COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..55172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 165..2138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701839.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 2354..3745 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(3766..5019) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057949.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(5309..6061) product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH44 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene trmJ CDS 6369..7322 product isoaspartyl peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 7362..8249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(8399..9427) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841777.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 9569..10906 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 11056..12678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(12687..13382) product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 13569..14150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(14237..15343) product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGP9 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene ruvB CDS 15541..15978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 16856..18667 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(19115..19414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057701.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 19623..20336 product protein Thf1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJT8 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene thf1 CDS complement(20350..21831) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480254.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 21960..22340 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(22621..23412) product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E6 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene ttcA CDS complement(23547..23915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 24325..24933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 note possible pseudo, internal stop codon CDS 25049..25297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 25452..26669 product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK70 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene ispG CDS 26792..27655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(27669..28178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(28374..29558) product cysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 29712..31235 product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 31420..31641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 31704..32876 product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNL4 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene bioF CDS complement(32903..34048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(34124..34915) product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205239.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene gltI CDS complement(35085..36143) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59312 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene argC CDS 36355..37461 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(37427..37846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(37880..38248) product ferredoxin-thioredoxin reductase, catalytic chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK3 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene ftrC CDS 38610..40880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(40962..42614) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057661.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene ilvB CDS 42994..43851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 43937..44122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 44187..44555 product photosystem II reaction center Psb28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLT0 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene psb28-2 CDS 44712..45626 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(45704..45913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(46551..46832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 47029..47958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141161.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(48164..49393) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 49556..51163 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 51529..52317 product acetyl-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene tagA sequence002 source 1..43973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1321 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000107217.1:sodium:proline symporter locus_tag LOCUS_00480 CDS 1471..2403 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(2446..3255) product tetracenomycin C synthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140320.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(3617..3859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 3741..4481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 4600..5763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(5784..6269) product putative phosphinothricin acetyltransferase YwnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71043 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene ywnH CDS 6456..7757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 7911..9383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(9403..11313) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene sdhA CDS complement(11465..13444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056981.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 13610..13864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 14098..14535 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057581.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 14691..15485 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124285.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene gst CDS 15618..16853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 17508..18995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 19053..20270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144202.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(20622..21248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(21346..23415) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(23412..23600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(23684..23959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 24124..24486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(24513..26192) product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(26259..27071) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144167.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(27190..27660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(27672..28010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 28519..29823 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173996.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 29844..30725 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(30867..31373) product TIGR02652 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058200.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 31465..31992 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056687.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 32104..32865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141101.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(32898..33653) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(33704..34498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887626.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 tRNA complement(35070..35143) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(35266..36429) product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(36505..37314) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057495.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(37454..37660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(37711..38142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(38173..38613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 38747..40222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 40265..41110 product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK2 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene blaA CDS complement(41378..42862) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057178.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 43214..43882 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143281.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 sequence003 source 1..41161 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1739 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057179.1:DNA polymerase I locus_tag LOCUS_00900 CDS 2196..4001 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 4304..5005 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 5145..6491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(6570..8066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(8552..12472) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL57 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene rpoC2 CDS complement(12540..14423) product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL56 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene rpoC1 CDS complement(14513..17824) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL55 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene rpoB CDS complement(17905..18690) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN5 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene tatD CDS complement(18809..19099) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN4 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene rpsT CDS 19381..20703 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR2 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene hisD tRNA 20857..20947 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 21156..22418 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 22682..23158 product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 23365..23973 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59134 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene rpsD CDS complement(24053..24973) product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCF5 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene moaA CDS 25279..26793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene ycf46 CDS 26798..27319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 27513..28472 product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124394.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene trxB CDS 28652..29110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(29173..29913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(30044..30823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(30848..31663) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 31942..32325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 32464..33480 product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058018.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(33547..33726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 33773..34207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(34391..37045) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH56 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene alaS CDS complement(37349..37831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 37992..39272 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140351.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 39294..39941 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 sequence004 source 1..39942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(333..1787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(1953..2579) product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406576.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(2590..4116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(4346..5893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(5910..6908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(6992..7924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140468.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(7997..8941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(8938..10125) product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 10740..13421 product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJD6 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 14043..16358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(16427..17563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 18346..19065 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058143.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 19122..19757 product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057765.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(20238..20966) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 21328..21831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(21884..22183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(22571..24022) product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9S5 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene icd CDS 24247..24954 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene ycf29 CDS 25670..26377 product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene ycf53 CDS 27157..28689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 28899..30164 product putative bicarbonate transporter, IctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058082.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 31084..32322 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEJ2 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 32733..34103 product putative malate transporter YflS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34726 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene yflS CDS complement(34116..35525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(35804..36589) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041786.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 36962..37900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 37964..38773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 38841..39710 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 sequence005 source 1..37148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(301..1722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(1918..2874) product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EA4 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene sucD CDS complement(2960..4207) product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05966 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene sucC CDS 4831..5577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(5622..6065) product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI8 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(6146..7438) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056850.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(7448..7723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(7824..9350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 9732..11834 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056974.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(11856..13040) product succinyldiaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143457.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 13444..14814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(14914..15678) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057529.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(15871..16611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(17043..17282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(17317..18120) product TIGR00268 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057083.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(18203..19483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(19779..20552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 20847..21842 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056195.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 22020..22721 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125174.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene tesA CDS complement(22739..23683) product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene ispE CDS complement(23855..25021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 25244..25741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(25971..26312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 26681..27139 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057639.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 27246..27902 product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056611.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 28050..29156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058193.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(29149..30291) product UPF0754 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM9 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(30438..31148) product 2-phytyl-1,4-naphtoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPC8 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene menG CDS complement(31314..32546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057902.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(33157..33513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056711.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene ycf57 CDS complement(33884..34222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 34805..35182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(35227..36231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 misc_feature complement(36483..>37148) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143105.1:glycosyl transferase locus_tag LOCUS_01810 sequence006 source 1..34226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2133 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941555.1:serine protease locus_tag LOCUS_01820 CDS 2223..2972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(3149..3796) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056342.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 4040..5479 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene ycf24 CDS complement(5591..6541) product putative UDP-glucose epimerase YtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34886 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene ytcB CDS 8033..9040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 9142..9888 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 10114..11880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057497.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 11927..12298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 12473..12892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(13039..14196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(14328..16181) product sugar hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031477.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(16321..17565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(17666..18808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(18847..19935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(19939..21126) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(21135..22508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(22529..26020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(26314..27987) product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(28050..29360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(29486..30541) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(30538..31692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(31736..32890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 misc_feature complement(33018..>34226) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056069.1:ABC transporter ATP-binding protein locus_tag LOCUS_02050 sequence007 source 1..32243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 181..1455 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057131.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(1497..2237) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144148.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 2922..3638 product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056220.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene ho1 CDS complement(3786..4019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(4143..4748) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(4804..6597) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 6669..7763 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 8054..8779 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJS3 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene coaX CDS 9009..9617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057402.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene ycf21 CDS 9738..10073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 10454..13690 product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI5 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene pyrA CDS complement(13775..14851) product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIZ8 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(15098..16897) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(17279..18244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(18551..19216) product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM85 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(19345..20649) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056769.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(20825..21577) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056437.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(21829..23532) product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 24220..24489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(24720..25613) product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH87 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene rsmH CDS complement(26476..27558) product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9V8 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene recA CDS complement(28453..29451) product biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140852.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene bvdR CDS 29835..30128 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene fdx CDS complement(30231..30719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(30756..31799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 sequence008 source 1..31859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 456..1382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 1532..3445 product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF8 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene mnmG CDS 3501..4478 product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 4543..4872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 5245..7488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 7506..7895 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 7956..8789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 8874..10322 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(10614..11111) product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A401 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene psaF CDS 11314..12354 product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI9 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene tsaD CDS complement(12364..12876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(13010..13855) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND10 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 14119..15531 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056302.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 15939..17687 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056106.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 17776..18612 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM3 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene murI CDS 19527..20501 product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene sds CDS 20551..21555 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142814.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 21573..22046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 22286..23221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(23424..23627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(23931..25682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene ycf45 CDS complement(25725..26816) product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056586.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(26957..27577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 27836..28156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058283.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 28355..29773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(29828..30580) product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143432.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(30670..31731) product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889292.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 sequence009 source 1..31752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 324..779 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057290.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(892..1350) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene hspA CDS complement(1810..3360) product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG7 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 3492..4793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 4869..5978 product UPF0284 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGL0 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(5952..6323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055984.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 6577..7758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056563.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 7769..9235 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056643.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene recQ CDS 9421..11532 product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKV9 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene glgX-1 CDS complement(11569..12795) product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 13121..13666 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057894.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 13718..13912 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCB9 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene rpmG CDS 13946..14161 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBX4 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene rpsR CDS 14254..16263 product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 16452..18197 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 18308..20347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 20849..22609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 22646..23674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 tRNA complement(24099..24172) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 24216..24632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 24704..25072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(25972..26301) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7SIA8 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene cutA CDS complement(26318..27268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(27471..28499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 28754..29890 product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU5 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene carA misc_feature complement(29988..>31752) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058142.1:squalene-hopene cyclase locus_tag LOCUS_02820 sequence010 source 1..29255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 875..1762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(1766..2374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(2371..2631) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103251.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(3276..3860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(3808..4119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(4320..4979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(4989..5558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(5885..6343) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143783.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(6386..6595) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(6564..7349) product acetyltransferase, GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064761.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(7457..7894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 8178..9038 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 9076..9435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 9500..10804 product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143064.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene glcE CDS 10910..12211 product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCA7 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene glcF CDS complement(12276..13388) product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFJ5 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene gcvT CDS complement(13554..15227) product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7MBB4 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene groL2 CDS complement(15423..16280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(17135..18532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(19238..19441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057624.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(19583..20314) product precorrin-2 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene cobI CDS 20979..22670 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 22884..24284 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 24443..24781 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057655.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 24778..26241 product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057654.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene ndhD5 CDS 26214..26615 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057653.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 26679..26930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 26983..27270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057651.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 27296..27919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057650.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 27919..28578 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 28615..29085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143984.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 sequence011 source 1..27935 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(22..1767) product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816913.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene ggt CDS 1931..2311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 2379..3533 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091709.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(4240..4425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(4621..5220) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKG1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene coaE CDS 5355..5810 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125105.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(5876..6616) product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(6683..7198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(7223..7609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(7772..9025) product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK88 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene metK CDS complement(9128..9868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057310.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(9968..11101) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene rps1 CDS complement(11394..11885) product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHT4 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene nrdR CDS complement(12360..13892) product photosystem II CP47 reaction center protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene psbB CDS complement(14203..14463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(14851..15030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057262.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 15102..15641 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056635.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 15709..16602 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057233.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(16753..17742) product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(18113..18298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 18682..19386 product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056304.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene chlM CDS 19468..21924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 22270..22743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(22775..24328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057727.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 24564..25901 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057372.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 26023..27447 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU2 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene glgA CDS complement(27451..27837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 sequence012 source 1..27934 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(310..1671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(2269..4197) product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL50 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene gyrB CDS 5008..5673 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene fabG CDS 6700..6870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 7331..8071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(8068..10284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 10497..11189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 11278..11799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 11905..12672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 12915..14933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056794.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(14984..16123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(16485..17078) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 17555..17959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 18071..19693 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGB1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene nadB CDS 19788..20363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(20360..21358) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259671.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 21644..22411 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020468.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 22524..23657 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267675.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 23889..24290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(24375..24803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124370.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(25031..25813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142532.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 26549..27730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 sequence013 source 1..27339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..623 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKD7:S-adenosylmethionine:tRNA ribosyltransferase-isomerase locus_tag LOCUS_03630 CDS complement(676..2643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 2889..3569 product riboflavin deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143523.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 3589..4659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 4899..5135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(5560..6288) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057411.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(6310..6732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057412.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 6956..8005 product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 7992..9023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 tRNA 9073..9148 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 9378..10313 product mRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene wcaG CDS complement(10241..10711) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(10990..11661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 12127..12834 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057970.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 13125..13892 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057242.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(13908..14681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 15114..15731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 15813..16961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057368.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(16958..18136) product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene solA CDS complement(18519..20426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(21395..26263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(26305..27339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 sequence014 source 1..27228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 256..2604 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 2610..3038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 3284..3712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(3818..5968) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW9 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene pnp CDS 6554..8479 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW7 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene ftsH CDS complement(8578..9810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(10110..10535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(10810..11223) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603272.