>Feature sequence001 1819 404 gene locus_tag LOCUS_00010 1819 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2343 1966 gene locus_tag LOCUS_00020 2343 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2804 2499 gene locus_tag LOCUS_00030 2804 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3055 2804 gene locus_tag LOCUS_00040 3055 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4140 2989 gene locus_tag LOCUS_00050 4140 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6511 4289 gene locus_tag LOCUS_00060 6511 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7002 7985 gene locus_tag LOCUS_00070 7002 7985 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_00070 8123 9625 gene locus_tag LOCUS_00080 8123 9625 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868291.1 protein_id gnl|my_center|LOCUS_00080 10165 9662 gene locus_tag LOCUS_00090 10165 9662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11291 10224 gene locus_tag LOCUS_00100 11291 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11652 11350 gene locus_tag LOCUS_00110 11652 11350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11960 11775 gene locus_tag LOCUS_00120 11960 11775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12242 12514 gene locus_tag LOCUS_00130 12242 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13570 13935 gene locus_tag LOCUS_00140 13570 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14137 15234 gene locus_tag LOCUS_00150 14137 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057303.1 protein_id gnl|my_center|LOCUS_00150 15439 15942 gene locus_tag LOCUS_00160 15439 15942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16276 15875 gene locus_tag LOCUS_00170 16276 15875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 16779 16381 gene locus_tag LOCUS_00180 16779 16381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18413 17334 gene locus_tag LOCUS_00190 18413 17334 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_00190 19672 18443 gene locus_tag LOCUS_00200 19672 18443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20096 19677 gene locus_tag LOCUS_00210 20096 19677 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326711.1 protein_id gnl|my_center|LOCUS_00210 20629 22461 gene locus_tag LOCUS_00220 20629 22461 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114120.1 protein_id gnl|my_center|LOCUS_00220 22482 23141 gene locus_tag LOCUS_00230 22482 23141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23345 23755 gene locus_tag LOCUS_00240 23345 23755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23906 24565 gene locus_tag LOCUS_00250 gene trkA 23906 24565 CDS product TRK system potassium uptake protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228894.1 protein_id gnl|my_center|LOCUS_00250 24634 26136 gene locus_tag LOCUS_00260 24634 26136 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080375.1 protein_id gnl|my_center|LOCUS_00260 29075 26328 gene locus_tag LOCUS_00270 29075 26328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 >Feature sequence002 <1 2150 gene locus_tag LOCUS_00280 <1 2150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DH56:alanine--tRNA ligase 2711 3160 gene locus_tag LOCUS_00290 gene hspA 2711 3160 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_00290 4670 3282 gene locus_tag LOCUS_00300 gene mgtE 4670 3282 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9N7 protein_id gnl|my_center|LOCUS_00300 5136 6203 gene locus_tag LOCUS_00310 gene ruvB 5136 6203 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR1 protein_id gnl|my_center|LOCUS_00310 6342 8174 gene locus_tag LOCUS_00320 6342 8174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 8383 13806 gene locus_tag LOCUS_00330 8383 13806 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_00330 14470 13838 gene locus_tag LOCUS_00340 14470 13838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 14850 17372 gene locus_tag LOCUS_00350 14850 17372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 19577 17658 gene locus_tag LOCUS_00360 gene cobJ 19577 17658 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057147.1 protein_id gnl|my_center|LOCUS_00360 20429 20091 gene locus_tag LOCUS_00370 20429 20091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 20745 20978 gene locus_tag LOCUS_00380 20745 20978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 21270 21016 gene locus_tag LOCUS_00390 21270 21016 CDS product sugar transporter SemiSWEET inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G85 protein_id gnl|my_center|LOCUS_00390 21418 21630 gene locus_tag LOCUS_00400 21418 21630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 protein_id gnl|my_center|LOCUS_00400 23219 21726 gene locus_tag LOCUS_00410 23219 21726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 protein_id gnl|my_center|LOCUS_00410 23877 23452 gene locus_tag LOCUS_00420 23877 23452 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703865.1 protein_id gnl|my_center|LOCUS_00420 23937 24473 gene locus_tag LOCUS_00430 23937 24473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 >Feature sequence003 <1 1551 gene locus_tag LOCUS_00440 <1 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971984.1:histidine kinase 1520 1975 gene locus_tag LOCUS_00450 1520 1975 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_00450 2034 3221 gene locus_tag LOCUS_00460 2034 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 3634 3368 gene locus_tag LOCUS_00470 3634 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 6990 4033 gene locus_tag LOCUS_00480 6990 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 7497 8456 gene locus_tag LOCUS_00490 gene kaiA 7497 8456 CDS product circadian clock protein KaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V62 protein_id gnl|my_center|LOCUS_00490 8560 8862 gene locus_tag LOCUS_00500 gene kaiB 8560 8862 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V61 protein_id gnl|my_center|LOCUS_00500 8970 10532 gene locus_tag LOCUS_00510 gene kaiC 8970 10532 CDS product circadian clock protein kinase KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V60 protein_id gnl|my_center|LOCUS_00510 13228 10685 gene locus_tag LOCUS_00520 gene arnT 13228 10685 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124217.1 protein_id gnl|my_center|LOCUS_00520 13435 13887 gene locus_tag LOCUS_00530 13435 13887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 13971 16169 gene locus_tag LOCUS_00540 13971 16169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 18708 16255 gene locus_tag LOCUS_00550 18708 16255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 19337 18840 gene locus_tag LOCUS_00560 19337 18840 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 protein_id gnl|my_center|LOCUS_00560 20890 19403 gene locus_tag LOCUS_00570 20890 19403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143058.1 protein_id gnl|my_center|LOCUS_00570 21126 21302 gene locus_tag LOCUS_00580 21126 21302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 21577 21831 gene locus_tag LOCUS_00590 21577 21831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 21848 22426 gene locus_tag LOCUS_00600 21848 22426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 23645 22500 gene locus_tag LOCUS_00610 gene nifS 23645 22500 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056757.1 protein_id gnl|my_center|LOCUS_00610 24023 23730 gene locus_tag LOCUS_00620 24023 23730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 >Feature sequence004 718 2115 gene locus_tag LOCUS_00630 718 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 2456 5647 gene locus_tag LOCUS_00640 2456 5647 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_00640 5900 8686 gene locus_tag LOCUS_00650 5900 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 9914 9066 gene locus_tag LOCUS_00660 9914 9066 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_00660 10623 10108 gene locus_tag LOCUS_00670 10623 10108 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038069.1 protein_id gnl|my_center|LOCUS_00670 11153 10854 gene locus_tag LOCUS_00680 11153 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_003858627.1 protein_id gnl|my_center|LOCUS_00680 12006 11749 gene locus_tag LOCUS_00690 12006 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143542.1 protein_id gnl|my_center|LOCUS_00690 12319 12810 gene locus_tag LOCUS_00700 12319 12810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 12920 14560 gene locus_tag LOCUS_00710 12920 14560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141468.1 protein_id gnl|my_center|LOCUS_00710 14880 16247 gene locus_tag LOCUS_00720 14880 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057693.1 protein_id gnl|my_center|LOCUS_00720 17181 16393 gene locus_tag LOCUS_00730 17181 16393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 17567 17749 gene locus_tag LOCUS_00740 17567 17749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 17844 18026 gene locus_tag LOCUS_00750 17844 18026 CDS product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPL5 protein_id gnl|my_center|LOCUS_00750 18125 18307 gene locus_tag LOCUS_00760 18125 18307 CDS product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPL5 protein_id gnl|my_center|LOCUS_00760 19279 18548 gene locus_tag LOCUS_00770 19279 18548 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_00770 20001 19597 gene locus_tag LOCUS_00780 20001 19597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 21971 20001 gene locus_tag LOCUS_00790 21971 20001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 >Feature sequence005 347 1669 gene locus_tag LOCUS_00800 347 1669 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056050.1 protein_id gnl|my_center|LOCUS_00800 2196 1807 gene locus_tag LOCUS_00810 2196 1807 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143594.1 protein_id gnl|my_center|LOCUS_00810 2665 2222 gene locus_tag LOCUS_00820 2665 2222 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 protein_id gnl|my_center|LOCUS_00820 3091 3489 gene locus_tag LOCUS_00830 3091 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_00830 5223 3547 gene locus_tag LOCUS_00840 5223 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 5890 7827 gene locus_tag LOCUS_00850 5890 7827 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057278.1 protein_id gnl|my_center|LOCUS_00850 8334 9986 gene locus_tag LOCUS_00860 8334 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056997.1 protein_id gnl|my_center|LOCUS_00860 10367 10053 gene locus_tag LOCUS_00870 10367 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057985.1 protein_id gnl|my_center|LOCUS_00870 11361 10468 gene locus_tag LOCUS_00880 11361 10468 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_00880 12997 11762 gene locus_tag LOCUS_00890 gene dapL 12997 11762 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH57 protein_id gnl|my_center|LOCUS_00890 14125 13037 gene locus_tag LOCUS_00900 gene aguA 14125 13037 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6J9 protein_id gnl|my_center|LOCUS_00900 14282 15526 gene locus_tag LOCUS_00910 14282 15526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 15884 15555 gene locus_tag LOCUS_00920 15884 15555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 16158 15868 gene locus_tag LOCUS_00930 16158 15868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 17725 16331 gene locus_tag LOCUS_00940 17725 16331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 18468 17914 gene locus_tag LOCUS_00950 18468 17914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143245.1 protein_id gnl|my_center|LOCUS_00950 20691 18595 gene locus_tag LOCUS_00960 20691 18595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 >Feature sequence006 <1 586 gene locus_tag LOCUS_00970 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141809.1:DNA-binding response regulator 767 1843 gene locus_tag LOCUS_00980 767 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 1997 3058 gene locus_tag LOCUS_00990 1997 3058 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_00990 3138 4799 gene locus_tag LOCUS_01000 3138 4799 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142325.1 protein_id gnl|my_center|LOCUS_01000 4903 5364 gene locus_tag LOCUS_01010 4903 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 5657 5466 gene locus_tag LOCUS_01020 5657 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 5702 7114 gene locus_tag LOCUS_01030 5702 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 7506 7282 gene locus_tag LOCUS_01040 7506 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 8138 7710 gene locus_tag LOCUS_01050 8138 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 11129 8238 gene locus_tag LOCUS_01060 11129 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 12046 11369 gene locus_tag LOCUS_01070 12046 11369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 13652 12033 gene locus_tag LOCUS_01080 13652 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 14560 15528 gene locus_tag LOCUS_01090 gene nadA 14560 15528 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_01090 15755 17443 gene locus_tag LOCUS_01100 15755 17443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 17608 19359 gene locus_tag LOCUS_01110 gene nadB 17608 19359 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGB1 protein_id gnl|my_center|LOCUS_01110 >Feature sequence007 1259 882 gene locus_tag LOCUS_01120 1259 882 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_01120 4776 1249 gene locus_tag LOCUS_01130 4776 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 5153 6652 gene locus_tag LOCUS_01140 5153 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 7078 7395 gene locus_tag LOCUS_01150 7078 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 8351 7374 gene locus_tag LOCUS_01160 8351 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 10629 8452 gene locus_tag LOCUS_01170 10629 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 10932 14720 gene locus_tag LOCUS_01180 10932 14720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 15409 17283 gene locus_tag LOCUS_01190 15409 17283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 protein_id gnl|my_center|LOCUS_01190 17326 17673 gene locus_tag LOCUS_01200 17326 17673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 17782 18432 gene locus_tag LOCUS_01210 17782 18432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 18504 19325 gene locus_tag LOCUS_01220 18504 19325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 >Feature sequence008 61 999 gene locus_tag LOCUS_01230 61 999 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268102.1 protein_id gnl|my_center|LOCUS_01230 4229 1032 gene locus_tag LOCUS_01240 4229 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 4397 4945 gene locus_tag LOCUS_01250 4397 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057284.1 protein_id gnl|my_center|LOCUS_01250 5207 5740 gene locus_tag LOCUS_01260 5207 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056693.1 protein_id gnl|my_center|LOCUS_01260 5857 6510 gene locus_tag LOCUS_01270 gene sigG 5857 6510 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 protein_id gnl|my_center|LOCUS_01270 6690 7133 gene locus_tag LOCUS_01280 6690 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057944.1 protein_id gnl|my_center|LOCUS_01280 7451 7251 gene locus_tag LOCUS_01290 7451 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 7730 9157 gene locus_tag LOCUS_01300 7730 9157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 9273 10064 gene locus_tag LOCUS_01310 9273 10064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056121.1 protein_id gnl|my_center|LOCUS_01310 11372 10443 gene locus_tag LOCUS_01320 gene ubiA 11372 10443 CDS product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 protein_id gnl|my_center|LOCUS_01320 14553 11584 gene locus_tag LOCUS_01330 14553 11584 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947361.1 protein_id gnl|my_center|LOCUS_01330 16319 14721 gene locus_tag LOCUS_01340 16319 14721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 16829 17287 gene locus_tag LOCUS_01350 16829 17287 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057639.1 protein_id gnl|my_center|LOCUS_01350 17449 18111 gene locus_tag LOCUS_01360 17449 18111 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056611.1 protein_id gnl|my_center|LOCUS_01360 >Feature sequence009 <1 654 gene locus_tag LOCUS_01370 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105030.1:fatty acid desaturase 1214 1780 gene locus_tag LOCUS_01380 1214 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 2054 2767 gene locus_tag LOCUS_01390 2054 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975434.1 protein_id gnl|my_center|LOCUS_01390 3497 3081 gene locus_tag LOCUS_01400 3497 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 3719 5095 gene locus_tag LOCUS_01410 3719 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 5970 5206 gene locus_tag LOCUS_01420 5970 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 6827 5970 gene locus_tag LOCUS_01430 6827 5970 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656688.1 protein_id gnl|my_center|LOCUS_01430 7138 7443 gene locus_tag LOCUS_01440 7138 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 7580 7990 gene locus_tag LOCUS_01450 7580 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 11000 8076 gene locus_tag LOCUS_01460 gene uvrA 11000 8076 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD5 protein_id gnl|my_center|LOCUS_01460 11308 12723 gene locus_tag LOCUS_01470 11308 12723 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143975.1 protein_id gnl|my_center|LOCUS_01470 12812 13432 gene locus_tag LOCUS_01480 12812 13432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 13532 16663 gene locus_tag LOCUS_01490 13532 16663 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 protein_id gnl|my_center|LOCUS_01490 17346 16798 gene locus_tag LOCUS_01500 17346 16798 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105108.1 protein_id gnl|my_center|LOCUS_01500 17701 17471 gene locus_tag LOCUS_01510 17701 17471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 <18849 17961 gene locus_tag LOCUS_01520 <18849 17961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLC2:lipoyl synthase 2 >Feature sequence010 2400 781 gene locus_tag LOCUS_01530 2400 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 3136 2570 gene locus_tag LOCUS_01540 3136 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 3928 3302 gene locus_tag LOCUS_01550 3928 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_01550 3981 4919 gene locus_tag LOCUS_01560 3981 4919 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP3 protein_id gnl|my_center|LOCUS_01560 5599 5781 gene locus_tag LOCUS_01570 5599 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 6038 7663 gene locus_tag LOCUS_01580 6038 7663 CDS product preprotein translocase subunit Tim44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_01580 7837 9306 gene locus_tag LOCUS_01590 7837 9306 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 protein_id gnl|my_center|LOCUS_01590 9648 10748 gene locus_tag LOCUS_01600 9648 10748 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_01600 11705 10881 gene locus_tag LOCUS_01610 11705 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_01610 12283 11867 gene locus_tag LOCUS_01620 12283 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 13651 12302 gene locus_tag LOCUS_01630 gene sun 13651 12302 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB2 protein_id gnl|my_center|LOCUS_01630 13718 15601 gene locus_tag LOCUS_01640 13718 15601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 16508 15639 gene locus_tag LOCUS_01650 16508 15639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 <18212 16563 gene locus_tag LOCUS_01660 <18212 16563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058113.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence011 4291 4470 gene locus_tag LOCUS_01670 4291 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 5927 4785 gene locus_tag LOCUS_01680 5927 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 7012 6308 gene locus_tag LOCUS_01690 7012 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056267.1 protein_id gnl|my_center|LOCUS_01690 8369 7104 gene locus_tag LOCUS_01700 8369 7104 CDS product Na+-transporting ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056159.1 protein_id gnl|my_center|LOCUS_01700 9021 8575 gene locus_tag LOCUS_01710 9021 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 10658 9129 gene locus_tag LOCUS_01720 10658 9129 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_01720 10819 11358 gene locus_tag LOCUS_01730 10819 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 11486 11827 gene locus_tag LOCUS_01740 11486 11827 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_01740 12264 12037 gene locus_tag LOCUS_01750 12264 12037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 12601 13905 gene locus_tag LOCUS_01760 gene thrC 12601 13905 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056826.1 protein_id gnl|my_center|LOCUS_01760 14002 14277 gene locus_tag LOCUS_01770 14002 14277 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_01770 15071 14358 gene locus_tag LOCUS_01780 15071 14358 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_01780 15269 15469 gene locus_tag LOCUS_01790 15269 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 15766 16644 gene locus_tag LOCUS_01800 15766 16644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 protein_id gnl|my_center|LOCUS_01800 >Feature sequence012 <1 3056 gene locus_tag LOCUS_01810 <1 3056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388379.1:magnesium chelatase subunit H 3470 4168 gene locus_tag LOCUS_01820 3470 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 4444 6678 gene locus_tag LOCUS_01830 4444 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 7061 6675 gene locus_tag LOCUS_01840 7061 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 7323 8279 gene locus_tag LOCUS_01850 gene cofG 7323 8279 CDS product FO synthase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR6 protein_id gnl|my_center|LOCUS_01850 8952 8371 gene locus_tag LOCUS_01860 8952 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 10252 9032 gene locus_tag LOCUS_01870 10252 9032 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_01870 11576 10392 gene locus_tag LOCUS_01880 11576 10392 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_01880 13982 12174 gene locus_tag LOCUS_01890 13982 12174 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_01890 15109 14114 gene locus_tag LOCUS_01900 gene ilvC 15109 14114 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR0 protein_id gnl|my_center|LOCUS_01900 15875 15384 gene locus_tag LOCUS_01910 15875 15384 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR4 protein_id gnl|my_center|LOCUS_01910 16330 15926 gene locus_tag LOCUS_01920 16330 15926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056937.1 protein_id gnl|my_center|LOCUS_01920 >Feature sequence013 50 928 gene locus_tag LOCUS_01930 50 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 954 1931 gene locus_tag LOCUS_01940 954 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 1962 3140 gene locus_tag LOCUS_01950 1962 3140 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530226.1 protein_id gnl|my_center|LOCUS_01950 4782 3241 gene locus_tag LOCUS_01960 4782 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 6726 4984 gene locus_tag LOCUS_01970 6726 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 7812 6967 gene locus_tag LOCUS_01980 7812 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 8124 9407 gene locus_tag LOCUS_01990 8124 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 9481 10284 gene locus_tag LOCUS_02000 9481 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 10339 11130 gene locus_tag LOCUS_02010 gene tagA 10339 11130 CDS product acetyl-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 protein_id gnl|my_center|LOCUS_02010 12772 11255 gene locus_tag LOCUS_02020 12772 11255 CDS product chloride channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057316.1 protein_id gnl|my_center|LOCUS_02020 13603 13289 gene locus_tag LOCUS_02030 13603 13289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 13677 14462 gene locus_tag LOCUS_02040 13677 14462 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144354.1 protein_id gnl|my_center|LOCUS_02040 14604 15863 gene locus_tag LOCUS_02050 14604 15863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 >Feature sequence014 201 2780 gene locus_tag LOCUS_02060 201 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 3561 2965 gene locus_tag LOCUS_02070 3561 2965 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC5 protein_id gnl|my_center|LOCUS_02070 4479 3865 gene locus_tag LOCUS_02080 4479 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143467.1 protein_id gnl|my_center|LOCUS_02080 5469 4714 gene locus_tag LOCUS_02090 5469 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_02090 5684 7399 gene locus_tag LOCUS_02100 5684 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 7533 8981 gene locus_tag LOCUS_02110 7533 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 9437 11113 gene locus_tag LOCUS_02120 gene egl2 9437 11113 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4N3 protein_id gnl|my_center|LOCUS_02120 11712 11266 gene locus_tag LOCUS_02130 gene fcbC 11712 11266 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124513.1 protein_id gnl|my_center|LOCUS_02130 12153 11722 gene locus_tag LOCUS_02140 12153 11722 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_02140 12268 13194 gene locus_tag LOCUS_02150 gene gpsA 12268 13194 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF59 protein_id gnl|my_center|LOCUS_02150 13910 13212 gene locus_tag LOCUS_02160 13910 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 14100 16436 gene locus_tag LOCUS_02170 14100 16436 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM14 protein_id gnl|my_center|LOCUS_02170 >Feature sequence015 2066 3022 gene locus_tag LOCUS_02180 2066 3022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_02180 3203 3994 gene locus_tag LOCUS_02190 3203 3994 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057314.1 protein_id gnl|my_center|LOCUS_02190 4331 6010 gene locus_tag LOCUS_02200 4331 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_02200 6181 6843 gene locus_tag LOCUS_02210 6181 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 7630 6872 gene locus_tag LOCUS_02220 7630 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 9783 7738 gene locus_tag LOCUS_02230 9783 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 10561 9962 gene locus_tag LOCUS_02240 10561 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 12629 10794 gene locus_tag LOCUS_02250 12629 10794 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942368.1 protein_id gnl|my_center|LOCUS_02250 12890 13312 gene locus_tag LOCUS_02260 12890 13312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 14356 13367 gene locus_tag LOCUS_02270 14356 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 >Feature sequence016 1132 2193 gene locus_tag LOCUS_02280 1132 2193 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064375.1 protein_id gnl|my_center|LOCUS_02280 2521 3789 gene locus_tag LOCUS_02290 2521 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 4413 3979 gene locus_tag LOCUS_02300 4413 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 13500 4573 gene locus_tag LOCUS_02310 13500 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 14211 13627 gene locus_tag LOCUS_02320 gene lrtA 14211 13627 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_02320 14538 14990 gene locus_tag LOCUS_02330 14538 14990 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125616.1 protein_id gnl|my_center|LOCUS_02330 15411 15055 gene locus_tag LOCUS_02340 15411 15055 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932868.1 protein_id gnl|my_center|LOCUS_02340 >Feature sequence017 1498 806 gene locus_tag LOCUS_02350 1498 806 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056725.1 protein_id gnl|my_center|LOCUS_02350 1661 2314 gene locus_tag LOCUS_02360 1661 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 protein_id gnl|my_center|LOCUS_02360 2387 2635 gene locus_tag LOCUS_02370 2387 2635 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057133.1 protein_id gnl|my_center|LOCUS_02370 2824 3852 gene locus_tag LOCUS_02380 gene fni 2824 3852 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ26 protein_id gnl|my_center|LOCUS_02380 3925 5727 gene locus_tag LOCUS_02390 3925 5727 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_02390 6683 5877 gene locus_tag LOCUS_02400 6683 5877 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141692.1 protein_id gnl|my_center|LOCUS_02400 7542 6781 gene locus_tag LOCUS_02410 7542 6781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_02410 8083 8901 gene locus_tag LOCUS_02420 gene fabG 8083 8901 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002027497.1 protein_id gnl|my_center|LOCUS_02420 10401 9007 gene locus_tag LOCUS_02430 gene fum 10401 9007 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRE5 protein_id gnl|my_center|LOCUS_02430 14214 10516 gene locus_tag LOCUS_02440 14214 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 15256 14618 gene locus_tag LOCUS_02450 gene pth 15256 14618 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN75 protein_id gnl|my_center|LOCUS_02450 >Feature sequence018 3595 686 gene locus_tag LOCUS_02460 3595 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 4406 3816 gene locus_tag LOCUS_02470 4406 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140946.1 protein_id gnl|my_center|LOCUS_02470 5152 4466 gene locus_tag LOCUS_02480 5152 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975434.1 protein_id gnl|my_center|LOCUS_02480 6060 5476 gene locus_tag LOCUS_02490 6060 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 8108 6060 gene locus_tag LOCUS_02500 8108 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 9449 8160 gene locus_tag LOCUS_02510 gene hemN 9449 8160 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_02510 9794 9519 gene locus_tag LOCUS_02520 9794 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 11183 9828 gene locus_tag LOCUS_02530 11183 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 12886 14553 gene locus_tag LOCUS_02540 12886 14553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 >Feature sequence019 2155 1064 gene locus_tag LOCUS_02550 2155 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 2303 3097 gene locus_tag LOCUS_02560 2303 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 3097 3741 gene locus_tag LOCUS_02570 3097 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 3764 4789 gene locus_tag LOCUS_02580 3764 4789 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545486.1 protein_id gnl|my_center|LOCUS_02580 4796 5920 gene locus_tag LOCUS_02590 4796 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 6085 6741 gene locus_tag LOCUS_02600 6085 6741 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966303.1 protein_id gnl|my_center|LOCUS_02600 7888 6803 gene locus_tag LOCUS_02610 7888 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 8208 9056 gene locus_tag LOCUS_02620 8208 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 9087 9857 gene locus_tag LOCUS_02630 9087 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 9874 11052 gene locus_tag LOCUS_02640 9874 11052 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642921.1 protein_id gnl|my_center|LOCUS_02640 11156 12244 gene locus_tag LOCUS_02650 11156 12244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 12219 14093 gene locus_tag LOCUS_02660 12219 14093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 15257 14154 gene locus_tag LOCUS_02670 15257 14154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 >Feature sequence020 319 185 gene locus_tag LOCUS_02680 319 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 702 340 gene locus_tag LOCUS_02690 702 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 1413 964 gene locus_tag LOCUS_02700 1413 964 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226669.1 protein_id gnl|my_center|LOCUS_02700 2776 1622 gene locus_tag LOCUS_02710 2776 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 4302 2941 gene locus_tag LOCUS_02720 4302 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 5004 4339 gene locus_tag LOCUS_02730 5004 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 5570 5001 gene locus_tag LOCUS_02740 5570 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029538.1 protein_id gnl|my_center|LOCUS_02740 5994 7088 gene locus_tag LOCUS_02750 5994 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 8246 7308 gene locus_tag LOCUS_02760 8246 7308 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709054.1 protein_id gnl|my_center|LOCUS_02760 9408 8434 gene locus_tag LOCUS_02770 gene glk 9408 8434 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLF5 protein_id gnl|my_center|LOCUS_02770 10638 9601 gene locus_tag LOCUS_02780 10638 9601 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_02780 11346 10660 gene locus_tag LOCUS_02790 11346 10660 CDS product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 protein_id gnl|my_center|LOCUS_02790 12338 11358 gene locus_tag LOCUS_02800 12338 11358 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976918.1 protein_id gnl|my_center|LOCUS_02800 13762 12347 gene locus_tag LOCUS_02810 13762 12347 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963690.1 protein_id gnl|my_center|LOCUS_02810 14611 14381 gene locus_tag LOCUS_02820 14611 14381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 15216 14806 gene locus_tag LOCUS_02830 15216 14806 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 protein_id gnl|my_center|LOCUS_02830 >Feature sequence021 2140 725 gene locus_tag LOCUS_02840 2140 725 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804864.1 protein_id gnl|my_center|LOCUS_02840 2303 3067 gene locus_tag LOCUS_02850 gene cysE 2303 3067 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK8 protein_id gnl|my_center|LOCUS_02850 3569 3207 gene locus_tag LOCUS_02860 3569 3207 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073477.1 protein_id gnl|my_center|LOCUS_02860 3757 4974 gene locus_tag LOCUS_02870 3757 4974 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058279.1 protein_id gnl|my_center|LOCUS_02870 5727 5155 gene locus_tag LOCUS_02880 5727 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_02880 6765 5830 gene locus_tag LOCUS_02890 gene nadK2 6765 5830 CDS product NAD kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RR32 protein_id gnl|my_center|LOCUS_02890 7544 6873 gene locus_tag LOCUS_02900 7544 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124316.1 protein_id gnl|my_center|LOCUS_02900 8278 7709 gene locus_tag LOCUS_02910 8278 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 9539 8727 gene locus_tag LOCUS_02920 9539 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 10501 9608 gene locus_tag LOCUS_02930 10501 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 11178 12482 gene locus_tag LOCUS_02940 11178 12482 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143095.1 protein_id gnl|my_center|LOCUS_02940 12686 13381 gene locus_tag LOCUS_02950 12686 13381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 14084 13506 gene locus_tag LOCUS_02960 gene rplY 14084 13506 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNL2 protein_id gnl|my_center|LOCUS_02960 <15109 14235 gene locus_tag LOCUS_02970 <15109 14235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLG2:adenylosuccinate synthetase >Feature sequence022 46 513 gene locus_tag LOCUS_02980 46 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 725 2236 gene locus_tag LOCUS_02990 725 2236 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945966.1 protein_id gnl|my_center|LOCUS_02990 2875 2513 gene locus_tag LOCUS_03000 2875 2513 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140204.1 protein_id gnl|my_center|LOCUS_03000 3122 4663 gene locus_tag LOCUS_03010 gene purH 3122 4663 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN5 protein_id gnl|my_center|LOCUS_03010 4913 6574 gene locus_tag LOCUS_03020 4913 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 6670 7254 gene locus_tag LOCUS_03030 6670 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142405.1 protein_id gnl|my_center|LOCUS_03030 7354 8589 gene locus_tag LOCUS_03040 7354 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 10003 8756 gene locus_tag LOCUS_03050 10003 8756 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_03050 10117 10413 gene locus_tag LOCUS_03060 10117 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 10948 10430 gene locus_tag LOCUS_03070 10948 10430 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296548.1 protein_id gnl|my_center|LOCUS_03070 11581 11117 gene locus_tag LOCUS_03080 11581 11117 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057290.1 protein_id gnl|my_center|LOCUS_03080 <14575 11729 gene locus_tag LOCUS_03090 <14575 11729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:aggregation factor core protein MAFp3, isoform C >Feature sequence023 742 29 gene locus_tag LOCUS_03100 742 29 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258296.1 protein_id gnl|my_center|LOCUS_03100 1626 751 gene locus_tag LOCUS_03110 1626 751 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_03110 5049 2170 gene locus_tag LOCUS_03120 5049 2170 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056417.1 protein_id gnl|my_center|LOCUS_03120 5341 6720 gene locus_tag LOCUS_03130 5341 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 7696 6866 gene locus_tag LOCUS_03140 7696 6866 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 protein_id gnl|my_center|LOCUS_03140 8015 9496 gene locus_tag LOCUS_03150 8015 9496 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403192.1 protein_id gnl|my_center|LOCUS_03150 11261 9579 gene locus_tag LOCUS_03160 11261 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 12342 11392 gene locus_tag LOCUS_03170 12342 11392 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_03170 13582 12821 gene locus_tag LOCUS_03180 13582 12821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 >Feature sequence024 798 2180 gene locus_tag LOCUS_03190 798 2180 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_03190 2907 2461 gene locus_tag LOCUS_03200 2907 2461 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 protein_id gnl|my_center|LOCUS_03200 4586 3150 gene locus_tag LOCUS_03210 gene crtQ 4586 3150 CDS product Zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY9 protein_id gnl|my_center|LOCUS_03210 5953 4727 gene locus_tag LOCUS_03220 gene tyrS 5953 4727 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR1 protein_id gnl|my_center|LOCUS_03220 6420 8348 gene locus_tag LOCUS_03230 6420 8348 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055904.1 protein_id gnl|my_center|LOCUS_03230 8541 10070 gene locus_tag LOCUS_03240 8541 10070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057405.1 protein_id gnl|my_center|LOCUS_03240 11516 10137 gene locus_tag LOCUS_03250 gene cbiA 11516 10137 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF32 protein_id gnl|my_center|LOCUS_03250 12824 11610 gene locus_tag LOCUS_03260 gene ispG 12824 11610 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK70 protein_id gnl|my_center|LOCUS_03260 13288 12941 gene locus_tag LOCUS_03270 13288 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056501.