protein_id gnl|my_center|LOCUS_49460 2628 2401 gene locus_tag LOCUS_49470 2628 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 >Feature sequence504 504 941 gene locus_tag LOCUS_49480 504 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 928 1653 gene locus_tag LOCUS_49490 928 1653 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_49490 1787 1993 gene locus_tag LOCUS_49500 1787 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 >Feature sequence505 1380 2510 gene locus_tag LOCUS_49510 1380 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 >Feature sequence506 >Feature sequence507 572 261 gene locus_tag LOCUS_49520 572 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 683 1309 gene locus_tag LOCUS_49530 683 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49530 1512 1973 gene locus_tag LOCUS_49540 1512 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 2163 2375 gene locus_tag LOCUS_49550 2163 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49550 >Feature sequence508 52 1215 gene locus_tag LOCUS_49560 52 1215 CDS product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_49560 1933 1325 gene locus_tag LOCUS_49570 1933 1325 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057273.1 protein_id gnl|my_center|LOCUS_49570 <2708 2055 gene locus_tag LOCUS_49580 <2708 2055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJZ9:ATP-dependent Clp protease proteolytic subunit 2 >Feature sequence509 1399 332 gene locus_tag LOCUS_49590 1399 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 >Feature sequence510 144 296 gene locus_tag LOCUS_49600 144 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 345 527 gene locus_tag LOCUS_49610 345 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 930 1163 gene locus_tag LOCUS_49620 930 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 1156 1353 gene locus_tag LOCUS_49630 1156 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 1960 1469 gene locus_tag LOCUS_49640 1960 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 >Feature sequence511 586 230 gene locus_tag LOCUS_49650 586 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 593 955 gene locus_tag LOCUS_49660 593 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 909 1514 gene locus_tag LOCUS_49670 909 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 1990 1667 gene locus_tag LOCUS_49680 1990 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49680 >Feature sequence512 1047 1613 gene locus_tag LOCUS_49690 1047 1613 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL3 protein_id gnl|my_center|LOCUS_49690 1804 2130 gene locus_tag LOCUS_49700 1804 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057859.1 protein_id gnl|my_center|LOCUS_49700 >Feature sequence513 864 307 gene locus_tag LOCUS_49710 864 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_49710 2618 981 gene locus_tag LOCUS_49720 2618 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 >Feature sequence514 1893 526 gene locus_tag LOCUS_49730 1893 526 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208142.1 protein_id gnl|my_center|LOCUS_49730 <2614 1942 gene locus_tag LOCUS_49740 <2614 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9K0K9:iron-regulated protein FrpA >Feature sequence515 166 1110 gene locus_tag LOCUS_49750 166 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 1336 1968 gene locus_tag LOCUS_49760 1336 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 >Feature sequence516 209 724 gene locus_tag LOCUS_49770 209 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 780 1109 gene locus_tag LOCUS_49780 780 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 2343 1126 gene locus_tag LOCUS_49790 2343 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 >Feature sequence517 1411 443 gene locus_tag LOCUS_49800 1411 443 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058155.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49800 >Feature sequence518 878 288 gene locus_tag LOCUS_49810 878 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 1569 2213 gene locus_tag LOCUS_49820 1569 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 >Feature sequence519 866 249 gene locus_tag LOCUS_49830 866 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 1237 872 gene locus_tag LOCUS_49840 1237 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 2355 1264 gene locus_tag LOCUS_49850 2355 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 >Feature sequence520 304 621 gene locus_tag LOCUS_49860 304 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49860 959 1468 gene locus_tag LOCUS_49870 959 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 1765 1601 gene locus_tag LOCUS_49880 1765 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 2006 2248 gene locus_tag LOCUS_49890 2006 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 >Feature sequence521 1467 2483 gene locus_tag LOCUS_49900 gene rbsK 1467 2483 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683574.1 protein_id gnl|my_center|LOCUS_49900 >Feature sequence522 1742 222 gene locus_tag LOCUS_49910 1742 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 2377 1748 gene locus_tag LOCUS_49920 2377 1748 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266514.1 protein_id gnl|my_center|LOCUS_49920 >Feature sequence523 381 211 gene locus_tag LOCUS_49930 381 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 1524 397 gene locus_tag LOCUS_49940 1524 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 <2517 1521 gene locus_tag LOCUS_49950 <2517 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_308587.1:protein RhsD >Feature sequence524 >Feature sequence525 <1 1950 gene locus_tag LOCUS_49960 <1 1950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121349.1:peptidase >Feature sequence526 2000 1395 gene locus_tag LOCUS_49970 2000 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 >Feature sequence527 1992 1759 gene locus_tag LOCUS_49980 1992 1759 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141646.1 protein_id gnl|my_center|LOCUS_49980 >Feature sequence528 1882 743 gene locus_tag LOCUS_49990 gene cofH 1882 743 CDS product FO synthase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DII8 protein_id gnl|my_center|LOCUS_49990 >Feature sequence529 1035 559 gene locus_tag LOCUS_50000 1035 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 1735 1019 gene locus_tag LOCUS_50010 1735 1019 