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(11464..12717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(12796..13818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(14016..14363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 14764..14976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 15097..15888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 16097..16387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 16739..17245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 17411..18244 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706147.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 18278..19099 product endonuclease 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z8D2 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene nei CDS complement(19109..19786) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM2 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 19923..20996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141362.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 21606..23204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 23286..23444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(23659..23958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(23963..24850) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460068.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(25229..26683) product bifunctional pantoate ligase/cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG73 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene panC/cmk sequence015 source 1..26621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 562..966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(1261..2070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(2144..4132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(4208..6931) product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(7044..7547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(7661..8737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(8792..9961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(10032..11927) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(12049..12957) product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942218.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(13133..13909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(13915..14811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(15413..15643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 16664..17251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(17409..19904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(19985..22423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 22524..23228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 23234..25336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 25570..26463 product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46352 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene xerD sequence016 source 1..26341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1377 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122925.1:type I restriction endonuclease locus_tag LOCUS_04260 CDS 1410..1652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 1649..1921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(1925..3331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(3693..3875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(4147..5103) product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(5408..5707) product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ7 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene gatC CDS complement(5779..6300) product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ6 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene ycf3 CDS 6606..7955 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP5 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 7980..8576 product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene nadD CDS 8573..9316 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 9352..11979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 12033..12326 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388327.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 12371..13198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 note possible pseudo, frameshifted CDS 13170..14033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 note possible pseudo, frameshifted CDS complement(14136..15119) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 15612..15929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125562.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(16015..17943) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055904.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 18579..19190 product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(19197..19838) product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 20558..22327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(22441..23220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(23506..25230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057930.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 misc_feature complement(25369..>26341) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010884033.1:HDIG domain-containing protein locus_tag LOCUS_04490 sequence017 source 1..26266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 365..1933 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 2134..2718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 3068..3943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057303.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 3948..4430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 4688..5920 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141757.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 6086..8158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 8240..9427 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053727.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(9453..11144) product beta-carotene ketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140397.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene crtO CDS complement(11351..12448) product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG6 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(12687..13328) product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(13439..14308) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056948.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 14559..16154 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228733.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(16213..18579) product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 18731..19333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 19514..20125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(20122..20922) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057803.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 tRNA complement(20975..21061) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 21257..22588 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS7 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene murA CDS 23139..24827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(24928..25125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 misc_feature complement(25172..>26266) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055982.1:glycosyl transferase locus_tag LOCUS_04690 sequence018 source 1..26006 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 728..2344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 2478..3599 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 3614..4504 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(4683..4895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 5144..5650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058114.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 5763..6323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(6377..7681) product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056045.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene folC CDS 7919..9103 product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD9 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene ndhH CDS 9898..14919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(14980..16221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143008.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 16392..17216 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057490.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene desC2 CDS 17955..18356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(18671..19342) product phosphoribosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984864.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(19509..22127) product chaperone protein ClpB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ40 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene clpB1 misc_feature complement(22446..>26006) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362020.1:protein of unknown function precursor; adhesin locus_tag LOCUS_04840 sequence019 source 1..25878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..1002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 1365..1853 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 1875..2783 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057385.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(2819..3241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 3546..4082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056576.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 4129..4767 product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH6 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene trmB CDS 4894..6294 product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 6319..7107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 7227..8051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 8153..8359 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9L2 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene rpmI CDS 8446..8799 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGV3 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene rplT CDS 8816..9085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 9172..9936 product glutamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(9953..10333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 10388..11605 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZD9 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 11780..12637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(12649..13443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 14297..15592 product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL40 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene eno CDS 15819..18362 product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLX1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(18563..18757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(18858..19463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(19598..22522) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK04 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene infB CDS complement(22795..22974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(23144..24517) product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHL2 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene nusA CDS complement(24579..25037) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFN6 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene rimP CDS 25259..25420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 sequence020 source 1..25766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2255..3094) product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088901.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 3229..4644 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 4905..5918 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene add CDS 6177..7184 product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331752.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(7163..7681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948551.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(7727..8299) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368006.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(8428..9564) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206974.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene aprA CDS 9969..10838 product 6-pyruvoyltetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056938.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 11324..11755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(11855..13294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 13526..14353 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH2 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene dapB CDS 14426..15124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056056.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(15430..16029) product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056907.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(16110..17102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(17418..19841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544732.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(20003..21400) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141457.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene aspA CDS 21631..21837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058047.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 22182..23243 product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF2 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene fbp CDS 23309..24454 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFZ7 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene tal sequence021 source 1..25650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..902 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331455.1:sodium-independent anion transporter locus_tag LOCUS_05300 CDS 975..1832 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(1905..2810) product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene pyrF CDS complement(2824..4107) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056443.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 4567..5877 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 5964..7124 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056963.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 7225..8391 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 8396..9145 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(9239..10069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 10130..10873 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 11131..11739 product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VAW7 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene lexA CDS 11861..12886 product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK75 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 13009..14118 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 14130..14642 product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057304.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(14661..15749) product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK79 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene rsgA CDS complement(15746..16024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(16021..17157) product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR7 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene dnaJ CDS complement(17297..19285) product chaperone protein dnaK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR6 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene dnaK1 CDS complement(19406..20137) product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB3 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene grpE CDS 20506..22509 product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene pilB CDS 22575..23690 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene pilT CDS 23742..24956 product pilus biosynthesis protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene pilC CDS 24972..25553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 sequence022 source 1..25328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(252..2357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(2354..4204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(4663..6762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056596.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 6885..8234 product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59112 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene pcxA CDS 9026..10090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 10471..10860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 10950..12914 product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH2 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene acsA CDS complement(13948..15213) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057429.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(15396..16100) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056649.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 16283..17059 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057158.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 17158..18603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 18633..20030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 20027..20704 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene surE CDS complement(20694..21197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(21490..23061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 23287..23688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 23701..25209 product potassium transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902931.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 sequence023 source 1..24894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1557..3371) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 3370..3561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(3505..4662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140225.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(4690..5862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143653.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 6223..8688 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 9038..10519 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056473.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 10572..12737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 12837..14084 product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918387.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene hfsI CDS 14094..15365 product O-unit flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 15463..18876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 19035..20021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(20087..21265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 21705..22655 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 22769..23575 product UDP-N-acetyl-D-mannosaminuronic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123818.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene wecG misc_feature complement(23744..>24894) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057422.1:rod shape-determining protein RodA locus_tag LOCUS_05840 sequence024 source 1..24477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(862..2130) product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FC6 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(2258..3646) product competence protein ComE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058172.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 3830..4543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055990.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 4684..4935 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 5117..5440 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI5 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene ycf64 CDS complement(5548..5811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 6093..6959 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(7128..7883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 8101..8877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 9018..9377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057900.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(9477..10454) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 10660..11778 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 11779..12945 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946492.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene yvfE CDS 13080..15683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 15930..16169 product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34601 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene ytjA CDS complement(16183..18048) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene cobJ CDS complement(18220..18756) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMC5 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(18839..19849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 20076..21242 product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124471.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene wecE CDS complement(21239..21982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene ycf23 CDS 22595..23752 product putative glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 23871..24326 product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 sequence025 source 1..24416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..3157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 3435..3689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 3915..5705 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144195.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 5896..7545 product alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141431.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(7834..8655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 note possible pseudo, frameshifted CDS complement(9236..9460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 9776..10336 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ09 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(10434..11432) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN6 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene prs CDS 11763..12470 product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB5 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene bioD CDS complement(12540..12842) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW7 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene rpsN CDS complement(13011..13709) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE9 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene nth CDS complement(13863..14954) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE8 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 15047..15571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 15611..16420 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 16584..18857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_250739.2 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 18901..19476 product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHZ6 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(19508..20740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 21163..22050 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881377.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(22059..22637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057756.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(22948..23670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 sequence026 source 1..23656 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(295..1320) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 1791..2087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 2332..3453 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH0 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene ddl CDS 3564..4013 product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM56 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene ndk CDS complement(4064..4459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140108.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 5013..5645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(5869..6699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 7152..7703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(7774..8229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(8397..9023) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW5 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene pyrE CDS 9119..9475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 tRNA complement(9679..9752) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 9880..10089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 10147..11466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(11677..12234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 12524..14299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 14455..14991 product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(15036..16196) product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHY0 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene recF CDS complement(16300..16896) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 17594..17857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 18097..18321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 18575..20917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 20917..23121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 sequence027 source 1..23541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(772..1473) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 1516..2496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 2590..3612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 3647..4981 product Na+-transporting ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056159.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 5494..6552 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene desA CDS complement(6682..7254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 7467..8423 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256681.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(8778..10532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 10720..11349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144203.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 11625..12518 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 12585..13367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(13377..13958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 14307..15662 product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 15851..16141 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056384.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene ycf19 CDS complement(16155..16613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056602.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(16720..17649) product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057400.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene pys CDS complement(17772..19187) product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057401.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene pds CDS complement(19334..20479) product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJG7 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene purK CDS complement(20658..20978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(21135..21365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 21403..21960 product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N8 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene petC CDS 22107..23078 product cytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N5 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene petA sequence028 source 1..23277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(173..889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144072.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(912..2168) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(2681..3682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(4166..5173) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(5314..5760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141484.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(5948..7885) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(8010..8783) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144381.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(8776..9561) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL42 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 9836..10180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142323.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 10331..11377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057862.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(11592..11822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(11839..12924) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(13031..14092) product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY4 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene murG CDS 14681..16633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(16766..17842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(17967..19595) product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(19848..20045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(20088..20270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(20554..21852) product carbon dioxide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141007.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene cupA misc_feature complement(22004..>23277) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141006.1:NAD(P)H-quinone oxidoreductase subunit M locus_tag LOCUS_06900 sequence029 source 1..23122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 152..1492 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY3 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene aroA CDS complement(2196..4811) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144168.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 5057..5971 product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 6096..8222 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763610.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(8223..8672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(9030..9668) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR9 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(9758..10612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 10900..11712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058025.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(11736..12941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058195.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(13029..14105) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057389.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(14222..14416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(14650..15204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 15383..16315 product lipoyl synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLC2 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene lipA2 CDS complement(16358..17014) product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653302.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene alkA CDS 17207..18898 product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144132.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(18947..19873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 20830..21645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 21778..22128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057712.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 sequence030 source 1..22696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 634..1776 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH66 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 2114..3058 product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972269.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene exoM CDS 3469..3735 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 3788..5281 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJI4 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene murE CDS 6163..7035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 7130..8497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 8540..9592 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971690.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 9744..11141 product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene opuE CDS 11706..11960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 12006..13046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(13067..13912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(14092..14730) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056166.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 15104..15865 product sucrose-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143827.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(16464..17144) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070923.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 17283..19196 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140600.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(19221..21071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 21213..21512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(21663..22157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 sequence031 source 1..22566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 331..1206 product FO synthase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR6 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene cofG tRNA 1277..1348 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(1507..2436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(2456..3442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(3452..5629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 5941..7584 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056296.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 7606..8451 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ9 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene folP CDS 8525..8743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(8753..9655) product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMS0 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene fabD CDS complement(9821..10969) product carbon dioxide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142079.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene cupB CDS complement(11014..12465) product NAD(P)H-quinone oxidoreductase subunit D4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057959.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene ndhD4 CDS complement(12508..14352) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057958.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene ndhF4 CDS 15461..15772 product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene ccmK1 CDS 15870..16208 product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene ccmK1 CDS 16237..16545 product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene ccmL CDS 16617..18695 product carbon dioxide concentrating mechanism protein CcmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142091.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene ccmM CDS 18877..19521 product carbon dioxide concentrating mechanism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142090.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene ccmN CDS 20103..21518 product ribulose bisphosphate carboxylase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIM7 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene cbbL CDS 21625..22029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142154.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene rbcX CDS 22053..22388 product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene rbcS sequence032 source 1..22183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(112..729) product cobalt-precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene cobH CDS complement(754..1530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 2013..3506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 3645..4304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 4331..5146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(5143..6849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 6835..7374 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(8111..8971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 9086..10597 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057989.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene hemD CDS 10757..11575 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056990.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(11586..12707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 12831..14165 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9J8 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene dnaB CDS complement(14173..15612) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057360.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(15704..16063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056902.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 16305..17144 product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A431 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene psbO CDS 17555..18331 product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene sigF CDS 18436..19203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 19357..19947 product fibrillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(20316..21044) product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 21114..21980 product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887938.