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence025 729 124 gene locus_tag LOCUS_03280 729 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 1040 1525 gene locus_tag LOCUS_03290 1040 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 1769 2692 gene locus_tag LOCUS_03300 1769 2692 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_03300 4027 2702 gene locus_tag LOCUS_03310 4027 2702 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056420.1 protein_id gnl|my_center|LOCUS_03310 5071 4442 gene locus_tag LOCUS_03320 5071 4442 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057443.1 protein_id gnl|my_center|LOCUS_03320 5202 6365 gene locus_tag LOCUS_03330 gene hemH 5202 6365 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGU6 protein_id gnl|my_center|LOCUS_03330 6576 6782 gene locus_tag LOCUS_03340 6576 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 7104 6790 gene locus_tag LOCUS_03350 7104 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 7535 7798 gene locus_tag LOCUS_03360 7535 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056018.1 protein_id gnl|my_center|LOCUS_03360 7807 8883 gene locus_tag LOCUS_03370 7807 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 10275 9226 gene locus_tag LOCUS_03380 10275 9226 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_03380 12029 10512 gene locus_tag LOCUS_03390 12029 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 12553 12113 gene locus_tag LOCUS_03400 12553 12113 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731060.1 protein_id gnl|my_center|LOCUS_03400 <13722 12810 gene locus_tag LOCUS_03410 <13722 12810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143421.1:sensor histidine kinase >Feature sequence026 1306 3486 gene locus_tag LOCUS_03420 1306 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056596.1 protein_id gnl|my_center|LOCUS_03420 4787 3549 gene locus_tag LOCUS_03430 4787 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 protein_id gnl|my_center|LOCUS_03430 5175 5011 gene locus_tag LOCUS_03440 5175 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 5916 5323 gene locus_tag LOCUS_03450 5916 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 6860 5985 gene locus_tag LOCUS_03460 6860 5985 CDS product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141847.1 protein_id gnl|my_center|LOCUS_03460 7154 8785 gene locus_tag LOCUS_03470 gene guaA 7154 8785 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA5 protein_id gnl|my_center|LOCUS_03470 8986 9306 gene locus_tag LOCUS_03480 8986 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 9431 12682 gene locus_tag LOCUS_03490 9431 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 12688 13083 gene locus_tag LOCUS_03500 12688 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 >Feature sequence027 680 456 gene locus_tag LOCUS_03510 680 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 2468 1257 gene locus_tag LOCUS_03520 2468 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144202.1 protein_id gnl|my_center|LOCUS_03520 3120 4724 gene locus_tag LOCUS_03530 3120 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 5736 4846 gene locus_tag LOCUS_03540 gene crtR 5736 4846 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_03540 5922 7013 gene locus_tag LOCUS_03550 5922 7013 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEB1 protein_id gnl|my_center|LOCUS_03550 7400 7786 gene locus_tag LOCUS_03560 7400 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 7879 9072 gene locus_tag LOCUS_03570 7879 9072 CDS product UNC-44 ankyrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_03570 9299 10219 gene locus_tag LOCUS_03580 9299 10219 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582729.1 protein_id gnl|my_center|LOCUS_03580 10212 11582 gene locus_tag LOCUS_03590 10212 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 12347 11646 gene locus_tag LOCUS_03600 12347 11646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence028 461 604 gene locus_tag LOCUS_03610 gene hli4 461 604 CDS product high light inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 protein_id gnl|my_center|LOCUS_03610 1052 804 gene locus_tag LOCUS_03620 1052 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 1392 2597 gene locus_tag LOCUS_03630 1392 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 4176 2809 gene locus_tag LOCUS_03640 gene mnmE 4176 2809 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P1 protein_id gnl|my_center|LOCUS_03640 4388 5473 gene locus_tag LOCUS_03650 4388 5473 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X28 protein_id gnl|my_center|LOCUS_03650 5634 6323 gene locus_tag LOCUS_03660 gene pyrF 5634 6323 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLT3 protein_id gnl|my_center|LOCUS_03660 6498 8987 gene locus_tag LOCUS_03670 6498 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 9599 9138 gene locus_tag LOCUS_03680 gene gcvH 9599 9138 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFJ4 protein_id gnl|my_center|LOCUS_03680 10520 9708 gene locus_tag LOCUS_03690 gene bioH 10520 9708 CDS product O-methylpimelyl-ACP methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_03690 12559 10646 gene locus_tag LOCUS_03700 gene mnmG 12559 10646 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF8 protein_id gnl|my_center|LOCUS_03700 >Feature sequence029 554 1186 gene locus_tag LOCUS_03710 554 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 1405 2178 gene locus_tag LOCUS_03720 1405 2178 CDS product 5-oxo-1,2,5-tricarboxylic-3-penten acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057118.1 protein_id gnl|my_center|LOCUS_03720 2676 2197 gene locus_tag LOCUS_03730 gene ycf60 2676 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056916.1 protein_id gnl|my_center|LOCUS_03730 3123 3875 gene locus_tag LOCUS_03740 3123 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056104.1 protein_id gnl|my_center|LOCUS_03740 4626 4093 gene locus_tag LOCUS_03750 4626 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5259 4759 gene locus_tag LOCUS_03760 5259 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_03760 6399 5428 gene locus_tag LOCUS_03770 6399 5428 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056913.1 protein_id gnl|my_center|LOCUS_03770 7794 6565 gene locus_tag LOCUS_03780 gene avtA 7794 6565 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057579.1 protein_id gnl|my_center|LOCUS_03780 8001 8264 gene locus_tag LOCUS_03790 8001 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 9485 8316 gene locus_tag LOCUS_03800 9485 8316 CDS product succinyldiaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143457.1 protein_id gnl|my_center|LOCUS_03800 9999 9685 gene locus_tag LOCUS_03810 9999 9685 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHW4 protein_id gnl|my_center|LOCUS_03810 10092 10787 gene locus_tag LOCUS_03820 gene cpcT1 10092 10787 CDS product chromophore lyase CpcT/CpeT 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNH3 protein_id gnl|my_center|LOCUS_03820 11964 11032 gene locus_tag LOCUS_03830 11964 11032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 12852 12346 gene locus_tag LOCUS_03840 12852 12346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 >Feature sequence030 758 1078 gene locus_tag LOCUS_03850 758 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 1164 2504 gene locus_tag LOCUS_03860 1164 2504 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_03860 2709 5615 gene locus_tag LOCUS_03870 2709 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 6744 5869 gene locus_tag LOCUS_03880 6744 5869 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141255.1 protein_id gnl|my_center|LOCUS_03880 7008 6769 gene locus_tag LOCUS_03890 7008 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 7192 7494 gene locus_tag LOCUS_03900 gene ureA 7192 7494 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK85 protein_id gnl|my_center|LOCUS_03900 7548 7856 gene locus_tag LOCUS_03910 gene ureB 7548 7856 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLZ6 protein_id gnl|my_center|LOCUS_03910 8012 9271 gene locus_tag LOCUS_03920 8012 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994245.1 protein_id gnl|my_center|LOCUS_03920 9264 9884 gene locus_tag LOCUS_03930 9264 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_03930 11522 9885 gene locus_tag LOCUS_03940 gene ppx 11522 9885 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057517.1 protein_id gnl|my_center|LOCUS_03940 11818 12705 gene locus_tag LOCUS_03950 gene ubiA 11818 12705 CDS product 4-hydroxybenzoate solanesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFU6 protein_id gnl|my_center|LOCUS_03950 >Feature sequence031 <1 2107 gene locus_tag LOCUS_03960 <1 2107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056203.1:methyl-accepting chemotaxis protein 3030 2188 gene locus_tag LOCUS_03970 3030 2188 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS4 protein_id gnl|my_center|LOCUS_03970 4843 3152 gene locus_tag LOCUS_03980 4843 3152 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 protein_id gnl|my_center|LOCUS_03980 5210 4932 gene locus_tag LOCUS_03990 5210 4932 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172914.1 protein_id gnl|my_center|LOCUS_03990 5336 6193 gene locus_tag LOCUS_04000 5336 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_04000 7832 6234 gene locus_tag LOCUS_04010 7832 6234 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG7 protein_id gnl|my_center|LOCUS_04010 7960 9111 gene locus_tag LOCUS_04020 7960 9111 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104921.1 protein_id gnl|my_center|LOCUS_04020 9101 9688 gene locus_tag LOCUS_04030 9101 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 9783 10586 gene locus_tag LOCUS_04040 9783 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 11350 10583 gene locus_tag LOCUS_04050 11350 10583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 11665 11946 gene locus_tag LOCUS_04060 11665 11946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 12130 12513 gene locus_tag LOCUS_04070 12130 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 >Feature sequence032 <1 873 gene locus_tag LOCUS_04080 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJE9:D-fructose 1,6-bisphosphatase class 2/sedoheptulose 1,7-bisphosphatase 1590 2051 gene locus_tag LOCUS_04090 1590 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 2727 2095 gene locus_tag LOCUS_04100 2727 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3157 4950 gene locus_tag LOCUS_04110 3157 4950 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_04110 5150 6232 gene locus_tag LOCUS_04120 gene pfkA 5150 6232 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ7 protein_id gnl|my_center|LOCUS_04120 6326 6571 gene locus_tag LOCUS_04130 6326 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 6620 6702 gene locus_tag LOCUS_t00010 6620 6702 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7044 8792 gene locus_tag LOCUS_04140 7044 8792 CDS product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142261.1 protein_id gnl|my_center|LOCUS_04140 8841 9998 gene locus_tag LOCUS_04150 8841 9998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 10332 11141 gene locus_tag LOCUS_04160 10332 11141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 12659 11235 gene locus_tag LOCUS_04170 12659 11235 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057032.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence033 <1 637 gene locus_tag LOCUS_04180 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DMR6:NAD(P)H-quinone oxidoreductase subunit 2 789 1199 gene locus_tag LOCUS_04190 789 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 1217 1414 gene locus_tag LOCUS_04200 1217 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 1857 2828 gene locus_tag LOCUS_04210 gene por 1857 2828 CDS product protochlorophyllide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 protein_id gnl|my_center|LOCUS_04210 3047 4333 gene locus_tag LOCUS_04220 3047 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 6174 4558 gene locus_tag LOCUS_04230 6174 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057554.1 protein_id gnl|my_center|LOCUS_04230 6878 6366 gene locus_tag LOCUS_04240 6878 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 8795 7173 gene locus_tag LOCUS_04250 8795 7173 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 protein_id gnl|my_center|LOCUS_04250 8930 9187 gene locus_tag LOCUS_04260 8930 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 9269 9757 gene locus_tag LOCUS_04270 9269 9757 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_04270 10208 10738 gene locus_tag LOCUS_04280 10208 10738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 10968 11300 gene locus_tag LOCUS_04290 10968 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 11445 12776 gene locus_tag LOCUS_04300 11445 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 >Feature sequence034 1265 276 gene locus_tag LOCUS_04310 gene moaA 1265 276 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCF5 protein_id gnl|my_center|LOCUS_04310 1437 1748 gene locus_tag LOCUS_04320 1437 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2595 1909 gene locus_tag LOCUS_04330 2595 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5174 2715 gene locus_tag LOCUS_04340 gene recG 5174 2715 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW6 protein_id gnl|my_center|LOCUS_04340 5927 5421 gene locus_tag LOCUS_04350 5927 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875932.1 protein_id gnl|my_center|LOCUS_04350 6261 6959 gene locus_tag LOCUS_04360 6261 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 7017 7352 gene locus_tag LOCUS_04370 7017 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 10316 7479 gene locus_tag LOCUS_04380 10316 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 10660 10842 gene locus_tag LOCUS_04390 10660 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 11982 10873 gene locus_tag LOCUS_04400 11982 10873 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058201.1 protein_id gnl|my_center|LOCUS_04400 <12623 11985 gene locus_tag LOCUS_04410 <12623 11985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142793.1:Crp/Fnr family transcriptional regulator >Feature sequence035 556 1725 gene locus_tag LOCUS_04420 556 1725 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056963.1 protein_id gnl|my_center|LOCUS_04420 1868 3031 gene locus_tag LOCUS_04430 1868 3031 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_04430 3038 4162 gene locus_tag LOCUS_04440 3038 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 4385 5131 gene locus_tag LOCUS_04450 4385 5131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_04450 5501 5325 gene locus_tag LOCUS_04460 5501 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 5618 6208 gene locus_tag LOCUS_04470 5618 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 6342 7052 gene locus_tag LOCUS_04480 6342 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04480 7291 8310 gene locus_tag LOCUS_04490 7291 8310 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_04490 8902 11124 gene locus_tag LOCUS_04500 8902 11124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 >Feature sequence036 2772 3065 gene locus_tag LOCUS_04510 2772 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 3215 4900 gene locus_tag LOCUS_04520 gene pyrG 3215 4900 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT7 protein_id gnl|my_center|LOCUS_04520 5926 5156 gene locus_tag LOCUS_04530 5926 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 6173 6865 gene locus_tag LOCUS_04540 6173 6865 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965031.1 protein_id gnl|my_center|LOCUS_04540 6991 7067 gene locus_tag LOCUS_t00020 6991 7067 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7572 7189 gene locus_tag LOCUS_04550 7572 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 8966 7656 gene locus_tag LOCUS_04560 8966 7656 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140286.1 protein_id gnl|my_center|LOCUS_04560 9793 9107 gene locus_tag LOCUS_04570 9793 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 10479 10105 gene locus_tag LOCUS_04580 10479 10105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 10698 11303 gene locus_tag LOCUS_04590 10698 11303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 <12532 11389 gene locus_tag LOCUS_04600 <12532 11389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NHY0:DNA replication and repair protein RecF >Feature sequence037 3374 5059 gene locus_tag LOCUS_04610 3374 5059 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142407.1 protein_id gnl|my_center|LOCUS_04610 5199 5810 gene locus_tag LOCUS_04620 5199 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 7540 5876 gene locus_tag LOCUS_04630 7540 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 7762 8625 gene locus_tag LOCUS_04640 gene bcpA 7762 8625 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808124.1 protein_id gnl|my_center|LOCUS_04640 9068 10219 gene locus_tag LOCUS_04650 9068 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 10722 10925 gene locus_tag LOCUS_04660 gene ycf33 10722 10925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057323.1 protein_id gnl|my_center|LOCUS_04660 11026 11424 gene locus_tag LOCUS_04670 gene rbfA 11026 11424 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF9 protein_id gnl|my_center|LOCUS_04670 >Feature sequence038 <1 974 gene locus_tag LOCUS_04680 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DH66:N-acetylglucosamine-6-phosphate deacetylase 2117 1482 gene locus_tag LOCUS_04690 2117 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 2541 2885 gene locus_tag LOCUS_04700 2541 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056921.1 protein_id gnl|my_center|LOCUS_04700 3324 3932 gene locus_tag LOCUS_04710 3324 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 4837 3956 gene locus_tag LOCUS_04720 4837 3956 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384270.1 protein_id gnl|my_center|LOCUS_04720 4903 5202 gene locus_tag LOCUS_04730 4903 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 5910 7400 gene locus_tag LOCUS_04740 5910 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 9155 7512 gene locus_tag LOCUS_04750 9155 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141468.1 protein_id gnl|my_center|LOCUS_04750 9374 10792 gene locus_tag LOCUS_04760 9374 10792 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108290.1 protein_id gnl|my_center|LOCUS_04760 11676 11005 gene locus_tag LOCUS_04770 11676 11005 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_04770 12221 11778 gene locus_tag LOCUS_04780 12221 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence039 755 156 gene locus_tag LOCUS_04790 755 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 1602 697 gene locus_tag LOCUS_04800 gene argB 1602 697 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59303 protein_id gnl|my_center|LOCUS_04800 1823 2920 gene locus_tag LOCUS_04810 1823 2920 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793128.1 protein_id gnl|my_center|LOCUS_04810 3890 2985 gene locus_tag LOCUS_04820 gene dpnIIA 3890 2985 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H7D1 protein_id gnl|my_center|LOCUS_04820 4667 3960 gene locus_tag LOCUS_04830 gene thyX 4667 3960 CDS product flavin-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYT0 protein_id gnl|my_center|LOCUS_04830 5170 7362 gene locus_tag LOCUS_04840 5170 7362 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_04840 7688 7924 gene locus_tag LOCUS_04850 7688 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 7911 8123 gene locus_tag LOCUS_04860 7911 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 8154 9245 gene locus_tag LOCUS_04870 8154 9245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 10155 9253 gene locus_tag LOCUS_04880 10155 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 >Feature sequence040 329 1351 gene locus_tag LOCUS_04890 329 1351 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055865.1 protein_id gnl|my_center|LOCUS_04890 1518 2411 gene locus_tag LOCUS_04900 gene ycf38 1518 2411 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJA3 protein_id gnl|my_center|LOCUS_04900 2572 2408 gene locus_tag LOCUS_04910 2572 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 2735 3925 gene locus_tag LOCUS_04920 2735 3925 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063811.1 protein_id gnl|my_center|LOCUS_04920 5007 3943 gene locus_tag LOCUS_04930 gene cheB 5007 3943 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBT0 protein_id gnl|my_center|LOCUS_04930 6002 5079 gene locus_tag LOCUS_04940 6002 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 7882 6125 gene locus_tag LOCUS_04950 7882 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 8519 7893 gene locus_tag LOCUS_04960 8519 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056685.1 protein_id gnl|my_center|LOCUS_04960 8922 9440 gene locus_tag LOCUS_04970 gene apt 8922 9440 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH9 protein_id gnl|my_center|LOCUS_04970 9589 10638 gene locus_tag LOCUS_04980 9589 10638 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 protein_id gnl|my_center|LOCUS_04980 10719 11015 gene locus_tag LOCUS_04990 10719 11015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 11618 11127 gene locus_tag LOCUS_05000 11618 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055932.1 protein_id gnl|my_center|LOCUS_05000 >Feature sequence041 1785 337 gene locus_tag LOCUS_05010 gene gltX 1785 337 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI5 protein_id gnl|my_center|LOCUS_05010 3368 2178 gene locus_tag LOCUS_05020 3368 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265890.1 protein_id gnl|my_center|LOCUS_05020 5120 3405 gene locus_tag LOCUS_05030 gene uup 5120 3405 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124260.1 protein_id gnl|my_center|LOCUS_05030 5781 5245 gene locus_tag LOCUS_05040 5781 5245 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 protein_id gnl|my_center|LOCUS_05040 6109 6921 gene locus_tag LOCUS_05050 6109 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 6953 7864 gene locus_tag LOCUS_05060 6953 7864 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_05060 8285 9871 gene locus_tag LOCUS_05070 8285 9871 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 protein_id gnl|my_center|LOCUS_05070 10932 10009 gene locus_tag LOCUS_05080 10932 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_05080 11640 11011 gene locus_tag LOCUS_05090 11640 11011 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057925.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence042 2369 3715 gene locus_tag LOCUS_05100 gene aroB 2369 3715 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2G0 protein_id gnl|my_center|LOCUS_05100 3728 4561 gene locus_tag LOCUS_05110 3728 4561 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_05110 4666 6021 gene locus_tag LOCUS_05120 4666 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_05120 6160 7302 gene locus_tag LOCUS_05130 gene garR 6160 7302 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTX1 protein_id gnl|my_center|LOCUS_05130 7523 7383 gene locus_tag LOCUS_05140 7523 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 7492 8343 gene locus_tag LOCUS_05150 7492 8343 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 protein_id gnl|my_center|LOCUS_05150 8476 9897 gene locus_tag LOCUS_05160 gene putP 8476 9897 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_05160 10068 11093 gene locus_tag LOCUS_05170 10068 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 11296 11928 gene locus_tag LOCUS_05180 11296 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence043 <1 2030 gene locus_tag LOCUS_05190 <1 2030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057444.1:transporter 2123 2434 gene locus_tag LOCUS_05200 2123 2434 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_05200 3756 2902 gene locus_tag LOCUS_05210 3756 2902 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057366.1 protein_id gnl|my_center|LOCUS_05210 4717 3956 gene locus_tag LOCUS_05220 gene hisA 4717 3956 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMQ9 protein_id gnl|my_center|LOCUS_05220 4810 4882 gene locus_tag LOCUS_t00030 4810 4882 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6671 4938 gene locus_tag LOCUS_05230 gene menD 6671 4938 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2V6 protein_id gnl|my_center|LOCUS_05230 8210 6777 gene locus_tag LOCUS_05240 8210 6777 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404102.1 protein_id gnl|my_center|LOCUS_05240 9133 8378 gene locus_tag LOCUS_05250 gene ubiE 9133 8378 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU2 protein_id gnl|my_center|LOCUS_05250 9507 10160 gene locus_tag LOCUS_05260 9507 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 >Feature sequence044 74 2881 gene locus_tag LOCUS_05270 gene secA 74 2881 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHU4 protein_id gnl|my_center|LOCUS_05270 3626 3135 gene locus_tag LOCUS_05280 3626 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 6921 3703 gene locus_tag LOCUS_05290 6921 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 10760 6990 gene locus_tag LOCUS_05300 10760 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 11410 10904 gene locus_tag LOCUS_05310 11410 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 11780 11421 gene locus_tag LOCUS_05320 11780 11421 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence045 1829 546 gene locus_tag LOCUS_05330 gene glyA 1829 546 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH33 protein_id gnl|my_center|LOCUS_05330 2090 2320 gene locus_tag LOCUS_05340 2090 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057807.1 protein_id gnl|my_center|LOCUS_05340 2777 2367 gene locus_tag LOCUS_05350 2777 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 3336 2902 gene locus_tag LOCUS_05360 3336 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 3599 4912 gene locus_tag LOCUS_05370 3599 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4918 5952 gene locus_tag LOCUS_05380 4918 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 protein_id gnl|my_center|LOCUS_05380 6943 5957 gene locus_tag LOCUS_05390 6943 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142395.1 protein_id gnl|my_center|LOCUS_05390 7066 7671 gene locus_tag LOCUS_05400 gene ywhC 7066 7671 CDS product putative zinc metalloprotease YwhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P70995 protein_id gnl|my_center|LOCUS_05400 9552 7834 gene locus_tag LOCUS_05410 gene lysS 9552 7834 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA9 protein_id gnl|my_center|LOCUS_05410 10025 10651 gene locus_tag LOCUS_05420 10025 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 11511 10948 gene locus_tag LOCUS_05430 11511 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 >Feature sequence046 2 661 gene locus_tag LOCUS_05440 2 661 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058278.1 protein_id gnl|my_center|LOCUS_05440 723 811 gene locus_tag LOCUS_t00040 723 811 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2211 838 gene locus_tag LOCUS_05450 gene dnaA 2211 838 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL93 protein_id gnl|my_center|LOCUS_05450 2407 3033 gene locus_tag LOCUS_05460 2407 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3483 3145 gene locus_tag LOCUS_05470 3483 3145 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 protein_id gnl|my_center|LOCUS_05470 3571 4035 gene locus_tag LOCUS_05480 3571 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 4060 4221 gene locus_tag LOCUS_05490 4060 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 5733 4468 gene locus_tag LOCUS_05500 5733 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056681.1 protein_id gnl|my_center|LOCUS_05500 6403 5795 gene locus_tag LOCUS_05510 6403 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475206.1 protein_id gnl|my_center|LOCUS_05510 6715 8526 gene locus_tag LOCUS_05520 6715 8526 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_05520 8783 9337 gene locus_tag LOCUS_05530 8783 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 10553 9408 gene locus_tag LOCUS_05540 gene wecE 10553 9408 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124471.1 protein_id gnl|my_center|LOCUS_05540 10730 11500 gene locus_tag LOCUS_05550 10730 11500 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence047 89 1198 gene locus_tag LOCUS_05560 89 1198 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144332.1 protein_id gnl|my_center|LOCUS_05560 1288 1587 gene locus_tag LOCUS_05570 1288 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2982 1732 gene locus_tag LOCUS_05580 2982 1732 CDS product NDP-hexose 3-C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_05580 4168 3176 gene locus_tag LOCUS_05590 4168 3176 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435695.1 protein_id gnl|my_center|LOCUS_05590 5003 4146 gene locus_tag LOCUS_05600 gene gcd1 5003 4146 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 protein_id gnl|my_center|LOCUS_05600 5539 6714 gene locus_tag LOCUS_05610 5539 6714 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056830.1 protein_id gnl|my_center|LOCUS_05610 7980 6907 gene locus_tag LOCUS_05620 7980 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 8346 9845 gene locus_tag LOCUS_05630 8346 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 10858 9959 gene locus_tag LOCUS_05640 10858 9959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence048 113 1099 gene locus_tag LOCUS_05650 113 1099 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_05650 1148 1219 gene locus_tag LOCUS_t00050 1148 1219 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1254 3635 gene locus_tag LOCUS_05660 1254 3635 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350101.1 protein_id gnl|my_center|LOCUS_05660 3837 4205 gene locus_tag LOCUS_05670 3837 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707140.1 protein_id gnl|my_center|LOCUS_05670 4431 5744 gene locus_tag LOCUS_05680 4431 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 6017 8965 gene locus_tag LOCUS_05690 6017 8965 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889695.1 protein_id gnl|my_center|LOCUS_05690 9056 9793 gene locus_tag LOCUS_05700 gene ccdA 9056 9793 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055907.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence049 <1 537 gene locus_tag LOCUS_05710 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKI1:GTPase Der 618 926 gene locus_tag LOCUS_05720 618 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 2244 1123 gene locus_tag LOCUS_05730 2244 1123 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXY8 protein_id gnl|my_center|LOCUS_05730 3591 2422 gene locus_tag LOCUS_05740 3591 2422 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_05740 4612 3635 gene locus_tag LOCUS_05750 4612 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 4951 4808 gene locus_tag LOCUS_05760 4951 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 5252 6352 gene locus_tag LOCUS_05770 5252 6352 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_05770 9790 6671 gene locus_tag LOCUS_05780 9790 6671 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057001.1 protein_id gnl|my_center|LOCUS_05780 11026 10292 gene locus_tag LOCUS_05790 11026 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence050 97 2004 gene locus_tag LOCUS_05800 gene dxs 97 2004 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL74 protein_id gnl|my_center|LOCUS_05800 2721 3584 gene locus_tag LOCUS_05810 2721 3584 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_05810 3938 3789 gene locus_tag LOCUS_05820 3938 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 4065 5909 gene locus_tag LOCUS_05830 4065 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 6249 7586 gene locus_tag LOCUS_05840 6249 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 7741 8877 gene locus_tag LOCUS_05850 7741 8877 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870654.1 protein_id gnl|my_center|LOCUS_05850 9034 10188 gene locus_tag LOCUS_05860 gene mscS-1 9034 10188 CDS product small-conductance mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942278.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence051 662 2023 gene locus_tag LOCUS_05870 662 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2086 4968 gene locus_tag LOCUS_05880 gene polA 2086 4968 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057179.1 protein_id gnl|my_center|LOCUS_05880 6109 5189 gene locus_tag LOCUS_05890 6109 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 6601 7086 gene locus_tag LOCUS_05900 6601 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 protein_id gnl|my_center|LOCUS_05900 7217 7696 gene locus_tag LOCUS_05910 7217 7696 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_05910 8363 9748 gene locus_tag LOCUS_05920 8363 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 9834 10853 gene locus_tag LOCUS_05930 9834 10853 CDS product hopanoid biosynthesis associated radical SAM protein HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_05930 11012 10941 gene locus_tag LOCUS_t00060 11012 10941 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence052 353 1204 gene locus_tag LOCUS_05940 gene ureD 353 1204 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF7 protein_id gnl|my_center|LOCUS_05940 4563 1336 gene locus_tag LOCUS_05950 4563 1336 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120142.1 protein_id gnl|my_center|LOCUS_05950 5992 4616 gene locus_tag LOCUS_05960 5992 4616 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120143.1 protein_id gnl|my_center|LOCUS_05960 6372 6995 gene locus_tag LOCUS_05970 6372 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 6992 7507 gene locus_tag LOCUS_05980 gene tadA 6992 7507 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLR8 protein_id gnl|my_center|LOCUS_05980 7728 8450 gene locus_tag LOCUS_05990 7728 8450 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056649.1 protein_id gnl|my_center|LOCUS_05990 8716 10173 gene locus_tag LOCUS_06000 8716 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence053 430 2211 gene locus_tag LOCUS_06010 430 2211 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_06010 2505 4103 gene locus_tag LOCUS_06020 2505 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 4533 5291 gene locus_tag LOCUS_06030 4533 5291 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_06030 5368 6186 gene locus_tag LOCUS_06040 5368 6186 CDS product 3-ketodihydrosphingosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706792.1 protein_id gnl|my_center|LOCUS_06040 6234 7073 gene locus_tag LOCUS_06050 6234 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 8323 7310 gene locus_tag LOCUS_06060 8323 7310 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958087.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence054 1025 2896 gene locus_tag LOCUS_06070 gene ftsH 1025 2896 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG5 protein_id gnl|my_center|LOCUS_06070 4302 3019 gene locus_tag LOCUS_06080 4302 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090400.1 protein_id gnl|my_center|LOCUS_06080 4787 5542 gene locus_tag LOCUS_06090 4787 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 5945 6727 gene locus_tag LOCUS_06100 5945 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 8088 6907 gene locus_tag LOCUS_06110 8088 6907 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057854.1 protein_id gnl|my_center|LOCUS_06110 8993 8190 gene locus_tag LOCUS_06120 8993 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056269.1 protein_id gnl|my_center|LOCUS_06120 9284 9484 gene locus_tag LOCUS_06130 9284 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 10848 9988 gene locus_tag LOCUS_06140 10848 9988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLW9 protein_id gnl|my_center|LOCUS_06140 >Feature sequence055 86 1444 gene locus_tag LOCUS_06150 86 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 2142 1489 gene locus_tag LOCUS_06160 2142 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 2269 2685 gene locus_tag LOCUS_06170 2269 2685 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038076.1 protein_id gnl|my_center|LOCUS_06170 3071 3538 gene locus_tag LOCUS_06180 3071 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142941.1 protein_id gnl|my_center|LOCUS_06180 3541 4167 gene locus_tag LOCUS_06190 3541 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 5917 4199 gene locus_tag LOCUS_06200 5917 4199 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141774.1 protein_id gnl|my_center|LOCUS_06200 8196 6382 gene locus_tag LOCUS_06210 8196 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143667.1 protein_id gnl|my_center|LOCUS_06210 8999 8424 gene locus_tag LOCUS_06220 8999 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 9317 9709 gene locus_tag LOCUS_06230 9317 9709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence056 1288 527 gene locus_tag LOCUS_06240 1288 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 protein_id gnl|my_center|LOCUS_06240 1669 1382 gene locus_tag LOCUS_06250 1669 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 2524 1886 gene locus_tag LOCUS_06260 gene pdxH 2524 1886 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WN7 protein_id gnl|my_center|LOCUS_06260 2677 4524 gene locus_tag LOCUS_06270 2677 4524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056007.1 protein_id gnl|my_center|LOCUS_06270 4726 6096 gene locus_tag LOCUS_06280 4726 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 6148 7170 gene locus_tag LOCUS_06290 6148 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 10342 7181 gene locus_tag LOCUS_06300 gene hsdR 10342 7181 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_06300 10628 10383 gene locus_tag LOCUS_06310 10628 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06310 >Feature sequence057 847 2046 gene locus_tag LOCUS_06320 847 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 2922 2329 gene locus_tag LOCUS_06330 2922 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143381.1 protein_id gnl|my_center|LOCUS_06330 4044 3079 gene locus_tag LOCUS_06340 gene cysK 4044 3079 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI7 protein_id gnl|my_center|LOCUS_06340 5272 4265 gene locus_tag LOCUS_06350 5272 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5628 7010 gene locus_tag LOCUS_06360 5628 7010 CDS product alkaline invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 protein_id gnl|my_center|LOCUS_06360 <10869 7507 gene locus_tag LOCUS_06370 <10869 7507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105890.1:RTX toxin >Feature sequence058 636 1487 gene locus_tag LOCUS_06380 636 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057827.1 protein_id gnl|my_center|LOCUS_06380 2567 1605 gene locus_tag LOCUS_06390 2567 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 3593 2589 gene locus_tag LOCUS_06400 3593 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 3990 3697 gene locus_tag LOCUS_06410 3990 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 4552 4833 gene locus_tag LOCUS_06420 4552 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 5937 4894 gene locus_tag LOCUS_06430 gene trpD 5937 4894 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI76 protein_id gnl|my_center|LOCUS_06430 6725 6129 gene locus_tag LOCUS_06440 6725 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 7360 7626 gene locus_tag LOCUS_06450 7360 7626 CDS product UPF0296 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ID1 protein_id gnl|my_center|LOCUS_06450 7653 8204 gene locus_tag LOCUS_06460 gene gmk 7653 8204 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ7 protein_id gnl|my_center|LOCUS_06460 10524 8350 gene locus_tag LOCUS_06470 10524 8350 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056743.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence059 74 886 gene locus_tag LOCUS_06480 74 886 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL42 protein_id gnl|my_center|LOCUS_06480 883 1695 gene locus_tag LOCUS_06490 883 1695 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_06490 3627 2119 gene locus_tag LOCUS_06500 3627 2119 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ1 protein_id gnl|my_center|LOCUS_06500 4404 3712 gene locus_tag LOCUS_06510 4404 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 4440 5399 gene locus_tag LOCUS_06520 4440 5399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_06520 5540 5986 gene locus_tag LOCUS_06530 5540 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 6669 6028 gene locus_tag LOCUS_06540 6669 6028 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110151.1 protein_id gnl|my_center|LOCUS_06540 6704 7900 gene locus_tag LOCUS_06550 gene bme6 6704 7900 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 protein_id gnl|my_center|LOCUS_06550 7996 8478 gene locus_tag LOCUS_06560 gene ndk 7996 8478 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM56 protein_id gnl|my_center|LOCUS_06560 9312 8554 gene locus_tag LOCUS_06570 9312 8554 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 protein_id gnl|my_center|LOCUS_06570 10411 10800 gene locus_tag LOCUS_06580 10411 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence060 1555 1358 gene locus_tag LOCUS_06590 1555 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 1539 4160 gene locus_tag LOCUS_06600 gene topA 1539 4160 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR4 protein_id gnl|my_center|LOCUS_06600 4575 8150 gene locus_tag LOCUS_06610 4575 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 9008 8361 gene locus_tag LOCUS_06620 9008 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143458.1 protein_id gnl|my_center|LOCUS_06620 9595 9251 gene locus_tag LOCUS_06630 9595 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 10689 9700 gene locus_tag LOCUS_06640 10689 9700 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123698.