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG61 protein_id gnl|my_center|LOCUS_50010 2461 1799 gene locus_tag LOCUS_50020 2461 1799 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 protein_id gnl|my_center|LOCUS_50020 >Feature sequence530 1033 458 gene locus_tag LOCUS_50030 1033 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 >Feature sequence531 836 564 gene locus_tag LOCUS_50040 836 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 1353 844 gene locus_tag LOCUS_50050 1353 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 1538 1353 gene locus_tag LOCUS_50060 1538 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 2044 1853 gene locus_tag LOCUS_50070 2044 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 2274 2047 gene locus_tag LOCUS_50080 2274 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 >Feature sequence532 >Feature sequence533 2150 1329 gene locus_tag LOCUS_50090 2150 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 >Feature sequence534 <1 1495 gene locus_tag LOCUS_50100 <1 1495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124488.1:bifunctional NADH dehydrogenase FAD-containing subunit/selenide,water dikinase SelD 1762 2337 gene locus_tag LOCUS_50110 1762 2337 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 protein_id gnl|my_center|LOCUS_50110 >Feature sequence535 1058 1309 gene locus_tag LOCUS_50120 1058 1309 CDS product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_50120 >Feature sequence536 395 84 gene locus_tag LOCUS_50130 395 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 1003 395 gene locus_tag LOCUS_50140 1003 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 1718 996 gene locus_tag LOCUS_50150 1718 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 >Feature sequence537 <1 1178 gene locus_tag LOCUS_50160 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228378.1:DNA methylase >Feature sequence538 600 142 gene locus_tag LOCUS_50170 600 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 1365 910 gene locus_tag LOCUS_50180 1365 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 >Feature sequence539 138 10 gene locus_tag LOCUS_50190 138 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 1907 765 gene locus_tag LOCUS_50200 1907 765 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_50200 2088 2015 gene locus_tag LOCUS_t00340 2088 2015 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence540 >Feature sequence541 1183 176 gene locus_tag LOCUS_50210 1183 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 1997 1224 gene locus_tag LOCUS_50220 1997 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 >Feature sequence542 >Feature sequence543 >Feature sequence544 >Feature sequence545 357 752 gene locus_tag LOCUS_50230 357 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 742 1017 gene locus_tag LOCUS_50240 742 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 999 1481 gene locus_tag LOCUS_50250 999 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 >Feature sequence546 1180 779 gene locus_tag LOCUS_50260 1180 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 2137 1928 gene locus_tag LOCUS_50270 2137 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 >Feature sequence547 >Feature sequence548 >Feature sequence549 >Feature sequence550 496 278 gene locus_tag LOCUS_50280 496 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 762 493 gene locus_tag LOCUS_50290 762 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 1054 725 gene locus_tag LOCUS_50300 1054 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 1220 1543 gene locus_tag LOCUS_50310 1220 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 >Feature sequence551 318 599 gene locus_tag LOCUS_50320 318 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 643 819 gene locus_tag LOCUS_50330 643 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 822 1031 gene locus_tag LOCUS_50340 822 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 1036 1245 gene locus_tag LOCUS_50350 1036 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 1245 1673 gene locus_tag LOCUS_50360 1245 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 >Feature sequence552 1544 1918 gene locus_tag LOCUS_50370 1544 1918 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 protein_id gnl|my_center|LOCUS_50370 >Feature sequence553 365 1369 gene locus_tag LOCUS_50380 365 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141310.1 protein_id gnl|my_center|LOCUS_50380 >Feature sequence554 59 268 gene locus_tag LOCUS_50390 59 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 265 786 gene locus_tag LOCUS_50400 265 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 848 1162 gene locus_tag LOCUS_50410 848 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 1164 1433 gene locus_tag LOCUS_50420 1164 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 1803 1567 gene locus_tag LOCUS_50430 1803 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 >Feature sequence555 1361 936 gene locus_tag LOCUS_50440 1361 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 >Feature sequence556 648 514 gene locus_tag LOCUS_50450 648 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 725 1018 gene locus_tag LOCUS_50460 725 1018 CDS product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_50460 1015 1359 gene locus_tag LOCUS_50470 1015 1359 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_50470 1589 1909 gene locus_tag LOCUS_50480 1589 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 >Feature sequence557 >Feature sequence558 >Feature sequence559 >Feature sequence560 1037 18 gene locus_tag LOCUS_50490 1037 18 CDS product chlorophyll a oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979027.1 protein_id gnl|my_center|LOCUS_50490 1433 1687 gene locus_tag LOCUS_50500 1433 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 >Feature sequence561 1207 1350 gene locus_tag LOCUS_50510 1207 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 1334 1555 gene locus_tag LOCUS_50520 1334 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 1691 1957 gene locus_tag LOCUS_50530 1691 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 >Feature sequence562 1122 334 gene locus_tag LOCUS_50540 1122 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 <1942 1179 gene locus_tag LOCUS_50550 <1942 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058113.