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 sequence033 source 1..22093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1096 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7ND11:S-(hydroxymethyl)glutathione dehydrogenase locus_tag LOCUS_07660 CDS 1611..2606 product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 2713..4110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(4130..5107) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene dnaJ CDS complement(5779..6432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(6733..8022) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057127.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene glgC CDS 8230..8670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(8754..9269) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055903.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene fur CDS complement(9451..10299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(10549..11073) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011716.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(11467..13092) product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD4 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene groL CDS complement(13233..13544) product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TV92 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene groS CDS complement(13971..14480) product phycobilisome core component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene apcF CDS 14960..17134 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene glnN CDS complement(17220..18329) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMG9 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene prfA CDS complement(18436..18675) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9Y9 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene rpmE CDS complement(18725..19132) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK7 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene rpsI CDS complement(19136..19585) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK8 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene rplM CDS complement(19628..20458) product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM6 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene truA CDS complement(20471..20797) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK9 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene rplQ CDS complement(20855..21841) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFF5 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene rpoA CDS complement(21938..22093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 sequence034 source 1..22079 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 327..1985 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(1982..3424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 3749..4483 product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS5 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene comB CDS complement(4496..5677) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(5711..6436) product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(6500..8293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058075.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(8475..8873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 9187..10776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 10878..11741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 11869..14151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 14156..14692 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(14679..15317) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYD1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene tal CDS 15578..17953 product chaperone protein dnaK3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH10 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene dnaK3 CDS 18043..18939 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057983.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene dnaJ CDS 19062..20159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 20256..21392 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870654.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 21667..21906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 sequence035 source 1..22005 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1066 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057496.1:sensor histidine kinase locus_tag LOCUS_08050 CDS 1243..1677 product photosystem I protein PsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125882.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene psaD CDS 1864..3396 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057509.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene trpE CDS 3801..4412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 4474..5931 product Zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY9 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene crtQ CDS 5979..6431 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 6921..8636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144393.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(9076..9858) product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59288 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene pcyA CDS 9998..10171 product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMQ4 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene tatA CDS complement(10189..11259) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056239.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(11268..12380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 12796..13689 product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKQ1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene hslO CDS 13882..15915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057491.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(15924..16733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 16867..17775 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058188.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(17967..19463) product zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933081.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 19851..21569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 sequence036 source 1..21809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(426..953) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(1168..1806) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404693.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(1844..2089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(2237..2737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 2854..3897 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI76 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene trpD CDS complement(3926..4357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(4462..5640) product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108906.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 5884..6777 product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 6805..7851 product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene hppD tRNA complement(7991..8065) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 8138..8644 product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCF1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene moaC CDS 8698..8949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 8949..9248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057560.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(9260..10522) product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 10703..10909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(10925..13459) product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIH1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene gyrA CDS 13695..14093 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390954.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(14249..15376) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 15609..16565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056713.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 17130..18038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 18466..19920 product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLC0 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(20046..21503) product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene cry sequence037 source 1..21670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 706..1947 product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene ctpA CDS complement(2067..3062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 3193..3570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 3661..4494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141258.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(4533..4745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 5057..6763 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMV6 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene ureC CDS complement(6781..9975) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(11254..12798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 12882..13595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 13759..14022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058048.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(14119..14532) product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL47 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(14549..15967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(16032..16709) product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057487.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene ntcA CDS 16996..17772 product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI97 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 17874..18530 product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI3 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene hisB CDS 18580..19317 product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 19415..20377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(20427..21485) product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK09 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene mtnA sequence038 source 1..21647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1270..2013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057260.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 2159..2629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057259.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 2662..3300 product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057258.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 3364..4152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 4188..4958 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057138.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 5074..6150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142156.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(6205..7182) product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIH2 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene tilS CDS 7600..8610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 8729..9631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141545.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(9870..10574) product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 10689..11576 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086032.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(11906..12385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(12476..12910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(13013..13195) product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPL5 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 13584..16742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(16942..17841) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058215.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(17834..18622) product putative iron transport system ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44662 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(18640..19590) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170110.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(19722..20495) product beta-carotene ketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141726.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene crtO CDS complement(20855..21004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141443.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 sequence039 source 1..21467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 66..2090 product Mg-protoporphyrin IX chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ18 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene chlD CDS complement(2152..4755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(4958..7486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 7731..8201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 8198..8506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(8558..9295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(9345..9671) product UPF0145 protein YbjQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67287 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene ybjQ CDS complement(9818..11005) product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230594.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 11107..12342 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(12494..12781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(13142..14242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(14483..15973) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(16104..17651) product glutamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896718.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 17977..18729 product glutamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 19294..21150 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056748.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene ndhF3 sequence040 source 1..21027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(759..2063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140609.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(2327..4585) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057710.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene zam CDS 5107..5883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 6055..6360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057985.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(6444..8096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056997.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(8463..10385) product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057278.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 11154..12650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(12776..13165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 13415..13858 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 13872..14258 product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143594.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 14239..15255 product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHT7 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene cobD CDS 16042..16398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 16447..17214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 17361..18563 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 18754..19077 product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL6 transl_table 11 codon_start 1 locus_tag LOCUS_09100 misc_feature complement(19177..>21027) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811240.1:polyketide synthase locus_tag LOCUS_09110 sequence041 source 1..20725 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 419..793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057860.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 823..1911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057861.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 1951..2145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(2306..3904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 4252..4872 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(4919..6478) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(6471..7346) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937713.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 7649..8080 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(8226..8966) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058233.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(9118..11145) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS5 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(11440..12651) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS4 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(12910..13155) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9R0 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene acpP CDS complement(13587..14144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(14627..15994) product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(16379..18226) product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 18448..19227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(19275..19994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(20023..20631) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204341.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 sequence042 source 1..20721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 286..1869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(1939..2397) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A499 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene rplI CDS complement(2558..3214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(3390..4508) product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMT4 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 4977..5363 product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(5383..6156) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG34 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene gloB CDS 6342..7457 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073716.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene dapA CDS 7528..8478 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ5 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene era CDS 8490..8750 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 8811..10463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(10503..10862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(10934..11704) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 11652..11816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(12074..12868) product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(13011..13880) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene cysQ CDS complement(13994..14782) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141377.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene cobM CDS complement(14820..15671) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH03 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene lgt CDS complement(15827..19234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(19336..20721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 sequence043 source 1..20666 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1169..2266) product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055863.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene ycf81 CDS 2477..3748 product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057034.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene hemN2 CDS complement(3909..4400) product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A386 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene psbV CDS complement(4569..4757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(4975..5733) product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055999.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene cobA CDS complement(5762..6475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 6765..9041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 9160..9822 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI28 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 9860..10150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 10228..10749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142303.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(10757..11539) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057622.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 11577..12032 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056985.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 12124..12912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 13177..13428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 13456..13695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(13771..14109) product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFI4 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(14232..15830) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057517.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene ppx CDS 16051..16935 product 4-hydroxybenzoate solanesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFU6 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene ubiA CDS 17168..17305 product photosystem II reaction center protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F1K9 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene psbK CDS 17507..17860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(18104..19240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(19461..20372) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI27 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene thrB sequence044 source 1..20344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(617..2824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(2950..4224) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057373.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene pyrC CDS 4320..5657 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG2 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene purA CDS 5748..6437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(6736..7113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 7414..8148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 8330..8644 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140011.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 8812..9966 product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 10000..10617 product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 10633..11028 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140008.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 11613..12188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 12270..12755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(12868..13947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(13949..15190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 15431..16852 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(16951..17607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143006.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(17689..17877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(17946..18641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 sequence045 source 1..20046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(669..2612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 2869..3228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143538.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(3542..3724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(3826..4113) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(4333..4845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(4858..5922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057198.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(5981..6946) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene ntcB CDS complement(7103..8065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(8237..9289) product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140747.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 9417..11129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 11404..12528 product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056246.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 12707..13855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730934.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 14087..15736 product NAD(P)H-quinone oxidoreductase chain 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHX4 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene ndhD2 CDS 16977..17726 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888201.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 18099..18368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 18680..18877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 sequence046 source 1..20030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1607..4786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 5081..5260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(5380..5901) product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143037.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(5898..6239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 6832..7062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 7087..7329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(7378..9591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 9911..10879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 11580..11825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 12230..12928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057555.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 13583..13750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(13826..14029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(14126..14395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 14634..15806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 15969..16283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 16602..18017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 18360..19745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 sequence047 source 1..19624 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(183..1025) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH54 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene pheA CDS 1147..1731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057548.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(1771..2388) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene rnhB CDS complement(2498..4471) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056445.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene rne CDS complement(5322..6584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057390.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(6619..8898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(9046..10209) product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK26 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene sat CDS 10468..10956 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 11000..12448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(12459..13532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(13649..14521) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141460.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(14636..15418) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(15533..16057) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene ycf52 CDS 16429..17370 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256418.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 misc_feature complement(17552..>19624) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NP12:glycine dehydrogenase (decarboxylating) locus_tag LOCUS_10360 sequence048 source 1..19505 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1098..1400) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(1529..2317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 2487..2798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(2813..3931) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057159.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 4300..5409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(5481..6572) product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(6736..7662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056124.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 7823..8470 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056125.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 8483..9223 product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMQ7 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene rsmG CDS complement(9308..10054) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 10246..11778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene crtH CDS 11936..12979 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 13175..14206 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 14529..14933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(15021..15365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(15398..16288) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJA3 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene ycf38 CDS complement(16335..17354) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055865.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(17445..18206) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143324.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(18346..19149) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG38 transl_table 11 codon_start 1 locus_tag LOCUS_10550 sequence049 source 1..19301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110358.1:GntR family transcriptional regulator locus_tag LOCUS_10560 CDS complement(716..1750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1868..2467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(2510..3265) product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJU8 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene sfsA CDS 3409..4089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 4257..4952 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE8 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene rpe CDS complement(5390..6553) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGU6 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene hemH CDS 6841..7389 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056346.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(7575..8735) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141789.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 9211..10224 product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHK2 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene thiE CDS 10249..10470 product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056654.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene ycf40 CDS 10512..11474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057334.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(12043..12798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 12975..14204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125209.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 14502..15818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 16183..18012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 misc_feature complement(18100..>19301) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056777.1:transglycosylase locus_tag LOCUS_10720 sequence050 source 1..18877 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(39..1742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 1933..2109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 2123..3178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 3184..3783 product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(3824..5128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(5195..6565) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(6724..7305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 7661..8470 product putative metallophosphoesterase YkuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34870 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene ykuE CDS complement(8489..10486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 11359..12324 product circadian clock protein KaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V62 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene kaiA CDS 12417..12725 product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V61 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene kaiB CDS 12833..14425 product circadian clock protein kinase KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V60 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene kaiC CDS 14406..15506 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057982.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(15574..17427) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene ilvG CDS complement(17636..18157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 sequence051 source 1..18688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1202 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058098.1:Xaa-Pro aminopeptidase locus_tag LOCUS_10880 CDS 1265..2086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(2314..2571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 2917..3687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058196.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(3876..5690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141293.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(5819..6820) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056436.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(6997..7845) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene btpA CDS 8420..9754 product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL8 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene rimO CDS 9875..11335 product DEAD-box ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHF7 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene cshA CDS 11471..12583 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJJ6 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene thrC CDS 12941..14308 product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59109 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene trmFO CDS 14314..14556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 15073..17046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 17091..18323 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056970.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(18502..18687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 sequence052 source 1..18236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(360..536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(523..723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 910..2136 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056830.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 2223..2771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(3004..3963) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(4002..5543) product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 5658..6011 product phenylpyruvate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125356.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(6023..7009) product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ6 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene xerD CDS 7256..7522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(7519..8190) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407919.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(8342..8512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 8728..9660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 9803..10288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 10690..10833 product high light inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene hli4 CDS 11169..12167 product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057238.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 12877..13452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(14296..14781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(14959..15486) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(15623..16606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 sequence053 source 1..18008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..692 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057103.1:DNA-binding response regulator locus_tag LOCUS_11220 CDS 837..1421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1517..2950) product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056712.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(3617..5131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 5247..6191 product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM6 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene ribF CDS 6303..7226 product ATP adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125113.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene APA2 CDS complement(7489..8328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 8746..9270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 9475..10701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(10707..11033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 11286..11717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 12528..14360 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 14430..14846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 15005..17590 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 sequence054 source 1..17973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(407..1774) product cytochrome c biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL16 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene ccsB CDS complement(2068..2802) product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055907.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene ccdA CDS 2957..4048 product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(4095..4931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057503.