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence061 751 20 gene locus_tag LOCUS_06650 gene cobI 751 20 CDS product precorrin-2 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057289.1 protein_id gnl|my_center|LOCUS_06650 789 1505 gene locus_tag LOCUS_06660 789 1505 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057817.1 protein_id gnl|my_center|LOCUS_06660 2389 5862 gene locus_tag LOCUS_06670 2389 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 6239 10231 gene locus_tag LOCUS_06680 6239 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence062 141 1724 gene locus_tag LOCUS_06690 141 1724 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258022.1 protein_id gnl|my_center|LOCUS_06690 1735 2280 gene locus_tag LOCUS_06700 1735 2280 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_06700 2586 3323 gene locus_tag LOCUS_06710 2586 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258024.1 protein_id gnl|my_center|LOCUS_06710 3395 7009 gene locus_tag LOCUS_06720 3395 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 7054 8265 gene locus_tag LOCUS_06730 7054 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258026.1 protein_id gnl|my_center|LOCUS_06730 8262 10229 gene locus_tag LOCUS_06740 8262 10229 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence063 405 3149 gene locus_tag LOCUS_06750 405 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 3388 5427 gene locus_tag LOCUS_06760 3388 5427 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 protein_id gnl|my_center|LOCUS_06760 6702 5608 gene locus_tag LOCUS_06770 gene mraY 6702 5608 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK95 protein_id gnl|my_center|LOCUS_06770 7207 6971 gene locus_tag LOCUS_06780 7207 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 7329 8279 gene locus_tag LOCUS_06790 gene ribF 7329 8279 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM6 protein_id gnl|my_center|LOCUS_06790 8272 9195 gene locus_tag LOCUS_06800 8272 9195 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_06800 9311 9751 gene locus_tag LOCUS_06810 9311 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 <10675 9970 gene locus_tag LOCUS_06820 <10675 9970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125110.1:branched chain amino acid aminotransferase >Feature sequence064 558 8924 gene locus_tag LOCUS_06830 558 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence065 278 1015 gene locus_tag LOCUS_06840 278 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262010.1 protein_id gnl|my_center|LOCUS_06840 1190 2392 gene locus_tag LOCUS_06850 1190 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 2652 2389 gene locus_tag LOCUS_06860 2652 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058048.1 protein_id gnl|my_center|LOCUS_06860 2982 3137 gene locus_tag LOCUS_06870 2982 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 4536 3289 gene locus_tag LOCUS_06880 gene cobL 4536 3289 CDS product precorrin-6Y C5,15-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056027.1 protein_id gnl|my_center|LOCUS_06880 5292 4786 gene locus_tag LOCUS_06890 5292 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 6527 5379 gene locus_tag LOCUS_06900 6527 5379 CDS product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125189.1 protein_id gnl|my_center|LOCUS_06900 7363 9351 gene locus_tag LOCUS_06910 7363 9351 CDS product UDP-glucose-beta-D-glucan glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057632.1 protein_id gnl|my_center|LOCUS_06910 9934 9368 gene locus_tag LOCUS_06920 9934 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence066 515 949 gene locus_tag LOCUS_06930 515 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2160 1033 gene locus_tag LOCUS_06940 gene hisC 2160 1033 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM42 protein_id gnl|my_center|LOCUS_06940 3098 2262 gene locus_tag LOCUS_06950 3098 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143597.1 protein_id gnl|my_center|LOCUS_06950 3189 4277 gene locus_tag LOCUS_06960 3189 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 4886 4284 gene locus_tag LOCUS_06970 4886 4284 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031805.1 protein_id gnl|my_center|LOCUS_06970 4976 6001 gene locus_tag LOCUS_06980 4976 6001 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865320.1 protein_id gnl|my_center|LOCUS_06980 6092 6343 gene locus_tag LOCUS_06990 6092 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 protein_id gnl|my_center|LOCUS_06990 6336 6638 gene locus_tag LOCUS_07000 6336 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057560.1 protein_id gnl|my_center|LOCUS_07000 7533 6874 gene locus_tag LOCUS_07010 7533 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 8443 7679 gene locus_tag LOCUS_07020 8443 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 9728 8706 gene locus_tag LOCUS_07030 9728 8706 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403928.1 protein_id gnl|my_center|LOCUS_07030 10555 9827 gene locus_tag LOCUS_07040 10555 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence067 2 514 gene locus_tag LOCUS_07050 2 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057876.1 protein_id gnl|my_center|LOCUS_07050 612 1679 gene locus_tag LOCUS_07060 612 1679 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 protein_id gnl|my_center|LOCUS_07060 2104 1805 gene locus_tag LOCUS_07070 2104 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 2306 3328 gene locus_tag LOCUS_07080 2306 3328 CDS product UNC-44 ankyrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_07080 3478 5181 gene locus_tag LOCUS_07090 3478 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 5187 6059 gene locus_tag LOCUS_07100 5187 6059 CDS product inward rectifier potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_07100 6695 6060 gene locus_tag LOCUS_07110 6695 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 7644 6826 gene locus_tag LOCUS_07120 7644 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 9297 7768 gene locus_tag LOCUS_07130 9297 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 <10539 9626 gene locus_tag LOCUS_07140 <10539 9626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082593.1:ATPase >Feature sequence068 <1 2431 gene locus_tag LOCUS_07150 <1 2431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGS4:DNA mismatch repair protein MutS 2578 3030 gene locus_tag LOCUS_07160 2578 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3179 3739 gene locus_tag LOCUS_07170 3179 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4896 3736 gene locus_tag LOCUS_07180 4896 3736 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142380.1 protein_id gnl|my_center|LOCUS_07180 5112 5411 gene locus_tag LOCUS_07190 5112 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 8720 5547 gene locus_tag LOCUS_07200 8720 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence069 523 2013 gene locus_tag LOCUS_07210 523 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056133.1 protein_id gnl|my_center|LOCUS_07210 3025 2669 gene locus_tag LOCUS_07220 3025 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 3947 3261 gene locus_tag LOCUS_07230 3947 3261 CDS product primitive phytochelatin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550267.1 protein_id gnl|my_center|LOCUS_07230 4273 5856 gene locus_tag LOCUS_07240 gene pgi 4273 5856 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY2 protein_id gnl|my_center|LOCUS_07240 6023 6703 gene locus_tag LOCUS_07250 6023 6703 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 protein_id gnl|my_center|LOCUS_07250 7411 6881 gene locus_tag LOCUS_07260 7411 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 7544 8329 gene locus_tag LOCUS_07270 gene ycf43 7544 8329 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJC0 protein_id gnl|my_center|LOCUS_07270 8762 8454 gene locus_tag LOCUS_07280 8762 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_07280 9034 9576 gene locus_tag LOCUS_07290 gene petC 9034 9576 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N8 protein_id gnl|my_center|LOCUS_07290 >Feature sequence070 1114 572 gene locus_tag LOCUS_07300 1114 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_07300 6361 1322 gene locus_tag LOCUS_07310 6361 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 9361 6908 gene locus_tag LOCUS_07320 9361 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 <10496 9495 gene locus_tag LOCUS_07330 <10496 9495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462984.1:calcium-binding protein >Feature sequence071 979 1404 gene locus_tag LOCUS_07340 gene rsfS 979 1404 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK1 protein_id gnl|my_center|LOCUS_07340 1407 1922 gene locus_tag LOCUS_07350 gene ycf36 1407 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056906.1 protein_id gnl|my_center|LOCUS_07350 1977 2930 gene locus_tag LOCUS_07360 1977 2930 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056905.1 protein_id gnl|my_center|LOCUS_07360 3400 2927 gene locus_tag LOCUS_07370 3400 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 4555 3671 gene locus_tag LOCUS_07380 4555 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056583.1 protein_id gnl|my_center|LOCUS_07380 4734 5372 gene locus_tag LOCUS_07390 4734 5372 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143820.1 protein_id gnl|my_center|LOCUS_07390 6193 5537 gene locus_tag LOCUS_07400 6193 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 7207 6284 gene locus_tag LOCUS_07410 gene rpsB 7207 6284 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA2 protein_id gnl|my_center|LOCUS_07410 8809 7325 gene locus_tag LOCUS_07420 8809 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 <10472 9287 gene locus_tag LOCUS_07430 <10472 9287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056045.1:bifunctional folylpolyglutamate synthase/dihydrofolate synthase >Feature sequence072 204 1616 gene locus_tag LOCUS_07440 204 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1760 2716 gene locus_tag LOCUS_07450 1760 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2945 3646 gene locus_tag LOCUS_07460 2945 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_07460 4899 3874 gene locus_tag LOCUS_07470 4899 3874 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 protein_id gnl|my_center|LOCUS_07470 5251 4958 gene locus_tag LOCUS_07480 gene gatC 5251 4958 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ7 protein_id gnl|my_center|LOCUS_07480 5785 5264 gene locus_tag LOCUS_07490 gene ycf3 5785 5264 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ6 protein_id gnl|my_center|LOCUS_07490 5865 6995 gene locus_tag LOCUS_07500 5865 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 7054 7983 gene locus_tag LOCUS_07510 gene era 7054 7983 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ5 protein_id gnl|my_center|LOCUS_07510 8402 10252 gene locus_tag LOCUS_07520 8402 10252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07520 >Feature sequence073 168 854 gene locus_tag LOCUS_07530 168 854 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_07530 1506 895 gene locus_tag LOCUS_07540 1506 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 2126 1683 gene locus_tag LOCUS_07550 2126 1683 CDS product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143701.1 protein_id gnl|my_center|LOCUS_07550 2645 3856 gene locus_tag LOCUS_07560 2645 3856 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_07560 3859 5205 gene locus_tag LOCUS_07570 3859 5205 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089043.1 protein_id gnl|my_center|LOCUS_07570 5280 6146 gene locus_tag LOCUS_07580 5280 6146 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975608.1 protein_id gnl|my_center|LOCUS_07580 6374 7948 gene locus_tag LOCUS_07590 6374 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence074 <1 571 gene locus_tag LOCUS_07600 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DM88:histidine biosynthesis bifunctional protein HisIE 902 660 gene locus_tag LOCUS_07610 902 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 1257 1520 gene locus_tag LOCUS_07620 1257 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 1507 2256 gene locus_tag LOCUS_07630 1507 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 2830 2420 gene locus_tag LOCUS_07640 2830 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 4250 3009 gene locus_tag LOCUS_07650 4250 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393799.1 protein_id gnl|my_center|LOCUS_07650 5000 4275 gene locus_tag LOCUS_07660 5000 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 5430 6737 gene locus_tag LOCUS_07670 5430 6737 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_07670 7777 6911 gene locus_tag LOCUS_07680 gene aroE 7777 6911 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA6 protein_id gnl|my_center|LOCUS_07680 7924 8481 gene locus_tag LOCUS_07690 7924 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 8645 9010 gene locus_tag LOCUS_07700 8645 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 >Feature sequence075 102 281 gene locus_tag LOCUS_07710 102 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 403 789 gene locus_tag LOCUS_07720 403 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056168.1 protein_id gnl|my_center|LOCUS_07720 1799 882 gene locus_tag LOCUS_07730 1799 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 2399 1824 gene locus_tag LOCUS_07740 2399 1824 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141158.1 protein_id gnl|my_center|LOCUS_07740 3063 2623 gene locus_tag LOCUS_07750 3063 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 3236 4375 gene locus_tag LOCUS_07760 gene pyrD 3236 4375 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB7 protein_id gnl|my_center|LOCUS_07760 4455 5072 gene locus_tag LOCUS_07770 4455 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 5088 5393 gene locus_tag LOCUS_07780 5088 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 6312 5410 gene locus_tag LOCUS_07790 6312 5410 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_07790 6571 6906 gene locus_tag LOCUS_07800 6571 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 7072 7245 gene locus_tag LOCUS_07810 7072 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 7404 7577 gene locus_tag LOCUS_07820 7404 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 7811 8068 gene locus_tag LOCUS_07830 7811 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 8662 8180 gene locus_tag LOCUS_07840 8662 8180 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878622.1 protein_id gnl|my_center|LOCUS_07840 9590 8706 gene locus_tag LOCUS_07850 gene lipA1 9590 8706 CDS product lipoyl synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL83 protein_id gnl|my_center|LOCUS_07850 10187 9786 gene locus_tag LOCUS_07860 10187 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 >Feature sequence076 2773 1439 gene locus_tag LOCUS_07870 2773 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 3178 5382 gene locus_tag LOCUS_07880 3178 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 5578 5910 gene locus_tag LOCUS_07890 5578 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 6013 8097 gene locus_tag LOCUS_07900 6013 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 8266 9951 gene locus_tag LOCUS_07910 8266 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence077 732 100 gene locus_tag LOCUS_07920 gene cpcT3 732 100 CDS product chromophore lyase CpcT/CpeT 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD3 protein_id gnl|my_center|LOCUS_07920 1494 958 gene locus_tag LOCUS_07930 gene cpeS 1494 958 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD4 protein_id gnl|my_center|LOCUS_07930 2526 1765 gene locus_tag LOCUS_07940 gene cpeE 2526 1765 CDS product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141265.1 protein_id gnl|my_center|LOCUS_07940 3405 2644 gene locus_tag LOCUS_07950 gene cpeD 3405 2644 CDS product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141264.1 protein_id gnl|my_center|LOCUS_07950 4501 3632 gene locus_tag LOCUS_07960 gene cpeC 4501 3632 CDS product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141263.1 protein_id gnl|my_center|LOCUS_07960 5351 4800 gene locus_tag LOCUS_07970 gene cpcS 5351 4800 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU5 protein_id gnl|my_center|LOCUS_07970 6061 5483 gene locus_tag LOCUS_07980 6061 5483 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141254.1 protein_id gnl|my_center|LOCUS_07980 6326 6081 gene locus_tag LOCUS_07990 6326 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 6976 6335 gene locus_tag LOCUS_08000 6976 6335 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143281.1 protein_id gnl|my_center|LOCUS_08000 7162 8613 gene locus_tag LOCUS_08010 gene phrA 7162 8613 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056280.1 protein_id gnl|my_center|LOCUS_08010 8815 9414 gene locus_tag LOCUS_08020 8815 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 9477 9959 gene locus_tag LOCUS_08030 9477 9959 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172509.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence078 2067 955 gene locus_tag LOCUS_08040 2067 955 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056452.1 protein_id gnl|my_center|LOCUS_08040 3055 2468 gene locus_tag LOCUS_08050 3055 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 3429 3133 gene locus_tag LOCUS_08060 3429 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 6963 3826 gene locus_tag LOCUS_08070 6963 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 8045 7173 gene locus_tag LOCUS_08080 8045 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 8653 8141 gene locus_tag LOCUS_08090 8653 8141 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 protein_id gnl|my_center|LOCUS_08090 9492 8650 gene locus_tag LOCUS_08100 gene kdsA 9492 8650 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61655 protein_id gnl|my_center|LOCUS_08100 >Feature sequence079 <1 948 gene locus_tag LOCUS_08110 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776584.1:DNA (cytosine-5-)-methyltransferase 1206 2318 gene locus_tag LOCUS_08120 1206 2318 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056993.1 protein_id gnl|my_center|LOCUS_08120 2612 3088 gene locus_tag LOCUS_08130 gene lspA 2612 3088 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA3 protein_id gnl|my_center|LOCUS_08130 3135 5396 gene locus_tag LOCUS_08140 3135 5396 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057331.1 protein_id gnl|my_center|LOCUS_08140 5636 6397 gene locus_tag LOCUS_08150 gene nagB 5636 6397 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_08150 6903 6532 gene locus_tag LOCUS_08160 6903 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 7212 8648 gene locus_tag LOCUS_08170 7212 8648 CDS product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHJ8 protein_id gnl|my_center|LOCUS_08170 8664 9092 gene locus_tag LOCUS_08180 8664 9092 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence080 537 166 gene locus_tag LOCUS_08190 537 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 602 1657 gene locus_tag LOCUS_08200 602 1657 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140747.1 protein_id gnl|my_center|LOCUS_08200 2159 1794 gene locus_tag LOCUS_08210 2159 1794 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057535.1 protein_id gnl|my_center|LOCUS_08210 3119 2256 gene locus_tag LOCUS_08220 3119 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 3309 5351 gene locus_tag LOCUS_08230 3309 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 5523 6371 gene locus_tag LOCUS_08240 5523 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 6549 8399 gene locus_tag LOCUS_08250 6549 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 8436 9413 gene locus_tag LOCUS_08260 8436 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence081 128 820 gene locus_tag LOCUS_08270 128 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 828 2453 gene locus_tag LOCUS_08280 828 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 2498 3175 gene locus_tag LOCUS_08290 2498 3175 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_08290 3348 4391 gene locus_tag LOCUS_08300 3348 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08300 4414 5079 gene locus_tag LOCUS_08310 4414 5079 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_08310 5166 5552 gene locus_tag LOCUS_08320 5166 5552 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_08320 5794 5597 gene locus_tag LOCUS_08330 5794 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 6009 6950 gene locus_tag LOCUS_08340 6009 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 7309 6974 gene locus_tag LOCUS_08350 7309 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 7653 7411 gene locus_tag LOCUS_08360 7653 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 7775 8026 gene locus_tag LOCUS_08370 7775 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 8124 8375 gene locus_tag LOCUS_08380 8124 8375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 8504 8734 gene locus_tag LOCUS_08390 8504 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 <9776 8799 gene locus_tag LOCUS_08400 <9776 8799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204628.1:histidine kinase >Feature sequence082 1031 7468 gene locus_tag LOCUS_08410 1031 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 7522 7887 gene locus_tag LOCUS_08420 7522 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 7929 8663 gene locus_tag LOCUS_08430 7929 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 8755 9669 gene locus_tag LOCUS_08440 8755 9669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence083 805 17 gene locus_tag LOCUS_08450 805 17 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_08450 2065 863 gene locus_tag LOCUS_08460 2065 863 CDS product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_08460 8096 2709 gene locus_tag LOCUS_08470 8096 2709 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_08470 <9607 8857 gene locus_tag LOCUS_08480 <9607 8857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144029.1:RNA methyltransferase >Feature sequence084 1308 2225 gene locus_tag LOCUS_08490 gene pstS 1308 2225 CDS product phosphate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768212.1 protein_id gnl|my_center|LOCUS_08490 2249 3220 gene locus_tag LOCUS_08500 2249 3220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_08500 3326 4312 gene locus_tag LOCUS_08510 3326 4312 CDS product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057563.1 protein_id gnl|my_center|LOCUS_08510 4582 5766 gene locus_tag LOCUS_08520 4582 5766 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176601.1 protein_id gnl|my_center|LOCUS_08520 6627 5806 gene locus_tag LOCUS_08530 6627 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 7073 7636 gene locus_tag LOCUS_08540 7073 7636 CDS product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056745.1 protein_id gnl|my_center|LOCUS_08540 8646 7633 gene locus_tag LOCUS_08550 8646 7633 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 protein_id gnl|my_center|LOCUS_08550 9370 8717 gene locus_tag LOCUS_08560 9370 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence085 2604 3767 gene locus_tag LOCUS_08570 2604 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 3929 4705 gene locus_tag LOCUS_08580 gene pspA 3929 4705 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_08580 4916 7690 gene locus_tag LOCUS_08590 4916 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 7871 8266 gene locus_tag LOCUS_08600 7871 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence086 2193 1123 gene locus_tag LOCUS_08610 2193 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142156.1 protein_id gnl|my_center|LOCUS_08610 2501 3667 gene locus_tag LOCUS_08620 gene aspC 2501 3667 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG0 protein_id gnl|my_center|LOCUS_08620 4156 3746 gene locus_tag LOCUS_08630 gene mrnC 4156 3746 CDS product mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ0 protein_id gnl|my_center|LOCUS_08630 4572 4222 gene locus_tag LOCUS_08640 4572 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 5920 4760 gene locus_tag LOCUS_08650 gene carA 5920 4760 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU5 protein_id gnl|my_center|LOCUS_08650 6117 7136 gene locus_tag LOCUS_08660 gene bioB 6117 7136 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL38 protein_id gnl|my_center|LOCUS_08660 7297 7653 gene locus_tag LOCUS_08670 7297 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 8499 7777 gene locus_tag LOCUS_08680 8499 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 9063 9368 gene locus_tag LOCUS_08690 9063 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence087 <1 2433 gene locus_tag LOCUS_08700 <1 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DL50:DNA gyrase subunit B 2867 5422 gene locus_tag LOCUS_08710 gene leuS 2867 5422 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH61 protein_id gnl|my_center|LOCUS_08710 6671 5658 gene locus_tag LOCUS_08720 6671 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 6875 6693 gene locus_tag LOCUS_08730 6875 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 8540 6894 gene locus_tag LOCUS_08740 8540 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 8906 9202 gene locus_tag LOCUS_08750 8906 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence088 3324 3569 gene locus_tag LOCUS_08760 3324 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3741 4799 gene locus_tag LOCUS_08770 3741 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 5623 4811 gene locus_tag LOCUS_08780 5623 4811 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_08780 6955 5768 gene locus_tag LOCUS_08790 6955 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 7362 6994 gene locus_tag LOCUS_08800 7362 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 7752 7462 gene locus_tag LOCUS_08810 7752 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 8235 9170 gene locus_tag LOCUS_08820 gene rfbB 8235 9170 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence089 117 404 gene locus_tag LOCUS_08830 117 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 548 2002 gene locus_tag LOCUS_08840 gene atpD 548 2002 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG8 protein_id gnl|my_center|LOCUS_08840 2193 2603 gene locus_tag LOCUS_08850 gene atpC 2193 2603 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG7 protein_id gnl|my_center|LOCUS_08850 3057 2755 gene locus_tag LOCUS_08860 3057 2755 CDS product putative 30S ribosomal protein PSRP-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA74 protein_id gnl|my_center|LOCUS_08860 3258 4046 gene locus_tag LOCUS_08870 3258 4046 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056155.1 protein_id gnl|my_center|LOCUS_08870 6583 4436 gene locus_tag LOCUS_08880 6583 4436 CDS product bacteriocin cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_08880 7428 6583 gene locus_tag LOCUS_08890 7428 6583 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_08890 8495 7575 gene locus_tag LOCUS_08900 8495 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 8869 8696 gene locus_tag LOCUS_08910 8869 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 9196 9035 gene locus_tag LOCUS_08920 9196 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence090 5480 6307 gene locus_tag LOCUS_08930 gene dapB 5480 6307 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH2 protein_id gnl|my_center|LOCUS_08930 6585 7247 gene locus_tag LOCUS_08940 6585 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056056.1 protein_id gnl|my_center|LOCUS_08940 8095 7394 gene locus_tag LOCUS_08950 8095 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 8747 8298 gene locus_tag LOCUS_08960 8747 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence091 1454 903 gene locus_tag LOCUS_08970 1454 903 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974638.1 protein_id gnl|my_center|LOCUS_08970 1558 2553 gene locus_tag LOCUS_08980 1558 2553 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142928.1 protein_id gnl|my_center|LOCUS_08980 3100 3705 gene locus_tag LOCUS_08990 3100 3705 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967636.1 protein_id gnl|my_center|LOCUS_08990 3935 4336 gene locus_tag LOCUS_09000 3935 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 4479 5441 gene locus_tag LOCUS_09010 4479 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 7162 5528 gene locus_tag LOCUS_09020 7162 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 <9162 7374 gene locus_tag LOCUS_09030 <9162 7374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJD1:acetolactate synthase >Feature sequence092 <1 909 gene locus_tag LOCUS_09040 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403760.1:sulfotransferase 1044 2549 gene locus_tag LOCUS_09050 1044 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 4941 2629 gene locus_tag LOCUS_09060 gene recJ 4941 2629 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056029.1 protein_id gnl|my_center|LOCUS_09060 5326 6192 gene locus_tag LOCUS_09070 5326 6192 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_09070 7219 6308 gene locus_tag LOCUS_09080 gene rimK 7219 6308 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AZ9 protein_id gnl|my_center|LOCUS_09080 7708 7247 gene locus_tag LOCUS_09090 gene rimK2 7708 7247 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_09090 7927 7784 gene locus_tag LOCUS_09100 7927 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 7995 9152 gene locus_tag LOCUS_09110 7995 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence093 925 245 gene locus_tag LOCUS_09120 925 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1418 2662 gene locus_tag LOCUS_09130 1418 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 2956 3819 gene locus_tag LOCUS_09140 gene pstS 2956 3819 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_09140 3827 4651 gene locus_tag LOCUS_09150 gene pstC 3827 4651 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9I6 protein_id gnl|my_center|LOCUS_09150 4772 5602 gene locus_tag LOCUS_09160 gene pstA2 4772 5602 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4D9 protein_id gnl|my_center|LOCUS_09160 5624 6445 gene locus_tag LOCUS_09170 5624 6445 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_09170 7166 6474 gene locus_tag LOCUS_09180 gene trmD 7166 6474 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM2 protein_id gnl|my_center|LOCUS_09180 7639 8445 gene locus_tag LOCUS_09190 gene cphB 7639 8445 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P3 protein_id gnl|my_center|LOCUS_09190 >Feature sequence094 2481 4970 gene locus_tag LOCUS_09200 2481 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 5418 5005 gene locus_tag LOCUS_09210 5418 5005 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_09210 5780 5424 gene locus_tag LOCUS_09220 5780 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 6166 6799 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccctaccgattgggttaaatcggaattgttggaaac >Feature sequence095 5517 295 gene locus_tag LOCUS_09230 5517 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 7975 5522 gene locus_tag LOCUS_09240 7975 5522 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258037.1 protein_id gnl|my_center|LOCUS_09240 8341 7982 gene locus_tag LOCUS_09250 8341 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_09250 8916 8593 gene locus_tag LOCUS_09260 8916 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258035.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence096 68 814 gene locus_tag LOCUS_09270 68 814 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_09270 1722 871 gene locus_tag LOCUS_09280 1722 871 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058143.1 protein_id gnl|my_center|LOCUS_09280 3655 1973 gene locus_tag LOCUS_09290 3655 1973 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056162.1 protein_id gnl|my_center|LOCUS_09290 4054 4887 gene locus_tag LOCUS_09300 4054 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 5395 5003 gene locus_tag LOCUS_09310 5395 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 6823 5681 gene locus_tag LOCUS_09320 gene proB 6823 5681 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH42 protein_id gnl|my_center|LOCUS_09320 6877 8130 gene locus_tag LOCUS_09330 6877 8130 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence097 2532 1057 gene locus_tag LOCUS_09340 2532 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 3859 2549 gene locus_tag LOCUS_09350 3859 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 5331 3886 gene locus_tag LOCUS_09360 5331 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 6348 5452 gene locus_tag LOCUS_09370 6348 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 7910 6474 gene locus_tag LOCUS_09380 7910 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 8909 7962 gene locus_tag LOCUS_09390 8909 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence098 1274 441 gene locus_tag LOCUS_09400 1274 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1661 1819 gene locus_tag LOCUS_09410 1661 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2226 3605 gene locus_tag LOCUS_09420 2226 3605 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055871.1 protein_id gnl|my_center|LOCUS_09420 4500 3607 gene locus_tag LOCUS_09430 4500 3607 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_09430 6441 4831 gene locus_tag LOCUS_09440 6441 4831 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_09440 7521 6484 gene locus_tag LOCUS_09450 7521 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 8501 7518 gene locus_tag LOCUS_09460 8501 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144162.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence099 1054 611 gene locus_tag LOCUS_09470 1054 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056063.1 protein_id gnl|my_center|LOCUS_09470 1195 2217 gene locus_tag LOCUS_09480 gene purM 1195 2217 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY2 protein_id gnl|my_center|LOCUS_09480 2815 4146 gene locus_tag LOCUS_09490 2815 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 4261 4608 gene locus_tag LOCUS_09500 4261 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09500 5442 4705 gene locus_tag LOCUS_09510 5442 4705 CDS product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056065.1 protein_id gnl|my_center|LOCUS_09510 5854 5567 gene locus_tag LOCUS_09520 gene clpS 5854 5567 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056066.1 protein_id gnl|my_center|LOCUS_09520 6306 6563 gene locus_tag LOCUS_09530 6306 6563 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057929.1 protein_id gnl|my_center|LOCUS_09530 6626 7375 gene locus_tag LOCUS_09540 6626 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_09540 7416 8573 gene locus_tag LOCUS_09550 7416 8573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence100 <1 934 gene locus_tag LOCUS_09560 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ32:2-isopropylmalate synthase 1317 2027 gene locus_tag LOCUS_09570 1317 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2223 2969 gene locus_tag LOCUS_09580 2223 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 3523 3107 gene locus_tag LOCUS_09590 3523 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057567.1 protein_id gnl|my_center|LOCUS_09590 3679 4734 gene locus_tag LOCUS_09600 3679 4734 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056239.1 protein_id gnl|my_center|LOCUS_09600 5276 4731 gene locus_tag LOCUS_09610 5276 4731 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 protein_id gnl|my_center|LOCUS_09610 5421 6863 gene locus_tag LOCUS_09620 5421 6863 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_09620 7038 7601 gene locus_tag LOCUS_09630 7038 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259737.1 protein_id gnl|my_center|LOCUS_09630 7594 8184 gene locus_tag LOCUS_09640 7594 8184 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence101 2 838 gene locus_tag LOCUS_09650 gene psbO 2 838 CDS product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A431 protein_id gnl|my_center|LOCUS_09650 2141 1029 gene locus_tag LOCUS_09660 2141 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4073 2244 gene locus_tag LOCUS_09670 4073 2244 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057909.1 protein_id gnl|my_center|LOCUS_09670 4582 4139 gene locus_tag LOCUS_09680 4582 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 5050 5832 gene locus_tag LOCUS_09690 5050 5832 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_09690 5967 6038 gene locus_tag LOCUS_t00070 5967 6038 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6192 7196 gene locus_tag LOCUS_09700 6192 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 7222 8145 gene locus_tag LOCUS_09710 7222 8145 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125164.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence102 953 1600 gene locus_tag LOCUS_09720 953 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1977 4190 gene locus_tag LOCUS_09730 gene dnaK3 1977 4190 CDS product chaperone protein dnaK3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH10 protein_id gnl|my_center|LOCUS_09730 4538 5536 gene locus_tag LOCUS_09740 gene dnaJ 4538 5536 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057983.1 protein_id gnl|my_center|LOCUS_09740 7246 5621 gene locus_tag LOCUS_09750 7246 5621 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 protein_id gnl|my_center|LOCUS_09750 7852 8202 gene locus_tag LOCUS_09760 7852 8202 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence103 2465 783 gene locus_tag LOCUS_09770 2465 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 3410 2547 gene locus_tag LOCUS_09780 3410 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4601 3423 gene locus_tag LOCUS_09790 4601 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 5723 4740 gene locus_tag LOCUS_09800 5723 4740 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_09800 7100 5919 gene locus_tag LOCUS_09810 7100 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390673.1 protein_id gnl|my_center|LOCUS_09810 8034 7171 gene locus_tag LOCUS_09820 8034 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142150.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence104 690 998 gene locus_tag LOCUS_09830 690 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1453 3387 gene locus_tag LOCUS_09840 gene appD 1453 3387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077263.1 protein_id gnl|my_center|LOCUS_09840 5205 3616 gene locus_tag LOCUS_09850 5205 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 6629 5292 gene locus_tag LOCUS_09860 6629 5292 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297122.1 protein_id gnl|my_center|LOCUS_09860 7288 6713 gene locus_tag LOCUS_09870 7288 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 7379 7807 gene locus_tag LOCUS_09880 7379 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 <8711 7939 gene locus_tag LOCUS_09890 <8711 7939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957681.1:MBL fold hydrolase >Feature sequence105 3 473 gene locus_tag LOCUS_09900 3 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1691 486 gene locus_tag LOCUS_09910 1691 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 4631 1755 gene locus_tag LOCUS_09920 4631 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5967 5266 gene locus_tag LOCUS_09930 5967 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057555.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence106 1235 1852 gene locus_tag LOCUS_09940 1235 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1881 2654 gene locus_tag LOCUS_09950 gene rfbF 1881 2654 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142205.1 protein_id gnl|my_center|LOCUS_09950 2812 4041 gene locus_tag LOCUS_09960 2812 4041 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_09960 4100 5023 gene locus_tag LOCUS_09970 4100 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 5032 6378 gene locus_tag LOCUS_09980 5032 6378 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_09980 6502 7233 gene locus_tag LOCUS_09990 6502 7233 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973506.1 protein_id gnl|my_center|LOCUS_09990 7428 8540 gene locus_tag LOCUS_10000 7428 8540 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence107 2479 2892 gene locus_tag LOCUS_10010 2479 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 3013 5157 gene locus_tag LOCUS_10020 gene glyS 3013 5157 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGX0 protein_id gnl|my_center|LOCUS_10020 5317 5661 gene locus_tag LOCUS_10030 gene psb28 5317 5661 CDS product photosystem II reaction center Psb28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ8 protein_id gnl|my_center|LOCUS_10030 5749 6249 gene locus_tag LOCUS_10040 gene moaB 5749 6249 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816R0 protein_id gnl|my_center|LOCUS_10040 8564 6378 gene locus_tag LOCUS_10050 8564 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence108 895 266 gene locus_tag LOCUS_10060 895 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 protein_id gnl|my_center|LOCUS_10060 1183 1542 gene locus_tag LOCUS_10070 1183 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1655 4336 gene locus_tag LOCUS_10080 1655 4336 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141744.1 protein_id gnl|my_center|LOCUS_10080 4788 4937 gene locus_tag LOCUS_10090 4788 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 5451 4972 gene locus_tag LOCUS_10100 5451 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 5519 5719 gene locus_tag LOCUS_10110 5519 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 6037 7083 gene locus_tag LOCUS_10120 6037 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_10120 7149 7937 gene locus_tag LOCUS_10130 7149 7937 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056208.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence109 182 703 gene locus_tag LOCUS_10140 gene rpsE 182 703 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59126 protein_id gnl|my_center|LOCUS_10140 755 1198 gene locus_tag LOCUS_10150 gene rplO 755 1198 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML6 protein_id gnl|my_center|LOCUS_10150 1333 2667 gene locus_tag LOCUS_10160 gene secY 1333 2667 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML5 protein_id gnl|my_center|LOCUS_10160 2781 3335 gene locus_tag LOCUS_10170 gene adk 2781 3335 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49973 protein_id gnl|my_center|LOCUS_10170 3516 3740 gene locus_tag LOCUS_10180 gene infA 3516 3740 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML3 protein_id gnl|my_center|LOCUS_10180 4041 4424 gene locus_tag LOCUS_10190 gene rpsM 4041 4424 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML1 protein_id gnl|my_center|LOCUS_10190 4483 4872 gene locus_tag LOCUS_10200 gene rpsK 4483 4872 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59379 protein_id gnl|my_center|LOCUS_10200 5006 5950 gene locus_tag LOCUS_10210 gene rpoA 5006 5950 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFF5 protein_id gnl|my_center|LOCUS_10210 6040 6390 gene locus_tag LOCUS_10220 gene rplQ 6040 6390 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK9 protein_id gnl|my_center|LOCUS_10220 6453 7280 gene locus_tag LOCUS_10230 gene truA 6453 7280 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM6 protein_id gnl|my_center|LOCUS_10230 7316 7768 gene locus_tag LOCUS_10240 gene rplM 7316 7768 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK8 protein_id gnl|my_center|LOCUS_10240 7772 8185 gene locus_tag LOCUS_10250 gene rpsI 7772 8185 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK7 protein_id gnl|my_center|LOCUS_10250 8273 8518 gene locus_tag LOCUS_10260 gene rpmE 8273 8518 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9Y9 protein_id gnl|my_center|LOCUS_10260 >Feature sequence110 722 252 gene locus_tag LOCUS_10270 722 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 886 2280 gene locus_tag LOCUS_10280 886 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3328 2336 gene locus_tag LOCUS_10290 3328 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4341 3394 gene locus_tag LOCUS_10300 4341 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_10300 5556 4570 gene locus_tag LOCUS_10310 5556 4570 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932263.1 protein_id gnl|my_center|LOCUS_10310 7236 5701 gene locus_tag LOCUS_10320 7236 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 <8410 7372 gene locus_tag LOCUS_10330 <8410 7372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119978.1:asparagine synthetase B >Feature sequence111 148 2328 gene locus_tag LOCUS_10340 148 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2325 2855 gene locus_tag LOCUS_10350 2325 2855 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_10350 2944 4794 gene locus_tag LOCUS_10360 2944 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 4841 7138 gene locus_tag LOCUS_10370 gene comE 4841 7138 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057539.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence112 1855 2577 gene locus_tag LOCUS_10380 1855 2577 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_10380 2814 4517 gene locus_tag LOCUS_10390 2814 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 4521 4946 gene locus_tag LOCUS_10400 4521 4946 CDS product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_10400 4985 5944 gene locus_tag LOCUS_10410 gene queG 4985 5944 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA9 protein_id gnl|my_center|LOCUS_10410 5995 6660 gene locus_tag LOCUS_10420 5995 6660 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024041.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence113 <1 2844 gene locus_tag LOCUS_10430 <1 2844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816940.1:adhesin 3033 5531 gene locus_tag LOCUS_10440 3033 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 5608 8115 gene locus_tag LOCUS_10450 5608 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence114 183 560 gene locus_tag LOCUS_10460 183 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 880 2349 gene locus_tag LOCUS_10470 880 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2673 4319 gene locus_tag LOCUS_10480 2673 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4501 6159 gene locus_tag LOCUS_10490 4501 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 6323 7825 gene locus_tag LOCUS_10500 6323 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence115 6614 1239 gene locus_tag LOCUS_10510 6614 1239 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_10510 7361 6870 gene locus_tag LOCUS_10520 gene psaL 7361 6870 CDS product photosystem I reaction center subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87787 protein_id gnl|my_center|LOCUS_10520 >Feature sequence116 237 929 gene locus_tag LOCUS_10530 237 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058104.1 protein_id gnl|my_center|LOCUS_10530 1650 1018 gene locus_tag LOCUS_10540 1650 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143183.1 protein_id gnl|my_center|LOCUS_10540 3009 1654 gene locus_tag LOCUS_10550 3009 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143184.1 protein_id gnl|my_center|LOCUS_10550 3512 3856 gene locus_tag LOCUS_10560 3512 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 4018 4455 gene locus_tag LOCUS_10570 4018 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144373.1 protein_id gnl|my_center|LOCUS_10570 4674 6005 gene locus_tag LOCUS_10580 4674 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058262.1 protein_id gnl|my_center|LOCUS_10580 7273 6002 gene locus_tag LOCUS_10590 7273 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence117 <1 886 gene locus_tag LOCUS_10600 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868366.1:glycosyl transferase 1169 1474 gene locus_tag LOCUS_10610 1169 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1633 2010 gene locus_tag LOCUS_10620 1633 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 2151 3566 gene locus_tag LOCUS_10630 2151 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 5189 3576 gene locus_tag LOCUS_10640 5189 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 5731 5192 gene locus_tag LOCUS_10650 5731 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 6064 5852 gene locus_tag LOCUS_10660 6064 5852 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_10660 6359 6087 gene locus_tag LOCUS_10670 6359 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 7398 6424 gene locus_tag LOCUS_10680 gene cysM 7398 6424 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058144.1 protein_id gnl|my_center|LOCUS_10680 8192 7557 gene locus_tag LOCUS_10690 8192 7557 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence118 613 1701 gene locus_tag LOCUS_10700 613 1701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119520.1 protein_id gnl|my_center|LOCUS_10700 1707 2990 gene locus_tag LOCUS_10710 1707 2990 CDS product 2-amino-3-ketobutyrate CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_10710 3204 4325 gene locus_tag LOCUS_10720 3204 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121691.1 protein_id gnl|my_center|LOCUS_10720 4322 5287 gene locus_tag LOCUS_10730 4322 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142445.1 protein_id gnl|my_center|LOCUS_10730 5356 6606 gene locus_tag LOCUS_10740 5356 6606 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 protein_id gnl|my_center|LOCUS_10740 7034 6612 gene locus_tag LOCUS_10750 7034 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence119 75 788 gene locus_tag LOCUS_10760 75 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1837 935 gene locus_tag LOCUS_10770 1837 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2012 3370 gene locus_tag LOCUS_10780 gene murD 2012 3370 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN8 protein_id gnl|my_center|LOCUS_10780 4113 3667 gene locus_tag LOCUS_10790 gene ywkD 4113 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45871 protein_id gnl|my_center|LOCUS_10790 4406 4110 gene locus_tag LOCUS_10800 4406 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 5341 4421 gene locus_tag LOCUS_10810 5341 4421 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_10810 6005 5679 gene locus_tag LOCUS_10820 6005 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 protein_id gnl|my_center|LOCUS_10820 6467 6153 gene locus_tag LOCUS_10830 6467 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057537.