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence563 929 1636 gene locus_tag LOCUS_50560 929 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 >Feature sequence564 872 534 gene locus_tag LOCUS_50570 872 534 CDS product phospholipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143796.1 protein_id gnl|my_center|LOCUS_50570 1138 1839 gene locus_tag LOCUS_50580 1138 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 >Feature sequence565 <1 1453 gene locus_tag LOCUS_50590 <1 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056432.1:GTP pyrophosphokinase >Feature sequence566 >Feature sequence567 >Feature sequence568 114 1652 gene locus_tag LOCUS_50600 114 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 >Feature sequence569 745 1686 gene locus_tag LOCUS_50610 745 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 >Feature sequence570 429 1445 gene locus_tag LOCUS_50620 gene prfB 429 1445 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VE10 protein_id gnl|my_center|LOCUS_50620 >Feature sequence571 880 221 gene locus_tag LOCUS_50630 880 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 1641 1108 gene locus_tag LOCUS_50640 1641 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 >Feature sequence572 656 1003 gene locus_tag LOCUS_50650 656 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 >Feature sequence573 >Feature sequence574 768 337 gene locus_tag LOCUS_50660 768 337 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141610.1 protein_id gnl|my_center|LOCUS_50660 1207 713 gene locus_tag LOCUS_50670 1207 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 1367 1570 gene locus_tag LOCUS_50680 1367 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 >Feature sequence575 >Feature sequence576 >Feature sequence577 273 1286 gene locus_tag LOCUS_50690 273 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 >Feature sequence578 256 723 gene locus_tag LOCUS_50700 256 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 1220 1414 gene locus_tag LOCUS_50710 1220 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 1536 1721 gene locus_tag LOCUS_50720 1536 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143955.1 protein_id gnl|my_center|LOCUS_50720 >Feature sequence579 851 285 gene locus_tag LOCUS_50730 851 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 <1717 848 gene locus_tag LOCUS_50740 <1717 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227211.1:type IV secretion protein Rhs >Feature sequence580 1646 378 gene locus_tag LOCUS_50750 1646 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 >Feature sequence581 405 620 gene locus_tag LOCUS_50760 405 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 >Feature sequence582 1361 6 gene locus_tag LOCUS_50770 1361 6 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 protein_id gnl|my_center|LOCUS_50770 >Feature sequence583 <1692 809 gene locus_tag LOCUS_50780 <1692 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066909.1:short-chain dehydrogenase >Feature sequence584 608 1096 gene locus_tag LOCUS_50790 608 1096 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142184.1 protein_id gnl|my_center|LOCUS_50790 1102 1677 gene locus_tag LOCUS_50800 1102 1677 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404744.1 protein_id gnl|my_center|LOCUS_50800 >Feature sequence585 >Feature sequence586 794 1492 gene locus_tag LOCUS_50810 794 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 >Feature sequence587 >Feature sequence588 569 315 gene locus_tag LOCUS_50820 569 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678786.1 protein_id gnl|my_center|LOCUS_50820 641 1279 gene locus_tag LOCUS_50830 641 1279 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_50830 >Feature sequence589 1421 450 gene locus_tag LOCUS_50840 1421 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 >Feature sequence590 361 591 gene locus_tag LOCUS_50850 361 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 772 972 gene locus_tag LOCUS_50860 772 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50860 1047 1544 gene locus_tag LOCUS_50870 1047 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 >Feature sequence591 5 1183 gene locus_tag LOCUS_50880 5 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 >Feature sequence592 548 39 gene locus_tag LOCUS_50890 548 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 733 548 gene locus_tag LOCUS_50900 733 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 905 723 gene locus_tag LOCUS_50910 905 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 1178 987 gene locus_tag LOCUS_50920 1178 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 >Feature sequence593 <1 652 gene locus_tag LOCUS_50930 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DHH4:ammonium transporter <1589 756 gene locus_tag LOCUS_50940 <1589 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531130.1:FAD-linked oxidase >Feature sequence594 163 333 gene locus_tag LOCUS_50950 163 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 860 612 gene locus_tag LOCUS_50960 860 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50960 >Feature sequence595 1323 1138 gene locus_tag LOCUS_50970 1323 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 >Feature sequence596 <1524 508 gene locus_tag LOCUS_50980 <1524 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7ND52:cysteine desulfurase IscS >Feature sequence597 <1524 604 gene locus_tag LOCUS_50990 <1524 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DL93:chromosomal replication initiator protein DnaA >Feature sequence598 716 336 gene locus_tag LOCUS_51000 716 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 1110 904 gene locus_tag LOCUS_51010 1110 904 CDS product addiction module toxin, HicA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103638.1 protein_id gnl|my_center|LOCUS_51010 1310 1107 gene locus_tag LOCUS_51020 1310 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 >Feature sequence599 <1 1392 gene locus_tag LOCUS_51030 <1 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NDN9:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence600 1328 789 gene locus_tag LOCUS_51040 1328 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 >Feature sequence601 785 201 gene locus_tag LOCUS_51050 785 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 1175 789 gene locus_tag LOCUS_51060 1175 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_51060