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 5154..7103 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB0 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene dnaG CDS 7250..7900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 8087..9049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 9227..9610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(9794..10141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(10396..11715) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142201.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(11749..12297) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142202.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene rfbC CDS complement(12867..13733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(13785..14861) product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142203.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(14954..16189) product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(16568..17338) product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142205.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene rfbF misc_feature complement(17354..>17973) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142189.1:glycosyl transferase locus_tag LOCUS_11510 sequence055 source 1..17577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 52..1704 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 1959..2207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 2268..2969 product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 3171..4304 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(4301..5269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(5315..5917) product chromophore lyase CpcT/CpeT 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLE2 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene cpcT2 CDS 6163..6570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141871.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(6583..6924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(7104..7892) product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS0 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene nusB CDS complement(7968..8699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 9202..9933 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 10115..11128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(11246..11965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 12396..14348 product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056777.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(14443..15789) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(15873..16811) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene rfbB misc_feature complement(16957..>17577) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DII8:FO synthase subunit 2 locus_tag LOCUS_11680 sequence056 source 1..17336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(770..1282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(1394..2479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(2588..6184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(6185..7327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 7460..7948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 7932..8288 product mRNA-degrading endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 8304..8846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(8878..9117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(9148..10371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(10526..11239) product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI45 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(11656..12630) product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(12724..14676) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140636.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(14771..15223) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 sequence057 source 1..16667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 244..723 product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057135.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene accB CDS 731..1627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1611..2234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056109.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(2389..3204) product 3-ketodihydrosphingosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706792.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(3244..3495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(3590..4432) product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS4 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(4753..5937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(6167..10801) product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057208.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene glsF CDS 11637..12056 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142135.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 12199..12546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142103.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene ycf57 CDS 12715..13086 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59168 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene rpsL CDS 13395..13865 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI44 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene rpsG CDS 14236..16317 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI43 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene fusA sequence058 source 1..16480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 467..1873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 2117..3163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(3265..3486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973278.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(3467..3976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888890.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(4017..4610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 5423..5599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(5633..6928) product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 7247..7972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 8218..9480 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNW0 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene ftsZ CDS 9499..10308 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 10325..10825 product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL3 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 10911..11258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057859.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 11991..13031 product D-fructose 1,6-bisphosphatase class 2/sedoheptulose 1,7-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE9 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 13316..14602 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI53 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene hemA CDS complement(14694..15620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124641.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 misc_feature complement(15668..>16480) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065100.1:peptide transporter locus_tag LOCUS_12100 sequence059 source 1..16395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..771 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071890.1:AraC family transcriptional regulator locus_tag LOCUS_12110 CDS 820..2013 product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039217.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene benE CDS 2069..2953 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(3113..5575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(5641..5856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(5903..6481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(6554..8356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142898.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(8881..10209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(10242..10457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 note possible pseudo, internal stop codon CDS complement(10500..10907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 note possible pseudo, internal stop codon CDS complement(10948..11820) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970783.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene pecM CDS complement(11915..12583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 13605..14384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(14404..15048) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942220.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 misc_feature complement(15286..>16395) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O07561:putative aromatic compound monooxygenase YhjG locus_tag LOCUS_12250 sequence060 source 1..16393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1575..2690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(2865..4979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056918.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(5107..6069) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKE4 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene rnz CDS 6299..6619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(6658..7401) product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(7699..8673) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene ycf30 CDS 8851..9579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056001.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 9692..10030 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH72 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene trxM2 CDS complement(10033..10449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(10609..12330) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 12772..13596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 13838..14122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141965.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 14178..14810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 misc_feature complement(14935..>16393) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140181.1:group II intron reverse transcriptase/maturase locus_tag LOCUS_12390 sequence061 source 1..16310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 900..1880 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056675.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene sigB CDS 2206..3816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 4206..4973 product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene sigF CDS 5239..6402 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(6592..8481) product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene nirA CDS 9048..9656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 10380..10604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(10984..12711) product diflavin flavoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141773.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(12861..13688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 13886..14203 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(14230..14793) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS3 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 14943..15617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056940.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 misc_feature complement(15621..>16310) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056432.1:GTP pyrophosphokinase locus_tag LOCUS_12520 sequence062 source 1..16256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1319..2302) product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIH3 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene ccsA CDS complement(2540..3406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(3771..3950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 4239..6092 product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101239.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene asnB1 CDS complement(6135..6557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(6963..8750) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530674.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(8809..9930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(9935..11050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 11460..11888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(11923..12393) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(12390..13127) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140670.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 13434..14096 product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSB4 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene trmH CDS complement(14093..14407) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 14549..16120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 sequence063 source 1..16184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..345) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGN0 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene trxM1 CDS 499..1263 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene fabG CDS complement(1361..1831) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140110.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene ycf52 CDS 2186..2812 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD9 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene hisG CDS 2953..4782 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056407.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(4817..5488) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(5516..6586) product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140935.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 6749..8017 product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59322 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene argD CDS 8408..9043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(9097..10467) product alkaline invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 10727..11527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 tRNA complement(11563..11647) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(11870..12028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 12220..12942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 12955..13599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 13702..14628 product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057810.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(14818..15447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 sequence064 source 1..16145 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 562..2838 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058113.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(2848..5277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 5680..6072 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 6396..7793 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089836.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 tRNA 7997..8070 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(8156..8629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(8695..9936) product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN4 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene argJ CDS 10425..11072 product hydantoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene hupE CDS 11088..12137 product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057463.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene cobW CDS 12371..12904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 13054..13905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(14065..14859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 misc_feature complement(15234..>16145) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DHA3:DNA-directed DNA polymerase locus_tag LOCUS_12940 sequence065 source 1..15643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 520..1086 product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL5 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 1234..3705 product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene clpC CDS 4300..7089 product magnesium-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 7096..7566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 8383..8931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 9876..10148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 10295..12316 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784260.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 12445..13350 product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPT1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene rimK CDS 13576..13941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 sequence066 source 1..15569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(187..474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886888.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(636..1061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1109..2728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(2894..4183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 4402..5091 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VAS0 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene clpP CDS 5204..5803 product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJZ9 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene clpP2 tRNA complement(5959..6041) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(6146..6283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 6454..7380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(7535..9151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057114.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 9417..10118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(10146..11513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(11928..12305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 12760..13464 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(13897..14712) product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL0 transl_table 11 codon_start 1 locus_tag LOCUS_13170 sequence067 source 1..15472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 374..511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 1103..1279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 1401..1856 product calpastatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729173.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(2152..2457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 2517..2861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 2981..4180 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP7 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene pgk CDS 4357..6186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(6225..7223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 8097..9554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 9600..10664 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142461.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 10668..11882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 11951..12811 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 13014..13844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 13964..14878 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 sequence068 source 1..15433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(288..1709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(2218..2448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(2542..2970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(3285..3677) product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140204.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 3935..4807 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142003.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 5028..5894 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 6014..6928 product UV DNA damage endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTE6 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene uvsE CDS 6957..7388 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(7514..7924) product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028036.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(8090..8278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(8495..10576) product succinoglycan transporter ExoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057604.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 11282..12532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 sequence069 source 1..14911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 228..1169 product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978308.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(1212..1724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055861.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 1807..2208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(2257..3150) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59303 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene argB CDS complement(3220..3744) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH7 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene aroK CDS 4387..4593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(4612..5076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 5500..6324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143597.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(6349..7800) product neopullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143635.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(7880..9124) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056017.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 9495..9680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(9684..10172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(10175..10537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 10626..11786 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055970.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene nifS CDS complement(12001..13608) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 misc_feature complement(13810..>14911) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DI46:putative cytosol aminopeptidase locus_tag LOCUS_13590 sequence070 source 1..14659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2649 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DMD5:UvrABC system protein A locus_tag LOCUS_13600 CDS complement(2704..3555) product modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458962.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 3917..4573 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141890.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 5456..6094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 6201..7871 product fused response regulator/thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 7990..9087 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene aroC CDS complement(9105..9617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 10381..11730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(11755..13002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 13207..14343 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH42 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene proB sequence071 source 1..14657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1282..2760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 2878..4167 product modulator of DNA gyrase PmbA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(4618..4845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 6035..7582 product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(7633..8697) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080048.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 8779..9558 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMK3 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene panB CDS 9685..10581 product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFX8 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(10674..11291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 11473..11748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(11820..12506) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 misc_feature complement(12766..>14657) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143985.1:glycogen debranching protein locus_tag LOCUS_13800 sequence072 source 1..14627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2082 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87M30:elongation factor G 2 locus_tag LOCUS_13810 CDS complement(2178..2873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(3113..4753) product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125785.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene putP CDS 5125..5871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(6012..6797) product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI00 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene lpxA CDS complement(7013..7498) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI01 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene fabZ CDS complement(7519..8355) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI02 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene lpxC CDS complement(8392..10545) product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057626.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(10830..11570) product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIT5 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene purC CDS 11804..12046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056628.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(12212..13354) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057886.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene gldA CDS complement(13376..13885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056935.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene ycf51 CDS complement(14060..14362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 sequence073 source 1..14531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..1103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 1165..2079 product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 2297..3142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 3139..4383 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 4385..5680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 5762..6529 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 6610..7377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 7465..8607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 8697..9923 product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene wcaG CDS complement(10354..11319) product photosystem reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056697.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(11698..12639) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCE6 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene rbsK CDS complement(12681..13976) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW4 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene purB tRNA complement(14048..14120) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 sequence074 source 1..14450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(168..938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058247.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1053..1592) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 2210..3058 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(3123..3617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056117.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(3688..4374) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056116.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(4415..5338) product NAD kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene nadK1 CDS 5733..6662 product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene crtE CDS 6712..7179 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 7227..8786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(8858..9997) product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072052.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(10031..10903) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907861.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(11041..11490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(11685..11831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(11853..13649) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024232.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 note possible pseudo, internal stop codon sequence075 source 1..14423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..883 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057195.1:nitrate reductase catalytic subunit locus_tag LOCUS_14200 CDS complement(886..1302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1396..2007) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 2034..2411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 2808..4385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 4430..6499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 6547..7098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(7115..7792) product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056065.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(7996..8289) product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056066.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene clpS CDS 8620..9519 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 9575..10366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140639.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 10695..11315 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057261.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(11365..12489) product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 12701..13426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 misc_feature complement(13464..>14423) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978206.1:phosphopantothenoylcysteine decarboxylase locus_tag LOCUS_14340 sequence076 source 1..14310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2337..2591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 3113..4264 product protoporphyrin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP87 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 4329..4475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(4619..5557) product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143363.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(5659..6285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 7253..10369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 11150..11935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 11999..12304 product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V61 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene kaiB CDS 12627..14144 product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259117.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 sequence077 source 1..14228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 248..1147 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065230.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 1241..2173 product inward rectifier potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(2182..3558) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 3641..3838 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124286.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 3985..4668 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144247.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(4672..5958) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(6066..6698) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055917.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 6787..7980 product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 8486..12778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 13174..13374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 sequence078 source 1..14064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 420..1205 product 5-oxo-1,2,5-tricarboxylic-3-penten acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057118.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1386..1871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143287.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1990..2187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 2458..3741 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH33 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene glyA CDS 3863..4921 product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 4956..6215 product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH31 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(6250..6459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058211.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(7060..7455) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(7605..10196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(10292..11767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(11896..12477) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 12628..13950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057293.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 sequence079 source 1..13652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1610..2044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(2072..2254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(2386..4176) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 4303..4749 product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPI3 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene lspA CDS complement(4844..6433) product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 6713..7888 product adaptive-response sensory-kinase SasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMT2 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene sasA CDS complement(7983..9338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(9749..10981) product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH57 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene dapL CDS complement(11052..12512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 misc_feature complement(12946..>13652) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104865.1:hybrid sensor histidine kinase/response regulator locus_tag LOCUS_14750 sequence080 source 1..13589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1364 product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene der CDS 1504..2391 product lactose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 2408..2980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 3296..4489 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 4534..6045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057082.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(6058..7539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(7784..7960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(8418..9977) product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN5 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene purH CDS complement(10030..11688) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 11988..12269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(12390..13325) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND12 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene prk sequence081 source 1..13500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 607..1404 product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI06 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene surE CDS complement(1401..2276) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 2333..3409 product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141720.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(3410..3637) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057929.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(3652..4599) product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 4782..5258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(5486..6220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 6336..6995 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene ycf39 CDS 7057..7758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 8220..9095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(9114..10535) product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN18 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 10689..10946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 sequence082 source 1..13348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 482..1495 product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 1618..2544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141368.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 2858..4348 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 4776..5516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(6148..6924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125038.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(7025..8155) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(8316..8816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141860.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 9131..9817 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057523.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene ribC CDS 10377..12401 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056567.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene ndhF1 sequence083 source 1..13298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..631 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NHG5:RNA polymerase sigma factor SigA locus_tag LOCUS_15080 CDS complement(797..1744) product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ3 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene pdhA CDS complement(1944..4523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(4745..5275) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056202.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene cheW CDS complement(5340..5705) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 6379..8055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(8056..8823) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962619.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene ilvE CDS complement(8877..10667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056767.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(11014..11808) product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123031.