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence120 890 246 gene locus_tag LOCUS_10840 890 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1778 981 gene locus_tag LOCUS_10850 1778 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3548 2136 gene locus_tag LOCUS_10860 3548 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_10860 4922 3882 gene locus_tag LOCUS_10870 4922 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087510.1 protein_id gnl|my_center|LOCUS_10870 6080 5148 gene locus_tag LOCUS_10880 6080 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477274.1 protein_id gnl|my_center|LOCUS_10880 7144 6206 gene locus_tag LOCUS_10890 7144 6206 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882720.1 protein_id gnl|my_center|LOCUS_10890 <8094 7317 gene locus_tag LOCUS_10900 <8094 7317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057543.1:porin >Feature sequence121 111 512 gene locus_tag LOCUS_10910 111 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141008.1 protein_id gnl|my_center|LOCUS_10910 1856 561 gene locus_tag LOCUS_10920 gene cupA 1856 561 CDS product carbon dioxide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141007.1 protein_id gnl|my_center|LOCUS_10920 3427 1898 gene locus_tag LOCUS_10930 gene ndhD 3427 1898 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141006.1 protein_id gnl|my_center|LOCUS_10930 5399 3537 gene locus_tag LOCUS_10940 gene ndhF3 5399 3537 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056748.1 protein_id gnl|my_center|LOCUS_10940 7123 5702 gene locus_tag LOCUS_10950 gene icd 7123 5702 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9S5 protein_id gnl|my_center|LOCUS_10950 7416 7916 gene locus_tag LOCUS_10960 7416 7916 CDS product cytidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057432.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence122 463 2526 gene locus_tag LOCUS_10970 463 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 3334 2729 gene locus_tag LOCUS_10980 3334 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 5846 4149 gene locus_tag LOCUS_10990 5846 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 6198 6413 gene locus_tag LOCUS_11000 6198 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence123 1694 4450 gene locus_tag LOCUS_11010 1694 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 4788 6995 gene locus_tag LOCUS_11020 4788 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence124 72 266 gene locus_tag LOCUS_11030 72 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1446 460 gene locus_tag LOCUS_11040 1446 460 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_11040 3239 1578 gene locus_tag LOCUS_11050 3239 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 5029 4073 gene locus_tag LOCUS_11060 5029 4073 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_11060 6329 5100 gene locus_tag LOCUS_11070 6329 5100 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061719.1 protein_id gnl|my_center|LOCUS_11070 6759 7577 gene locus_tag LOCUS_11080 6759 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 8011 7694 gene locus_tag LOCUS_11090 8011 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143528.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence125 460 1497 gene locus_tag LOCUS_11100 gene asd 460 1497 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP2 protein_id gnl|my_center|LOCUS_11100 1541 2428 gene locus_tag LOCUS_11110 gene dapA 1541 2428 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK4 protein_id gnl|my_center|LOCUS_11110 2910 4673 gene locus_tag LOCUS_11120 gene rnj 2910 4673 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK3 protein_id gnl|my_center|LOCUS_11120 7070 4785 gene locus_tag LOCUS_11130 7070 4785 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250243.1 protein_id gnl|my_center|LOCUS_11130 <8018 7406 gene locus_tag LOCUS_11140 <8018 7406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722710.1:sugar ABC transporter permease >Feature sequence126 152 1516 gene locus_tag LOCUS_11150 gene opcA 152 1516 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 protein_id gnl|my_center|LOCUS_11150 5548 1601 gene locus_tag LOCUS_11160 5548 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 6709 5732 gene locus_tag LOCUS_11170 6709 5732 CDS product isoaspartyl peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_11170 7165 7455 gene locus_tag LOCUS_11180 7165 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence127 312 632 gene locus_tag LOCUS_11190 312 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 713 1876 gene locus_tag LOCUS_11200 713 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2081 1854 gene locus_tag LOCUS_11210 2081 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3231 2032 gene locus_tag LOCUS_11220 3231 2032 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056956.1 protein_id gnl|my_center|LOCUS_11220 3427 3684 gene locus_tag LOCUS_11230 3427 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 3888 4592 gene locus_tag LOCUS_11240 3888 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 4685 4840 gene locus_tag LOCUS_11250 4685 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 5115 5960 gene locus_tag LOCUS_11260 5115 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 5976 6305 gene locus_tag LOCUS_11270 5976 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 6321 6572 gene locus_tag LOCUS_11280 6321 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 <7985 6877 gene locus_tag LOCUS_11290 <7985 6877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NH24:UDP-3-O-acylglucosamine N-acyltransferase 3 >Feature sequence128 317 1438 gene locus_tag LOCUS_11300 317 1438 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056455.1 protein_id gnl|my_center|LOCUS_11300 1445 2704 gene locus_tag LOCUS_11310 1445 2704 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254458.1 protein_id gnl|my_center|LOCUS_11310 2831 3163 gene locus_tag LOCUS_11320 gene petJ 2831 3163 CDS product cytochrome c6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X9 protein_id gnl|my_center|LOCUS_11320 3379 3810 gene locus_tag LOCUS_11330 3379 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140769.1 protein_id gnl|my_center|LOCUS_11330 3816 4667 gene locus_tag LOCUS_11340 3816 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140768.1 protein_id gnl|my_center|LOCUS_11340 6326 4884 gene locus_tag LOCUS_11350 6326 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 7034 6465 gene locus_tag LOCUS_11360 gene pyrE 7034 6465 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW5 protein_id gnl|my_center|LOCUS_11360 >Feature sequence129 95 1636 gene locus_tag LOCUS_11370 95 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143459.1 protein_id gnl|my_center|LOCUS_11370 2374 1685 gene locus_tag LOCUS_11380 2374 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 4316 3105 gene locus_tag LOCUS_11390 4316 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 5822 5112 gene locus_tag LOCUS_11400 5822 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 7929 5866 gene locus_tag LOCUS_11410 7929 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence130 1643 147 gene locus_tag LOCUS_11420 1643 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2340 1936 gene locus_tag LOCUS_11430 gene psb27 2340 1936 CDS product photosystem II lipoprotein Psb27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG60 protein_id gnl|my_center|LOCUS_11430 2723 3604 gene locus_tag LOCUS_11440 2723 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 3726 4433 gene locus_tag LOCUS_11450 3726 4433 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056089.1 protein_id gnl|my_center|LOCUS_11450 4456 4620 gene locus_tag LOCUS_11460 4456 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5975 4728 gene locus_tag LOCUS_11470 gene rfaG 5975 4728 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125976.1 protein_id gnl|my_center|LOCUS_11470 6427 5999 gene locus_tag LOCUS_11480 6427 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 7831 6491 gene locus_tag LOCUS_11490 7831 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence131 463 173 gene locus_tag LOCUS_11500 463 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1282 947 gene locus_tag LOCUS_11510 1282 947 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 protein_id gnl|my_center|LOCUS_11510 1356 2960 gene locus_tag LOCUS_11520 1356 2960 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056694.1 protein_id gnl|my_center|LOCUS_11520 3094 3549 gene locus_tag LOCUS_11530 3094 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 3559 4167 gene locus_tag LOCUS_11540 3559 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5024 4512 gene locus_tag LOCUS_11550 5024 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6177 5215 gene locus_tag LOCUS_11560 gene dnaX 6177 5215 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056369.1 protein_id gnl|my_center|LOCUS_11560 7876 6260 gene locus_tag LOCUS_11570 7876 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence132 <1 942 gene locus_tag LOCUS_11580 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056417.1:methyl-accepting chemotaxis protein 2121 1213 gene locus_tag LOCUS_11590 gene thrB 2121 1213 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI27 protein_id gnl|my_center|LOCUS_11590 3266 2118 gene locus_tag LOCUS_11600 3266 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3526 3696 gene locus_tag LOCUS_11610 3526 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 3808 3978 gene locus_tag LOCUS_11620 3808 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 7478 4101 gene locus_tag LOCUS_11630 7478 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence133 152 2572 gene locus_tag LOCUS_11640 152 2572 CDS product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056890.1 protein_id gnl|my_center|LOCUS_11640 3799 3302 gene locus_tag LOCUS_11650 3799 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 4376 3921 gene locus_tag LOCUS_11660 4376 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 4469 5443 gene locus_tag LOCUS_11670 4469 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 5440 6042 gene locus_tag LOCUS_11680 5440 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 6460 7302 gene locus_tag LOCUS_11690 6460 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 7354 7533 gene locus_tag LOCUS_11700 7354 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence134 63 1322 gene locus_tag LOCUS_11710 63 1322 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_11710 1999 1418 gene locus_tag LOCUS_11720 1999 1418 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_11720 2193 3764 gene locus_tag LOCUS_11730 2193 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140470.1 protein_id gnl|my_center|LOCUS_11730 6556 3863 gene locus_tag LOCUS_11740 6556 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 6928 7221 gene locus_tag LOCUS_11750 6928 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence135 310 1725 gene locus_tag LOCUS_11760 310 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_11760 2004 4022 gene locus_tag LOCUS_11770 gene frgA 2004 4022 CDS product siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947056.1 protein_id gnl|my_center|LOCUS_11770 5091 4054 gene locus_tag LOCUS_11780 5091 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 5533 5871 gene locus_tag LOCUS_11790 5533 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 6676 5885 gene locus_tag LOCUS_11800 6676 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141258.1 protein_id gnl|my_center|LOCUS_11800 6790 7380 gene locus_tag LOCUS_11810 gene cpcS 6790 7380 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL67 protein_id gnl|my_center|LOCUS_11810 >Feature sequence136 1194 961 gene locus_tag LOCUS_11820 1194 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1922 1500 gene locus_tag LOCUS_11830 1922 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2692 2030 gene locus_tag LOCUS_11840 2692 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 3280 3355 gene locus_tag LOCUS_t00080 3280 3355 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3833 5035 gene locus_tag LOCUS_11850 3833 5035 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 protein_id gnl|my_center|LOCUS_11850 5774 5499 gene locus_tag LOCUS_11860 5774 5499 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_11860 6467 6027 gene locus_tag LOCUS_11870 6467 6027 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_11870 7299 6544 gene locus_tag LOCUS_11880 7299 6544 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726908.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence137 219 689 gene locus_tag LOCUS_11890 219 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1179 790 gene locus_tag LOCUS_11900 1179 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 protein_id gnl|my_center|LOCUS_11900 1919 1320 gene locus_tag LOCUS_11910 1919 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 3756 2110 gene locus_tag LOCUS_11920 3756 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 6048 4108 gene locus_tag LOCUS_11930 6048 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056767.1 protein_id gnl|my_center|LOCUS_11930 6953 6597 gene locus_tag LOCUS_11940 gene ndhM 6953 6597 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKF6 protein_id gnl|my_center|LOCUS_11940 7563 7021 gene locus_tag LOCUS_11950 7563 7021 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence138 732 1766 gene locus_tag LOCUS_11960 732 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 2226 4376 gene locus_tag LOCUS_11970 2226 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 5976 4408 gene locus_tag LOCUS_11980 5976 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140470.1 protein_id gnl|my_center|LOCUS_11980 6799 6113 gene locus_tag LOCUS_11990 6799 6113 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_11990 7623 6796 gene locus_tag LOCUS_12000 7623 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702708.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence139 756 388 gene locus_tag LOCUS_12010 756 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1745 864 gene locus_tag LOCUS_12020 1745 864 CDS product chromosome partitioning ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600639.1 protein_id gnl|my_center|LOCUS_12020 2762 1893 gene locus_tag LOCUS_12030 2762 1893 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709820.1 protein_id gnl|my_center|LOCUS_12030 2950 3495 gene locus_tag LOCUS_12040 gene rfbC-2 2950 3495 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_12040 3539 4420 gene locus_tag LOCUS_12050 gene rfbD 3539 4420 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 protein_id gnl|my_center|LOCUS_12050 4454 5527 gene locus_tag LOCUS_12060 gene rfbA 4454 5527 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_12060 5743 6207 gene locus_tag LOCUS_12070 5743 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 6676 7230 gene locus_tag LOCUS_12080 6676 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence140 3 236 gene locus_tag LOCUS_12090 3 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 264 1046 gene locus_tag LOCUS_12100 264 1046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143437.1 protein_id gnl|my_center|LOCUS_12100 1292 3679 gene locus_tag LOCUS_12110 1292 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 4669 3764 gene locus_tag LOCUS_12120 gene cdsA 4669 3764 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 protein_id gnl|my_center|LOCUS_12120 5171 4923 gene locus_tag LOCUS_12130 5171 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 5874 5275 gene locus_tag LOCUS_12140 gene cobL 5874 5275 CDS product precorrin-6B methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 protein_id gnl|my_center|LOCUS_12140 6735 7037 gene locus_tag LOCUS_12150 6735 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence141 1654 668 gene locus_tag LOCUS_12160 1654 668 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403412.1 protein_id gnl|my_center|LOCUS_12160 2020 2814 gene locus_tag LOCUS_12170 gene trpA 2020 2814 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLN9 protein_id gnl|my_center|LOCUS_12170 4577 3102 gene locus_tag LOCUS_12180 gene lnt 4577 3102 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIC3 protein_id gnl|my_center|LOCUS_12180 4736 6469 gene locus_tag LOCUS_12190 4736 6469 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089656.1 protein_id gnl|my_center|LOCUS_12190 6899 6579 gene locus_tag LOCUS_12200 6899 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence142 <1 3970 gene locus_tag LOCUS_12210 <1 3970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056126.1:magnesium chelatase subunit H 4085 4636 gene locus_tag LOCUS_12220 4085 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44014 protein_id gnl|my_center|LOCUS_12220 5405 4668 gene locus_tag LOCUS_12230 5405 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 5760 6950 gene locus_tag LOCUS_12240 5760 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence143 2210 2764 gene locus_tag LOCUS_12250 2210 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057824.1 protein_id gnl|my_center|LOCUS_12250 2916 3287 gene locus_tag LOCUS_12260 2916 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057825.1 protein_id gnl|my_center|LOCUS_12260 3491 4033 gene locus_tag LOCUS_12270 3491 4033 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057826.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence144 115 1161 gene locus_tag LOCUS_12280 115 1161 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RH17 protein_id gnl|my_center|LOCUS_12280 1194 1760 gene locus_tag LOCUS_12290 1194 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1938 2090 gene locus_tag LOCUS_12300 1938 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2313 3317 gene locus_tag LOCUS_12310 2313 3317 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK75 protein_id gnl|my_center|LOCUS_12310 3392 4768 gene locus_tag LOCUS_12320 gene aldH 3392 4768 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0U1 protein_id gnl|my_center|LOCUS_12320 7223 5019 gene locus_tag LOCUS_12330 7223 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence145 2833 1952 gene locus_tag LOCUS_12340 2833 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 4236 2878 gene locus_tag LOCUS_12350 4236 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 5335 4253 gene locus_tag LOCUS_12360 5335 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 7033 5522 gene locus_tag LOCUS_12370 7033 5522 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865256.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence146 470 2110 gene locus_tag LOCUS_12380 470 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2339 3217 gene locus_tag LOCUS_12390 gene ycf66 2339 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057849.1 protein_id gnl|my_center|LOCUS_12390 4352 3321 gene locus_tag LOCUS_12400 4352 3321 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_12400 5112 4399 gene locus_tag LOCUS_12410 gene rnc 5112 4399 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH89 protein_id gnl|my_center|LOCUS_12410 5927 5163 gene locus_tag LOCUS_12420 5927 5163 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266205.1 protein_id gnl|my_center|LOCUS_12420 <7382 6143 gene locus_tag LOCUS_12430 <7382 6143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257891.1:ABC transporter substrate-binding protein >Feature sequence147 2529 1393 gene locus_tag LOCUS_12440 2529 1393 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC5 protein_id gnl|my_center|LOCUS_12440 4001 2616 gene locus_tag LOCUS_12450 4001 2616 CDS product dolichyl-phosphate-mannose-protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence148 <1 1004 gene locus_tag LOCUS_12460 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057152.1:long-chain acyl-[acyl-carrier-protein] reductase 1015 1995 gene locus_tag LOCUS_12470 gene accA 1015 1995 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB6 protein_id gnl|my_center|LOCUS_12470 2527 3255 gene locus_tag LOCUS_12480 2527 3255 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057150.1 protein_id gnl|my_center|LOCUS_12480 3338 4072 gene locus_tag LOCUS_12490 gene folE 3338 4072 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB8 protein_id gnl|my_center|LOCUS_12490 4774 4133 gene locus_tag LOCUS_12500 gene trpF 4774 4133 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP3 protein_id gnl|my_center|LOCUS_12500 >Feature sequence149 1460 372 gene locus_tag LOCUS_12510 1460 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1648 4092 gene locus_tag LOCUS_12520 1648 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 5356 4493 gene locus_tag LOCUS_12530 5356 4493 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 protein_id gnl|my_center|LOCUS_12530 5795 6163 gene locus_tag LOCUS_12540 5795 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 7183 6443 gene locus_tag LOCUS_12550 7183 6443 CDS product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence150 <1 1208 gene locus_tag LOCUS_12560 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546515.1:glycosyl transferase group 1 1444 2013 gene locus_tag LOCUS_12570 1444 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2015 3757 gene locus_tag LOCUS_12580 2015 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 3787 4806 gene locus_tag LOCUS_12590 3787 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence151 3 320 gene locus_tag LOCUS_12600 3 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1282 362 gene locus_tag LOCUS_12610 1282 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1416 2378 gene locus_tag LOCUS_12620 gene ycjY 1416 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243943.1 protein_id gnl|my_center|LOCUS_12620 2493 3548 gene locus_tag LOCUS_12630 2493 3548 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143449.1 protein_id gnl|my_center|LOCUS_12630 3678 4613 gene locus_tag LOCUS_12640 3678 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence152 75 149 gene locus_tag LOCUS_t00090 75 149 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1090 572 gene locus_tag LOCUS_12650 gene ilvH 1090 572 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 protein_id gnl|my_center|LOCUS_12650 4781 1431 gene locus_tag LOCUS_12660 4781 1431 CDS product filamentous hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704567.1 protein_id gnl|my_center|LOCUS_12660 6110 5094 gene locus_tag LOCUS_12670 6110 5094 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_12670 7060 6101 gene locus_tag LOCUS_12680 7060 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence153 9 1643 gene locus_tag LOCUS_12690 gene ndhD2 9 1643 CDS product NAD(P)H-quinone oxidoreductase chain 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHX4 protein_id gnl|my_center|LOCUS_12690 1860 2606 gene locus_tag LOCUS_12700 1860 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2847 4127 gene locus_tag LOCUS_12710 2847 4127 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120863.1 protein_id gnl|my_center|LOCUS_12710 4761 4285 gene locus_tag LOCUS_12720 gene hspA 4761 4285 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_12720 5315 5854 gene locus_tag LOCUS_12730 5315 5854 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_12730 5921 6688 gene locus_tag LOCUS_12740 5921 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058247.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence154 <1 1140 gene locus_tag LOCUS_12750 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141968.1:serine protease inhibitor 1276 2595 gene locus_tag LOCUS_12760 1276 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2775 4163 gene locus_tag LOCUS_12770 2775 4163 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 protein_id gnl|my_center|LOCUS_12770 4296 6143 gene locus_tag LOCUS_12780 4296 6143 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_12780 6140 6919 gene locus_tag LOCUS_12790 6140 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence155 149 78 gene locus_tag LOCUS_t00100 149 78 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 398 2206 gene locus_tag LOCUS_12800 398 2206 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_12800 2216 2431 gene locus_tag LOCUS_12810 2216 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 2449 3462 gene locus_tag LOCUS_12820 2449 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 3528 4709 gene locus_tag LOCUS_12830 3528 4709 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_12830 4983 4777 gene locus_tag LOCUS_12840 4983 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 5948 5016 gene locus_tag LOCUS_12850 5948 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 6466 6122 gene locus_tag LOCUS_12860 6466 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence156 423 1049 gene locus_tag LOCUS_12870 423 1049 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266514.1 protein_id gnl|my_center|LOCUS_12870 1056 2606 gene locus_tag LOCUS_12880 1056 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 2810 3535 gene locus_tag LOCUS_12890 2810 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 3572 4273 gene locus_tag LOCUS_12900 3572 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 4288 5421 gene locus_tag LOCUS_12910 4288 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence157 132 1598 gene locus_tag LOCUS_12920 gene glmM 132 1598 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI20 protein_id gnl|my_center|LOCUS_12920 4785 2077 gene locus_tag LOCUS_12930 4785 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 6466 5093 gene locus_tag LOCUS_12940 gene murF 6466 5093 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM9 protein_id gnl|my_center|LOCUS_12940 >Feature sequence158 48 1253 gene locus_tag LOCUS_12950 gene ispH 48 1253 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK29 protein_id gnl|my_center|LOCUS_12950 1752 1336 gene locus_tag LOCUS_12960 1752 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 2032 3642 gene locus_tag LOCUS_12970 2032 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 3661 4032 gene locus_tag LOCUS_12980 3661 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12980 4248 4039 gene locus_tag LOCUS_12990 4248 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 6601 4370 gene locus_tag LOCUS_13000 6601 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence159 <1 1385 gene locus_tag LOCUS_13010 <1 1385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272333.1:peptidoglycan-binding protein 3184 1847 gene locus_tag LOCUS_13020 gene dnaB 3184 1847 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA9 protein_id gnl|my_center|LOCUS_13020 3345 4694 gene locus_tag LOCUS_13030 3345 4694 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057484.1 protein_id gnl|my_center|LOCUS_13030 5826 4780 gene locus_tag LOCUS_13040 gene desA 5826 4780 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence160 6077 2430 gene locus_tag LOCUS_13050 6077 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence161 2659 248 gene locus_tag LOCUS_13060 2659 248 CDS product putative phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN6 protein_id gnl|my_center|LOCUS_13060 3264 5462 gene locus_tag LOCUS_13070 3264 5462 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229242.1 protein_id gnl|my_center|LOCUS_13070 5981 6586 gene locus_tag LOCUS_13080 5981 6586 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence162 2241 2080 gene locus_tag LOCUS_13090 2241 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 4062 2308 gene locus_tag LOCUS_13100 4062 2308 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141553.1 protein_id gnl|my_center|LOCUS_13100 4222 4650 gene locus_tag LOCUS_13110 4222 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 4651 6696 gene locus_tag LOCUS_13120 4651 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence163 5796 3025 gene locus_tag LOCUS_13130 5796 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 <6864 5932 gene locus_tag LOCUS_13140 <6864 5932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403412.1:transposase >Feature sequence164 <6837 3769 gene locus_tag LOCUS_13150 <6837 3769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120142.1:acriflavine resistance protein B >Feature sequence165 32 1384 gene locus_tag LOCUS_13160 gene accC 32 1384 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_13160 1408 2040 gene locus_tag LOCUS_13170 gene satA 1408 2040 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071891.1 protein_id gnl|my_center|LOCUS_13170 2095 3069 gene locus_tag LOCUS_13180 2095 3069 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_13180 3894 3115 gene locus_tag LOCUS_13190 3894 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 4610 4317 gene locus_tag LOCUS_13200 4610 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943940.1 protein_id gnl|my_center|LOCUS_13200 5307 4666 gene locus_tag LOCUS_13210 5307 4666 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR9 protein_id gnl|my_center|LOCUS_13210 6475 5384 gene locus_tag LOCUS_13220 gene ychF 6475 5384 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ8 protein_id gnl|my_center|LOCUS_13220 >Feature sequence166 2481 2813 gene locus_tag LOCUS_13230 2481 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 2982 4676 gene locus_tag LOCUS_13240 2982 4676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056296.1 protein_id gnl|my_center|LOCUS_13240 4880 6304 gene locus_tag LOCUS_13250 4880 6304 CDS product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056712.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence167 580 128 gene locus_tag LOCUS_13260 580 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_13260 2804 573 gene locus_tag LOCUS_13270 gene narB 2804 573 CDS product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057195.1 protein_id gnl|my_center|LOCUS_13270 4609 2996 gene locus_tag LOCUS_13280 gene crnA 4609 2996 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_13280 5116 5967 gene locus_tag LOCUS_13290 5116 5967 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144354.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence168 <1 1740 gene locus_tag LOCUS_13300 <1 1740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DG52:endonuclease MutS2 2954 1992 gene locus_tag LOCUS_13310 2954 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4168 3221 gene locus_tag LOCUS_13320 4168 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 4609 5193 gene locus_tag LOCUS_13330 4609 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057324.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence169 1577 435 gene locus_tag LOCUS_13340 1577 435 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141544.1 protein_id gnl|my_center|LOCUS_13340 1871 2965 gene locus_tag LOCUS_13350 1871 2965 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964805.1 protein_id gnl|my_center|LOCUS_13350 3160 3627 gene locus_tag LOCUS_13360 3160 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3717 4781 gene locus_tag LOCUS_13370 gene hemE 3717 4781 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBL3 protein_id gnl|my_center|LOCUS_13370 5124 6065 gene locus_tag LOCUS_13380 5124 6065 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence170 654 1730 gene locus_tag LOCUS_13390 gene acsF1 654 1730 CDS product magnesium-protoporphyrin IX monomethyl ester [oxidative] cyclase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ05 protein_id gnl|my_center|LOCUS_13390 1949 2350 gene locus_tag LOCUS_13400 gene msrB 1949 2350 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE61 protein_id gnl|my_center|LOCUS_13400 2892 2428 gene locus_tag LOCUS_13410 2892 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 3839 3039 gene locus_tag LOCUS_13420 3839 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 3889 4056 gene locus_tag LOCUS_13430 3889 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 4999 4250 gene locus_tag LOCUS_13440 4999 4250 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_13440 5633 5076 gene locus_tag LOCUS_13450 5633 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 6275 5901 gene locus_tag LOCUS_13460 6275 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057498.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence171 <1 742 gene locus_tag LOCUS_13470 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140084.1:alpha-mannosidase 846 2213 gene locus_tag LOCUS_13480 846 2213 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_13480 2327 2551 gene locus_tag LOCUS_13490 2327 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058260.1 protein_id gnl|my_center|LOCUS_13490 2714 3997 gene locus_tag LOCUS_13500 gene hisS 2714 3997 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHP7 protein_id gnl|my_center|LOCUS_13500 4218 5789 gene locus_tag LOCUS_13510 4218 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6288 5851 gene locus_tag LOCUS_13520 6288 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence172 19 729 gene locus_tag LOCUS_13530 gene rpiA 19 729 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJF2 protein_id gnl|my_center|LOCUS_13530 1248 1622 gene locus_tag LOCUS_13540 gene cytM 1248 1622 CDS product cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058261.1 protein_id gnl|my_center|LOCUS_13540 3414 1765 gene locus_tag LOCUS_13550 3414 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057114.1 protein_id gnl|my_center|LOCUS_13550 4938 3604 gene locus_tag LOCUS_13560 4938 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 6116 5010 gene locus_tag LOCUS_13570 6116 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence173 <1 748 gene locus_tag LOCUS_13580 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJP5:nicotinate phosphoribosyltransferase 854 1453 gene locus_tag LOCUS_13590 gene nadD 854 1453 CDS product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 protein_id gnl|my_center|LOCUS_13590 1429 2166 gene locus_tag LOCUS_13600 1429 2166 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 protein_id gnl|my_center|LOCUS_13600 2236 2553 gene locus_tag LOCUS_13610 2236 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2728 4458 gene locus_tag LOCUS_13620 gene nadE 2728 4458 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_13620 5119 4571 gene locus_tag LOCUS_13630 5119 4571 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 protein_id gnl|my_center|LOCUS_13630 5530 5243 gene locus_tag LOCUS_13640 5530 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence174 665 2104 gene locus_tag LOCUS_13650 665 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 2475 2550 gene locus_tag LOCUS_t00110 2475 2550 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2755 4005 gene locus_tag LOCUS_13660 2755 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057832.1 protein_id gnl|my_center|LOCUS_13660 4754 4137 gene locus_tag LOCUS_13670 4754 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence175 806 1294 gene locus_tag LOCUS_13680 806 1294 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 protein_id gnl|my_center|LOCUS_13680 4498 1424 gene locus_tag LOCUS_13690 4498 1424 CDS product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJM9 protein_id gnl|my_center|LOCUS_13690 6068 4785 gene locus_tag LOCUS_13700 gene hemA 6068 4785 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI53 protein_id gnl|my_center|LOCUS_13700 >Feature sequence176 1299 544 gene locus_tag LOCUS_13710 gene phnC 1299 544 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FMM1 protein_id gnl|my_center|LOCUS_13710 1861 1520 gene locus_tag LOCUS_13720 1861 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2174 3316 gene locus_tag LOCUS_13730 2174 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 3507 3947 gene locus_tag LOCUS_13740 3507 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 4157 4474 gene locus_tag LOCUS_13750 4157 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4479 4979 gene locus_tag LOCUS_13760 4479 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 <6483 5257 gene locus_tag LOCUS_13770 <6483 5257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLK8:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence177 46 2460 gene locus_tag LOCUS_13780 46 2460 CDS product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056890.1 protein_id gnl|my_center|LOCUS_13780 2994 5981 gene locus_tag LOCUS_13790 2994 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence178 104 409 gene locus_tag LOCUS_13800 gene cpeR 104 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141186.1 protein_id gnl|my_center|LOCUS_13800 435 1490 gene locus_tag LOCUS_13810 435 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1670 3046 gene locus_tag LOCUS_13820 1670 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 3171 4526 gene locus_tag LOCUS_13830 3171 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 4644 5003 gene locus_tag LOCUS_13840 4644 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 6439 5237 gene locus_tag LOCUS_13850 gene pgk 6439 5237 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDZ4 protein_id gnl|my_center|LOCUS_13850 >Feature sequence179 1062 202 gene locus_tag LOCUS_13860 gene map 1062 202 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ4 protein_id gnl|my_center|LOCUS_13860 1246 2127 gene locus_tag LOCUS_13870 1246 2127 CDS product putative aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72208 protein_id gnl|my_center|LOCUS_13870 2241 3539 gene locus_tag LOCUS_13880 2241 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 5224 3572 gene locus_tag LOCUS_13890 5224 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 6264 5302 gene locus_tag LOCUS_13900 6264 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence180 1734 2147 gene locus_tag LOCUS_13910 1734 2147 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142135.1 protein_id gnl|my_center|LOCUS_13910 2266 2604 gene locus_tag LOCUS_13920 2266 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67709 protein_id gnl|my_center|LOCUS_13920 2804 3178 gene locus_tag LOCUS_13930 gene rpsL 2804 3178 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59168 protein_id gnl|my_center|LOCUS_13930 3305 3775 gene locus_tag LOCUS_13940 gene rpsG 3305 3775 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI44 protein_id gnl|my_center|LOCUS_13940 4060 6138 gene locus_tag LOCUS_13950 gene fusA 4060 6138 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI43 protein_id gnl|my_center|LOCUS_13950 >Feature sequence181 <1 676 gene locus_tag LOCUS_13960 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DL06:aconitate hydratase B 949 1224 gene locus_tag LOCUS_13970 949 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1602 1805 gene locus_tag LOCUS_13980 1602 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 2029 3729 gene locus_tag LOCUS_13990 2029 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3937 4629 gene locus_tag LOCUS_14000 3937 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 4685 5629 gene locus_tag LOCUS_14010 4685 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence182 <1 1380 gene locus_tag LOCUS_14020 <1 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P59081:methionine--tRNA ligase 1673 2278 gene locus_tag LOCUS_14030 1673 2278 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 protein_id gnl|my_center|LOCUS_14030 2275 3429 gene locus_tag LOCUS_14040 2275 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 3706 3515 gene locus_tag LOCUS_14050 3706 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3952 4476 gene locus_tag LOCUS_14060 3952 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056704.1 protein_id gnl|my_center|LOCUS_14060 5857 4592 gene locus_tag LOCUS_14070 gene pyrC 5857 4592 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057373.1 protein_id gnl|my_center|LOCUS_14070 6196 5915 gene locus_tag LOCUS_14080 6196 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence183 1848 148 gene locus_tag LOCUS_14090 1848 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2736 1933 gene locus_tag LOCUS_14100 2736 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3942 2740 gene locus_tag LOCUS_14110 3942 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 4190 5233 gene locus_tag LOCUS_14120 4190 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057921.1 protein_id gnl|my_center|LOCUS_14120 6051 5236 gene locus_tag LOCUS_14130 6051 5236 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142171.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence184 2280 118 gene locus_tag LOCUS_14140 2280 118 CDS product succinoglycan transporter ExoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057604.1 protein_id gnl|my_center|LOCUS_14140 2983 2468 gene locus_tag LOCUS_14150 2983 2468 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 protein_id gnl|my_center|LOCUS_14150 4731 3271 gene locus_tag LOCUS_14160 4731 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 6127 4742 gene locus_tag LOCUS_14170 6127 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence185 957 2273 gene locus_tag LOCUS_14180 957 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 3667 2411 gene locus_tag LOCUS_14190 3667 2411 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_14190 4173 4697 gene locus_tag LOCUS_14200 4173 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056084.1 protein_id gnl|my_center|LOCUS_14200 4841 5728 gene locus_tag LOCUS_14210 4841 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056085.1 protein_id gnl|my_center|LOCUS_14210 6288 5788 gene locus_tag LOCUS_14220 6288 5788 CDS product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence186 581 922 gene locus_tag LOCUS_14230 gene rpsF 581 922 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNH7 protein_id gnl|my_center|LOCUS_14230 1343 1026 gene locus_tag LOCUS_14240 1343 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1514 1587 gene locus_tag LOCUS_t00120 1514 1587 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2315 1740 gene locus_tag LOCUS_14250 gene aat 2315 1740 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKJ8 protein_id gnl|my_center|LOCUS_14250 3552 2335 gene locus_tag LOCUS_14260 3552 2335 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058298.1 protein_id gnl|my_center|LOCUS_14260 3789 3577 gene locus_tag LOCUS_14270 3789 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4064 4798 gene locus_tag LOCUS_14280 4064 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 6206 4902 gene locus_tag LOCUS_14290 6206 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence187 142 3621 gene locus_tag LOCUS_14300 142 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 4572 3688 gene locus_tag LOCUS_14310 4572 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 5254 4751 gene locus_tag LOCUS_14320 5254 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 6320 5523 gene locus_tag LOCUS_14330 6320 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence188 2656 416 gene locus_tag LOCUS_14340 2656 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2858 3343 gene locus_tag LOCUS_14350 2858 3343 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142677.1 protein_id gnl|my_center|LOCUS_14350 3401 4654 gene locus_tag LOCUS_14360 3401 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142706.1 protein_id gnl|my_center|LOCUS_14360 4829 5272 gene locus_tag LOCUS_14370 4829 5272 CDS product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_14370 5305 6123 gene locus_tag LOCUS_14380 5305 6123 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence189 <1 695 gene locus_tag LOCUS_14390 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000282880.1:glycosyl transferase 906 1799 gene locus_tag LOCUS_14400 906 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence190 59 979 gene locus_tag LOCUS_14410 gene argF 59 979 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJW4 protein_id gnl|my_center|LOCUS_14410 1308 1550 gene locus_tag LOCUS_14420 1308 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1881 2780 gene locus_tag LOCUS_14430 1881 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2924 4282 gene locus_tag LOCUS_14440 gene miaB 2924 4282 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB2 protein_id gnl|my_center|LOCUS_14440 4358 4627 gene locus_tag LOCUS_14450 gene rpsO 4358 4627 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE54 protein_id gnl|my_center|LOCUS_14450 4645 5115 gene locus_tag LOCUS_14460 4645 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124904.