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 11966..12157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 sequence084 source 1..13215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(296..880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806862.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(944..1768) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1962..2597) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943220.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(3160..4062) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(4214..5917) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056078.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(5961..6455) product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143166.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(6552..6728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 7411..8814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(8903..9850) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 10132..10446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(10545..11585) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(11655..12050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057705.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 12367..13020 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP5 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene hisH sequence085 source 1..13110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(551..1357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057843.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 1692..2618 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(2664..2903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143542.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(2968..3375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 3563..4729 product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK30 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene dxr CDS 5088..5816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 5966..7732 product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058297.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene mutL CDS 8137..8511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 8659..9357 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 9539..11977 product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL37 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene pheT misc_feature complement(12042..>13110) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057679.1:arsenic-transporting ATPase locus_tag LOCUS_15410 sequence086 source 1..13027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 827..1438 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214810.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1470..3488) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK2 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene ligA CDS 3709..4686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 5125..6366 product carbon dioxide concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(6367..6663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143740.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(6684..6971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 7146..7439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(7469..7762) product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125139.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(7798..8151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 8328..9275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058107.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(9437..11212) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057086.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(11377..12096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 sequence087 source 1..12891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1758..3464 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 3792..5219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056967.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 5234..5698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057363.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 5717..6433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057026.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 6530..7078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 7094..7321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 7471..8082 product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 8146..8631 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057216.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 8662..9693 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIT6 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene glk CDS complement(9720..11018) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887980.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 11460..12314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 12593..12847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 sequence088 source 1..12639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 328..573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 note possible pseudo, internal stop codon, frameshifted CDS 552..851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 note possible pseudo, internal stop codon CDS complement(1108..2205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143082.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 2330..3076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(3079..3978) product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene ubiA CDS 4650..6692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(6700..8124) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(8351..9184) product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(9483..10103) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPW6 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene pth CDS complement(10168..10389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056228.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 11233..11880 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9R4 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene rimM CDS complement(11901..12371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 tRNA 12515..12586 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 sequence089 source 1..12624 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 207..788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(836..2020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 2214..3188 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 3430..3696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 3791..4465 product type I-MYXAN CRISPR-associated protein Cas6/Cmx6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026911.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 4440..6767 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601707.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 6764..8437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 8556..9479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 9482..10159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 10258..11916 product CRISPR-associated exonuclease Cas4/endonuclease Cas1 fusion inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1F5 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene cas4-cas1 CDS 11925..12218 product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1F4 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene cas2 sequence090 source 1..12573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 736..1854 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 1924..2916 product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGF1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene thiL CDS 3347..5233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 5396..7051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058118.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 7407..8993 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY2 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene pgi CDS 9179..10018 product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 10775..12391 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene crnA sequence091 source 1..12531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKW7:ATP-dependent zinc metalloprotease FtsH locus_tag LOCUS_15960 CDS complement(939..2870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(3331..4365) product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RH17 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 4755..5450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(5871..8486) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGS4 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene mutS CDS 8598..9038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 9421..9801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 9925..10932 product Ycf48-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI95 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 11017..11262 product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP0 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene psbE sequence092 source 1..12258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..669 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DIA0:sulfate/thiosulfate import ATP-binding protein CysA locus_tag LOCUS_16050 CDS 709..1131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 1390..2379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 2476..3690 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD8 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene hisZ CDS 3792..4061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056004.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(4130..4480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387861.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(4599..5195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387862.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(5237..6964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(7003..7371) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085073.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(7432..9609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 misc_feature complement(9673..>12258) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ61:histidine kinase locus_tag LOCUS_16150 sequence093 source 1..12162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 329..550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 571..807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(821..1723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(1764..2831) product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(2939..3622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(3635..4927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(4951..7338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(7358..10354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(10464..11348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 sequence094 source 1..11887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..614 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393502.1:sulfurylase large subunit, molybdopterin cytosine dinucleotide biosynthesis locus_tag LOCUS_16250 CDS 601..1200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 1689..3149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(3276..5207) product sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056194.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene sir CDS complement(5727..6176) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 6320..6790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143485.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 7055..7450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(7488..8246) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VEB8 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene cysH CDS 8663..9811 product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125189.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(9964..10176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(10361..11416) product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL38 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene bioB sequence095 source 1..11853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(557..973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(1368..2024) product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHL9 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene msrA CDS 2257..2943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 2961..4280 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141685.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 4507..5466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94474 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene yeaC CDS complement(5492..6463) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene galE CDS 6553..7722 product glutamyl-tRNA(Gln) amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 8066..9550 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(9596..10474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 11183..11626 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057352.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 sequence096 source 1..11829 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(786..3314) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140924.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(3626..4717) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ8 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene ychF CDS complement(4736..5494) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 5626..6165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 note possible pseudo, internal stop codon CDS 6202..7077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 note possible pseudo, internal stop codon CDS 7129..7719 product precorrin-6B methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene cobL CDS 7845..8720 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene cdsA CDS complement(8945..9235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(9383..9742) product plastocyanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125233.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene petE CDS 10023..10355 product cytochrome c6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X9 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene petJ CDS complement(10657..11823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 sequence097 source 1..11684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 409..840 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070884.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 934..2211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 2266..3339 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(3447..3986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 4209..4760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 4785..5876 product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267946.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(5848..6117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 6686..7543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 7740..8909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 tRNA 9089..9167 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(10170..11516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 sequence098 source 1..11673 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..719 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057605.1:polysaccharide export protein locus_tag LOCUS_16670 CDS 827..3178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 3375..3851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143752.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(4098..4424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 4701..6002 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056050.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 6047..7036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 7237..9780 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ59 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene gyrA CDS 10004..11542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 sequence099 source 1..11662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(537..863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(923..1984) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene ccmA CDS complement(2286..2831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(3440..3940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(3954..4223) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819Z0 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene rpsO CDS 4387..6648 product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 6661..7029 product Fe-S cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056500.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 7096..10584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 10712..11239 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969958.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 sequence100 source 1..11526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(321..1010) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 1189..2181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(2277..3068) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144315.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(3158..3688) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLR8 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene tadA CDS 3793..4362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 4425..4856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142480.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 5077..6264 product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(6317..6676) product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 6897..8240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 note possible pseudo, frameshifted CDS 8240..10987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 note possible pseudo, frameshifted sequence101 source 1..11505 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(377..1048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189279.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 951..1235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 1264..1620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 1832..2962 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM42 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene hisC CDS 3030..4214 product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 4288..5172 product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL01 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene trpC CDS complement(5353..6660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 7322..8638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 8818..10098 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195009.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene codB CDS complement(10110..10535) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393272.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 misc_feature complement(10651..>11505) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056589.1:epimerase locus_tag LOCUS_17040 sequence102 source 1..11307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 191..952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 1013..2110 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793128.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 2202..3173 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene cysM CDS 3609..5531 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL74 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene dxs CDS complement(5734..7077) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057484.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(7087..8001) product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG92 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene uppP CDS 8239..8898 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 9181..10155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 10291..11178 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125164.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 sequence103 source 1..11302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(55..306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(385..1833) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHI6 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene ffh CDS 2442..3287 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057297.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(3370..3966) product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144254.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(4047..4220) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBW1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene rpmF CDS complement(4276..5055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(5163..6524) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143095.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(6819..7286) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(7349..7747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 7805..8683 product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJE8 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene folD CDS 8853..9092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 9163..10509 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene accC CDS complement(10520..10804) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(10833..11012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 10962..11177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 sequence104 source 1..11266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2665..4902 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056743.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 5002..5649 product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S544 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene pdxH CDS 5687..6463 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191253.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(6782..7882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 8039..8386 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055899.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 8486..9559 product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU4 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene hrcA CDS complement(9572..10195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057912.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(10326..11258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 sequence105 source 1..11236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(485..1036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 note possible pseudo, internal stop codon CDS complement(1100..1309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 note possible pseudo, internal stop codon CDS complement(1374..2408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(2483..3241) product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DME3 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(3291..4730) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMB5 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene cysS CDS complement(5238..5681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 5797..6438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 note possible pseudo, frameshifted CDS 6438..7688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 note possible pseudo, frameshifted CDS complement(7788..8783) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM4 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene pyrB CDS complement(9053..9457) product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLK3 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(9490..9819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 sequence106 source 1..11202 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(766..1866) product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH08 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene ribD CDS 2022..3410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 3770..4015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 4012..4878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(4882..6207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(6601..8004) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142209.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(8109..9422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055996.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 9652..10989 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM9 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene murF sequence107 source 1..11151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(205..1794) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59081 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene metG CDS 2334..3056 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142237.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 3212..4009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142238.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(4023..4661) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene ilvH CDS 4765..5400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(5448..5714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 5817..7043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(7053..8219) product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP9 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene purT tRNA 8414..8485 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(8871..9170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056708.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(9319..9924) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC5 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(10017..10571) product photosystem II oxygen-evolving complex 23K protein PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene psbP CDS complement(10717..10896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055918.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 sequence108 source 1..10964 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1368..1589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 1579..3057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 3407..4630 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(4662..6668) product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124141.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene asnB CDS complement(6806..7198) product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D058 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene vapC CDS complement(7198..7389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 7636..8361 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(8385..8684) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941930.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(8946..9557) product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI2 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene clpP1 CDS complement(9633..10196) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ7 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene gmk CDS complement(10216..10476) product UPF0296 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ID1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 sequence109 source 1..10898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(533..1828) product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 2054..3067 product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL5 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene plsX CDS 3107..4105 product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL4 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene fabH CDS 4424..5152 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056315.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(6042..7040) product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR0 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene ilvC CDS complement(7220..8908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 misc_feature complement(8911..>10898) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057122.1:two-component hybrid sensor and regulator locus_tag LOCUS_17860 sequence110 source 1..10649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1549..1797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 2115..2816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(2892..3956) product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene idiA CDS 4067..4636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(4633..5082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 5227..5808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(5830..6933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(7113..8219) product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(8219..9082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(9082..10248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 sequence111 source 1..10546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 105..1682 product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090321.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 tRNA complement(1838..1918) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 2111..4507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056048.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(4533..4907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 6089..6820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 7121..7387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 7576..8142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 note possible pseudo, internal stop codon, frameshifted CDS 8640..9431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142238.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 9529..10323 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494437.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 sequence112 source 1..10499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1142..1828) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(1859..3049) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 3590..4996 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene suc1 CDS 4993..8127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 misc_feature complement(8151..>10499) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112465.1:diguanylate cyclase/phosphodiesterase locus_tag LOCUS_18090 sequence113 source 1..10487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 723..3731 product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJM9 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(3735..4181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(4357..4653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 4774..5691 product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 5976..6152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(6162..6623) product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055973.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene dnaJ CDS 6890..7135 product photosystem I iron-sulfur center inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A415 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene psaC CDS 7757..9862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056358.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 10100..10312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 sequence114 source 1..10480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..622 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057713.1:ATPase AAA locus_tag LOCUS_18190 CDS 769..1119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057714.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(1207..1563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 1968..3410 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141197.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene cydA CDS 3475..4482 product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141196.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene cydB CDS complement(4579..5817) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057883.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 6241..7344 product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058174.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene pilM CDS 7433..8188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142430.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 8185..8952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 sequence115 source 1..10365 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(795..1154) product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKV4 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(1172..2476) product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene proA CDS complement(2580..3680) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261724.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 4039..5067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 5193..5462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 5893..8748 product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHU4 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene secA CDS complement(9028..9558) product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ01 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene ndhJ CDS complement(9551..10285) product NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ4 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene ndhK sequence116 source 1..10217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..991 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NEB1:alanine dehydrogenase locus_tag LOCUS_18360 CDS 1732..3273 product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031501.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 3288..3713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 3723..4436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 4845..5192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 5276..5899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(5948..6481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143393.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 6603..7826 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene tyrS CDS 7930..8424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(8449..9303) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(9333..10124) product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141462.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 sequence117 source 1..10069 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 315..1322 product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056913.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 1868..3199 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH4 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(3311..4384) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 4698..6473 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(6571..8496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(8931..9596) product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 sequence118 source 1..10047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(548..1477) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJW4 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene argF CDS 1739..3391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057554.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(3423..3692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 3842..4486 product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP3 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene trpF CDS 4522..5781 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHV4 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene purD CDS 5943..7916 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056292.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(7945..8541) product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH04 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene cpcT CDS 9214..9984 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002027497.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene fabG sequence119 source 1..10032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(278..943) product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCB5 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene tsf CDS complement(1045..1848) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA2 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene rpsB CDS 2097..3101 product mononuclear molybdenum enzyme YedY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene yedY CDS complement(3505..5769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039895.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 5980..6990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 7368..7685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056366.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 7841..8269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(8331..9164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057694.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 misc_feature complement(9166..>10032) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057063.1:O-succinylbenzoic acid--CoA ligase locus_tag LOCUS_18690 sequence120 source 1..9963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 831..989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 1457..1852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140146.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(1931..2161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(2474..2761) product mRNA interferase HigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64580 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene higB CDS complement(2823..5111) product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RH18 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 5568..5777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 5809..6486 product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056880.