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence191 >Feature sequence192 413 802 gene locus_tag LOCUS_14470 413 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 protein_id gnl|my_center|LOCUS_14470 865 1227 gene locus_tag LOCUS_14480 865 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 2205 4076 gene locus_tag LOCUS_14490 2205 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 4230 4081 gene locus_tag LOCUS_14500 4230 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 4841 4206 gene locus_tag LOCUS_14510 4841 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939177.1 protein_id gnl|my_center|LOCUS_14510 5855 4863 gene locus_tag LOCUS_14520 5855 4863 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057238.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence193 <1 1002 gene locus_tag LOCUS_14530 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861256.1:transposase 2479 1184 gene locus_tag LOCUS_14540 gene eno 2479 1184 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL40 protein_id gnl|my_center|LOCUS_14540 3685 2645 gene locus_tag LOCUS_14550 gene gap1 3685 2645 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG48 protein_id gnl|my_center|LOCUS_14550 5044 4175 gene locus_tag LOCUS_14560 5044 4175 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085765.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence194 2200 2367 gene locus_tag LOCUS_14570 2200 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2631 2798 gene locus_tag LOCUS_14580 2631 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2852 2995 gene locus_tag LOCUS_14590 2852 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 3070 3219 gene locus_tag LOCUS_14600 3070 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 5588 3465 gene locus_tag LOCUS_14610 5588 3465 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_14610 6168 5783 gene locus_tag LOCUS_tm00010 6168 5783 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence195 1247 1975 gene locus_tag LOCUS_14620 gene kdsB 1247 1975 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFA8 protein_id gnl|my_center|LOCUS_14620 2155 2784 gene locus_tag LOCUS_14630 2155 2784 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 protein_id gnl|my_center|LOCUS_14630 3533 2853 gene locus_tag LOCUS_14640 3533 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4694 3897 gene locus_tag LOCUS_14650 4694 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 <6201 4992 gene locus_tag LOCUS_14660 <6201 4992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143944.1:nitrate transporter NrtC >Feature sequence196 1288 788 gene locus_tag LOCUS_14670 1288 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1575 1715 gene locus_tag LOCUS_14680 1575 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2346 1957 gene locus_tag LOCUS_14690 2346 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 4787 2343 gene locus_tag LOCUS_14700 4787 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 4933 6138 gene locus_tag LOCUS_14710 4933 6138 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140568.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence197 1425 550 gene locus_tag LOCUS_14720 1425 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1574 2272 gene locus_tag LOCUS_14730 1574 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2310 3707 gene locus_tag LOCUS_14740 2310 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_14740 3806 4942 gene locus_tag LOCUS_14750 3806 4942 CDS product putative glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_14750 <6162 5043 gene locus_tag LOCUS_14760 <6162 5043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DHV4:phosphoribosylamine--glycine ligase >Feature sequence198 2704 632 gene locus_tag LOCUS_14770 2704 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4015 2738 gene locus_tag LOCUS_14780 gene livK 4015 2738 CDS product leucine/isoleucine/valine-binding protein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121339.1 protein_id gnl|my_center|LOCUS_14780 4501 4331 gene locus_tag LOCUS_14790 4501 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057753.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence199 583 1695 gene locus_tag LOCUS_14800 583 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1953 2486 gene locus_tag LOCUS_14810 1953 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2513 3526 gene locus_tag LOCUS_14820 2513 3526 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG6 protein_id gnl|my_center|LOCUS_14820 3719 5491 gene locus_tag LOCUS_14830 3719 5491 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 protein_id gnl|my_center|LOCUS_14830 <6147 5575 gene locus_tag LOCUS_14840 <6147 5575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DM20:elongation factor 4 >Feature sequence200 <1 1218 gene locus_tag LOCUS_14850 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057883.1:sugar ABC transporter substrate-binding protein 2135 1857 gene locus_tag LOCUS_14860 2135 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2366 3511 gene locus_tag LOCUS_14870 2366 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530607.1 protein_id gnl|my_center|LOCUS_14870 3638 5026 gene locus_tag LOCUS_14880 3638 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence201 638 1198 gene locus_tag LOCUS_14890 638 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1474 3720 gene locus_tag LOCUS_14900 1474 3720 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_14900 4099 3923 gene locus_tag LOCUS_14910 4099 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 4372 4950 gene locus_tag LOCUS_14920 4372 4950 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_14920 5077 5724 gene locus_tag LOCUS_14930 5077 5724 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705438.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence202 950 1591 gene locus_tag LOCUS_14940 950 1591 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056166.1 protein_id gnl|my_center|LOCUS_14940 1687 2322 gene locus_tag LOCUS_14950 1687 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_14950 4455 2446 gene locus_tag LOCUS_14960 4455 2446 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_14960 4722 5735 gene locus_tag LOCUS_14970 gene pdxA 4722 5735 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLZ9 protein_id gnl|my_center|LOCUS_14970 >Feature sequence203 <1 2694 gene locus_tag LOCUS_14980 <1 2694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGI7:isoleucine--tRNA ligase 2757 3317 gene locus_tag LOCUS_14990 2757 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_14990 3299 3757 gene locus_tag LOCUS_15000 3299 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 4453 3794 gene locus_tag LOCUS_15010 4453 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 5909 4575 gene locus_tag LOCUS_15020 5909 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 6079 6007 gene locus_tag LOCUS_t00130 6079 6007 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence204 1122 1901 gene locus_tag LOCUS_15030 1122 1901 CDS product lactose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_15030 2344 3543 gene locus_tag LOCUS_15040 2344 3543 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 protein_id gnl|my_center|LOCUS_15040 5209 3680 gene locus_tag LOCUS_15050 5209 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 5335 6075 gene locus_tag LOCUS_15060 5335 6075 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence205 391 1761 gene locus_tag LOCUS_15070 391 1761 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKB7 protein_id gnl|my_center|LOCUS_15070 2189 1884 gene locus_tag LOCUS_15080 2189 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3920 2364 gene locus_tag LOCUS_15090 3920 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 <6077 4436 gene locus_tag LOCUS_15100 <6077 4436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P59177:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence206 164 1531 gene locus_tag LOCUS_15110 164 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 2223 1555 gene locus_tag LOCUS_15120 gene trmB 2223 1555 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH6 protein_id gnl|my_center|LOCUS_15120 2298 3404 gene locus_tag LOCUS_15130 2298 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057388.1 protein_id gnl|my_center|LOCUS_15130 4754 3486 gene locus_tag LOCUS_15140 4754 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence207 1474 1076 gene locus_tag LOCUS_15150 1474 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2766 1681 gene locus_tag LOCUS_15160 2766 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 3075 2866 gene locus_tag LOCUS_15170 3075 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 3196 3687 gene locus_tag LOCUS_15180 3196 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 4641 3775 gene locus_tag LOCUS_15190 4641 3775 CDS product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_15190 <6026 4727 gene locus_tag LOCUS_15200 <6026 4727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DIF8:photosystem II CP43 reaction center protein >Feature sequence208 1419 628 gene locus_tag LOCUS_15210 1419 628 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975514.1 protein_id gnl|my_center|LOCUS_15210 3483 1450 gene locus_tag LOCUS_15220 3483 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 5529 3571 gene locus_tag LOCUS_15230 5529 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence209 1385 609 gene locus_tag LOCUS_15240 1385 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 4281 1468 gene locus_tag LOCUS_15250 4281 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence210 3325 356 gene locus_tag LOCUS_15260 3325 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 5907 3400 gene locus_tag LOCUS_15270 5907 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence211 927 1628 gene locus_tag LOCUS_15280 927 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057874.1 protein_id gnl|my_center|LOCUS_15280 2264 1716 gene locus_tag LOCUS_15290 gene dpsA 2264 1716 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056462.1 protein_id gnl|my_center|LOCUS_15290 2639 3619 gene locus_tag LOCUS_15300 gene kdsD 2639 3619 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ16 protein_id gnl|my_center|LOCUS_15300 4024 4785 gene locus_tag LOCUS_15310 4024 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 5028 5573 gene locus_tag LOCUS_15320 gene pyrR 5028 5573 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ7 protein_id gnl|my_center|LOCUS_15320 5848 5660 gene locus_tag LOCUS_15330 5848 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence212 459 2276 gene locus_tag LOCUS_15340 459 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4219 2462 gene locus_tag LOCUS_15350 4219 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 5955 4669 gene locus_tag LOCUS_15360 5955 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence213 459 1721 gene locus_tag LOCUS_15370 459 1721 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056017.1 protein_id gnl|my_center|LOCUS_15370 1811 3247 gene locus_tag LOCUS_15380 1811 3247 CDS product myeloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143588.1 protein_id gnl|my_center|LOCUS_15380 5842 3587 gene locus_tag LOCUS_15390 5842 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence214 807 364 gene locus_tag LOCUS_15400 807 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057015.1 protein_id gnl|my_center|LOCUS_15400 1166 939 gene locus_tag LOCUS_15410 1166 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 <5946 1294 gene locus_tag LOCUS_15420 <5946 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225917.1:hyalin >Feature sequence215 3086 423 gene locus_tag LOCUS_15430 3086 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 3974 4243 gene locus_tag LOCUS_15440 3974 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 4700 5788 gene locus_tag LOCUS_15450 4700 5788 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141502.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence216 964 512 gene locus_tag LOCUS_15460 gene ureE 964 512 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ62 protein_id gnl|my_center|LOCUS_15460 1549 1103 gene locus_tag LOCUS_15470 1549 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3250 2243 gene locus_tag LOCUS_15480 3250 2243 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057413.1 protein_id gnl|my_center|LOCUS_15480 3466 4077 gene locus_tag LOCUS_15490 gene cobH 3466 4077 CDS product cobalt-precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056028.1 protein_id gnl|my_center|LOCUS_15490 4074 5240 gene locus_tag LOCUS_15500 gene nifS 4074 5240 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055970.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence217 252 1028 gene locus_tag LOCUS_15510 252 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056927.1 protein_id gnl|my_center|LOCUS_15510 1075 1551 gene locus_tag LOCUS_15520 1075 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1578 2294 gene locus_tag LOCUS_15530 1578 2294 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704243.1 protein_id gnl|my_center|LOCUS_15530 4134 2320 gene locus_tag LOCUS_15540 4134 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 4879 4121 gene locus_tag LOCUS_15550 4879 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 5797 5063 gene locus_tag LOCUS_15560 5797 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence218 461 928 gene locus_tag LOCUS_15570 461 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 3150 1087 gene locus_tag LOCUS_15580 3150 1087 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056593.1 protein_id gnl|my_center|LOCUS_15580 4562 3390 gene locus_tag LOCUS_15590 4562 3390 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_15590 4969 4718 gene locus_tag LOCUS_15600 4969 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056812.1 protein_id gnl|my_center|LOCUS_15600 5635 5363 gene locus_tag LOCUS_15610 5635 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence219 543 1382 gene locus_tag LOCUS_15620 gene tyrA 543 1382 CDS product arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058267.1 protein_id gnl|my_center|LOCUS_15620 1463 2140 gene locus_tag LOCUS_15630 1463 2140 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058023.1 protein_id gnl|my_center|LOCUS_15630 2297 2983 gene locus_tag LOCUS_15640 2297 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 3359 3096 gene locus_tag LOCUS_15650 3359 3096 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 protein_id gnl|my_center|LOCUS_15650 5571 3364 gene locus_tag LOCUS_15660 5571 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057163.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence220 2522 648 gene locus_tag LOCUS_15670 2522 648 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056292.1 protein_id gnl|my_center|LOCUS_15670 3758 3003 gene locus_tag LOCUS_15680 gene cpcG2 3758 3003 CDS product phycobilisome rod-core linker polypeptide CpcG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50040 protein_id gnl|my_center|LOCUS_15680 4685 4068 gene locus_tag LOCUS_15690 gene ycf58 4685 4068 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD5 protein_id gnl|my_center|LOCUS_15690 4925 5092 gene locus_tag LOCUS_15700 4925 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence221 1814 999 gene locus_tag LOCUS_15710 1814 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141752.1 protein_id gnl|my_center|LOCUS_15710 2298 2225 gene locus_tag LOCUS_t00140 2298 2225 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence222 1404 214 gene locus_tag LOCUS_15720 1404 214 CDS product cysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 protein_id gnl|my_center|LOCUS_15720 1725 3242 gene locus_tag LOCUS_15730 1725 3242 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124464.1 protein_id gnl|my_center|LOCUS_15730 4430 3408 gene locus_tag LOCUS_15740 4430 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 <5851 4753 gene locus_tag LOCUS_15750 <5851 4753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NIR8:amidophosphoribosyltransferase >Feature sequence223 <1 1150 gene locus_tag LOCUS_15760 <1 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGR2:histidinol dehydrogenase 2488 1259 gene locus_tag LOCUS_15770 2488 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 2639 3178 gene locus_tag LOCUS_15780 2639 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 3520 3855 gene locus_tag LOCUS_15790 3520 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 4215 4664 gene locus_tag LOCUS_15800 4215 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence224 32 958 gene locus_tag LOCUS_15810 32 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2478 1186 gene locus_tag LOCUS_15820 2478 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057642.1 protein_id gnl|my_center|LOCUS_15820 3286 2552 gene locus_tag LOCUS_15830 gene comB 3286 2552 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS5 protein_id gnl|my_center|LOCUS_15830 3754 4677 gene locus_tag LOCUS_15840 3754 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence225 3 1559 gene locus_tag LOCUS_15850 3 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057082.1 protein_id gnl|my_center|LOCUS_15850 1655 2551 gene locus_tag LOCUS_15860 1655 2551 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143278.1 protein_id gnl|my_center|LOCUS_15860 3368 2613 gene locus_tag LOCUS_15870 3368 2613 CDS product teichoic acid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056307.1 protein_id gnl|my_center|LOCUS_15870 3980 3642 gene locus_tag LOCUS_15880 3980 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057677.1 protein_id gnl|my_center|LOCUS_15880 4052 4351 gene locus_tag LOCUS_15890 4052 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 <5769 4561 gene locus_tag LOCUS_15900 <5769 4561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056005.1:geranylgeranyl reductase >Feature sequence226 224 673 gene locus_tag LOCUS_15910 224 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 951 817 gene locus_tag LOCUS_15920 951 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 908 1606 gene locus_tag LOCUS_15930 908 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 2348 1626 gene locus_tag LOCUS_15940 2348 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 3307 2558 gene locus_tag LOCUS_15950 3307 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3550 5112 gene locus_tag LOCUS_15960 gene hemD 3550 5112 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057989.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence227 1364 1101 gene locus_tag LOCUS_15970 1364 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1652 1389 gene locus_tag LOCUS_15980 1652 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1796 2023 gene locus_tag LOCUS_15990 1796 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 3238 2036 gene locus_tag LOCUS_16000 3238 2036 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056970.1 protein_id gnl|my_center|LOCUS_16000 5376 3373 gene locus_tag LOCUS_16010 5376 3373 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057481.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence228 27 227 gene locus_tag LOCUS_16020 27 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 473 1297 gene locus_tag LOCUS_16030 473 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2123 1605 gene locus_tag LOCUS_16040 2123 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2324 2572 gene locus_tag LOCUS_16050 gene ycf19 2324 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143529.1 protein_id gnl|my_center|LOCUS_16050 3605 3159 gene locus_tag LOCUS_16060 3605 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056602.1 protein_id gnl|my_center|LOCUS_16060 4348 3737 gene locus_tag LOCUS_16070 gene lipA 4348 3737 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 protein_id gnl|my_center|LOCUS_16070 4597 5070 gene locus_tag LOCUS_16080 4597 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence229 191 3226 gene locus_tag LOCUS_16090 191 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3343 3996 gene locus_tag LOCUS_16100 3343 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142667.1 protein_id gnl|my_center|LOCUS_16100 4088 5296 gene locus_tag LOCUS_16110 4088 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence230 1641 811 gene locus_tag LOCUS_16120 1641 811 CDS product putative iron transport system ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44662 protein_id gnl|my_center|LOCUS_16120 2745 1768 gene locus_tag LOCUS_16130 2745 1768 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170110.1 protein_id gnl|my_center|LOCUS_16130 3871 2930 gene locus_tag LOCUS_16140 3871 2930 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403412.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence231 2758 1529 gene locus_tag LOCUS_16150 2758 1529 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142192.1 protein_id gnl|my_center|LOCUS_16150 3344 4237 gene locus_tag LOCUS_16160 3344 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057461.1 protein_id gnl|my_center|LOCUS_16160 4536 5447 gene locus_tag LOCUS_16170 4536 5447 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence232 2407 407 gene locus_tag LOCUS_16180 2407 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 2637 3461 gene locus_tag LOCUS_16190 2637 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUR8 protein_id gnl|my_center|LOCUS_16190 3539 3976 gene locus_tag LOCUS_16200 3539 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 4111 5172 gene locus_tag LOCUS_16210 gene mtnA 4111 5172 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK09 protein_id gnl|my_center|LOCUS_16210 5594 5295 gene locus_tag LOCUS_16220 5594 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence233 459 713 gene locus_tag LOCUS_16230 459 713 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 protein_id gnl|my_center|LOCUS_16230 1635 814 gene locus_tag LOCUS_16240 1635 814 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124685.1 protein_id gnl|my_center|LOCUS_16240 2400 3593 gene locus_tag LOCUS_16250 2400 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 4713 3700 gene locus_tag LOCUS_16260 4713 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 <5635 5092 gene locus_tag LOCUS_16270 <5635 5092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056891.1:DNA-binding response regulator >Feature sequence234 780 1277 gene locus_tag LOCUS_16280 780 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2728 1274 gene locus_tag LOCUS_16290 2728 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 3126 3629 gene locus_tag LOCUS_16300 3126 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 3787 4269 gene locus_tag LOCUS_16310 3787 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 4803 4444 gene locus_tag LOCUS_16320 4803 4444 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 protein_id gnl|my_center|LOCUS_16320 <5634 5028 gene locus_tag LOCUS_16330 <5634 5028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141845.1:serine protease >Feature sequence235 140 892 gene locus_tag LOCUS_16340 140 892 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056437.1 protein_id gnl|my_center|LOCUS_16340 1261 2448 gene locus_tag LOCUS_16350 1261 2448 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056769.1 protein_id gnl|my_center|LOCUS_16350 2837 3505 gene locus_tag LOCUS_16360 2837 3505 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM85 protein_id gnl|my_center|LOCUS_16360 3696 3502 gene locus_tag LOCUS_16370 3696 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence236 <1 947 gene locus_tag LOCUS_16380 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004544542.1:two-component system sensor kinase 1018 2178 gene locus_tag LOCUS_16390 gene bioF 1018 2178 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNL4 protein_id gnl|my_center|LOCUS_16390 3378 2191 gene locus_tag LOCUS_16400 3378 2191 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_16400 4866 3673 gene locus_tag LOCUS_16410 4866 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 5582 5289 gene locus_tag LOCUS_16420 5582 5289 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142008.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence237 20 1234 gene locus_tag LOCUS_16430 20 1234 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 protein_id gnl|my_center|LOCUS_16430 1424 2428 gene locus_tag LOCUS_16440 gene thiL 1424 2428 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGF1 protein_id gnl|my_center|LOCUS_16440 2540 3628 gene locus_tag LOCUS_16450 2540 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 3641 4759 gene locus_tag LOCUS_16460 3641 4759 CDS product putative MscS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66994 protein_id gnl|my_center|LOCUS_16460 5615 4956 gene locus_tag LOCUS_16470 5615 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence238 568 1947 gene locus_tag LOCUS_16480 568 1947 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_16480 2095 4167 gene locus_tag LOCUS_16490 2095 4167 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_16490 5494 4496 gene locus_tag LOCUS_16500 5494 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence239 135 1019 gene locus_tag LOCUS_16510 gene rsmH 135 1019 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH87 protein_id gnl|my_center|LOCUS_16510 1146 994 gene locus_tag LOCUS_16520 1146 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3504 1339 gene locus_tag LOCUS_16530 3504 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 4525 3554 gene locus_tag LOCUS_16540 4525 3554 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056436.1 protein_id gnl|my_center|LOCUS_16540 5423 4605 gene locus_tag LOCUS_16550 gene btpA 5423 4605 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence240 1325 945 gene locus_tag LOCUS_16560 1325 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1739 1446 gene locus_tag LOCUS_16570 1739 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2355 1936 gene locus_tag LOCUS_16580 2355 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2713 4056 gene locus_tag LOCUS_16590 2713 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence241 <1 3876 gene locus_tag LOCUS_16600 <1 3876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase 4821 4072 gene locus_tag LOCUS_16610 4821 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 protein_id gnl|my_center|LOCUS_16610 <5592 4986 gene locus_tag LOCUS_16620 <5592 4986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGE8:ribulose-phosphate 3-epimerase >Feature sequence242 1975 1547 gene locus_tag LOCUS_16630 1975 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 2827 2030 gene locus_tag LOCUS_16640 gene minD 2827 2030 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE2 protein_id gnl|my_center|LOCUS_16640 3764 2910 gene locus_tag LOCUS_16650 gene minC 3764 2910 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE3 protein_id gnl|my_center|LOCUS_16650 4532 3900 gene locus_tag LOCUS_16660 4532 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 <5591 4832 gene locus_tag LOCUS_16670 <5591 4832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056204.1:two-component hybrid sensor and regulator >Feature sequence243 216 716 gene locus_tag LOCUS_16680 216 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 661 3816 gene locus_tag LOCUS_16690 661 3816 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140084.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence244 708 1058 gene locus_tag LOCUS_16700 708 1058 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_16700 1087 3678 gene locus_tag LOCUS_16710 1087 3678 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_16710 5428 3824 gene locus_tag LOCUS_16720 5428 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence245 41 505 gene locus_tag LOCUS_16730 41 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1105 701 gene locus_tag LOCUS_16740 1105 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1343 2650 gene locus_tag LOCUS_16750 1343 2650 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_16750 4122 2863 gene locus_tag LOCUS_16760 4122 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 4544 4152 gene locus_tag LOCUS_16770 4544 4152 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_769503.2 protein_id gnl|my_center|LOCUS_16770 <5549 4662 gene locus_tag LOCUS_16780 <5549 4662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085646.1:ATPase >Feature sequence246 186 953 gene locus_tag LOCUS_16790 186 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1057 2007 gene locus_tag LOCUS_16800 1057 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2294 2875 gene locus_tag LOCUS_16810 2294 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3476 2967 gene locus_tag LOCUS_16820 3476 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4057 3602 gene locus_tag LOCUS_16830 4057 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 5026 4127 gene locus_tag LOCUS_16840 5026 4127 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence247 <1 1292 gene locus_tag LOCUS_16850 <1 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKU2:glycogen synthase 1428 1991 gene locus_tag LOCUS_16860 1428 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_16860 4792 2009 gene locus_tag LOCUS_16870 4792 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 5539 4895 gene locus_tag LOCUS_16880 gene fabG 5539 4895 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence248 2335 659 gene locus_tag LOCUS_16890 gene mutL 2335 659 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058297.1 protein_id gnl|my_center|LOCUS_16890 2450 3184 gene locus_tag LOCUS_16900 2450 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143821.1 protein_id gnl|my_center|LOCUS_16900 3384 3653 gene locus_tag LOCUS_16910 3384 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056004.1 protein_id gnl|my_center|LOCUS_16910 3804 4490 gene locus_tag LOCUS_16920 3804 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141964.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence249 2 403 gene locus_tag LOCUS_16930 2 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 632 1087 gene locus_tag LOCUS_16940 632 1087 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143783.1 protein_id gnl|my_center|LOCUS_16940 1367 2200 gene locus_tag LOCUS_16950 1367 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2903 2259 gene locus_tag LOCUS_16960 2903 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 4322 3444 gene locus_tag LOCUS_16970 4322 3444 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057510.1 protein_id gnl|my_center|LOCUS_16970 5038 4358 gene locus_tag LOCUS_16980 gene queC 5038 4358 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI59 protein_id gnl|my_center|LOCUS_16980 >Feature sequence250 3981 268 gene locus_tag LOCUS_16990 gene cobN 3981 268 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056744.1 protein_id gnl|my_center|LOCUS_16990 4286 4068 gene locus_tag LOCUS_17000 4286 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057485.1 protein_id gnl|my_center|LOCUS_17000 <5490 4371 gene locus_tag LOCUS_17010 <5490 4371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479510.1:mechanosensitive ion channel protein MscS >Feature sequence251 <1 880 gene locus_tag LOCUS_17020 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003732470.1:iron ABC transporter permease 1066 1641 gene locus_tag LOCUS_17030 1066 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142405.1 protein_id gnl|my_center|LOCUS_17030 1654 2439 gene locus_tag LOCUS_17040 gene yfmF 1654 2439 CDS product Fe(3+)-citrate import ATP-binding protein YfmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34510 protein_id gnl|my_center|LOCUS_17040 2638 2859 gene locus_tag LOCUS_17050 gene ftrV 2638 2859 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057357.1 protein_id gnl|my_center|LOCUS_17050 4773 3151 gene locus_tag LOCUS_17060 gene groL 4773 3151 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD4 protein_id gnl|my_center|LOCUS_17060 5154 4843 gene locus_tag LOCUS_17070 gene groS 5154 4843 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A347 protein_id gnl|my_center|LOCUS_17070 >Feature sequence252 553 2721 gene locus_tag LOCUS_17080 553 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3389 3790 gene locus_tag LOCUS_17090 3389 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence253 207 878 gene locus_tag LOCUS_17100 207 878 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058255.1 protein_id gnl|my_center|LOCUS_17100 1185 2807 gene locus_tag LOCUS_17110 gene prfC 1185 2807 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGV7 protein_id gnl|my_center|LOCUS_17110 3970 2936 gene locus_tag LOCUS_17120 gene cobW 3970 2936 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057463.1 protein_id gnl|my_center|LOCUS_17120 4806 4159 gene locus_tag LOCUS_17130 gene hupE 4806 4159 CDS product hydantoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124210.1 protein_id gnl|my_center|LOCUS_17130 5274 5203 gene locus_tag LOCUS_t00150 5274 5203 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence254 587 1900 gene locus_tag LOCUS_17140 587 1900 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 protein_id gnl|my_center|LOCUS_17140 2540 2043 gene locus_tag LOCUS_17150 2540 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 3257 2727 gene locus_tag LOCUS_17160 gene cysC 3257 2727 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56861 protein_id gnl|my_center|LOCUS_17160 3923 3492 gene locus_tag LOCUS_17170 3923 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 5348 3930 gene locus_tag LOCUS_17180 5348 3930 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence255 <1 700 gene locus_tag LOCUS_17190 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34903:putative transcriptional regulatory protein YkoG 767 1825 gene locus_tag LOCUS_17200 gene thiE 767 1825 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHK2 protein_id gnl|my_center|LOCUS_17200 2000 2221 gene locus_tag LOCUS_17210 gene ycf40 2000 2221 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056654.1 protein_id gnl|my_center|LOCUS_17210 2689 3633 gene locus_tag LOCUS_17220 2689 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057334.1 protein_id gnl|my_center|LOCUS_17220 3952 5184 gene locus_tag LOCUS_17230 3952 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence256 2 322 gene locus_tag LOCUS_17240 2 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1263 451 gene locus_tag LOCUS_17250 1263 451 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957681.1 protein_id gnl|my_center|LOCUS_17250 3769 1493 gene locus_tag LOCUS_17260 3769 1493 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058113.1 protein_id gnl|my_center|LOCUS_17260 4705 3935 gene locus_tag LOCUS_17270 4705 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence257 715 464 gene locus_tag LOCUS_17280 715 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1013 3223 gene locus_tag LOCUS_17290 1013 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056928.1 protein_id gnl|my_center|LOCUS_17290 4220 3483 gene locus_tag LOCUS_17300 gene ho2 4220 3483 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057558.1 protein_id gnl|my_center|LOCUS_17300 4493 4278 gene locus_tag LOCUS_17310 4493 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 5202 4987 gene locus_tag LOCUS_17320 5202 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence258 406 1302 gene locus_tag LOCUS_17330 406 1302 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086032.1 protein_id gnl|my_center|LOCUS_17330 1387 2142 gene locus_tag LOCUS_17340 1387 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963188.1 protein_id gnl|my_center|LOCUS_17340 2310 2534 gene locus_tag LOCUS_17350 2310 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 2561 2842 gene locus_tag LOCUS_17360 2561 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2891 3154 gene locus_tag LOCUS_17370 2891 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3206 4636 gene locus_tag LOCUS_17380 3206 4636 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963189.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence259 2 1366 gene locus_tag LOCUS_17390 2 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 4047 1447 gene locus_tag LOCUS_17400 4047 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 4917 4324 gene locus_tag LOCUS_17410 4917 4324 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144254.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence260 1605 583 gene locus_tag LOCUS_17420 gene purM 1605 583 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY2 protein_id gnl|my_center|LOCUS_17420 1750 2193 gene locus_tag LOCUS_17430 1750 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056063.1 protein_id gnl|my_center|LOCUS_17430 2458 2841 gene locus_tag LOCUS_17440 2458 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 3958 3005 gene locus_tag LOCUS_17450 gene ispE 3958 3005 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ1 protein_id gnl|my_center|LOCUS_17450 4788 3967 gene locus_tag LOCUS_17460 gene rsmA 4788 3967 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59157 protein_id gnl|my_center|LOCUS_17460 >Feature sequence261 410 24 gene locus_tag LOCUS_17470 410 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 515 1381 gene locus_tag LOCUS_17480 gene folD 515 1381 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMU0 protein_id gnl|my_center|LOCUS_17480 3795 1618 gene locus_tag LOCUS_17490 3795 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 4333 3836 gene locus_tag LOCUS_17500 4333 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 <5337 4522 gene locus_tag LOCUS_17510 <5337 4522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013382900.1:tRNA (methyladenosine) methyltransferase >Feature sequence262 132 965 gene locus_tag LOCUS_17520 132 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1187 1924 gene locus_tag LOCUS_17530 1187 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence263 211 780 gene locus_tag LOCUS_17540 211 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 870 1466 gene locus_tag LOCUS_17550 870 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1510 3180 gene locus_tag LOCUS_17560 gene glpA 1510 3180 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_17560 3210 3734 gene locus_tag LOCUS_17570 3210 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 3773 4591 gene locus_tag LOCUS_17580 3773 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence264 38 901 gene locus_tag LOCUS_17590 38 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141513.1 protein_id gnl|my_center|LOCUS_17590 1542 973 gene locus_tag LOCUS_17600 1542 973 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141084.1 protein_id gnl|my_center|LOCUS_17600 2040 1726 gene locus_tag LOCUS_17610 2040 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 5053 2240 gene locus_tag LOCUS_17620 5053 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence265 <1 711 gene locus_tag LOCUS_17630 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021995.1:glycogen debranching enzyme 863 1201 gene locus_tag LOCUS_17640 863 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1356 1688 gene locus_tag LOCUS_17650 gene btrV 1356 1688 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z841 protein_id gnl|my_center|LOCUS_17650 1917 1834 gene locus_tag LOCUS_t00160 1917 1834 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2771 1896 gene locus_tag LOCUS_17660 2771 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 protein_id gnl|my_center|LOCUS_17660 3350 2934 gene locus_tag LOCUS_17670 3350 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143379.1 protein_id gnl|my_center|LOCUS_17670 3776 3420 gene locus_tag LOCUS_17680 gene ycf57 3776 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056711.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence266 1353 253 gene locus_tag LOCUS_17690 1353 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056632.1 protein_id gnl|my_center|LOCUS_17690 1724 4930 gene locus_tag LOCUS_17700 1724 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence267 883 44 gene locus_tag LOCUS_17710 883 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2763 1165 gene locus_tag LOCUS_17720 2763 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 3880 2891 gene locus_tag LOCUS_17730 3880 2891 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_17730 4985 3903 gene locus_tag LOCUS_17740 4985 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057861.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence268 1710 106 gene locus_tag LOCUS_17750 1710 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 2739 2305 gene locus_tag LOCUS_17760 2739 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 2962 3318 gene locus_tag LOCUS_17770 2962 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 3383 3913 gene locus_tag LOCUS_17780 3383 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence269 73 306 gene locus_tag LOCUS_17790 73 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 1929 343 gene locus_tag LOCUS_17800 1929 343 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057298.1 protein_id gnl|my_center|LOCUS_17800 2358 2642 gene locus_tag LOCUS_17810 2358 2642 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058100.1 protein_id gnl|my_center|LOCUS_17810 2666 3754 gene locus_tag LOCUS_17820 2666 3754 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058099.1 protein_id gnl|my_center|LOCUS_17820 3914 5176 gene locus_tag LOCUS_17830 gene rfaG 3914 5176 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125976.