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 6863..7441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 7467..8273 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMR1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene proC CDS 8389..8883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 8849..9769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 sequence121 source 1..9938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(169..2094) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 2833..3789 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056119.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene sigD CDS 3944..4270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056921.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 4485..4859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 4859..6031 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056200.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(6055..7167) product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM7 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene tgt CDS complement(7198..7626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 7824..8573 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ91 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene cobS CDS 8574..8873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 sequence122 source 1..9925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(646..981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 1383..2951 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 3024..4391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143184.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 4459..5091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143183.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 5293..5883 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 6009..6416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141959.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 6417..6860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 6923..7579 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141890.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(7653..8156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 8423..8824 product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIB2 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene gcvH sequence123 source 1..9876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 975..1331 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MF2 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 1558..1794 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG62 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene rpmB CDS 2070..3290 product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHI2 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene sbcD CDS 3590..4432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142803.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 4485..5075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 5147..6241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057888.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(6304..6687) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM25 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene rplL CDS complement(6748..7272) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM26 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene rplJ CDS complement(7519..8238) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM27 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene rplA CDS complement(8322..8747) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM28 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene rplK CDS complement(8751..9389) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM29 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene nusG CDS complement(9392..9628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 sequence124 source 1..9871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(276..2156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(2217..4373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 5147..5629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 6246..8096 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI5 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene ftsH CDS 8276..9685 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFV7 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene leuC sequence125 source 1..9783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(465..2177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(2170..2646) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 3089..4372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 4485..5342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057453.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 5501..7102 product NAD(P)H-quinone oxidoreductase chain 4 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY0 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene ndhD1 CDS complement(7172..8206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 sequence126 source 1..9631 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1008 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056029.1:single-stranded-DNA-specific exonuclease RecJ locus_tag LOCUS_19230 CDS 1174..3141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(3158..3616) product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140032.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 3975..5699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056580.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 sequence127 source 1..9529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 588..1661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141800.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 2155..3378 product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056005.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene chlP CDS complement(3786..4082) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 4413..5786 product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9N7 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene mgtE CDS complement(5828..6934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143323.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene ycf84 CDS complement(7031..7495) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228135.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 7540..8871 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143975.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 sequence128 source 1..9434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(799..2454) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057298.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 2650..2913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(2949..3287) product putative anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1F5 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(3803..4189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(4536..5066) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFJ4 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene cysC CDS 5277..5726 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(5839..6780) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 7038..8549 product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7U9 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene ilvA CDS complement(8685..8927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 sequence129 source 1..9427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..878 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056870.1:5-methyltetrahydrofolate--homocysteine methyltransferase locus_tag LOCUS_19430 CDS 1533..1991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(2066..3226) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG0 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene aspC CDS complement(3478..3750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 3887..5110 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK29 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene ispH CDS 5209..6102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 6251..6823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 6870..8207 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 8461..8886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 sequence130 source 1..9385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..897 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000643768.1:NADPH:quinone reductase locus_tag LOCUS_19520 CDS complement(894..1109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(1207..2979) product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141553.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(3266..4624) product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(4701..5303) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene queE CDS 5355..6533 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72F23 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 6567..6980 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789904.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene panD CDS complement(7017..8132) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(8174..8638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(8645..9355) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097816.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 sequence131 source 1..9367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 813..1328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056704.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(1343..2014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(2523..4964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(5796..6395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141514.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 6513..7721 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268208.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 7700..8335 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852919.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 misc_feature complement(8424..>9367) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056059.1:pyruvate dehydrogenase subunit beta locus_tag LOCUS_19680 sequence132 source 1..9314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(145..2322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(2377..3093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(3160..3567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(3704..4744) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259230.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 5449..7206 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058137.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(7227..8033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 misc_feature complement(8034..>9314) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056271.1:L-glutamate gamma-semialdehyde dehydrogenase locus_tag LOCUS_19750 sequence133 source 1..9311 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 561..1454 product lipoyl synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL83 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene lipA1 CDS 1898..3148 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEW6 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 3292..3543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056812.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(3616..3924) product cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058261.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene cytM CDS complement(4468..4950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(5249..6301) product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHJ8 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 6749..7249 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJT5 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene ruvC CDS complement(7256..8119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 sequence134 source 1..9254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(375..1322) product metallo-mystery pair system four-Cys motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538118.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 1684..2289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475206.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(2316..3227) product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125110.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene ilvE CDS complement(3260..5026) product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 5249..5938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056267.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(5935..6717) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143437.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(6742..7974) product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM0 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 8093..8746 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 sequence135 source 1..9207 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(533..1357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057104.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 1440..2720 product glucosylglycerol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124948.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(2885..3772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(3837..4712) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141692.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(4693..5451) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 5545..6522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 6628..7089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 7343..7891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(8058..8408) product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene ccmK1 CDS complement(8534..8848) product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene ccmK sequence136 source 1..9174 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 745..1827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 1873..3813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(3825..5135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056607.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 5386..5967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 6067..6894 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 6964..7743 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 7903..9033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 sequence137 source 1..9134 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..556 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLR3:primosomal protein N' locus_tag LOCUS_20090 CDS 744..2420 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D6F1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene glpA CDS 2544..3494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 3778..4464 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 4470..4868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 5004..7205 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143066.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(7350..7526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 7864..8343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 8340..8942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 sequence138 source 1..9126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(167..2461) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(2525..2719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092060.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(3206..3628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(3694..4257) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056210.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene trxA CDS 4323..4724 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(4801..5184) product chorismate mutase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH32 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(5325..6149) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 misc_feature complement(6341..>9126) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143976.1:multidrug efflux RND transporter permease subunit locus_tag LOCUS_20250 sequence139 source 1..9065 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(239..1063) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790353.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(1615..2010) product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496461.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(2168..4279) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058305.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 5379..6125 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI29 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene uppS CDS 6393..7259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(7333..7965) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(7976..8497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(8656..8994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 sequence140 source 1..9032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1126..1968 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143025.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(2147..2287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 2696..3541 product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404568.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 3746..5140 product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143647.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(5156..6304) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056119.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene sigD sequence141 source 1..9022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1803..3317) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949063.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 3665..4666 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene dnaJ CDS 4663..4956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 5128..5595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 5815..6447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 6641..7432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 7618..8070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 sequence142 source 1..8957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 352..1512 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390089.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(1532..2191) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140299.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 2290..2718 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 2878..3450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(3462..3863) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142398.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(3850..4494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 5062..5991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(5992..6780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056927.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 6943..7719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058307.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 8044..8895 product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene gcd1 sequence143 source 1..8949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1736..2062 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NM87 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 2211..3275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141603.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 3462..3683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(3781..4071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 4111..5346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 5366..6121 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 6234..7622 product O-unit flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 7788..8483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 sequence144 source 1..8918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(228..638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142480.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(643..1212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 1310..1855 product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLR8 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene tadA CDS 1922..2713 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144315.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 2685..3902 product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141636.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(4164..5837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(6244..6498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 6797..8608 product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM20 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene lepA sequence145 source 1..8787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..792 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P37956:spore photoproduct lyase locus_tag LOCUS_20720 CDS complement(795..1295) product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(1345..2256) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(2413..4161) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056502.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(4485..5627) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC5 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 6092..6838 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 7092..7517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 sequence146 source 1..8746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(362..1351) product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L85 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene dusA CDS 1975..3414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124949.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(3445..4443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(4436..5413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(5419..6432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 6806..7924 product homoserine/choline kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124950.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 7921..8451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 sequence147 source 1..8701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 33..1013 product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056703.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene ycf39 CDS complement(1075..1611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(1630..1965) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 2044..3660 product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056694.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 3682..5283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142439.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 5701..6303 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene tpx CDS complement(6582..7277) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056725.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(7374..8327) product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI7 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene cysK sequence148 source 1..8663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 608..1192 product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(1353..2294) product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHQ2 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene ctaB CDS complement(2349..3272) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 3895..4800 product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE8 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene ctaC CDS 4888..6570 product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE9 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene ctaD CDS 6687..7307 product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene ctaE sequence149 source 1..8628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(207..992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(1173..1772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057957.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(1814..2701) product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHV7 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene prmC CDS complement(2702..3475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141751.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 3822..4406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 4559..4729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 4805..6313 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058059.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 6546..7061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 7273..8253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 sequence150 source 1..8546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(302..811) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118797.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(901..2808) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057909.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(2888..3355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 misc_feature complement(4024..>8546) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141952.1:polyketide synthase locus_tag LOCUS_21130 sequence151 source 1..8444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(679..1227) product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM64 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene frr CDS complement(1214..1936) product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM63 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene pyrH CDS complement(2106..2639) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902490.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(3323..4210) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(4254..4628) product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143244.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(4625..5311) product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGM4 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene nfi CDS 5688..6602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 tRNA complement(6798..6881) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 sequence152 source 1..8440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(123..587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(1045..2385) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDN9 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene clpX CDS complement(2413..3090) product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI2 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene clpP1 CDS complement(3294..4694) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDP0 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene tig CDS 5211..6254 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP2 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene asd CDS 6302..7192 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK4 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene dapA sequence153 source 1..8430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(243..1688) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055871.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 1780..2538 product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 2620..3093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143287.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 3287..4135 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057366.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(4216..4629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(4694..5425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 5750..7225 product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(7326..7895) product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141254.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 sequence154 source 1..8415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 824..894 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 1041..1592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 1617..2531 product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 2646..4055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(4077..5606) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125883.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(5850..7367) product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124737.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 7451..7936 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN3 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene idnK sequence155 source 1..8411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1418 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RHI0:malto-oligosyltrehalose trehalohydrolase locus_tag LOCUS_21410 CDS 1482..4238 product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393311.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 4471..5481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(5510..6658) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259230.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(6667..7380) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 sequence156 source 1..8294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(88..846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(962..1192) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene secG CDS complement(1329..2927) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59177 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene gpmI CDS complement(3033..3509) product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125616.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(3676..4236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(4292..4648) product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLN5 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene ndhM CDS complement(4749..5258) product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR2 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene ppa CDS complement(5482..7206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 7406..7918 product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 sequence157 source 1..8281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 535..1836 product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138487.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene gudB CDS complement(2003..3583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 3822..4526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057874.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 4593..4778 product DUF3285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057423.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 4791..5303 product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIK0 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene ybeY CDS 5425..5934 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ9 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 5947..6549 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene trpG CDS 6546..7316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140886.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 7313..7531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(7550..8137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 sequence158 source 1..8262 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1483..2754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 3005..3952 product dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900117.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 3967..4146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 4483..7242 product chaperone protein ClpB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG71 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene clpB2 CDS complement(7323..7733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 8019..8258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 sequence159 source 1..8257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 922..1806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 1898..2959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 2999..4219 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(4298..5776) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene glcD CDS complement(6018..6914) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 misc_feature complement(6956..>8257) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141779.1:lipopolysaccharide biosynthesis protein locus_tag LOCUS_21760 sequence160 source 1..8146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(227..997) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA5 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene hisA CDS complement(1060..1944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 tRNA complement(2114..2202) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 2322..2690 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 2748..3260 product thermonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545903.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 3257..4078 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 4137..4367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(4469..5671) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061719.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(5792..6640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 6668..7888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 rRNA complement(8002..8104) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence161 source 1..8138 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 860..2227 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene ndh CDS complement(2339..3064) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144247.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(3289..4287) product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene ldhA CDS complement(4307..6460) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA8 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene ppk CDS 6718..7296 product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGV8 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene recR misc_feature complement(7321..>8138) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061498.1:calcium-binding protein locus_tag LOCUS_21910 sequence162 source 1..8098 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(883..2226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 2596..4083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143058.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 4345..6165 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT0 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene proS CDS 6302..6547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(6790..7092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(7089..8045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 sequence163 source 1..8063 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 640..2070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 2572..3639 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528100.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(3739..5463) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA9 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene lysS CDS 5674..6981 product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 7004..7906 product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM5 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene miaA sequence164 source 1..8062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1553..2149 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141158.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 2154..2939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 3090..3863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(4209..5810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(5862..6206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 6331..6882 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056278.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(6939..7421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143336.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 sequence165 source 1..8004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(94..870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(1075..3288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(3288..4145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 4305..4667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 4671..5324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 5674..5919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 6341..6541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 6645..6884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 6887..7153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 note possible pseudo, internal stop codon CDS complement(7405..7725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 sequence166 source 1..7958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 999..1169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 1272..2045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(2102..5536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871158.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(5587..6009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 6203..6799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(6909..7112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 sequence167 source 1..7899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1323..5018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 5130..5927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 6157..6393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 6984..7667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 sequence168 source 1..7862 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2425 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142684.1:phosphoenolpyruvate synthase locus_tag LOCUS_22300 CDS 2572..3618 product SBC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125746.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene tlyC CDS complement(3711..5486) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057025.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(5787..6944) product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene corA misc_feature complement(7257..>7862) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057001.1:cation transporter locus_tag LOCUS_22340 sequence169 source 1..7699 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 161..850 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058278.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(861..2579) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 2980..3573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(3659..4219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(4203..4493) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057702.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(4970..5137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 5424..6029 product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD5 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene ycf58 CDS 6200..6952 product phycobilisome rod-core linker polypeptide CpcG4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50041 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene cpcG4 misc_feature complement(7098..>7699) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NPI2:pseudouridine synthase locus_tag LOCUS_22430 sequence170 source 1..7693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 78..1643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(1677..2798) product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(2962..3246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 3976..5115 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056402.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene pilT CDS 5361..6131 product circadian oscillation regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056401.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 6285..6584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(6602..6991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 sequence171 source 1..7659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 253..1485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058239.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 1802..3559 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKN4 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene argS CDS complement(3609..3947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 4106..5599 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIC3 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene lnt CDS 5613..5903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 misc_feature complement(6828..>7659) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E2X0:3-isopropylmalate dehydratase large subunit locus_tag LOCUS_22560 sequence172 source 1..7658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 296..490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(743..1687) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL64 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene fcl CDS complement(1759..2832) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene gmd CDS complement(3287..4015) product galactosyl-1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125542.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene wcaJ CDS complement(4112..5254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(5322..6920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(6960..7337) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIU1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene ssb sequence173 source 1..7657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..330) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141646.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(349..1839) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI74 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene cobQ CDS complement(1951..2349) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606465.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 2544..3530 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403412.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(3567..3971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(4103..5239) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544567.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(5297..5980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 sequence174 source 1..7638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2205..2948 product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG61 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(3030..3209) product proteolipid membrane potential modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 3473..3841 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141555.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 tRNA 4247..4319 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(4331..4789) product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ7 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene aroQ CDS complement(4816..4956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 5583..7109 product light-independent protochlorophyllide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC6 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene chlB sequence175 source 1..7627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 333..1199 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257977.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 1219..2505 product glycosyl transferase group 1/2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546575.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 2629..3360 product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257981.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 3374..5224 product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142193.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 5267..5716 product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143701.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 5776..6312 product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143700.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 6305..7051 product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257981.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 sequence176 source 1..7621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2646..3335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 3571..4158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(4252..4470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(4460..4669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(4922..5374) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208113.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(5438..6139) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941968.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(6150..7145) product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 sequence177 source 1..7587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..507 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DMN8:UDP-N-acetylmuramoylalanine--D-glutamate ligase locus_tag LOCUS_22910 CDS complement(493..1185) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056716.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 1297..2799 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056715.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(2878..3645) product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNP3 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene aqpZ CDS complement(3753..4430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(4528..5319) product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIN3 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(5436..7412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 sequence178 source 1..7549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(585..1475) product 2-hydroxy-6-oxohepta-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 1674..2264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(2370..2804) product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 3163..4074 product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7MBB8 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene truB CDS complement(4141..4779) product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058094.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 5082..6218 product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057305.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 6380..7348 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 sequence179 source 1..7491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..508 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DIN0:serine--tRNA ligase locus_tag LOCUS_23050 CDS complement(503..775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 897..2162 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057579.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene avtA CDS complement(2188..3702) product (6-4) photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CH39 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene phrB CDS complement(3736..6054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 6310..7281 product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE4 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene hemC sequence180 source 1..7485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(425..763) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKX6 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(845..1729) product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV6 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene murB CDS complement(1911..3404) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV5 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene murC CDS 3886..4899 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VEJ0 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene gap2 CDS complement(5030..5854) product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR7 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene rsmI CDS 6288..7448 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056868.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 sequence181 source 1..7475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 332..1306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 1323..1583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(1570..2133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(2102..2653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 note possible pseudo, frameshifted CDS 2739..4667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 4732..5994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(6114..6329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 6556..7413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 sequence182 source 1..7459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1871..2062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 2339..3187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 3272..3817 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932013.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 4123..5310 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056978.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene ndbB CDS 5339..6505 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337450.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 6599..7315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056977.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 sequence183 source 1..7425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1316..1597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141186.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene cpeR CDS complement(1736..2350) product chromophore lyase CpcT/CpeT 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD3 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene cpcT3 CDS complement(2512..3048) product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD4 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene cpeS CDS complement(3565..3798) product phycobilisome 8.9 KD linker polypeptide, phycocyanin-associated, rod (rod capping linker protein) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141266.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene cpcD CDS complement(3889..4653) product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141265.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene cpeE CDS complement(4775..5686) product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141263.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene cpeC CDS complement(6358..6915) product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU5 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene cpcS sequence184 source 1..7406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1277..1759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(2130..2561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(2787..3575) product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057619.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(3577..4599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(4728..6167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 sequence185 source 1..7359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..706 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057023.1:oligopeptidase A locus_tag LOCUS_23430 CDS 962..2023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056254.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 2127..3443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056019.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(3710..4462) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056042.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 4671..5678 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHG3 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene trpS CDS 5850..6752 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI21 transl_table 11 codon_start 1 locus_tag LOCUS_23480 sequence186 source 1..7332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..739 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256148.1:serine/threonine protein kinase locus_tag LOCUS_23490 CDS 861..1991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(2035..2346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 2587..3873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(4039..4725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(4950..5927) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057951.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 misc_feature complement(6184..>7332) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DHC6:UvrABC system protein B locus_tag LOCUS_23550 sequence187 source 1..7082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 259..672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(684..1454) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 1719..2333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(2439..3515) product magnesium-protoporphyrin IX monomethyl ester [oxidative] cyclase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ05 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene acsF1 CDS complement(3678..4799) product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(4870..5619) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMH9 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(5762..6322) product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ41 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene ycf4 sequence188 source 1..7055 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1285..1560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142102.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 2034..3320 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHP7 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene hisS CDS 3752..4042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943940.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(4039..4467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140049.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 4973..6508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 sequence189 source 1..7014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(315..746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 1045..1551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 1763..3076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(3095..4093) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123698.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 misc_feature complement(4513..>7014) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0A3X5:phosphoenolpyruvate carboxylase locus_tag LOCUS_23720 sequence190 source 1..6996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1621..1968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(1989..3314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 3764..4690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055987.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 4791..5375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057284.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 sequence191 source 1..6901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(637..1143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(1144..2025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(2040..2675) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883F4 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene ureG-1 CDS complement(2675..2980) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLZ6 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene ureB CDS complement(3084..3386) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK85 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene ureA CDS 3710..4333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140118.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(4413..5402) product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057379.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene chlG CDS complement(5471..6556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(6597..6791) product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056374.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 sequence192 source 1..6895 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(130..804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(966..1388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 1853..2698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(2722..3207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057944.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(3320..3976) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene sigG CDS complement(4148..4696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056693.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(4838..5692) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057801.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 sequence193 source 1..6797 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(462..671) product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065020.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(835..1833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140531.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 2182..2388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057972.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 2448..2834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142875.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene ycf35 CDS 2834..3205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(3271..4275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(4453..5928) product alginate O-acetylation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 sequence194 source 1..6711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 492..1016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056251.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 1053..1403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene ycf20 CDS 1420..2370 product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(2378..2629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(2641..3444) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031846.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(3736..4485) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI29 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene uppS CDS complement(4570..5556) product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057599.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 misc_feature complement(5611..>6711) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DI31:diaminopimelate decarboxylase locus_tag LOCUS_24070 sequence195 source 1..6697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(317..949) product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNE0 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene plsY CDS complement(1021..2457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(2511..2897) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056952.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(3091..3879) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057285.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene ycf63 CDS complement(3945..4559) product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056120.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene cobO CDS 4616..4801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(4828..5682) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(5809..6195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 sequence196 source 1..6653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3074 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056204.1:two-component hybrid sensor and regulator locus_tag LOCUS_24160 CDS 3233..4870 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125969.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene spoIID CDS complement(4925..5353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(5399..5794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 5874..6644 product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229587.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 sequence197 source 1..6612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(518..1066) product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP4 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene atpH CDS complement(1071..1595) product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP5 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene atpF CDS complement(1890..2390) product ATP synthase subunit b' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP6 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene atpG CDS complement(2519..2764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(2918..3661) product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP8 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene atpB CDS complement(3728..4081) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056284.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene atp1 CDS 4125..4367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(4422..5624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(5881..6063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 sequence198 source 1..6575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 260..1291 product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004313935.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 1390..1923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(1958..2548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(2863..3294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(3407..4297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(4263..5159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(5248..5898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(6007..6471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 sequence199 source 1..6572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(311..493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(652..2136) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416624.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(2169..2741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 3490..3924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 3967..4935 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 4962..5756 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057314.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 sequence200 source 1..6505 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 254..1030 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 1030..2337 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 2352..3614 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH91 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene nifS CDS 3624..4337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 4559..5581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 sequence201 source 1..6446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(201..734) product putative REP-associated tyrosine transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43965 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(1251..1841) product stress response protein SCP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P81100 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene yceC CDS complement(1885..2460) product general stress protein 16U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80875 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene yceD CDS complement(2694..3272) product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236643.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 3529..5163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(5182..6027) product lactose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(6063..6311) product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 sequence202 source 1..6443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 373..675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 863..3157 product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB8 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene glgB CDS complement(3238..3759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(4110..5192) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59029 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene leuB tRNA 5355..5428 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 misc_feature complement(5739..>6443) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903232.1:MFS transporter locus_tag LOCUS_24600 sequence203 source 1..6417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 622..1392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143473.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 1430..1639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 1641..2471 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene nagB CDS complement(2702..4840) product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGX0 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene glyS CDS complement(4942..5109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 sequence204 source 1..6349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 32..961 product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140187.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 1032..1694 product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGB4 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(1710..2546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(2556..3320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(3449..3964) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNU5 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene isiB CDS complement(4431..5273) product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(5334..6017) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene purN sequence205 source 1..6324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 160..1500 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057904.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene dnaE CDS 1790..2359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(2389..2754) product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 3431..4564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(4627..6084) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 transl_table 11 codon_start 1 locus_tag LOCUS_24770 sequence206 source 1..6296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(49..567) product C-phycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50033 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene cpcB CDS complement(1131..1892) product phycoerythrobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL65 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene pebB CDS complement(1889..2623) product 15,16-dihydrobiliverdin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL66 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene pebA CDS 2856..3500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 3734..4231 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037392.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(4243..4920) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022855.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 5248..5574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 sequence207 source 1..6277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tmRNA 586..968 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(1123..1620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(1755..2936) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056455.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 3020..3697 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 3818..5365 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088893.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 5379..6089 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706456.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 sequence208 source 1..6263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(473..2116) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT7 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene pyrG CDS complement(2495..3145) product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEC8 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene mtnX CDS 3681..3896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 3956..4582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(4851..5285) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 sequence209 source 1..6225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(260..1489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057105.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(1732..2229) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 2426..3619 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM4 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(3606..5942) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM14 transl_table 11 codon_start 1 locus_tag LOCUS_24980 sequence210 source 1..6200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(688..1254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 2111..2518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 2537..3196 product TRK system potassium uptake protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228894.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene trkA CDS 3275..4795 product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080375.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(4825..5130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 misc_feature complement(5290..>6200) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525270.1:sodium/hydrogen exchanger locus_tag LOCUS_25040 sequence211 source 1..6159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 693..2342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141468.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 2856..5750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 sequence212 source 1..6153 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1542..2147 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene rplC CDS 2197..2832 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN0 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene rplD CDS 2822..3127 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM9 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene rplW CDS 3173..4003 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9W5 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene rplB CDS 4022..4300 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM7 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene rpsS CDS 4316..4675 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM6 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene rplV CDS 4717..5427 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59187 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene rpsC CDS 5459..5878 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM5 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene rplP CDS 5880..6095 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEG0 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene rpmC sequence213 source 1..6104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 240..452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(548..3130) product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058103.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 3699..5372 product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI64 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene ribA CDS 5443..6012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 sequence214 source 1..6071 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(214..2586) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057757.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(3082..3900) product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(3971..4384) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19079 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene cdd CDS complement(4566..5654) product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL5 transl_table 11 codon_start 1 locus_tag LOCUS_25230 sequence215 source 1..6041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 432..1823 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896012.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 1859..2236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(2289..3101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(3212..3952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 5044..5877 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143200.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(5892..6041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25290 sequence216 source 1..6026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(221..970) product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964845.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 1128..1331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(1388..2842) product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK65 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene gatA CDS 3131..4021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056269.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 4028..5212 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057854.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(5582..5803) product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 sequence217 source 1..5912 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1189 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538117.1:di-heme enzyme locus_tag LOCUS_25360 CDS complement(1317..2006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058104.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(2061..3521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057642.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 4009..4377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 4646..5170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 5177..5554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 sequence218 source 1..5850 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(198..2006) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057670.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(2201..3910) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(4066..5064) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057568.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 5482..5838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 sequence219 source 1..5831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1165..1440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06715 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene yisB CDS 1521..2147 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056172.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene sigH CDS 2189..2575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 2631..3119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 tRNA 3179..3260 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 3593..3979 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMF1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene rplU CDS 4003..4272 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NME2 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene rpmA CDS 4509..4847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 sequence220 source 1..5828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(554..1162) product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144355.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 1260..2129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(2445..2981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(3141..3980) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM2 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene dapF CDS 4023..4235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058128.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(4280..4735) product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 sequence221 source 1..5815 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 463..618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(1033..2076) product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG98 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene rlmN CDS complement(2298..2645) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141461.