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence270 <1 914 gene locus_tag LOCUS_17840 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P59312:N-acetyl-gamma-glutamyl-phosphate reductase 1561 1130 gene locus_tag LOCUS_17850 1561 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2079 1660 gene locus_tag LOCUS_17860 2079 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2375 2178 gene locus_tag LOCUS_17870 2375 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 3009 2707 gene locus_tag LOCUS_17880 3009 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 5201 3441 gene locus_tag LOCUS_17890 gene fusA2 5201 3441 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7H2 protein_id gnl|my_center|LOCUS_17890 >Feature sequence271 337 41 gene locus_tag LOCUS_17900 337 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 874 3999 gene locus_tag LOCUS_17910 874 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 4008 4298 gene locus_tag LOCUS_17920 4008 4298 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141676.1 protein_id gnl|my_center|LOCUS_17920 4924 4352 gene locus_tag LOCUS_17930 4924 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence272 2461 353 gene locus_tag LOCUS_17940 2461 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 3376 2816 gene locus_tag LOCUS_17950 3376 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 protein_id gnl|my_center|LOCUS_17950 4012 3428 gene locus_tag LOCUS_17960 4012 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 4429 4139 gene locus_tag LOCUS_17970 4429 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence273 2665 503 gene locus_tag LOCUS_17980 2665 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence274 2595 643 gene locus_tag LOCUS_17990 2595 643 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141921.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence275 <1 954 gene locus_tag LOCUS_18000 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q73QZ8:DNA gyrase subunit A 973 1515 gene locus_tag LOCUS_18010 973 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2398 1733 gene locus_tag LOCUS_18020 2398 1733 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140299.1 protein_id gnl|my_center|LOCUS_18020 2494 3327 gene locus_tag LOCUS_18030 2494 3327 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9Y9 protein_id gnl|my_center|LOCUS_18030 4407 3328 gene locus_tag LOCUS_18040 4407 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057888.1 protein_id gnl|my_center|LOCUS_18040 4871 4425 gene locus_tag LOCUS_18050 4871 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence276 815 279 gene locus_tag LOCUS_18060 gene cpcS 815 279 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKE7 protein_id gnl|my_center|LOCUS_18060 2878 1298 gene locus_tag LOCUS_18070 gene ndhD1 2878 1298 CDS product NAD(P)H-quinone oxidoreductase chain 4 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY0 protein_id gnl|my_center|LOCUS_18070 5051 3048 gene locus_tag LOCUS_18080 gene ndhF1 5051 3048 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056567.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence277 111 1592 gene locus_tag LOCUS_18090 111 1592 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 protein_id gnl|my_center|LOCUS_18090 1971 5021 gene locus_tag LOCUS_18100 1971 5021 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence278 2503 170 gene locus_tag LOCUS_18110 gene pcrA 2503 170 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG65 protein_id gnl|my_center|LOCUS_18110 >Feature sequence279 1742 1206 gene locus_tag LOCUS_18120 gene sodC 1742 1206 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z6P6 protein_id gnl|my_center|LOCUS_18120 2380 1844 gene locus_tag LOCUS_18130 2380 1844 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969958.1 protein_id gnl|my_center|LOCUS_18130 3985 2666 gene locus_tag LOCUS_18140 3985 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 5012 4170 gene locus_tag LOCUS_18150 gene folP 5012 4170 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ9 protein_id gnl|my_center|LOCUS_18150 >Feature sequence280 74 1753 gene locus_tag LOCUS_18160 74 1753 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_18160 1919 2467 gene locus_tag LOCUS_18170 1919 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2720 3055 gene locus_tag LOCUS_18180 2720 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 3636 3058 gene locus_tag LOCUS_18190 3636 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141116.1 protein_id gnl|my_center|LOCUS_18190 3938 4426 gene locus_tag LOCUS_18200 3938 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 4989 4540 gene locus_tag LOCUS_18210 4989 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence281 1266 3017 gene locus_tag LOCUS_18220 gene recN 1266 3017 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNY7 protein_id gnl|my_center|LOCUS_18220 >Feature sequence282 4372 167 gene locus_tag LOCUS_18230 4372 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 4881 4606 gene locus_tag LOCUS_18240 4881 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence283 >Feature sequence284 728 2731 gene locus_tag LOCUS_18250 728 2731 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259742.1 protein_id gnl|my_center|LOCUS_18250 2921 3172 gene locus_tag LOCUS_18260 2921 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 4549 3203 gene locus_tag LOCUS_18270 gene aroA 4549 3203 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY3 protein_id gnl|my_center|LOCUS_18270 >Feature sequence285 99 935 gene locus_tag LOCUS_18280 99 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 935 1936 gene locus_tag LOCUS_18290 gene fmt 935 1936 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS1 protein_id gnl|my_center|LOCUS_18290 2481 2104 gene locus_tag LOCUS_18300 2481 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143538.1 protein_id gnl|my_center|LOCUS_18300 4493 2571 gene locus_tag LOCUS_18310 4493 2571 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence286 786 1127 gene locus_tag LOCUS_18320 786 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1639 1196 gene locus_tag LOCUS_18330 1639 1196 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142874.1 protein_id gnl|my_center|LOCUS_18330 2025 1639 gene locus_tag LOCUS_18340 gene ycf35 2025 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_18340 2297 2082 gene locus_tag LOCUS_18350 2297 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057972.1 protein_id gnl|my_center|LOCUS_18350 3378 2539 gene locus_tag LOCUS_18360 3378 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 4555 3677 gene locus_tag LOCUS_18370 4555 3677 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence287 1337 3550 gene locus_tag LOCUS_18380 1337 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 protein_id gnl|my_center|LOCUS_18380 3625 4446 gene locus_tag LOCUS_18390 3625 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 <5049 4524 gene locus_tag LOCUS_18400 <5049 4524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057400.1:phytoene synthase >Feature sequence288 437 54 gene locus_tag LOCUS_18410 437 54 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSF7 protein_id gnl|my_center|LOCUS_18410 1722 586 gene locus_tag LOCUS_18420 1722 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 3696 1897 gene locus_tag LOCUS_18430 gene atsA 3696 1897 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206058.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence289 820 287 gene locus_tag LOCUS_18440 820 287 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 protein_id gnl|my_center|LOCUS_18440 1553 918 gene locus_tag LOCUS_18450 gene hisH 1553 918 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP5 protein_id gnl|my_center|LOCUS_18450 1705 2520 gene locus_tag LOCUS_18460 1705 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 2705 2995 gene locus_tag LOCUS_18470 2705 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 3136 4530 gene locus_tag LOCUS_18480 3136 4530 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142736.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence290 130 879 gene locus_tag LOCUS_18490 gene ndhK 130 879 CDS product NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ4 protein_id gnl|my_center|LOCUS_18490 872 1411 gene locus_tag LOCUS_18500 gene ndhJ 872 1411 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ01 protein_id gnl|my_center|LOCUS_18500 2136 1453 gene locus_tag LOCUS_18510 gene bioD 2136 1453 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB5 protein_id gnl|my_center|LOCUS_18510 2442 2370 gene locus_tag LOCUS_t00170 2442 2370 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2723 2517 gene locus_tag LOCUS_18520 2723 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 3588 2821 gene locus_tag LOCUS_18530 gene hisF 3588 2821 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN7 protein_id gnl|my_center|LOCUS_18530 3731 4834 gene locus_tag LOCUS_18540 gene aroB 3731 4834 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS3 protein_id gnl|my_center|LOCUS_18540 >Feature sequence291 117 1070 gene locus_tag LOCUS_18550 117 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_18550 1289 2029 gene locus_tag LOCUS_18560 gene sfsA 1289 2029 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJU8 protein_id gnl|my_center|LOCUS_18560 3797 2076 gene locus_tag LOCUS_18570 3797 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 4463 3972 gene locus_tag LOCUS_18580 4463 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence292 962 1049 gene locus_tag LOCUS_t00180 962 1049 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1450 1052 gene locus_tag LOCUS_18590 1450 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1577 2191 gene locus_tag LOCUS_18600 1577 2191 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057261.1 protein_id gnl|my_center|LOCUS_18600 2243 2674 gene locus_tag LOCUS_18610 2243 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140148.1 protein_id gnl|my_center|LOCUS_18610 4826 2781 gene locus_tag LOCUS_18620 4826 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 >Feature sequence293 2080 866 gene locus_tag LOCUS_18630 gene pilC 2080 866 CDS product pilus biosynthesis protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_18630 3266 2160 gene locus_tag LOCUS_18640 gene pilT 3266 2160 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_18640 4910 3396 gene locus_tag LOCUS_18650 4910 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence294 396 157 gene locus_tag LOCUS_18660 396 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 1364 504 gene locus_tag LOCUS_18670 1364 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279526.1 protein_id gnl|my_center|LOCUS_18670 1571 1437 gene locus_tag LOCUS_18680 1571 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 4540 1925 gene locus_tag LOCUS_18690 4540 1925 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144168.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence295 1634 1188 gene locus_tag LOCUS_18700 1634 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2251 1859 gene locus_tag LOCUS_18710 2251 1859 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_18710 3162 2269 gene locus_tag LOCUS_18720 3162 2269 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143200.1 protein_id gnl|my_center|LOCUS_18720 <4899 3438 gene locus_tag LOCUS_18730 <4899 3438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DK65:glutamyl-tRNA(Gln) amidotransferase subunit A >Feature sequence296 161 856 gene locus_tag LOCUS_18740 161 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1571 885 gene locus_tag LOCUS_18750 1571 885 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407919.1 protein_id gnl|my_center|LOCUS_18750 1929 1711 gene locus_tag LOCUS_18760 1929 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2833 1970 gene locus_tag LOCUS_18770 2833 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4180 2957 gene locus_tag LOCUS_18780 gene trpB 4180 2957 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG49 protein_id gnl|my_center|LOCUS_18780 4233 4583 gene locus_tag LOCUS_18790 4233 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence297 2400 376 gene locus_tag LOCUS_18800 2400 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3865 2546 gene locus_tag LOCUS_18810 3865 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4412 4708 gene locus_tag LOCUS_18820 4412 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence298 <1 1536 gene locus_tag LOCUS_18830 <1 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037121.1:sensor histidine kinase 2468 1593 gene locus_tag LOCUS_18840 2468 1593 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815017.1 protein_id gnl|my_center|LOCUS_18840 4270 2636 gene locus_tag LOCUS_18850 4270 2636 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222804.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence299 287 90 gene locus_tag LOCUS_18860 287 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 584 387 gene locus_tag LOCUS_18870 584 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1019 1492 gene locus_tag LOCUS_18880 1019 1492 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK86 protein_id gnl|my_center|LOCUS_18880 3819 1546 gene locus_tag LOCUS_18890 3819 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 4389 3925 gene locus_tag LOCUS_18900 4389 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 4747 4445 gene locus_tag LOCUS_18910 4747 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence300 541 347 gene locus_tag LOCUS_18920 541 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2582 600 gene locus_tag LOCUS_18930 gene ftsH 2582 600 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW1 protein_id gnl|my_center|LOCUS_18930 2847 4772 gene locus_tag LOCUS_18940 2847 4772 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence301 1411 20 gene locus_tag LOCUS_18950 1411 20 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM2 protein_id gnl|my_center|LOCUS_18950 1711 2064 gene locus_tag LOCUS_18960 1711 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 2576 2818 gene locus_tag LOCUS_18970 2576 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2970 4451 gene locus_tag LOCUS_18980 2970 4451 CDS product lignostilbene alpha-beta-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055870.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence302 2716 2024 gene locus_tag LOCUS_18990 2716 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 3174 4523 gene locus_tag LOCUS_19000 3174 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence303 3624 1855 gene locus_tag LOCUS_19010 3624 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence304 <1 1048 gene locus_tag LOCUS_19020 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NMM5:cytochrome c oxidase subunit 1 1145 1756 gene locus_tag LOCUS_19030 gene ctaE 1145 1756 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 protein_id gnl|my_center|LOCUS_19030 1777 3759 gene locus_tag LOCUS_19040 1777 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence305 2241 1477 gene locus_tag LOCUS_19050 2241 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058125.1 protein_id gnl|my_center|LOCUS_19050 2621 2388 gene locus_tag LOCUS_19060 gene secG 2621 2388 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 protein_id gnl|my_center|LOCUS_19060 4604 3030 gene locus_tag LOCUS_19070 4604 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence306 1476 358 gene locus_tag LOCUS_19080 gene ndhA 1476 358 CDS product NAD(P)H-quinone oxidoreductase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL32 protein_id gnl|my_center|LOCUS_19080 1729 2238 gene locus_tag LOCUS_19090 1729 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 3771 2440 gene locus_tag LOCUS_19100 gene gdhA 3771 2440 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P03 protein_id gnl|my_center|LOCUS_19100 4607 4044 gene locus_tag LOCUS_19110 4607 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence307 119 1045 gene locus_tag LOCUS_19120 119 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057438.1 protein_id gnl|my_center|LOCUS_19120 4403 1152 gene locus_tag LOCUS_19130 gene pyrA 4403 1152 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI5 protein_id gnl|my_center|LOCUS_19130 >Feature sequence308 174 863 gene locus_tag LOCUS_19140 gene nanE 174 863 CDS product putative N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGQ5 protein_id gnl|my_center|LOCUS_19140 2112 937 gene locus_tag LOCUS_19150 gene tlpB 2112 937 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861290.1 protein_id gnl|my_center|LOCUS_19150 2165 2347 gene locus_tag LOCUS_19160 2165 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 3389 2424 gene locus_tag LOCUS_19170 3389 2424 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986927.1 protein_id gnl|my_center|LOCUS_19170 3559 4350 gene locus_tag LOCUS_19180 3559 4350 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence309 <1 939 gene locus_tag LOCUS_19190 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NMD1:cryptochrome DASH 1324 4302 gene locus_tag LOCUS_19200 gene putA 1324 4302 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056271.1 protein_id gnl|my_center|LOCUS_19200 4699 4565 gene locus_tag LOCUS_19210 4699 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence310 1394 1104 gene locus_tag LOCUS_19220 gene yczJ 1394 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31484 protein_id gnl|my_center|LOCUS_19220 1594 2502 gene locus_tag LOCUS_19230 1594 2502 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057233.1 protein_id gnl|my_center|LOCUS_19230 2626 3177 gene locus_tag LOCUS_19240 2626 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_19240 3985 3239 gene locus_tag LOCUS_19250 3985 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883059.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence311 402 2246 gene locus_tag LOCUS_19260 402 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19260 2552 3232 gene locus_tag LOCUS_19270 gene aqpZ 2552 3232 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719935.1 protein_id gnl|my_center|LOCUS_19270 3946 3281 gene locus_tag LOCUS_19280 gene tmk 3946 3281 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHA4 protein_id gnl|my_center|LOCUS_19280 >Feature sequence312 1501 1190 gene locus_tag LOCUS_19290 1501 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 1710 2675 gene locus_tag LOCUS_19300 1710 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2746 3735 gene locus_tag LOCUS_19310 2746 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence313 22 315 gene locus_tag LOCUS_19320 gene petF1 22 315 CDS product ferredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3C9 protein_id gnl|my_center|LOCUS_19320 1107 2642 gene locus_tag LOCUS_19330 1107 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2647 3813 gene locus_tag LOCUS_19340 2647 3813 CDS product NDP-hexose methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975523.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence314 1296 151 gene locus_tag LOCUS_19350 1296 151 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056586.1 protein_id gnl|my_center|LOCUS_19350 1806 2588 gene locus_tag LOCUS_19360 1806 2588 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141348.1 protein_id gnl|my_center|LOCUS_19360 2624 4354 gene locus_tag LOCUS_19370 2624 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence315 59 1432 gene locus_tag LOCUS_19380 59 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 3254 1767 gene locus_tag LOCUS_19390 gene gatB 3254 1767 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC4 protein_id gnl|my_center|LOCUS_19390 3435 4556 gene locus_tag LOCUS_19400 3435 4556 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058231.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence316 721 2556 gene locus_tag LOCUS_19410 721 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 3424 2786 gene locus_tag LOCUS_19420 3424 2786 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404693.1 protein_id gnl|my_center|LOCUS_19420 4543 3431 gene locus_tag LOCUS_19430 gene prfA 4543 3431 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMG9 protein_id gnl|my_center|LOCUS_19430 >Feature sequence317 1125 28 gene locus_tag LOCUS_19440 gene tgt 1125 28 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM7 protein_id gnl|my_center|LOCUS_19440 1698 1249 gene locus_tag LOCUS_19450 1698 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140803.1 protein_id gnl|my_center|LOCUS_19450 2008 2775 gene locus_tag LOCUS_19460 gene cobS 2008 2775 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ91 protein_id gnl|my_center|LOCUS_19460 3123 3695 gene locus_tag LOCUS_19470 3123 3695 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHZ6 protein_id gnl|my_center|LOCUS_19470 4273 3935 gene locus_tag LOCUS_19480 gene glnB 4273 3935 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence318 2 1039 gene locus_tag LOCUS_19490 2 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1379 1044 gene locus_tag LOCUS_19500 1379 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 1678 2310 gene locus_tag LOCUS_19510 1678 2310 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140352.1 protein_id gnl|my_center|LOCUS_19510 3945 2932 gene locus_tag LOCUS_19520 3945 2932 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144236.1 protein_id gnl|my_center|LOCUS_19520 <4586 4008 gene locus_tag LOCUS_19530 <4586 4008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:peptide transporter >Feature sequence319 1276 308 gene locus_tag LOCUS_19540 1276 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2270 1482 gene locus_tag LOCUS_19550 2270 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 3358 2555 gene locus_tag LOCUS_19560 3358 2555 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056948.1 protein_id gnl|my_center|LOCUS_19560 4388 3594 gene locus_tag LOCUS_19570 4388 3594 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 protein_id gnl|my_center|LOCUS_19570 4534 4462 gene locus_tag LOCUS_t00190 4534 4462 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence320 2 1792 gene locus_tag LOCUS_19580 2 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2978 1914 gene locus_tag LOCUS_19590 2978 1914 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140935.1 protein_id gnl|my_center|LOCUS_19590 3245 3724 gene locus_tag LOCUS_19600 gene recR 3245 3724 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGV8 protein_id gnl|my_center|LOCUS_19600 4415 4071 gene locus_tag LOCUS_19610 4415 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence321 164 30 gene locus_tag LOCUS_19620 164 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 468 142 gene locus_tag LOCUS_19630 468 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 958 2448 gene locus_tag LOCUS_19640 958 2448 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073422.1 protein_id gnl|my_center|LOCUS_19640 3895 2498 gene locus_tag LOCUS_19650 3895 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence322 1422 496 gene locus_tag LOCUS_19660 1422 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 1657 1947 gene locus_tag LOCUS_19670 1657 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 1935 2270 gene locus_tag LOCUS_19680 1935 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2332 4242 gene locus_tag LOCUS_19690 2332 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence323 <1 1219 gene locus_tag LOCUS_19700 <1 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393971.1:PAS domain-containing sensor histidine kinase 1237 2316 gene locus_tag LOCUS_19710 1237 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143082.1 protein_id gnl|my_center|LOCUS_19710 2972 2445 gene locus_tag LOCUS_19720 2972 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056576.1 protein_id gnl|my_center|LOCUS_19720 4306 3611 gene locus_tag LOCUS_19730 4306 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence324 550 996 gene locus_tag LOCUS_19740 550 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2760 1102 gene locus_tag LOCUS_19750 2760 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 4372 3164 gene locus_tag LOCUS_19760 4372 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence325 893 270 gene locus_tag LOCUS_19770 893 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 2344 1265 gene locus_tag LOCUS_19780 2344 1265 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_19780 2859 2587 gene locus_tag LOCUS_19790 2859 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143502.1 protein_id gnl|my_center|LOCUS_19790 3346 2861 gene locus_tag LOCUS_19800 gene dnaJ 3346 2861 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055973.1 protein_id gnl|my_center|LOCUS_19800 3998 3588 gene locus_tag LOCUS_19810 3998 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 <4514 4008 gene locus_tag LOCUS_19820 <4514 4008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256901.1:stage II sporulation protein E >Feature sequence326 492 220 gene locus_tag LOCUS_19830 492 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 754 1047 gene locus_tag LOCUS_19840 754 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125696.1 protein_id gnl|my_center|LOCUS_19840 3556 1136 gene locus_tag LOCUS_19850 3556 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 4401 3637 gene locus_tag LOCUS_19860 4401 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence327 1175 1540 gene locus_tag LOCUS_19870 1175 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2879 1653 gene locus_tag LOCUS_19880 2879 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 3326 3820 gene locus_tag LOCUS_19890 3326 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4251 3835 gene locus_tag LOCUS_19900 4251 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence328 <1 1243 gene locus_tag LOCUS_19910 <1 1243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DIL8:ribosomal protein S12 methylthiotransferase RimO 1388 2788 gene locus_tag LOCUS_19920 gene cshA 1388 2788 CDS product DEAD-box ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHF7 protein_id gnl|my_center|LOCUS_19920 2926 4041 gene locus_tag LOCUS_19930 gene thrC 2926 4041 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJJ6 protein_id gnl|my_center|LOCUS_19930 >Feature sequence329 1155 64 gene locus_tag LOCUS_19940 1155 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 3856 1466 gene locus_tag LOCUS_19950 3856 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence330 <1 1683 gene locus_tag LOCUS_19960 <1 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118589.1:alkaline phosphatase 2751 1927 gene locus_tag LOCUS_19970 2751 1927 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_19970 4348 2924 gene locus_tag LOCUS_19980 4348 2924 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141482.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence331 648 1226 gene locus_tag LOCUS_19990 648 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1263 2222 gene locus_tag LOCUS_20000 1263 2222 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141897.1 protein_id gnl|my_center|LOCUS_20000 2338 3207 gene locus_tag LOCUS_20010 2338 3207 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141897.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence332 474 980 gene locus_tag LOCUS_20020 gene ycf51 474 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056935.1 protein_id gnl|my_center|LOCUS_20020 1151 1792 gene locus_tag LOCUS_20030 1151 1792 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976220.1 protein_id gnl|my_center|LOCUS_20030 <4449 1835 gene locus_tag LOCUS_20040 <4449 1835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110104.1:non-ribosomal peptide synthetase >Feature sequence333 3361 3149 gene locus_tag LOCUS_20050 3361 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence334 1649 438 gene locus_tag LOCUS_20060 1649 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 1839 2435 gene locus_tag LOCUS_20070 gene cpcT 1839 2435 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH04 protein_id gnl|my_center|LOCUS_20070 2758 2934 gene locus_tag LOCUS_20080 2758 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 3617 2991 gene locus_tag LOCUS_20090 3617 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence335 637 759 gene locus_tag LOCUS_20100 637 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 1345 968 gene locus_tag LOCUS_20110 1345 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 1883 3160 gene locus_tag LOCUS_20120 gene ahcY 1883 3160 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC8 protein_id gnl|my_center|LOCUS_20120 3663 3328 gene locus_tag LOCUS_20130 3663 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 4396 3734 gene locus_tag LOCUS_20140 4396 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056016.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence336 261 1922 gene locus_tag LOCUS_20150 gene ribA 261 1922 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI64 protein_id gnl|my_center|LOCUS_20150 3167 2043 gene locus_tag LOCUS_20160 3167 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730934.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence337 2192 363 gene locus_tag LOCUS_20170 2192 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 3792 2239 gene locus_tag LOCUS_20180 3792 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 <4384 3885 gene locus_tag LOCUS_20190 <4384 3885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262523.1:cytochrome-c peroxidase >Feature sequence338 1504 620 gene locus_tag LOCUS_20200 1504 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3176 1836 gene locus_tag LOCUS_20210 3176 1836 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence339 <1 836 gene locus_tag LOCUS_20220 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9W9Q2:proline--tRNA ligase 939 1634 gene locus_tag LOCUS_20230 gene fabG 939 1634 CDS product 3-oxoacyl-(ACP) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144338.1 protein_id gnl|my_center|LOCUS_20230 2474 1656 gene locus_tag LOCUS_20240 2474 1656 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528620.1 protein_id gnl|my_center|LOCUS_20240 2934 2566 gene locus_tag LOCUS_20250 2934 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2987 3271 gene locus_tag LOCUS_20260 2987 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 3724 3308 gene locus_tag LOCUS_20270 3724 3308 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057301.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence340 1867 1034 gene locus_tag LOCUS_20280 gene lgt 1867 1034 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH03 protein_id gnl|my_center|LOCUS_20280 2194 3261 gene locus_tag LOCUS_20290 gene rlmN 2194 3261 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG98 protein_id gnl|my_center|LOCUS_20290 4224 4036 gene locus_tag LOCUS_20300 4224 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence341 1467 2105 gene locus_tag LOCUS_20310 1467 2105 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_20310 3429 2632 gene locus_tag LOCUS_20320 3429 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence342 31 183 gene locus_tag LOCUS_20330 31 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 1027 275 gene locus_tag LOCUS_20340 1027 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056083.1 protein_id gnl|my_center|LOCUS_20340 3484 1037 gene locus_tag LOCUS_20350 3484 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence343 331 2343 gene locus_tag LOCUS_20360 331 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 3930 2410 gene locus_tag LOCUS_20370 gene trpE 3930 2410 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057509.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence344 <1 1414 gene locus_tag LOCUS_20380 <1 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056499.1:ribonuclease 1998 1576 gene locus_tag LOCUS_20390 1998 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056733.1 protein_id gnl|my_center|LOCUS_20390 2933 2202 gene locus_tag LOCUS_20400 2933 2202 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056716.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence345 <1 3485 gene locus_tag LOCUS_20410 <1 3485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142743.1:two-component hybrid sensor and regulator <4231 3534 gene locus_tag LOCUS_20420 <4231 3534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000817269.1:transposase >Feature sequence346 511 2565 gene locus_tag LOCUS_20430 511 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 3202 2573 gene locus_tag LOCUS_20440 3202 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 <4229 3351 gene locus_tag LOCUS_20450 <4229 3351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055863.1:PIN/TRAM domain-containing protein >Feature sequence347 1727 513 gene locus_tag LOCUS_20460 1727 513 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_20460 3561 1813 gene locus_tag LOCUS_20470 3561 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 4221 3706 gene locus_tag LOCUS_20480 4221 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence348 1594 1049 gene locus_tag LOCUS_20490 1594 1049 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056784.1 protein_id gnl|my_center|LOCUS_20490 2354 1608 gene locus_tag LOCUS_20500 2354 1608 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056783.1 protein_id gnl|my_center|LOCUS_20500 3450 2407 gene locus_tag LOCUS_20510 3450 2407 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056782.1 protein_id gnl|my_center|LOCUS_20510 3681 3842 gene locus_tag LOCUS_20520 3681 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence349 88 402 gene locus_tag LOCUS_20530 88 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056366.1 protein_id gnl|my_center|LOCUS_20530 1619 648 gene locus_tag LOCUS_20540 gene sds 1619 648 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_20540 3643 2774 gene locus_tag LOCUS_20550 gene murI 3643 2774 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM3 protein_id gnl|my_center|LOCUS_20550 >Feature sequence350 879 1931 gene locus_tag LOCUS_20560 gene mnmA 879 1931 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM0 protein_id gnl|my_center|LOCUS_20560 2473 2069 gene locus_tag LOCUS_20570 2473 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 3111 2491 gene locus_tag LOCUS_20580 3111 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 4141 3056 gene locus_tag LOCUS_20590 4141 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence351 1050 526 gene locus_tag LOCUS_20600 1050 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057704.1 protein_id gnl|my_center|LOCUS_20600 1990 1193 gene locus_tag LOCUS_20610 gene surE 1990 1193 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI06 protein_id gnl|my_center|LOCUS_20610 2145 3146 gene locus_tag LOCUS_20620 gene pheS 2145 3146 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL09 protein_id gnl|my_center|LOCUS_20620 3320 3646 gene locus_tag LOCUS_20630 3320 3646 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLS3 protein_id gnl|my_center|LOCUS_20630 >Feature sequence352 110 982 gene locus_tag LOCUS_20640 gene mtnP 110 982 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE4 protein_id gnl|my_center|LOCUS_20640 1130 1462 gene locus_tag LOCUS_20650 1130 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1707 2201 gene locus_tag LOCUS_20660 1707 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 3515 2202 gene locus_tag LOCUS_20670 3515 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001446739.1 protein_id gnl|my_center|LOCUS_20670 4051 3572 gene locus_tag LOCUS_20680 4051 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence353 <1 630 gene locus_tag LOCUS_20690 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056432.1:GTP pyrophosphokinase 1009 782 gene locus_tag LOCUS_20700 1009 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 1280 1666 gene locus_tag LOCUS_20710 1280 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140108.1 protein_id gnl|my_center|LOCUS_20710 2200 1739 gene locus_tag LOCUS_20720 2200 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2364 3449 gene locus_tag LOCUS_20730 gene purK 2364 3449 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJG7 protein_id gnl|my_center|LOCUS_20730 >Feature sequence354 244 1101 gene locus_tag LOCUS_20740 244 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2999 1098 gene locus_tag LOCUS_20750 gene sir 2999 1098 CDS product sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056194.1 protein_id gnl|my_center|LOCUS_20750 3839 3171 gene locus_tag LOCUS_20760 gene hypB 3839 3171 CDS product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_20760 4134 3850 gene locus_tag LOCUS_20770 4134 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 >Feature sequence355 <1 1338 gene locus_tag LOCUS_20780 <1 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056298.1:serine/threonine protein kinase 2425 1547 gene locus_tag LOCUS_20790 2425 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057174.1 protein_id gnl|my_center|LOCUS_20790 2888 2700 gene locus_tag LOCUS_20800 2888 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 3450 3902 gene locus_tag LOCUS_20810 3450 3902 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057352.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence356 841 254 gene locus_tag LOCUS_20820 841 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1165 2244 gene locus_tag LOCUS_20830 1165 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2906 3649 gene locus_tag LOCUS_20840 2906 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 4102 3638 gene locus_tag LOCUS_20850 4102 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence357 867 292 gene locus_tag LOCUS_20860 867 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_20860 2102 978 gene locus_tag LOCUS_20870 2102 978 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258191.1 protein_id gnl|my_center|LOCUS_20870 <4105 2431 gene locus_tag LOCUS_20880 <4105 2431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGP1:pyruvate kinase >Feature sequence358 <1 2287 gene locus_tag LOCUS_20890 <1 2287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140166.1:penicillin-binding protein 2301 2819 gene locus_tag LOCUS_20900 2301 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 <4100 2904 gene locus_tag LOCUS_20910 <4100 2904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DK04:translation initiation factor IF-2 >Feature sequence359 647 1258 gene locus_tag LOCUS_20920 647 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 1401 2270 gene locus_tag LOCUS_20930 1401 2270 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143200.1 protein_id gnl|my_center|LOCUS_20930 <4067 2747 gene locus_tag LOCUS_20940 <4067 2747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLZ2:phosphomethylpyrimidine synthase >Feature sequence360 46 255 gene locus_tag LOCUS_20950 46 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 304 1788 gene locus_tag LOCUS_20960 304 1788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056078.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20960 2706 1813 gene locus_tag LOCUS_20970 2706 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 2932 3681 gene locus_tag LOCUS_20980 2932 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence361 <1 1430 gene locus_tag LOCUS_20990 <1 1430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057543.1:porin >Feature sequence362 <1 2154 gene locus_tag LOCUS_21000 <1 2154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256308.1:histidine kinase 2548 2168 gene locus_tag LOCUS_21010 2548 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2807 3763 gene locus_tag LOCUS_21020 2807 3763 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence363 2449 767 gene locus_tag LOCUS_21030 gene phnE 2449 767 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707871.1 protein_id gnl|my_center|LOCUS_21030 3702 2572 gene locus_tag LOCUS_21040 3702 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058193.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence364 <1 949 gene locus_tag LOCUS_21050 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057271.1:DNA processing protein DprA 3117 2134 gene locus_tag LOCUS_21060 3117 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 4003 3110 gene locus_tag LOCUS_21070 4003 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence365 625 326 gene locus_tag LOCUS_21080 625 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 1733 630 gene locus_tag LOCUS_21090 1733 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2405 3232 gene locus_tag LOCUS_21100 2405 3232 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGK9 protein_id gnl|my_center|LOCUS_21100 >Feature sequence366 695 156 gene locus_tag LOCUS_21110 695 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 885 703 gene locus_tag LOCUS_21120 885 703 CDS product DUF3285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057423.1 protein_id gnl|my_center|LOCUS_21120 2468 1251 gene locus_tag LOCUS_21130 gene ackA 2468 1251 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLW9 protein_id gnl|my_center|LOCUS_21130 4033 2618 gene locus_tag LOCUS_21140 4033 2618 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG50 protein_id gnl|my_center|LOCUS_21140 >Feature sequence367 1766 414 gene locus_tag LOCUS_21150 1766 414 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084306.1 protein_id gnl|my_center|LOCUS_21150 4032 1759 gene locus_tag LOCUS_21160 4032 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence368 3823 908 gene locus_tag LOCUS_21170 3823 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence369 924 115 gene locus_tag LOCUS_21180 924 115 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141338.1 protein_id gnl|my_center|LOCUS_21180 1459 1010 gene locus_tag LOCUS_21190 1459 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3106 1688 gene locus_tag LOCUS_21200 3106 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3364 3918 gene locus_tag LOCUS_21210 3364 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21210 >Feature sequence370 272 508 gene locus_tag LOCUS_21220 272 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056987.1 protein_id gnl|my_center|LOCUS_21220 993 2030 gene locus_tag LOCUS_21230 993 2030 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_21230 2181 3344 gene locus_tag LOCUS_21240 2181 3344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence371 <4007 2972 gene locus_tag LOCUS_21250 <4007 2972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975523.1:NDP-hexose methyltransferase >Feature sequence372 <1 1841 gene locus_tag LOCUS_21260 <1 1841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057710.1:iron ABC transporter substrate-binding protein 2007 2183 gene locus_tag LOCUS_21270 2007 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 3922 2279 gene locus_tag LOCUS_21280 3922 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence373 <1 933 gene locus_tag LOCUS_21290 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DIN0:serine--tRNA ligase 1233 1940 gene locus_tag LOCUS_21300 1233 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 <3976 2336 gene locus_tag LOCUS_21310 <3976 2336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057496.1:sensor histidine kinase >Feature sequence374 3328 1142 gene locus_tag LOCUS_21320 3328 1142 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056777.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence375 814 1818 gene locus_tag LOCUS_21330 814 1818 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_21330 2710 1820 gene locus_tag LOCUS_21340 2710 1820 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI21 protein_id gnl|my_center|LOCUS_21340 <3966 3007 gene locus_tag LOCUS_21350 <3966 3007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DHG3:tryptophan--tRNA ligase >Feature sequence376 <1 516 gene locus_tag LOCUS_21360 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P59109:methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO 2045 1086 gene locus_tag LOCUS_21370 2045 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2628 2221 gene locus_tag LOCUS_21380 2628 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 3856 2666 gene locus_tag LOCUS_21390 gene dxr 3856 2666 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK30 protein_id gnl|my_center|LOCUS_21390 >Feature sequence377 832 3069 gene locus_tag LOCUS_21400 gene ndh 832 3069 CDS product bifunctional NADH dehydrogenase FAD-containing subunit/selenide,water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124488.1 protein_id gnl|my_center|LOCUS_21400 3700 3071 gene locus_tag LOCUS_21410 gene ruvA 3700 3071 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence378 434 1630 gene locus_tag LOCUS_21420 434 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2141 3004 gene locus_tag LOCUS_21430 2141 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence379 <1 1141 gene locus_tag LOCUS_21440 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120474.1:hybrid sensor histidine kinase/response regulator 2132 1164 gene locus_tag LOCUS_21450 gene ycf30 2132 1164 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 protein_id gnl|my_center|LOCUS_21450 2442 3119 gene locus_tag LOCUS_21460 2442 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056001.1 protein_id gnl|my_center|LOCUS_21460 3237 3689 gene locus_tag LOCUS_21470 3237 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence380 <3930 2179 gene locus_tag LOCUS_21480 <3930 2179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056205.1:DEAD/DEAH box helicase >Feature sequence381 583 1329 gene locus_tag LOCUS_21490 583 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 2413 1754 gene locus_tag LOCUS_21500 2413 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 protein_id gnl|my_center|LOCUS_21500 2597 3229 gene locus_tag LOCUS_21510 2597 3229 CDS product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 protein_id gnl|my_center|LOCUS_21510 3907 3317 gene locus_tag LOCUS_21520 3907 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence382 2488 2907 gene locus_tag LOCUS_21530 2488 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence383 >Feature sequence384 1797 331 gene locus_tag LOCUS_21540 gene speA 1797 331 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21885 protein_id gnl|my_center|LOCUS_21540 1979 2692 gene locus_tag LOCUS_21550 1979 2692 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 protein_id gnl|my_center|LOCUS_21550 <3865 2768 gene locus_tag LOCUS_21560 <3865 2768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJN1:chaperone protein HtpG >Feature sequence385 409 924 gene locus_tag LOCUS_21570 409 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 911 2518 gene locus_tag LOCUS_21580 911 2518 CDS product putative peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702957.1 protein_id gnl|my_center|LOCUS_21580 3352 2756 gene locus_tag LOCUS_21590 3352 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence386 369 166 gene locus_tag LOCUS_21600 gene rpmI 369 166 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH01 protein_id gnl|my_center|LOCUS_21600 495 2561 gene locus_tag LOCUS_21610 495 2561 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144195.1 protein_id gnl|my_center|LOCUS_21610 <3842 2714 gene locus_tag LOCUS_21620 <3842 2714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003533497.1:multi antimicrobial extrusion protein MatE >Feature sequence387 340 2862 gene locus_tag LOCUS_21630 340 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 3007 3294 gene locus_tag LOCUS_21640 3007 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence388 772 1071 gene locus_tag LOCUS_21650 772 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 1099 2181 gene locus_tag LOCUS_21660 1099 2181 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533549.1 protein_id gnl|my_center|LOCUS_21660 2779 2192 gene locus_tag LOCUS_21670 2779 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_21670 3793 2852 gene locus_tag LOCUS_21680 gene speE 3793 2852 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Z7 protein_id gnl|my_center|LOCUS_21680 >Feature sequence389 >Feature sequence390 41 1780 gene locus_tag LOCUS_21690 41 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3742 2327 gene locus_tag LOCUS_21700 gene trpE 3742 2327 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056140.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence391 91 175 gene locus_tag LOCUS_t00200 91 175 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 235 1533 gene locus_tag LOCUS_21710 gene glcE 235 1533 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143064.1 protein_id gnl|my_center|LOCUS_21710 1630 2937 gene locus_tag LOCUS_21720 gene glcF 1630 2937 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCA7 protein_id gnl|my_center|LOCUS_21720 3164 2952 gene locus_tag LOCUS_21730 3164 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence392 325 1080 gene locus_tag LOCUS_21740 gene cobA 325 1080 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055999.1 protein_id gnl|my_center|LOCUS_21740 1900 1178 gene locus_tag LOCUS_21750 gene rph 1900 1178 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA4 protein_id gnl|my_center|LOCUS_21750 2175 2804 gene locus_tag LOCUS_21760 2175 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence393 3 3626 gene locus_tag LOCUS_21770 3 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence394 <1 1165 gene locus_tag LOCUS_21780 <1 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DMT2:adaptive-response sensory-kinase SasA 3716 1203 gene locus_tag LOCUS_21790 gene ppc 3716 1203 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X5 protein_id gnl|my_center|LOCUS_21790 >Feature sequence395 80 2638 gene locus_tag LOCUS_21800 gene gyrA 80 2638 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ59 protein_id gnl|my_center|LOCUS_21800 2722 3540 gene locus_tag LOCUS_21810 2722 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence396 3100 2558 gene locus_tag LOCUS_21820 gene cobU 3100 2558 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 protein_id gnl|my_center|LOCUS_21820 3655 3104 gene locus_tag LOCUS_21830 3655 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence397 153 19 gene locus_tag LOCUS_21840 153 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 1143 205 gene locus_tag LOCUS_21850 1143 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2834 1437 gene locus_tag LOCUS_21860 2834 1437 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058184.1 protein_id gnl|my_center|LOCUS_21860 3619 2855 gene locus_tag LOCUS_21870 gene map 3619 2855 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX4 protein_id gnl|my_center|LOCUS_21870 >Feature sequence398 2458 1487 gene locus_tag LOCUS_21880 2458 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 3665 2991 gene locus_tag LOCUS_21890 gene surE 3665 2991 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence399 2187 952 gene locus_tag LOCUS_21900 2187 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057855.1 protein_id gnl|my_center|LOCUS_21900 2296 3108 gene locus_tag LOCUS_21910 gene desC1 2296 3108 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058212.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence400 11 691 gene locus_tag LOCUS_21920 gene cysH 11 691 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK35 protein_id gnl|my_center|LOCUS_21920 1072 728 gene locus_tag LOCUS_21930 1072 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1194 3689 gene locus_tag LOCUS_21940 1194 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence401 1568 1377 gene locus_tag LOCUS_21950 1568 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 2559 1807 gene locus_tag LOCUS_21960 2559 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730049.1 protein_id gnl|my_center|LOCUS_21960 2849 3208 gene locus_tag LOCUS_21970 2849 3208 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142094.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence402 1772 267 gene locus_tag LOCUS_21980 1772 267 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH4 protein_id gnl|my_center|LOCUS_21980 3153 2299 gene locus_tag LOCUS_21990 3153 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence403 <1 1264 gene locus_tag LOCUS_22000 <1 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJS8:aspartate--tRNA(Asp/Asn) ligase 2453 1374 gene locus_tag LOCUS_22010 2453 1374 CDS product peptidase M4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022497.1 protein_id gnl|my_center|LOCUS_22010 <3711 2849 gene locus_tag LOCUS_22020 <3711 2849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141348.1:histidine kinase >Feature sequence404 2998 560 gene locus_tag LOCUS_22030 2998 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence405 <1 1508 gene locus_tag LOCUS_22040 <1 1508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385565.1:peptidyl-prolyl cis-trans isomerase 1991 1665 gene locus_tag LOCUS_22050 1991 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2550 2251 gene locus_tag LOCUS_22060 2550 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 3047 2712 gene locus_tag LOCUS_22070 3047 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence406 <1 1207 gene locus_tag LOCUS_22080 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021291.1:ATPase 2164 1307 gene locus_tag LOCUS_22090 gene nadC 2164 1307 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057550.1 protein_id gnl|my_center|LOCUS_22090 2697 3434 gene locus_tag LOCUS_22100 2697 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence407 226 1068 gene locus_tag LOCUS_22110 226 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_22110 1307 2314 gene locus_tag LOCUS_22120 1307 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 <3659 2507 gene locus_tag LOCUS_22130 <3659 2507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057446.1:carboxyl-terminal processing protease >Feature sequence408 <1 1028 gene locus_tag LOCUS_22140 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403763.1:sulfotransferase 1849 1187 gene locus_tag LOCUS_22150 1849 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056977.1 protein_id gnl|my_center|LOCUS_22150 3135 1945 gene locus_tag LOCUS_22160 gene ndbB 3135 1945 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056978.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence409 130 789 gene locus_tag LOCUS_22170 gene purN 130 789 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ1 protein_id gnl|my_center|LOCUS_22170 902 1483 gene locus_tag LOCUS_22180 902 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2354 1581 gene locus_tag LOCUS_22190 gene panB 2354 1581 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM44 protein_id gnl|my_center|LOCUS_22190 3179 2385 gene locus_tag LOCUS_22200 gene ilvE 3179 2385 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142576.1 protein_id gnl|my_center|LOCUS_22200 3560 3360 gene locus_tag LOCUS_22210 3560 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057514.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence410 <1 1081 gene locus_tag LOCUS_22220 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122885.1:alanine glycine permease 1313 1110 gene locus_tag LOCUS_22230 1313 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 <3630 1229 gene locus_tag LOCUS_22240 <3630 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WI21:putative PPE family protein PPE21 >Feature sequence411 787 194 gene locus_tag LOCUS_22250 gene tpx 787 194 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 protein_id gnl|my_center|LOCUS_22250 1181 1108 gene locus_tag LOCUS_t00210 1181 1108 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 <3625 1300 gene locus_tag LOCUS_22260 <3625 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057988.1:peptidase >Feature sequence412 <1 2344 gene locus_tag LOCUS_22270 <1 2344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058092.1:B12-binding protein >Feature sequence413 519 1301 gene locus_tag LOCUS_22280 519 1301 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222295.1 protein_id gnl|my_center|LOCUS_22280 1418 1942 gene locus_tag LOCUS_22290 1418 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2019 2960 gene locus_tag LOCUS_22300 gene murK 2019 2960 CDS product N-acetylmuramic acid/N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ML3 protein_id gnl|my_center|LOCUS_22300 3622 3011 gene locus_tag LOCUS_22310 3622 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence414 1081 110 gene locus_tag LOCUS_22320 1081 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056139.1 protein_id gnl|my_center|LOCUS_22320 1203 2060 gene locus_tag LOCUS_22330 1203 2060 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_22330 3365 2166 gene locus_tag LOCUS_22340 3365 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057862.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence415 2682 1495 gene locus_tag LOCUS_22350 2682 1495 CDS product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 protein_id gnl|my_center|LOCUS_22350 3123 2740 gene locus_tag LOCUS_22360 3123 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142480.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence416 522 25 gene locus_tag LOCUS_22370 522 25 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_22370 727 1929 gene locus_tag LOCUS_22380 727 1929 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM4 protein_id gnl|my_center|LOCUS_22380 2250 1933 gene locus_tag LOCUS_22390 2250 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2431 2868 gene locus_tag LOCUS_22400 2431 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 3473 2874 gene locus_tag LOCUS_22410 3473 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence417 180 1526 gene locus_tag LOCUS_22420 180 1526 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 protein_id gnl|my_center|LOCUS_22420 1605 2117 gene locus_tag LOCUS_22430 1605 2117 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_22430 2764 2417 gene locus_tag LOCUS_22440 2764 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 3417 2944 gene locus_tag LOCUS_22450 3417 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence418 298 948 gene locus_tag LOCUS_22460 gene plsY 298 948 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59256 protein_id gnl|my_center|LOCUS_22460 1085 2308 gene locus_tag LOCUS_22470 1085 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2361 3215 gene locus_tag LOCUS_22480 2361 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence419 1199 459 gene locus_tag LOCUS_22490 1199 459 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 protein_id gnl|my_center|LOCUS_22490 1928 1371 gene locus_tag LOCUS_22500 1928 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2177 3193 gene locus_tag LOCUS_22510 gene pyrB 2177 3193 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM4 protein_id gnl|my_center|LOCUS_22510 >Feature sequence420 1832 1425 gene locus_tag LOCUS_22520 1832 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143090.1 protein_id gnl|my_center|LOCUS_22520 <3570 2156 gene locus_tag LOCUS_22530 <3570 2156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGC6:light-independent protochlorophyllide reductase subunit B >Feature sequence421 2801 1851 gene locus_tag LOCUS_22540 2801 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence422 432 641 gene locus_tag LOCUS_22550 432 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 1720 656 gene locus_tag LOCUS_22560 gene ddl 1720 656 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH0 protein_id gnl|my_center|LOCUS_22560 2114 3328 gene locus_tag LOCUS_22570 2114 3328 CDS product glycine/betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356523.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence423 284 2173 gene locus_tag LOCUS_22580 284 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2400 3473 gene locus_tag LOCUS_22590 2400 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence424 338 424 gene locus_tag LOCUS_t00220 338 424 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 445 1278 gene locus_tag LOCUS_22600 445 1278 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057803.1 protein_id gnl|my_center|LOCUS_22600 1654 1424 gene locus_tag LOCUS_22610 1654 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2665 1754 gene locus_tag LOCUS_22620 gene APA2 2665 1754 CDS product ATP adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125113.1 protein_id gnl|my_center|LOCUS_22620 <3541 2719 gene locus_tag LOCUS_22630 <3541 2719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGW6:2-carboxy-1,4-naphthoquinone phytyltransferase >Feature sequence425 356 3181 gene locus_tag LOCUS_22640 356 3181 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142684.1 protein_id gnl|my_center|LOCUS_22640 3356 3514 gene locus_tag LOCUS_22650 3356 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence426 673 1662 gene locus_tag LOCUS_22660 673 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_22660 2235 3143 gene locus_tag LOCUS_22670 2235 3143 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence427 <1 1789 gene locus_tag LOCUS_22680 <1 1789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057025.1:penicillin-binding protein 2 2059 3462 gene locus_tag LOCUS_22690 2059 3462 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056302.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence428 342 118 gene locus_tag LOCUS_22700 342 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 965 657 gene locus_tag LOCUS_22710 965 657 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_22710 1871 1275 gene locus_tag LOCUS_22720 gene ureG 1871 1275 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ4 protein_id gnl|my_center|LOCUS_22720 2866 1868 gene locus_tag LOCUS_22730 2866 1868 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056558.1 protein_id gnl|my_center|LOCUS_22730 3492 3028 gene locus_tag LOCUS_22740 3492 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056684.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence429 2296 1619 gene locus_tag LOCUS_22750 gene ntcA 2296 1619 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057487.1 protein_id gnl|my_center|LOCUS_22750 2578 3357 gene locus_tag LOCUS_22760 2578 3357 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI97 protein_id gnl|my_center|LOCUS_22760 >Feature sequence430 947 1501 gene locus_tag LOCUS_22770 947 1501 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056346.1 protein_id gnl|my_center|LOCUS_22770 2648 2136 gene locus_tag LOCUS_22780 2648 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057414.1 protein_id gnl|my_center|LOCUS_22780 2979 2671 gene locus_tag LOCUS_22790 2979 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence431 1678 2436 gene locus_tag LOCUS_22800 1678 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence432 633 560 gene locus_tag LOCUS_t00230 633 560 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2699 810 gene locus_tag LOCUS_22810 gene putP 2699 810 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125785.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence433 74 1462 gene locus_tag LOCUS_22820 gene asnS 74 1462 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG51 protein_id gnl|my_center|LOCUS_22820 2676 1753 gene locus_tag LOCUS_22830 2676 1753 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055913.1 protein_id gnl|my_center|LOCUS_22830 3315 3097 gene locus_tag LOCUS_22840 3315 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140944.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence434 <1 1257 gene locus_tag LOCUS_22850 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057668.1:histidine kinase 1446 3095 gene locus_tag LOCUS_22860 1446 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058118.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence435 385 56 gene locus_tag LOCUS_22870 385 56 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140011.1 protein_id gnl|my_center|LOCUS_22870 1199 2341 gene locus_tag LOCUS_22880 1199 2341 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140086.1 protein_id gnl|my_center|LOCUS_22880 <3484 2579 gene locus_tag LOCUS_22890 <3484 2579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020316.1:transposase >Feature sequence436 1442 1852 gene locus_tag LOCUS_22900 1442 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3334 1889 gene locus_tag LOCUS_22910 3334 1889 CDS product regulator of sigma-B activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence437 1529 405 gene locus_tag LOCUS_22920 gene potD 1529 405 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262840.1 protein_id gnl|my_center|LOCUS_22920 1679 2620 gene locus_tag LOCUS_22930 1679 2620 CDS product alkylphosphonate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477713.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence438 59 247 gene locus_tag LOCUS_22940 59 247 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143465.1 protein_id gnl|my_center|LOCUS_22940 445 921 gene locus_tag LOCUS_22950 445 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 1216 2868 gene locus_tag LOCUS_22960 1216 2868 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence439 174 1235 gene locus_tag LOCUS_22970 174 1235 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889292.1 protein_id gnl|my_center|LOCUS_22970 1481 2524 gene locus_tag LOCUS_22980 1481 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 3313 2834 gene locus_tag LOCUS_22990 3313 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence440 <1 662 gene locus_tag LOCUS_23000 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NMR1:pyrroline-5-carboxylate reductase 771 1523 gene locus_tag LOCUS_23010 771 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 1599 2351 gene locus_tag LOCUS_23020 1599 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 protein_id gnl|my_center|LOCUS_23020 2965 2519 gene locus_tag LOCUS_23030 2965 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence441 1551 1024 gene locus_tag LOCUS_23040 1551 1024 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL5 protein_id gnl|my_center|LOCUS_23040 1673 3115 gene locus_tag LOCUS_23050 gene lysA 1673 3115 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI31 protein_id gnl|my_center|LOCUS_23050 >Feature sequence442 1432 704 gene locus_tag LOCUS_23060 1432 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence443 1295 132 gene locus_tag LOCUS_23070 1295 132 CDS product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_23070 3230 1500 gene locus_tag LOCUS_23080 gene ycf45 3230 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence444 906 724 gene locus_tag LOCUS_23090 906 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2630 1119 gene locus_tag LOCUS_23100 2630 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 <3448 2864 gene locus_tag LOCUS_23110 <3448 2864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057066.1:magnesium-transporting ATPase >Feature sequence445 194 475 gene locus_tag LOCUS_23120 194 475 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW8 protein_id gnl|my_center|LOCUS_23120 807 1193 gene locus_tag LOCUS_23130 807 1193 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence446 933 2558 gene locus_tag LOCUS_23140 933 2558 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_23140 2903 2628 gene locus_tag LOCUS_23150 2903 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence447 85 372 gene locus_tag LOCUS_23160 85 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 1088 828 gene locus_tag LOCUS_23170 1088 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 1354 1157 gene locus_tag LOCUS_23180 1354 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2497 1544 gene locus_tag LOCUS_23190 2497 1544 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261387.1 protein_id gnl|my_center|LOCUS_23190 2822 2505 gene locus_tag LOCUS_23200 2822 2505 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence448 2 1570 gene locus_tag LOCUS_23210 2 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_23210 1676 2056 gene locus_tag LOCUS_23220 1676 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 <3422 2129 gene locus_tag LOCUS_23230 <3422 2129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143057.1:cytochrome P450 >Feature sequence449 1696 476 gene locus_tag LOCUS_23240 1696 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058195.1 protein_id gnl|my_center|LOCUS_23240 2954 1917 gene locus_tag LOCUS_23250 2954 1917 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057389.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence450 <1 971 gene locus_tag LOCUS_23260 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057611.1:N-acetylmuramoyl-L-alanine amidase 1042 1257 gene locus_tag LOCUS_23270 1042 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2074 1382 gene locus_tag LOCUS_23280 2074 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2530 2192 gene locus_tag LOCUS_23290 gene glnB 2530 2192 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence451 895 2781 gene locus_tag LOCUS_23300 895 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 2771 3091 gene locus_tag LOCUS_23310 2771 3091 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2V0 protein_id gnl|my_center|LOCUS_23310 >Feature sequence452 <1 1054 gene locus_tag LOCUS_23320 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057337.1:helix-turn-helix domain-containing protein 1635 1162 gene locus_tag LOCUS_23330 1635 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_23330 3211 1721 gene locus_tag LOCUS_23340 gene murE 3211 1721 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJI4 protein_id gnl|my_center|LOCUS_23340 >Feature sequence453 <1 765 gene locus_tag LOCUS_23350 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056204.1:two-component hybrid sensor and regulator 784 1281 gene locus_tag LOCUS_23360 784 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 1418 1969 gene locus_tag LOCUS_23370 1418 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 protein_id gnl|my_center|LOCUS_23370 2110 2247 gene locus_tag LOCUS_23380 gene rpmH 2110 2247 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL94 protein_id gnl|my_center|LOCUS_23380 2847 3242 gene locus_tag LOCUS_23390 2847 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23390 >Feature sequence454 >Feature sequence455 293 1087 gene locus_tag LOCUS_23400 293 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 1338 1248 gene locus_tag LOCUS_t00240 1338 1248 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1739 2845 gene locus_tag LOCUS_23410 1739 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence456 2098 1466 gene locus_tag LOCUS_23420 2098 1466 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHQ4 protein_id gnl|my_center|LOCUS_23420 2433 3347 gene locus_tag LOCUS_23430 2433 3347 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence457 604 2733 gene locus_tag LOCUS_23440 604 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057491.1 protein_id gnl|my_center|LOCUS_23440 <3358 2822 gene locus_tag LOCUS_23450 <3358 2822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057523.1:riboflavin synthase subunit alpha >Feature sequence458 <1 1064 gene locus_tag LOCUS_23460 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJD9:NAD(P)H-quinone oxidoreductase subunit H 1629 2120 gene locus_tag LOCUS_23470 1629 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 2301 2735 gene locus_tag LOCUS_23480 2301 2735 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267849.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence459 51 272 gene locus_tag LOCUS_23490 51 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 539 1177 gene locus_tag LOCUS_23500 539 1177 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058094.1 protein_id gnl|my_center|LOCUS_23500 1539 1898 gene locus_tag LOCUS_23510 1539 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2302 2096 gene locus_tag LOCUS_23520 2302 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2652 2329 gene locus_tag LOCUS_23530 2652 2329 CDS product UPF0166 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66758 protein_id gnl|my_center|LOCUS_23530 <3344 2707 gene locus_tag LOCUS_23540 <3344 2707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392987.1:two-component sensor histidine kinase >Feature sequence460 628 227 gene locus_tag LOCUS_23550 628 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 688 1806 gene locus_tag LOCUS_23560 688 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 3106 1916 gene locus_tag LOCUS_23570 3106 1916 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024498.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence461 1448 2053 gene locus_tag LOCUS_23580 1448 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2287 2982 gene locus_tag LOCUS_23590 2287 2982 CDS product aldehyde decarbonylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB4 protein_id gnl|my_center|LOCUS_23590 >Feature sequence462 852 52 gene locus_tag LOCUS_23600 852 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 1985 849 gene locus_tag LOCUS_23610 1985 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258033.1 protein_id gnl|my_center|LOCUS_23610 2291 2001 gene locus_tag LOCUS_23620 2291 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_23620 3093 2431 gene locus_tag LOCUS_23630 3093 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence463 435 626 gene locus_tag LOCUS_23640 435 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 712 1494 gene locus_tag LOCUS_23650 712 1494 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056899.1 protein_id gnl|my_center|LOCUS_23650 1528 1800 gene locus_tag LOCUS_23660 1528 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142361.1 protein_id gnl|my_center|LOCUS_23660 1876 2793 gene locus_tag LOCUS_23670 1876 2793 CDS product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence464 938 210 gene locus_tag LOCUS_23680 938 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057518.1 protein_id gnl|my_center|LOCUS_23680 1382 1906 gene locus_tag LOCUS_23690 gene ycf52 1382 1906 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 protein_id gnl|my_center|LOCUS_23690 2103 3302 gene locus_tag LOCUS_23700 2103 3302 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057867.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence465 1652 2161 gene locus_tag LOCUS_23710 gene apcF 1652 2161 CDS product phycobilisome core component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 protein_id gnl|my_center|LOCUS_23710 3035 2274 gene locus_tag LOCUS_23720 3035 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence466 <1 846 gene locus_tag LOCUS_23730 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DIE4:porphobilinogen deaminase 1394 1080 gene locus_tag LOCUS_23740 1394 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056554.1 protein_id gnl|my_center|LOCUS_23740 1669 1412 gene locus_tag LOCUS_23750 1669 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 1947 2030 gene locus_tag LOCUS_t00250 1947 2030 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2187 2621 gene locus_tag LOCUS_23760 2187 2621 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 protein_id gnl|my_center|LOCUS_23760 2981 2706 gene locus_tag LOCUS_23770 2981 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence467 1909 1535 gene locus_tag LOCUS_23780 1909 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 2413 2117 gene locus_tag LOCUS_23790 2413 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence468 1312 3135 gene locus_tag LOCUS_23800 1312 3135 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence469 794 3139 gene locus_tag LOCUS_23810 794 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence470 986 96 gene locus_tag LOCUS_23820 gene fabD 986 96 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMS0 protein_id gnl|my_center|LOCUS_23820 2071 1067 gene locus_tag LOCUS_23830 gene fabH 2071 1067 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL4 protein_id gnl|my_center|LOCUS_23830 3152 2112 gene locus_tag LOCUS_23840 gene plsX 3152 2112 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL5 protein_id gnl|my_center|LOCUS_23840 >Feature sequence471 309 956 gene locus_tag LOCUS_23850 309 956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056125.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence472 263 1012 gene locus_tag LOCUS_23860 gene ycf23 263 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_23860 2952 1291 gene locus_tag LOCUS_23870 gene kefB 2952 1291 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399950.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence473 1252 2841 gene locus_tag LOCUS_23880 1252 2841 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056013.1 protein_id gnl|my_center|LOCUS_23880 3091 2858 gene locus_tag LOCUS_23890 3091 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence474 109 966 gene locus_tag LOCUS_23900 109 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 1940 1308 gene locus_tag LOCUS_23910 1940 1308 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141890.1 protein_id gnl|my_center|LOCUS_23910 <3274 2054 gene locus_tag LOCUS_23920 <3274 2054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056295.1:cell division protein FtsW >Feature sequence475 2351 282 gene locus_tag LOCUS_23930 2351 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 <3251 2420 gene locus_tag LOCUS_23940 <3251 2420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121339.1:leucine/isoleucine/valine-binding protein precursor >Feature sequence476 38 1948 gene locus_tag LOCUS_23950 gene rne 38 1948 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056445.1 protein_id gnl|my_center|LOCUS_23950 1963 2535 gene locus_tag LOCUS_23960 gene rnhB 1963 2535 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_23960 3148 2576 gene locus_tag LOCUS_23970 3148 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057548.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence477 2055 1081 gene locus_tag LOCUS_23980 2055 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 3014 2883 gene locus_tag LOCUS_23990 gene psbN 3014 2883 CDS product protein PsbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ42 protein_id gnl|my_center|LOCUS_23990 >Feature sequence478 >Feature sequence479 1404 2246 gene locus_tag LOCUS_24000 1404 2246 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_24000 2323 2772 gene locus_tag LOCUS_24010 2323 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence480 <1 1749 gene locus_tag LOCUS_24020 <1 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DL37:phenylalanine--tRNA ligase beta subunit 2054 3160 gene locus_tag LOCUS_24030 gene pilM 2054 3160 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058174.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence481 550 924 gene locus_tag LOCUS_24040 550 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 1204 1767 gene locus_tag LOCUS_24050 1204 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143972.1 protein_id gnl|my_center|LOCUS_24050 2893 1781 gene locus_tag LOCUS_24060 2893 1781 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140060.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence482 1030 338 gene locus_tag LOCUS_24070 1030 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2289 1384 gene locus_tag LOCUS_24080 gene uppP 2289 1384 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG92 protein_id gnl|my_center|LOCUS_24080 >Feature sequence483 1089 61 gene locus_tag LOCUS_24090 1089 61 CDS product bactoprenol glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920729.1 protein_id gnl|my_center|LOCUS_24090 3041 1323 gene locus_tag LOCUS_24100 3041 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 >Feature sequence484 1003 2436 gene locus_tag LOCUS_24110 1003 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence485 <1 701 gene locus_tag LOCUS_24120 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057103.1:DNA-binding response regulator 1293 3062 gene locus_tag LOCUS_24130 1293 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence486 1775 1062 gene locus_tag LOCUS_24140 1775 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056940.1 protein_id gnl|my_center|LOCUS_24140 2345 1941 gene locus_tag LOCUS_24150 2345 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence487 2205 1810 gene locus_tag LOCUS_24160 2205 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 <3127 2400 gene locus_tag LOCUS_24170 <3127 2400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141899.1:sulfotransferase family protein >Feature sequence488 <1 836 gene locus_tag LOCUS_24180 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RUW8:60 kDa SS-A/Ro ribonucleoprotein 1208 2926 gene locus_tag LOCUS_24190 1208 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence489 2606 1854 gene locus_tag LOCUS_24200 2606 1854 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058216.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence490 <3088 1568 gene locus_tag LOCUS_24210 <3088 1568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125969.1:amidase >Feature sequence491 <1 755 gene locus_tag LOCUS_24220 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142637.1:3'(2'),5'-bisphosphate nucleotidase CysQ 890 1519 gene locus_tag LOCUS_24230 890 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_24230 2566 1553 gene locus_tag LOCUS_24240 2566 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence492 27 1805 gene locus_tag LOCUS_24250 27 1805 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_24250 1875 2540 gene locus_tag LOCUS_24260 1875 2540 CDS product chitooligosaccharide deacetylase NodB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144237.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence493 1305 787 gene locus_tag LOCUS_24270 1305 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 1675 1460 gene locus_tag LOCUS_24280 1675 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1907 2344 gene locus_tag LOCUS_24290 1907 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125638.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence494 400 1665 gene locus_tag LOCUS_24300 400 1665 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_24300 1662 2936 gene locus_tag LOCUS_24310 1662 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence495 <1 1018 gene locus_tag LOCUS_24320 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545101.1:adenylate/guanylate cyclase domain-containing protein 2625 2062 gene locus_tag LOCUS_24330 2625 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence496 >Feature sequence497 177 249 gene locus_tag LOCUS_t00260 177 249 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 772 287 gene locus_tag LOCUS_24340 gene ispF 772 287 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC4 protein_id gnl|my_center|LOCUS_24340 833 1405 gene locus_tag LOCUS_24350 833 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 1505 2338 gene locus_tag LOCUS_24360 1505 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 2314 2949 gene locus_tag LOCUS_24370 2314 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence498 <3033 1245 gene locus_tag LOCUS_24380 <3033 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057093.1:ABC transporter ATP-binding protein >Feature sequence499 <1 778 gene locus_tag LOCUS_24390 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918387.1:ligase 766 1851 gene locus_tag LOCUS_24400 766 1851 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_24400 1870 2883 gene locus_tag LOCUS_24410 1870 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence500 1343 624 gene locus_tag LOCUS_24420 gene ho1 1343 624 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056220.1 protein_id gnl|my_center|LOCUS_24420 3007 1487 gene locus_tag LOCUS_24430 3007 1487 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_24430 >Feature sequence501 72 602 gene locus_tag LOCUS_24440 72 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 702 1310 gene locus_tag LOCUS_24450 gene trpG 702 1310 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 protein_id gnl|my_center|LOCUS_24450 1360 2133 gene locus_tag LOCUS_24460 1360 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057312.1 protein_id gnl|my_center|LOCUS_24460 2144 2389 gene locus_tag LOCUS_24470 2144 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence502 <1 2455 gene locus_tag LOCUS_24480 <1 2455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225610.1:haloperoxidase >Feature sequence503 309 16 gene locus_tag LOCUS_24490 gene petF 309 16 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143612.1 protein_id gnl|my_center|LOCUS_24490 736 1761 gene locus_tag LOCUS_24500 gene bvdR 736 1761 CDS product biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140852.1 protein_id gnl|my_center|LOCUS_24500 1843 2772 gene locus_tag LOCUS_24510 gene crtE 1843 2772 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence504 1236 325 gene locus_tag LOCUS_24520 1236 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1732 1250 gene locus_tag LOCUS_24530 1732 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2781 1819 gene locus_tag LOCUS_24540 2781 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence505 290 2560 gene locus_tag LOCUS_24550 290 2560 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RH18 protein_id gnl|my_center|LOCUS_24550 >Feature sequence506 1746 16 gene locus_tag LOCUS_24560 1746 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2980 1838 gene locus_tag LOCUS_24570 2980 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence507 110 1078 gene locus_tag LOCUS_24580 gene murB 110 1078 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV6 protein_id gnl|my_center|LOCUS_24580 1162 1506 gene locus_tag LOCUS_24590 1162 1506 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKX6 protein_id gnl|my_center|LOCUS_24590 >Feature sequence508 778 392 gene locus_tag LOCUS_24600 gene queF 778 392 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA3 protein_id gnl|my_center|LOCUS_24600 1188 793 gene locus_tag LOCUS_24610 1188 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 1590 1222 gene locus_tag LOCUS_24620 1590 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 <2970 1930 gene locus_tag LOCUS_24630 <2970 1930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140627.1:prolyl endopeptidase >Feature sequence509 <1 901 gene locus_tag LOCUS_24640 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024198.1:phycocyanobilin lyase 1563 976 gene locus_tag LOCUS_24650 1563 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_24650 2341 1733 gene locus_tag LOCUS_24660 2341 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_24660 2879 2451 gene locus_tag LOCUS_24670 2879 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence510 <2961 683 gene locus_tag LOCUS_24680 <2961 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DIA7:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence511 <1 932 gene locus_tag LOCUS_24690 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NCF5:GTP 3',8-cyclase 1671 1063 gene locus_tag LOCUS_24700 gene rpsD 1671 1063 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59134 protein_id gnl|my_center|LOCUS_24700 <2961 1767 gene locus_tag LOCUS_24710 <2961 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946526.1:alginate O-acetyltransferase >Feature sequence512 2308 488 gene locus_tag LOCUS_24720 2308 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2955 2305 gene locus_tag LOCUS_24730 2955 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence513 278 526 gene locus_tag LOCUS_24740 278 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142102.1 protein_id gnl|my_center|LOCUS_24740 2746 527 gene locus_tag LOCUS_24750 2746 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence514 <1 1335 gene locus_tag LOCUS_24760 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057654.1:monovalent cation/H+ antiporter subunit D 1308 1769 gene locus_tag LOCUS_24770 1308 1769 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057653.1 protein_id gnl|my_center|LOCUS_24770 1826 2077 gene locus_tag LOCUS_24780 1826 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 protein_id gnl|my_center|LOCUS_24780 2074 2364 gene locus_tag LOCUS_24790 2074 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057651.1 protein_id gnl|my_center|LOCUS_24790 >Feature sequence515 2 1177 gene locus_tag LOCUS_24800 2 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141501.1 protein_id gnl|my_center|LOCUS_24800 1339 2628 gene locus_tag LOCUS_24810 1339 2628 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058069.