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(2726..3580) product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59157 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene rsmA CDS complement(3683..4537) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD6 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene purU sequence222 source 1..5802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1158..1517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(1527..1979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(1981..2430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(2608..4437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 4714..5718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 sequence223 source 1..5801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..802 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056652.1:nucleoside triphosphate pyrophosphohydrolase locus_tag LOCUS_25690 CDS 851..2029 product putative oxidoreductase YurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32159 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene yurR CDS complement(2086..2262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(2423..2770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 2871..3365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 3441..4388 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 sequence224 source 1..5746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 214..1842 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDU0 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene hflX CDS 1966..2697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(2855..3436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 3640..3843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 3850..4068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 4173..5168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 sequence225 source 1..5661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(956..1879) product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(1939..2664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538272.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(2812..4539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 misc_feature complement(4738..>5661) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143828.1:sucrose-phosphate synthase locus_tag LOCUS_25840 sequence226 source 1..5601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(181..771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 1362..3449 product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(3522..5015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 sequence227 source 1..5571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1148 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0C8P1:tRNA modification GTPase MnmE locus_tag LOCUS_25880 CDS complement(1156..2448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 3099..3563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 3747..5300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140887.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 sequence228 source 1..5509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 245..1279 product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ26 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene fni CDS 1371..1706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140556.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 1785..2324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057421.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 2413..4131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 4221..5480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056681.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 sequence229 source 1..5469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(425..1513) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGD6 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene rfbB CDS complement(1692..2765) product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene rfbA CDS complement(2911..3798) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene rfbD CDS complement(3795..4340) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene rfbC-1 sequence230 source 1..5404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1378..2301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 2348..3364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 3451..4047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 sequence231 source 1..5374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..1572) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227510.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(1661..3199) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057086.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 3554..5077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 sequence232 source 1..5348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 275..934 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119974.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene chd1 CDS complement(1129..2031) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097054.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(2114..2809) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL01 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene purQ CDS complement(2832..3128) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG9 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene purS CDS 3292..3669 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 3910..4089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 misc_feature complement(4371..>5348) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058092.1:B12-binding protein locus_tag LOCUS_26130 sequence233 source 1..5201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(74..1339) product phycocyanin operon protein Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141188.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene cpeY CDS 1499..1714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 1715..2620 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141255.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 2765..3145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 3199..4110 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057997.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 repeat_region 4362..4574 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtggagccaatttgactgaagcc sequence234 source 1..5198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 90..359 product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141676.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 362..781 product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK03 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene vapC CDS complement(1078..2457) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(2467..3042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(3130..3825) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405093.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(3809..4810) product bactoprenol glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920729.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 sequence235 source 1..5028 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1342..1737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 note possible pseudo, internal stop codon CDS 1840..2082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 note possible pseudo, internal stop codon CDS 2218..2862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 sequence236 source 1..4998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..1123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(1145..2308) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056182.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(2588..4003) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140087.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(4024..4878) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPH1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene recO sequence237 source 1..4953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 337..1179 product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P3 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene cphB CDS 1313..3934 product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058004.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 4257..4784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 sequence238 source 1..4943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 829..2700 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869035.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(2850..3338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 3474..4043 product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKE7 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene cpcS sequence239 source 1..4848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..937 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257013.1:adenylate cyclase locus_tag LOCUS_26380 CDS complement(976..2637) product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 3029..3307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 3417..4610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 sequence240 source 1..4835 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 361..3060 product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR4 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene topA CDS 3249..3713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056684.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(3810..4178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057769.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 sequence241 source 1..4832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(289..558) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005397239.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(659..2599) product amylosucrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(2655..2969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224559.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(2987..3445) product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U893 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene crcB CDS 3502..4563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 sequence242 source 1..4821 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1029..1172 product high light inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene hli4 CDS 1370..3169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(3268..4770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 sequence243 source 1..4796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 277..3438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 3545..3982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 sequence244 source 1..4724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 555..1238 product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM88 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene hisI CDS complement(1415..2368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 sequence245 source 1..4719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056126.1:magnesium chelatase subunit H locus_tag LOCUS_26570 CDS 2213..2677 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142755.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 2807..2941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 2945..3727 product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186890.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 sequence246 source 1..4706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(63..356) product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 551..1093 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 1086..2435 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(2453..3799) product oxidoreductase FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530417.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(3973..4428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 sequence247 source 1..4636 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1221..1721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(1722..2324) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387727.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(2428..3228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(3185..3850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(3847..4503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 sequence248 source 1..4571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(602..2413) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW0 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene thrS CDS 2662..2985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057537.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 3084..3389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 misc_feature complement(3483..>4571) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058264.1:serine/threonine protein kinase locus_tag LOCUS_26750 sequence249 source 1..4464 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1034..1948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(2025..2480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(2816..4264) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI5 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene gltX sequence250 source 1..4402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(282..902) product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256910.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(899..2056) product putative xanthine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32147 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene pucA CDS complement(2151..2480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(2578..2811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(2804..3034) product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022341.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 misc_feature complement(3098..>4402) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706537.1:acylaldehyde oxidase locus_tag LOCUS_26840 sequence251 source 1..4389 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(10..648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(759..1553) product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056155.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 1808..2116 product putative 30S ribosomal protein PSRP-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59327 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(2330..2740) product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG7 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene atpC misc_feature complement(2974..>4389) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLG8:ATP synthase subunit beta locus_tag LOCUS_26890 sequence252 source 1..4377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 707..1405 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057150.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 1472..2197 product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB8 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene folE CDS 3147..4352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26920 sequence253 source 1..4367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(9..494) product allophycocyanin-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057391.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene apcD CDS complement(529..1299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056083.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(1315..1791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056683.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 2132..2464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene ycf54 CDS complement(2591..3943) product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB2 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene miaB sequence254 source 1..4356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..921 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142407.1:metallophosphoesterase locus_tag LOCUS_26980 CDS 1619..2389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 2625..4073 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141482.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 sequence255 source 1..4340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(475..759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(1061..1702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056696.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(1773..2375) product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN84 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene ubiX CDS complement(2444..3193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(3319..4068) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH89 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene rnc sequence256 source 1..4336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1029 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056474.1:diguanylate cyclase locus_tag LOCUS_27060 CDS complement(1127..1648) product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI91 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene cpcS CDS 1753..2247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 2325..3197 product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE4 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene mtnP misc_feature complement(3325..>4336) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLZ2:phosphomethylpyrimidine synthase locus_tag LOCUS_27100 sequence257 source 1..4317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 366..1217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259386.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(1274..1399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 1870..2355 product photosystem I reaction center subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87787 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene psaL CDS 2554..3231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(3228..3620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056206.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 sequence258 source 1..4223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1374 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056204.1:two-component hybrid sensor and regulator locus_tag LOCUS_27160 CDS 1400..1867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 1959..2738 product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 2809..3210 product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA3 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene queF CDS 3328..3504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057753.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 sequence259 source 1..4177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(301..1650) product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB2 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene sun CDS complement(2100..2333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(2616..3266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057176.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(3328..3933) product phycocyanin operon protein Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141187.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene cpeZ sequence260 source 1..4147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1632..3035) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ92 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene ahcY sequence261 source 1..4106 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 879..1043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 1158..2069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 2101..2670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056197.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 misc_feature complement(2747..>4106) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011181932.1:diguanylate cyclase locus_tag LOCUS_27290 sequence262 source 1..4009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(719..1372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(1498..2421) product inosine-uridine preferring nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110084.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(2425..2808) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056861.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 tRNA 3181..3253 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 repeat_region 3620..3954 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaacatctcccacatcgggagagccgaagcaac sequence263 source 1..3993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 935..1315 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 1398..1574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 1714..1923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 2250..2951 product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057487.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene ntcA CDS 2971..3486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27370 sequence264 source 1..3981 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(147..632) product allophycocyanin alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50030 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene apcA misc_feature complement(1277..>3981) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058198.1:photosystem I reaction center subunit X locus_tag LOCUS_27390 sequence265 source 1..3965 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 note possible pseudo, frameshifted CDS complement(565..930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 note possible pseudo, frameshifted CDS complement(936..1079) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL94 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene rpmH CDS complement(1243..1776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(2008..2406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 2470..2955 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC4 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene ispF CDS 3186..3926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27460 sequence266 source 1..3902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(10..372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(415..1470) product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143707.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(2101..2478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140455.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(3386..3514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 sequence267 source 1..3901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(951..1856) product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPT1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene rimK CDS complement(1898..2374) product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(2745..3461) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJX2 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene rnc sequence268 source 1..3892 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..963 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143331.1:mannose-1-phosphate guanylyltransferase locus_tag LOCUS_27540 CDS 1057..1608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056144.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene ycf41 misc_feature complement(1698..>3892) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836190.1:hemolysin-type calcium-binding protein locus_tag LOCUS_27560 sequence269 source 1..3859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 728..1258 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 1384..2379 product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL09 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene pheS CDS complement(2400..2822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(2849..3328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27600 sequence270 source 1..3821 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..635 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DHS1:methionyl-tRNA formyltransferase locus_tag LOCUS_27610 CDS complement(669..1730) product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA4 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(1850..2191) product toxin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266694.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(2188..2445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(2622..2897) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142059.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 misc_feature complement(2986..>3821) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056826.1:threonine synthase locus_tag LOCUS_27660 sequence271 source 1..3764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(45..407) product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ02 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene ndhC CDS 803..1549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057978.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 1994..3067 product Mg-protoporphyrin IX chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS0 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene chlI sequence272 source 1..3760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1508..1696 product photosystem II reaction center protein Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHJ2 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene psbZ CDS 1799..2377 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP4 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene ribH CDS complement(2477..3208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 3416..3661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27730 note possible pseudo, internal stop codon sequence273 source 1..3754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(637..1302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(1725..2474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056104.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(2688..3131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057414.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(3161..3508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27770 sequence274 source 1..3753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(18..452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 642..1343 product nitrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057403.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 1379..2389 product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG4 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene obg misc_feature complement(2740..>3753) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJK3:ribonuclease J locus_tag LOCUS_27810 sequence275 source 1..3753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1466 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140397.1:beta-carotene ketolase locus_tag LOCUS_27820 CDS 1515..3467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 sequence276 source 1..3743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142623.1:ATP-dependent DNA helicase RecQ locus_tag LOCUS_27840 CDS complement(1991..2935) product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLU1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene atpG CDS complement(3044..3742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 sequence277 source 1..3703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 62..1060 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN2 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene prk CDS 1293..1748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228678.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 sequence278 source 1..3630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..928 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NHN5:homoserine O-acetyltransferase locus_tag LOCUS_27890 CDS 1221..1607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(1787..3118) product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC8 transl_table 11 codon_start 1 locus_tag LOCUS_27910 sequence279 source 1..3604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(370..2838) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW6 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene recG sequence280 source 1..3599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(492..1001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(1027..2334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(2379..3389) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057413.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 sequence281 source 1..3487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..639 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680778.1:diguanylate cyclase locus_tag LOCUS_27960 CDS complement(803..1108) product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMW3 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene ndhE CDS complement(1150..1767) product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene ndhG CDS complement(1861..2478) product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL31 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene ndhI misc_feature complement(2573..>3487) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DL32:NAD(P)H-quinone oxidoreductase subunit 1 locus_tag LOCUS_28000 sequence282 source 1..3404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2994 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268199.1:peptidase C39 locus_tag LOCUS_28010 sequence283 source 1..3396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 93..539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(662..1072) product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND93 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene vapC CDS complement(1075..1314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 1826..3268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 sequence284 source 1..3376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 571..930 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433620.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 923..1591 product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070789.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene yniC CDS complement(1658..2212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 misc_feature complement(2318..>3376) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258192.1:C4-dicarboxylate ABC transporter locus_tag LOCUS_28090 sequence285 source 1..3278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(381..1304) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109834.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 1871..2077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 2113..2274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(2320..3090) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 sequence286 source 1..3255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1001..1438) product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181Y7 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene dut misc_feature complement(1577..>3255) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142666.1:ABC transporter ATP-binding protein locus_tag LOCUS_28150 sequence287 source 1..3193 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1024..1662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(1914..2897) product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND78 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene hemB sequence288 source 1..3149 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(511..894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057643.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 1122..1553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 1671..2732 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBL3 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene hemE sequence289 source 1..3102 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence290 source 1..3070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(387..1616) product NDP-hexose 3-C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(1730..2722) product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435695.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 sequence291 source 1..2965 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 51..935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 sequence292 source 1..2960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 897..2156 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 sequence293 source 1..2958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 927..2954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142700.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 sequence294 source 1..2932 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2118..2312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 sequence295 source 1..2915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1496 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088478.1:nitrate ABC transporter substrate-binding protein locus_tag LOCUS_28270 CDS 1584..2414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 sequence296 source 1..2906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(616..689) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(801..1352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(1470..2174) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056429.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(2174..2449) product UPF0367 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKQ5 transl_table 11 codon_start 1 locus_tag LOCUS_28310 sequence297 source 1..2868 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1448 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021995.1:glycogen debranching enzyme locus_tag LOCUS_28320 CDS 1512..1859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 sequence298 source 1..2780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..555 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816663.1:GntR family transcriptional regulator locus_tag LOCUS_28340 CDS complement(552..1748) product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 misc_feature complement(1839..>2780) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975523.1:NDP-hexose methyltransferase locus_tag LOCUS_28360 sequence299 source 1..2752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..547 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144264.1:ZIP family metal transporter locus_tag LOCUS_28370 CDS 639..1145 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 sequence300 source 1..2692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(275..658) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene rpsM CDS complement(951..1175) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML3 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene infA CDS complement(1220..1774) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD15 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene adk misc_feature complement(1960..>2692) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DML5:protein translocase subunit SecY locus_tag LOCUS_28420 sequence301 source 1..2689 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 775..1116 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(1143..1700) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055910.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(1731..2429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 sequence302 source 1..2646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1328 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141168.1:glucosidase locus_tag LOCUS_28460 CDS complement(1371..2267) product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG4 transl_table 11 codon_start 1 locus_tag LOCUS_28470 sequence303 source 1..2633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(340..885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141208.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 misc_feature complement(1237..>2633) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGA5:GMP synthase [glutamine-hydrolyzing] locus_tag LOCUS_28490 sequence304 source 1..2611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..719 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLF3:glucose-6-phosphate 1-dehydrogenase locus_tag LOCUS_28500 CDS 822..2174 product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene opcA sequence305 source 1..2468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1959..2465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 sequence306 source 1..2416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 41..427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(587..1639) product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLZ9 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene pdxA sequence307 source 1..2332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence308 source 1..2306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..717 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143959.1:glycosyl transferase locus_tag LOCUS_28550 misc_feature complement(768..>2306) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056162.1:transglutaminase locus_tag LOCUS_28560 sequence309 source 1..2141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 230..589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022115.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 549..770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(781..1818) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene xerC sequence310 source 1..1890 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 152..739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 note possible pseudo, frameshifted CDS 790..1578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 note possible pseudo, frameshifted sequence311 source 1..1879 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..869 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DI39:UvrABC system protein C locus_tag LOCUS_28620 CDS 1032..1553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 sequence312 source 1..1609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@