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence516 >Feature sequence517 1593 154 gene locus_tag LOCUS_24820 1593 154 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057215.1 protein_id gnl|my_center|LOCUS_24820 <2935 1892 gene locus_tag LOCUS_24830 <2935 1892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057332.1:ABC transporter ATP-binding protein >Feature sequence518 1016 1210 gene locus_tag LOCUS_24840 1016 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 1478 1639 gene locus_tag LOCUS_24850 1478 1639 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4Q8 protein_id gnl|my_center|LOCUS_24850 1640 2893 gene locus_tag LOCUS_24860 1640 2893 CDS product carbon dioxide concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence519 957 220 gene locus_tag LOCUS_24870 gene cpcG2 957 220 CDS product phycobilisome rod-core linker polypeptide CpcG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50040 protein_id gnl|my_center|LOCUS_24870 2085 1339 gene locus_tag LOCUS_24880 gene pebB 2085 1339 CDS product phycoerythrobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL65 protein_id gnl|my_center|LOCUS_24880 <2920 2228 gene locus_tag LOCUS_24890 <2920 2228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NL66:15,16-dihydrobiliverdin:ferredoxin oxidoreductase >Feature sequence520 2377 1418 gene locus_tag LOCUS_24900 2377 1418 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022960.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence521 24 506 gene locus_tag LOCUS_24910 24 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057259.1 protein_id gnl|my_center|LOCUS_24910 506 1144 gene locus_tag LOCUS_24920 506 1144 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057258.1 protein_id gnl|my_center|LOCUS_24920 1145 1927 gene locus_tag LOCUS_24930 1145 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 <2913 2099 gene locus_tag LOCUS_24940 <2913 2099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DI38:succinate dehydrogenase iron-sulfur subunit >Feature sequence522 1224 130 gene locus_tag LOCUS_24950 gene aroC 1224 130 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_24950 2028 1372 gene locus_tag LOCUS_24960 2028 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 >Feature sequence523 1142 174 gene locus_tag LOCUS_24970 1142 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056713.1 protein_id gnl|my_center|LOCUS_24970 2225 1233 gene locus_tag LOCUS_24980 gene prs 2225 1233 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN6 protein_id gnl|my_center|LOCUS_24980 2542 2880 gene locus_tag LOCUS_24990 2542 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence524 >Feature sequence525 712 188 gene locus_tag LOCUS_25000 712 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056704.1 protein_id gnl|my_center|LOCUS_25000 975 1493 gene locus_tag LOCUS_25010 975 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence526 <1 1158 gene locus_tag LOCUS_25020 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055994.1:tetracycline resistance MFS efflux pump 1256 1990 gene locus_tag LOCUS_25030 gene coaX 1256 1990 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJS3 protein_id gnl|my_center|LOCUS_25030 <2884 1995 gene locus_tag LOCUS_25040 <2884 1995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057875.1:UDP-N-acetyl glucosamine 2-epimerase >Feature sequence527 >Feature sequence528 >Feature sequence529 107 295 gene locus_tag LOCUS_25050 107 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 559 2361 gene locus_tag LOCUS_25060 559 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2528 2349 gene locus_tag LOCUS_25070 2528 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence530 825 1193 gene locus_tag LOCUS_25080 825 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 <2876 1190 gene locus_tag LOCUS_25090 <2876 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DMV6:urease subunit alpha >Feature sequence531 39 1430 gene locus_tag LOCUS_25100 39 1430 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141660.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence532 103 1113 gene locus_tag LOCUS_25110 103 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 1497 1880 gene locus_tag LOCUS_25120 1497 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056206.1 protein_id gnl|my_center|LOCUS_25120 2790 2059 gene locus_tag LOCUS_25130 2790 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 protein_id gnl|my_center|LOCUS_25130 >Feature sequence533 520 900 gene locus_tag LOCUS_25140 520 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144314.1 protein_id gnl|my_center|LOCUS_25140 940 1551 gene locus_tag LOCUS_25150 940 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144203.1 protein_id gnl|my_center|LOCUS_25150 1624 2118 gene locus_tag LOCUS_25160 1624 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2129 2506 gene locus_tag LOCUS_25170 2129 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence534 566 2569 gene locus_tag LOCUS_25180 566 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence535 1074 616 gene locus_tag LOCUS_25190 1074 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2537 1722 gene locus_tag LOCUS_25200 2537 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 >Feature sequence536 <1 628 gene locus_tag LOCUS_25210 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NP87:protoporphyrin ferrochelatase 1357 758 gene locus_tag LOCUS_25220 1357 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142405.1 protein_id gnl|my_center|LOCUS_25220 1664 1398 gene locus_tag LOCUS_25230 1664 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 1953 1615 gene locus_tag LOCUS_25240 1953 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2041 2253 gene locus_tag LOCUS_25250 2041 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence537 <1 747 gene locus_tag LOCUS_25260 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125975.1:NAD-dependent dehydratase <2829 817 gene locus_tag LOCUS_25270 <2829 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225149.1:SGNH hydrolase >Feature sequence538 349 1080 gene locus_tag LOCUS_25280 349 1080 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142663.1 protein_id gnl|my_center|LOCUS_25280 1433 2077 gene locus_tag LOCUS_25290 1433 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 protein_id gnl|my_center|LOCUS_25290 2230 2814 gene locus_tag LOCUS_25300 2230 2814 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence539 1647 460 gene locus_tag LOCUS_25310 1647 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence540 351 2078 gene locus_tag LOCUS_25320 351 2078 CDS product diflavin flavoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141773.1 protein_id gnl|my_center|LOCUS_25320 <2812 2120 gene locus_tag LOCUS_25330 <2812 2120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057494.1:inositol monophosphatase >Feature sequence541 >Feature sequence542 >Feature sequence543 <1 1038 gene locus_tag LOCUS_25340 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DHY4:UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase 2036 1185 gene locus_tag LOCUS_25350 2036 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 2448 2041 gene locus_tag LOCUS_25360 2448 2041 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL47 protein_id gnl|my_center|LOCUS_25360 >Feature sequence544 1743 1030 gene locus_tag LOCUS_25370 1743 1030 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393986.1 protein_id gnl|my_center|LOCUS_25370 1955 2653 gene locus_tag LOCUS_25380 1955 2653 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142403.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence545 949 1932 gene locus_tag LOCUS_25390 949 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 2102 2464 gene locus_tag LOCUS_25400 2102 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence546 <1 1857 gene locus_tag LOCUS_25410 <1 1857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ61:histidine kinase 1899 2408 gene locus_tag LOCUS_25420 1899 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence547 <1 516 gene locus_tag LOCUS_25430 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141189.1:bleomycin hydrolase 759 1364 gene locus_tag LOCUS_25440 gene cpeZ 759 1364 CDS product phycocyanin operon protein Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141187.1 protein_id gnl|my_center|LOCUS_25440 2445 1405 gene locus_tag LOCUS_25450 2445 1405 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence548 <1 850 gene locus_tag LOCUS_25460 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057178.1:peptidase M16 864 2369 gene locus_tag LOCUS_25470 864 2369 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence549 <1 787 gene locus_tag LOCUS_25480 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057626.1:outer membrane protein assembly factor 1014 1856 gene locus_tag LOCUS_25490 gene lpxC 1014 1856 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI02 protein_id gnl|my_center|LOCUS_25490 1898 2392 gene locus_tag LOCUS_25500 gene fabZ 1898 2392 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TV98 protein_id gnl|my_center|LOCUS_25500 >Feature sequence550 2549 264 gene locus_tag LOCUS_25510 2549 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence551 68 2683 gene locus_tag LOCUS_25520 68 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25520 >Feature sequence552 >Feature sequence553 2616 244 gene locus_tag LOCUS_25530 2616 244 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057757.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence554 628 218 gene locus_tag LOCUS_25540 628 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 1601 1044 gene locus_tag LOCUS_25550 1601 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_25550 2552 1644 gene locus_tag LOCUS_25560 2552 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence555 646 1707 gene locus_tag LOCUS_25570 646 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057198.1 protein_id gnl|my_center|LOCUS_25570 1950 2555 gene locus_tag LOCUS_25580 gene lexA 1950 2555 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VAW7 protein_id gnl|my_center|LOCUS_25580 >Feature sequence556 2505 97 gene locus_tag LOCUS_25590 2505 97 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143682.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence557 <2737 166 gene locus_tag LOCUS_25600 <2737 166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DL06:aconitate hydratase B >Feature sequence558 945 1274 gene locus_tag LOCUS_25610 945 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 2693 2097 gene locus_tag LOCUS_25620 2693 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence559 1397 555 gene locus_tag LOCUS_25630 gene menB 1397 555 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG66 protein_id gnl|my_center|LOCUS_25630 >Feature sequence560 1413 394 gene locus_tag LOCUS_25640 1413 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 1577 1410 gene locus_tag LOCUS_25650 1577 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 1806 2087 gene locus_tag LOCUS_25660 1806 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2210 2614 gene locus_tag LOCUS_25670 2210 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence561 <1 521 gene locus_tag LOCUS_25680 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141428.1:hemolysin D 601 1776 gene locus_tag LOCUS_25690 601 1776 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence562 1902 1084 gene locus_tag LOCUS_25700 1902 1084 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404883.1 protein_id gnl|my_center|LOCUS_25700 2140 2541 gene locus_tag LOCUS_25710 2140 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence563 62 730 gene locus_tag LOCUS_25720 62 730 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 protein_id gnl|my_center|LOCUS_25720 812 1363 gene locus_tag LOCUS_25730 gene cpcS 812 1363 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI91 protein_id gnl|my_center|LOCUS_25730 2144 1557 gene locus_tag LOCUS_25740 2144 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence564 47 505 gene locus_tag LOCUS_25750 gene rplI 47 505 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9J9 protein_id gnl|my_center|LOCUS_25750 1143 649 gene locus_tag LOCUS_25760 1143 649 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057216.1 protein_id gnl|my_center|LOCUS_25760 1441 2607 gene locus_tag LOCUS_25770 gene sat 1441 2607 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK26 protein_id gnl|my_center|LOCUS_25770 >Feature sequence565 1329 919 gene locus_tag LOCUS_25780 1329 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 1723 2286 gene locus_tag LOCUS_25790 1723 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2689 2369 gene locus_tag LOCUS_25800 2689 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence566 136 1287 gene locus_tag LOCUS_25810 gene dnaN 136 1287 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VEL1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence567 1357 191 gene locus_tag LOCUS_25820 1357 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2656 1661 gene locus_tag LOCUS_25830 gene gmd 2656 1661 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ72 protein_id gnl|my_center|LOCUS_25830 >Feature sequence568 138 1361 gene locus_tag LOCUS_25840 gene tufA 138 1361 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50064 protein_id gnl|my_center|LOCUS_25840 1528 1845 gene locus_tag LOCUS_25850 gene rpsJ 1528 1845 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA06 protein_id gnl|my_center|LOCUS_25850 2004 2645 gene locus_tag LOCUS_25860 2004 2645 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence569 76 2619 gene locus_tag LOCUS_25870 76 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence570 953 1210 gene locus_tag LOCUS_25880 953 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 1255 2430 gene locus_tag LOCUS_25890 1255 2430 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence571 1134 358 gene locus_tag LOCUS_25900 1134 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2342 1368 gene locus_tag LOCUS_25910 2342 1368 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140505.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence572 153 2339 gene locus_tag LOCUS_25920 153 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence573 <1 1290 gene locus_tag LOCUS_25930 <1 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061641.1:hemolysin expression modulating protein 2057 1512 gene locus_tag LOCUS_25940 2057 1512 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056278.1 protein_id gnl|my_center|LOCUS_25940 2572 2054 gene locus_tag LOCUS_25950 2572 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence574 >Feature sequence575 <1 729 gene locus_tag LOCUS_25960 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057967.1:glycosyl transferase 722 1315 gene locus_tag LOCUS_25970 gene gmhB 722 1315 CDS product D-glycero-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH26 protein_id gnl|my_center|LOCUS_25970 >Feature sequence576 198 1667 gene locus_tag LOCUS_25980 gene recQ 198 1667 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056643.1 protein_id gnl|my_center|LOCUS_25980 2512 2111 gene locus_tag LOCUS_25990 2512 2111 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence577 2546 390 gene locus_tag LOCUS_26000 2546 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence578 924 277 gene locus_tag LOCUS_26010 924 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140850.1 protein_id gnl|my_center|LOCUS_26010 1385 819 gene locus_tag LOCUS_26020 gene coaD 1385 819 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ7 protein_id gnl|my_center|LOCUS_26020 1825 1439 gene locus_tag LOCUS_26030 1825 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143307.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence579 >Feature sequence580 1747 308 gene locus_tag LOCUS_26040 gene pds 1747 308 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124322.1 protein_id gnl|my_center|LOCUS_26040 2135 1929 gene locus_tag LOCUS_26050 2135 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057624.1 protein_id gnl|my_center|LOCUS_26050 2536 2333 gene locus_tag LOCUS_26060 gene apcC 2536 2333 CDS product phycobilisome 7.8 kDa linker polypeptide, allophycocyanin-associated, core inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50036 protein_id gnl|my_center|LOCUS_26060 >Feature sequence581 1283 81 gene locus_tag LOCUS_26070 1283 81 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056984.1 protein_id gnl|my_center|LOCUS_26070 1874 1458 gene locus_tag LOCUS_26080 1874 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence582 <2549 1404 gene locus_tag LOCUS_26090 <2549 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056870.1:5-methyltetrahydrofolate--homocysteine methyltransferase >Feature sequence583 <1 1806 gene locus_tag LOCUS_26100 <1 1806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016398.1:ABC transporter ATP-binding protein 2548 2342 gene locus_tag LOCUS_26110 2548 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence584 >Feature sequence585 737 351 gene locus_tag LOCUS_26120 737 351 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462837.1 protein_id gnl|my_center|LOCUS_26120 902 2428 gene locus_tag LOCUS_26130 902 2428 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883980.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence586 >Feature sequence587 546 43 gene locus_tag LOCUS_26140 546 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2367 877 gene locus_tag LOCUS_26150 gene radA 2367 877 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX9 protein_id gnl|my_center|LOCUS_26150 >Feature sequence588 >Feature sequence589 2008 548 gene locus_tag LOCUS_26160 gene ftsY 2008 548 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKD1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence590 <1 1392 gene locus_tag LOCUS_26170 <1 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NCW4:nuclease SbcCD subunit C 1719 1411 gene locus_tag LOCUS_26180 1719 1411 CDS product divalent ion tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_26180 2300 1818 gene locus_tag LOCUS_26190 2300 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence591 857 135 gene locus_tag LOCUS_26200 857 135 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG61 protein_id gnl|my_center|LOCUS_26200 1348 2397 gene locus_tag LOCUS_26210 1348 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056254.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence592 651 1892 gene locus_tag LOCUS_26220 gene sbcD 651 1892 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHI2 protein_id gnl|my_center|LOCUS_26220 >Feature sequence593 632 1450 gene locus_tag LOCUS_26230 632 1450 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_26230 >Feature sequence594 324 713 gene locus_tag LOCUS_26240 324 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 protein_id gnl|my_center|LOCUS_26240 1739 765 gene locus_tag LOCUS_26250 gene chlG 1739 765 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057379.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence595 1980 13 gene locus_tag LOCUS_26260 gene acsA 1980 13 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH2 protein_id gnl|my_center|LOCUS_26260 >Feature sequence596 935 1336 gene locus_tag LOCUS_26270 gene acpS 935 1336 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE72 protein_id gnl|my_center|LOCUS_26270 2421 1483 gene locus_tag LOCUS_26280 2421 1483 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence597 427 2115 gene locus_tag LOCUS_26290 427 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 >Feature sequence598 1058 1531 gene locus_tag LOCUS_26300 1058 1531 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_26300 1861 2232 gene locus_tag LOCUS_26310 1861 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence599 152 1327 gene locus_tag LOCUS_26320 152 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056563.1 protein_id gnl|my_center|LOCUS_26320 1798 1541 gene locus_tag LOCUS_26330 1798 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 2235 1843 gene locus_tag LOCUS_26340 2235 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence600 801 2087 gene locus_tag LOCUS_26350 801 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 >Feature sequence601 >Feature sequence602 <1 1534 gene locus_tag LOCUS_26360 <1 1534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DM01:D-3-phosphoglycerate dehydrogenase >Feature sequence603 343 840 gene locus_tag LOCUS_26370 343 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 1124 780 gene locus_tag LOCUS_26380 1124 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1490 2221 gene locus_tag LOCUS_26390 1490 2221 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI45 protein_id gnl|my_center|LOCUS_26390 2254 2382 gene locus_tag LOCUS_26400 2254 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 >Feature sequence604 841 623 gene locus_tag LOCUS_26410 841 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 928 1794 gene locus_tag LOCUS_26420 gene dapF 928 1794 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM2 protein_id gnl|my_center|LOCUS_26420 >Feature sequence605 1597 779 gene locus_tag LOCUS_26430 1597 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 2338 1763 gene locus_tag LOCUS_26440 2338 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence606 1 732 gene locus_tag LOCUS_26450 1 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 751 1233 gene locus_tag LOCUS_26460 gene yqjY 751 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54562 protein_id gnl|my_center|LOCUS_26460 >Feature sequence607 1208 1888 gene locus_tag LOCUS_26470 1208 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence608 1642 713 gene locus_tag LOCUS_26480 gene petA 1642 713 CDS product cytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N5 protein_id gnl|my_center|LOCUS_26480 2317 1775 gene locus_tag LOCUS_26490 gene petC 2317 1775 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N8 protein_id gnl|my_center|LOCUS_26490 >Feature sequence609 1000 1761 gene locus_tag LOCUS_26500 1000 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 >Feature sequence610 <1 964 gene locus_tag LOCUS_26510 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142862.1:long-chain-fatty-acid--CoA ligase 2082 1060 gene locus_tag LOCUS_26520 2082 1060 CDS product endonuclease/exonuclease/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532618.1 protein_id gnl|my_center|LOCUS_26520 >Feature sequence611 1715 1218 gene locus_tag LOCUS_26530 1715 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence612 <1 504 gene locus_tag LOCUS_26540 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJZ9:ATP-dependent Clp protease proteolytic subunit 2 <2334 691 gene locus_tag LOCUS_26550 <2334 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058004.1:cyanophycin synthetase >Feature sequence613 220 1044 gene locus_tag LOCUS_26560 220 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence614 388 978 gene locus_tag LOCUS_26570 388 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 2298 1102 gene locus_tag LOCUS_26580 2298 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057682.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence615 2 304 gene locus_tag LOCUS_26590 2 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 605 1513 gene locus_tag LOCUS_26600 605 1513 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_26600 1600 1968 gene locus_tag LOCUS_26610 gene rplS 1600 1968 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC4 protein_id gnl|my_center|LOCUS_26610 2045 2118 gene locus_tag LOCUS_t00270 2045 2118 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence616 1174 2091 gene locus_tag LOCUS_26620 1174 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence617 2263 1181 gene locus_tag LOCUS_26630 2263 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence618 1373 888 gene locus_tag LOCUS_26640 1373 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence619 2264 1182 gene locus_tag LOCUS_26650 gene gmd 2264 1182 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 protein_id gnl|my_center|LOCUS_26650 >Feature sequence620 920 225 gene locus_tag LOCUS_26660 gene nusB 920 225 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS0 protein_id gnl|my_center|LOCUS_26660 1794 1018 gene locus_tag LOCUS_26670 1794 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence621 176 1120 gene locus_tag LOCUS_26680 176 1120 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057872.1 protein_id gnl|my_center|LOCUS_26680 1671 1309 gene locus_tag LOCUS_26690 1671 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886888.1 protein_id gnl|my_center|LOCUS_26690 >Feature sequence622 1689 1345 gene locus_tag LOCUS_26700 1689 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 1884 2087 gene locus_tag LOCUS_26710 1884 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence623 <1 1143 gene locus_tag LOCUS_26720 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037121.1:sensor histidine kinase 1329 2078 gene locus_tag LOCUS_26730 1329 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141492.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence624 999 406 gene locus_tag LOCUS_26740 999 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence625 586 293 gene locus_tag LOCUS_26750 586 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 840 2111 gene locus_tag LOCUS_26760 840 2111 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FC6 protein_id gnl|my_center|LOCUS_26760 >Feature sequence626 1480 638 gene locus_tag LOCUS_26770 1480 638 CDS product heterodisulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056823.1 protein_id gnl|my_center|LOCUS_26770 1873 2127 gene locus_tag LOCUS_26780 gene acpP 1873 2127 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7P3 protein_id gnl|my_center|LOCUS_26780 >Feature sequence627 5 688 gene locus_tag LOCUS_26790 5 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26790 691 1071 gene locus_tag LOCUS_26800 691 1071 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_26800 1179 1817 gene locus_tag LOCUS_26810 1179 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140730.1 protein_id gnl|my_center|LOCUS_26810 2076 1894 gene locus_tag LOCUS_26820 2076 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 >Feature sequence628 837 631 gene locus_tag LOCUS_26830 837 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144012.1 protein_id gnl|my_center|LOCUS_26830 <2259 1019 gene locus_tag LOCUS_26840 <2259 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124630.1:short-chain dehydrogenase >Feature sequence629 454 1050 gene locus_tag LOCUS_26850 454 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence630 2168 1101 gene locus_tag LOCUS_26860 2168 1101 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 protein_id gnl|my_center|LOCUS_26860 >Feature sequence631 >Feature sequence632 <1 625 gene locus_tag LOCUS_26870 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NHG5:RNA polymerase sigma factor SigA <2201 914 gene locus_tag LOCUS_26880 <2201 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974189.1:glycosyltransferase WbuB >Feature sequence633 623 1687 gene locus_tag LOCUS_26890 623 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 2005 1934 gene locus_tag LOCUS_t00280 2005 1934 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence634 472 1971 gene locus_tag LOCUS_26900 472 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_26900 >Feature sequence635 >Feature sequence636 156 722 gene locus_tag LOCUS_26910 156 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 <2190 954 gene locus_tag LOCUS_26920 <2190 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947136.1:dolichol monophosphate mannose synthase >Feature sequence637 1706 579 gene locus_tag LOCUS_26930 gene potA 1706 579 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBU2 protein_id gnl|my_center|LOCUS_26930 >Feature sequence638 <1 999 gene locus_tag LOCUS_26940 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141551.1:serine/threonine protein kinase 2069 1146 gene locus_tag LOCUS_26950 2069 1146 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141348.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence639 257 862 gene locus_tag LOCUS_26960 257 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 1263 910 gene locus_tag LOCUS_26970 1263 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 1505 1263 gene locus_tag LOCUS_26980 1505 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence640 2 511 gene locus_tag LOCUS_26990 2 511 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 protein_id gnl|my_center|LOCUS_26990 713 2005 gene locus_tag LOCUS_27000 713 2005 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence641 2026 1049 gene locus_tag LOCUS_27010 gene ctaC 2026 1049 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE8 protein_id gnl|my_center|LOCUS_27010 >Feature sequence642 235 107 gene locus_tag LOCUS_27020 235 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 704 1459 gene locus_tag LOCUS_27030 704 1459 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKC6 protein_id gnl|my_center|LOCUS_27030 <2154 1509 gene locus_tag LOCUS_27040 <2154 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056585.1:RNA polymerase sigma factor SigF >Feature sequence643 673 404 gene locus_tag LOCUS_27050 673 404 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005397239.1 protein_id gnl|my_center|LOCUS_27050 847 2004 gene locus_tag LOCUS_27060 847 2004 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056224.1 protein_id gnl|my_center|LOCUS_27060 >Feature sequence644 1747 1148 gene locus_tag LOCUS_27070 gene terD 1747 1148 CDS product stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430074.1 protein_id gnl|my_center|LOCUS_27070 >Feature sequence645 428 111 gene locus_tag LOCUS_27080 428 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 947 645 gene locus_tag LOCUS_27090 947 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence646 >Feature sequence647 485 1555 gene locus_tag LOCUS_27100 485 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence648 68 1786 gene locus_tag LOCUS_27110 68 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence649 1174 2019 gene locus_tag LOCUS_27120 1174 2019 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726830.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence650 >Feature sequence651 1263 214 gene locus_tag LOCUS_27130 gene mnmA 1263 214 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM0 protein_id gnl|my_center|LOCUS_27130 >Feature sequence652 1003 221 gene locus_tag LOCUS_27140 gene folP 1003 221 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ9 protein_id gnl|my_center|LOCUS_27140 2073 1201 gene locus_tag LOCUS_27150 2073 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence653 270 797 gene locus_tag LOCUS_27160 gene psbV 270 797 CDS product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A386 protein_id gnl|my_center|LOCUS_27160 1070 1756 gene locus_tag LOCUS_27170 1070 1756 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence654 >Feature sequence655 1074 1949 gene locus_tag LOCUS_27180 1074 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence656 997 182 gene locus_tag LOCUS_27190 gene tatD 997 182 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN5 protein_id gnl|my_center|LOCUS_27190 1489 1196 gene locus_tag LOCUS_27200 gene rpsT 1489 1196 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN4 protein_id gnl|my_center|LOCUS_27200 >Feature sequence657 541 128 gene locus_tag LOCUS_27210 541 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 1179 559 gene locus_tag LOCUS_27220 1179 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence658 1472 912 gene locus_tag LOCUS_27230 1472 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 >Feature sequence659 >Feature sequence660 164 787 gene locus_tag LOCUS_27240 164 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence661 >Feature sequence662 1719 1120 gene locus_tag LOCUS_27250 1719 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141284.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence663 <1 1182 gene locus_tag LOCUS_27260 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082593.1:ATPase >Feature sequence664 >Feature sequence665 361 1698 gene locus_tag LOCUS_27270 gene menE 361 1698 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057063.1 protein_id gnl|my_center|LOCUS_27270 >Feature sequence666 1377 697 gene locus_tag LOCUS_27280 1377 697 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728775.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence667 <1 963 gene locus_tag LOCUS_27290 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957990.1:mechanosensitive ion channel protein MscS >Feature sequence668 >Feature sequence669 <1 1231 gene locus_tag LOCUS_27300 <1 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058264.1:serine/threonine protein kinase 1557 1997 gene locus_tag LOCUS_27310 1557 1997 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence670 553 831 gene locus_tag LOCUS_27320 553 831 CDS product UPF0367 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKQ5 protein_id gnl|my_center|LOCUS_27320 1060 1722 gene locus_tag LOCUS_27330 1060 1722 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056429.1 protein_id gnl|my_center|LOCUS_27330 >Feature sequence671 94 1380 gene locus_tag LOCUS_27340 94 1380 CDS product sucrose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143828.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence672 2 511 gene locus_tag LOCUS_27350 2 511 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 protein_id gnl|my_center|LOCUS_27350 696 1898 gene locus_tag LOCUS_27360 696 1898 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057867.1 protein_id gnl|my_center|LOCUS_27360 >Feature sequence673 1837 1196 gene locus_tag LOCUS_27370 1837 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141284.1 protein_id gnl|my_center|LOCUS_27370 >Feature sequence674 1015 122 gene locus_tag LOCUS_27380 1015 122 CDS product heparan sulfate glucosamine 3-O-sulfotransferase 3B1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887312.1 protein_id gnl|my_center|LOCUS_27380 1968 1024 gene locus_tag LOCUS_27390 1968 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 >Feature sequence675 >Feature sequence676 331 1395 gene locus_tag LOCUS_27400 gene recA 331 1395 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9V8 protein_id gnl|my_center|LOCUS_27400 >Feature sequence677 >Feature sequence678 >Feature sequence679 >Feature sequence680 <1 1003 gene locus_tag LOCUS_27410 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056675.1:RNA polymerase sigma factor >Feature sequence681 86 1420 gene locus_tag LOCUS_27420 gene murA 86 1420 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGP3 protein_id gnl|my_center|LOCUS_27420 >Feature sequence682 299 478 gene locus_tag LOCUS_27430 299 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 765 1847 gene locus_tag LOCUS_27440 765 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 >Feature sequence683 <1 1044 gene locus_tag LOCUS_27450 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141428.1:hemolysin D >Feature sequence684 370 1305 gene locus_tag LOCUS_27460 370 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 1329 1862 gene locus_tag LOCUS_27470 1329 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence685 <1947 127 gene locus_tag LOCUS_27480 <1947 127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975519.1:nucleotide-binding protein >Feature sequence686 159 1595 gene locus_tag LOCUS_27490 159 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence687 21 722 gene locus_tag LOCUS_27500 21 722 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_27500 741 1349 gene locus_tag LOCUS_27510 741 1349 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141157.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence688 391 155 gene locus_tag LOCUS_27520 391 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 1782 733 gene locus_tag LOCUS_27530 1782 733 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence689 >Feature sequence690 1260 424 gene locus_tag LOCUS_27540 1260 424 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144167.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence691 1064 3 gene locus_tag LOCUS_27550 1064 3 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_27550 1564 1394 gene locus_tag LOCUS_27560 1564 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence692 <1 1056 gene locus_tag LOCUS_27570 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DIE8:zinc metalloprotease 1076 1732 gene locus_tag LOCUS_27580 gene nth 1076 1732 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE9 protein_id gnl|my_center|LOCUS_27580 >Feature sequence693 53 880 gene locus_tag LOCUS_27590 53 880 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 protein_id gnl|my_center|LOCUS_27590 1089 1472 gene locus_tag LOCUS_27600 gene aroH 1089 1472 CDS product chorismate mutase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHZ0 protein_id gnl|my_center|LOCUS_27600 >Feature sequence694 1019 816 gene locus_tag LOCUS_27610 1019 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 1564 1133 gene locus_tag LOCUS_27620 1564 1133 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525346.1 protein_id gnl|my_center|LOCUS_27620 >Feature sequence695 >Feature sequence696 >Feature sequence697 >Feature sequence698 148 981 gene locus_tag LOCUS_27630 148 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 981 1694 gene locus_tag LOCUS_27640 981 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 >Feature sequence699 >Feature sequence700 1740 1150 gene locus_tag LOCUS_27650 1740 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence701 1022 243 gene locus_tag LOCUS_27660 1022 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142238.1 protein_id gnl|my_center|LOCUS_27660 >Feature sequence702 526 1203 gene locus_tag LOCUS_27670 gene ispD 526 1203 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL91 protein_id gnl|my_center|LOCUS_27670 <1879 1252 gene locus_tag LOCUS_27680 <1879 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P59288:phycocyanobilin:ferredoxin oxidoreductase >Feature sequence703 1654 482 gene locus_tag LOCUS_27690 gene anmK 1654 482 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC2 protein_id gnl|my_center|LOCUS_27690 >Feature sequence704 <1871 564 gene locus_tag LOCUS_27700 <1871 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056511.1:UDP-glucose 6-dehydrogenase >Feature sequence705 >Feature sequence706 >Feature sequence707 1767 769 gene locus_tag LOCUS_27710 1767 769 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142814.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence708 <1807 1219 gene locus_tag LOCUS_27720 <1807 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000467939.1:tyrosine protein kinase >Feature sequence709 >Feature sequence710 >Feature sequence711 <1 1514 gene locus_tag LOCUS_27730 <1 1514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403760.1:sulfotransferase >Feature sequence712 674 438 gene locus_tag LOCUS_27740 674 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 862 1308 gene locus_tag LOCUS_27750 862 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056323.1 protein_id gnl|my_center|LOCUS_27750 >Feature sequence713 >Feature sequence714 1726 437 gene locus_tag LOCUS_27760 gene glgC 1726 437 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057127.1 protein_id gnl|my_center|LOCUS_27760 >Feature sequence715 >Feature sequence716 517 1578 gene locus_tag LOCUS_27770 517 1578 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA4 protein_id gnl|my_center|LOCUS_27770 >Feature sequence717 1442 726 gene locus_tag LOCUS_27780 1442 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence718 >Feature sequence719 >Feature sequence720 >Feature sequence721 870 7 gene locus_tag LOCUS_27790 870 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence722 386 724 gene locus_tag LOCUS_27800 386 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 >Feature sequence723 1710 193 gene locus_tag LOCUS_27810 gene murC 1710 193 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV5 protein_id gnl|my_center|LOCUS_27810 >Feature sequence724 >Feature sequence725 >Feature sequence726 >Feature sequence727 429 731 gene locus_tag LOCUS_27820 429 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 845 1201 gene locus_tag LOCUS_27830 845 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence728 <1 1179 gene locus_tag LOCUS_27840 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056806.1:ABC transporter ATP-binding protein >Feature sequence729 <1704 531 gene locus_tag LOCUS_27850 <1704 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056163.1:ATP-dependent Clp protease ATP-binding subunit ClpC >Feature sequence730 390 872 gene locus_tag LOCUS_27860 390 872 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141194.1 protein_id gnl|my_center|LOCUS_27860 <1702 1148 gene locus_tag LOCUS_27870 <1702 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072047.1:gamma-glutamyltransferase >Feature sequence731 >Feature sequence732 224 688 gene locus_tag LOCUS_27880 gene smpB 224 688 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM0 protein_id gnl|my_center|LOCUS_27880 <1687 784 gene locus_tag LOCUS_27890 <1687 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058082.1:putative bicarbonate transporter, IctB family protein >Feature sequence733 628 1389 gene locus_tag LOCUS_27900 gene trmJ 628 1389 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH44 protein_id gnl|my_center|LOCUS_27900 >Feature sequence734 >Feature sequence735 855 553 gene locus_tag LOCUS_27910 gene ccmL 855 553 CDS product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_27910 1207 872 gene locus_tag LOCUS_27920 gene ccmK1 1207 872 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_27920 1619 1308 gene locus_tag LOCUS_27930 1619 1308 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142094.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence736 <1670 313 gene locus_tag LOCUS_27940 <1670 313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057654.1:monovalent cation/H+ antiporter subunit D >Feature sequence737 <1 1339 gene locus_tag LOCUS_27950 <1 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057246.1:carboxyl-terminal processing protease >Feature sequence738 >Feature sequence739 >Feature sequence740 >Feature sequence741 >Feature sequence742 >Feature sequence743 >Feature sequence744 265 549 gene locus_tag LOCUS_27960 265 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 1511 681 gene locus_tag LOCUS_27970 1511 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 >Feature sequence745 2 346 gene locus_tag LOCUS_27980 2 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 443 1402 gene locus_tag LOCUS_27990 443 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence746 >Feature sequence747 >Feature sequence748 536 1261 gene locus_tag LOCUS_28000 536 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence749 <1549 286 gene locus_tag LOCUS_28010 <1549 286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058142.1:squalene-hopene cyclase >Feature sequence750 >Feature sequence751 1381 395 gene locus_tag LOCUS_28020 1381 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 >Feature sequence752 <1 960 gene locus_tag LOCUS_28030 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLF2:fructose-1,6-bisphosphatase class 1 >Feature sequence753 >Feature sequence754 >Feature sequence755 >Feature sequence756 >Feature sequence757 1371 739 gene locus_tag LOCUS_28040 1371 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence758