COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..41419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(205..2706) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056743.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 3418..7425 product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056744.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene cobN CDS complement(7527..8345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142967.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(8376..10181) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT0 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene proS CDS 10824..11561 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058197.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(11621..12094) product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815307.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(12247..14019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(14126..16711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(16850..18133) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH91 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene nifS CDS complement(18187..19569) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(19566..20345) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(20372..21814) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene ycf24 CDS complement(21963..22328) product ferredoxin-thioredoxin reductase, catalytic chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK3 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene ftrC CDS 22670..23371 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056342.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 23427..23699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 24024..24539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(24659..24997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886888.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 25109..26038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(26057..26776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(26781..27464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(27525..28283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(28482..31058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 31333..32697 product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCA7 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene glcF CDS complement(32747..34390) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 34619..35968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 36331..36891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 misc_feature complement(37271..>41419) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ61:histidine kinase locus_tag LOCUS_00270 sequence002 source 1..31997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 173..583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 672..1379 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(1390..2511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 2705..4120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 4246..5121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(5139..5507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(5617..7479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057497.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(7580..8722) product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124471.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene wecE CDS 8950..9741 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(9776..13216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 13448..14308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 14356..15492 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259230.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 15631..16773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(16868..17584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(17658..18611) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767531.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(18742..19482) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(19588..20664) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974461.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 20824..21165 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144188.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(21325..21546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(21709..22662) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056888.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 22756..23454 product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJF2 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene rpiA CDS 23568..29255 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(29252..30457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142861.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 30655..31536 product delta-9 desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057556.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene desC3 sequence003 source 1..31432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1076..1450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 1447..2403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 2631..3044 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143408.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(3255..4439) product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD9 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene ndhH CDS 4540..5433 product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCQ1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene rsmH CDS complement(5422..8793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 9764..10438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 10486..11067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 11175..11639 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHW8 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(11878..13296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 13483..15627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(15690..16691) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 16831..19092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 19086..20204 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 20491..20748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(20757..22373) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(22524..23024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(23363..24379) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN83 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene gap1 CDS 24670..26127 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV5 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene murC CDS 26127..27125 product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV6 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene murB CDS 27214..27558 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKX6 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 27688..28071 product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 28269..30131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(30151..30480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(30713..30919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 sequence004 source 1..25856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(409..1398) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143200.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(1602..2120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(2351..2755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(3042..4253) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 5771..8623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 9862..12765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 12936..13682 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407919.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(13702..14973) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268208.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(15060..15731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 15990..16970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142149.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 16974..17462 product TIGR02588 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142148.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(17636..18064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 18438..18974 product photosystem II oxygen-evolving complex 23K protein PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene psbP CDS 18990..19583 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC5 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(19590..20468) product primosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057597.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(20579..21637) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY2 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene purM CDS 22346..23422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 23567..25126 product bifunctional pantoate ligase/cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG73 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene panC/cmk CDS 25183..25749 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK86 transl_table 11 codon_start 1 locus_tag LOCUS_00950 sequence005 source 1..25795 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(294..674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(793..1209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(1259..2635) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207678.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene guaD CDS 2780..3637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(3724..4446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(4446..5078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(5106..6236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058078.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 6515..7972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 8117..8680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 8680..9708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(9805..10917) product DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120072.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene POL4 CDS complement(11400..11564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(11898..12314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(12375..12836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142941.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(12920..13492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058161.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 13719..15065 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 15141..15356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 15362..15619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 15791..16675 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 16800..18383 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 18407..19651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 19629..21257 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026997.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(21451..22347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(22563..22895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(23439..24107) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729836.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 24352..24792 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 sequence006 source 1..25366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(387..731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 938..1345 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124399.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(1342..3555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 4052..4546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 4944..5201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(5274..6077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142774.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 6306..7109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(7280..8779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 9339..12044 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLR3 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene priA CDS complement(12205..12501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 12391..13206 product beta-carotene ketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141726.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene crtO CDS complement(13104..13670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 13834..14229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 14237..15397 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055970.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene nifS CDS 15629..15808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 15942..16844 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056948.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 16847..21076 product SWF/SNF family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 21102..21815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(21849..23963) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(24119..24604) product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(24601..24849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 sequence007 source 1..25328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(839..1759) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(2005..2889) product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI06 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene surE CDS 2995..3990 product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL09 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene pheS CDS complement(4002..4808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(4805..8173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(8275..11073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(11185..11736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(11764..12126) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(12247..13629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(14333..14554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 15577..16248 product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(16252..17610) product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056650.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(17821..19038) product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057271.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(19525..20022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055932.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(20060..20563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(20702..21973) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL96 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene yidC CDS complement(22182..22577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 note possible pseudo, internal stop codon, frameshifted CDS complement(22594..23091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 note possible pseudo, internal stop codon, frameshifted CDS complement(23466..24047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 sequence008 source 1..25043 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 839..1306 product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJU2 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene ndhN CDS 1346..1912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144386.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 1921..2976 product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056586.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 3055..5028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene ycf45 CDS 5234..5641 product photosystem II lipoprotein Psb27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG60 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene psb27 CDS 6011..6391 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene rpsM CDS 6670..7062 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59379 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene rpsK CDS 7195..8139 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFF5 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene rpoA CDS 8303..8653 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK9 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene rplQ CDS 8744..9580 product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM6 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene truA CDS 9639..10091 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK8 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene rplM CDS 10097..10501 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07828 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene rpsI CDS 10527..10781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 10904..12004 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMG9 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene prfA CDS complement(12119..12919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(13457..14254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 14404..15669 product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055915.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(15673..16461) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975024.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 16639..19134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 20002..20433 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(20538..21476) product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene pys CDS 21897..23180 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH33 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene glyA CDS 23681..24745 product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 sequence009 source 1..24918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 896..4021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 4038..4664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 4747..7554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 7650..10307 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056205.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 10397..10981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140824.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 11006..11440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 11530..12744 product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058279.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 12803..13876 product interphotoreceptor retinoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142542.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 14067..14951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 15098..16687 product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 16882..17154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 17144..17398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 17498..17743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(18306..18950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(19024..19203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(19608..20477) product cytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N5 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene petA CDS complement(20661..21200) product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N8 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene petC CDS 21627..21944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 22296..23297 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN6 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene prs CDS complement(23568..23756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(23984..24262) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 sequence010 source 1..24788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(394..1224) product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA6 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene tatC CDS complement(1274..2761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(2900..5188) product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056777.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 5548..7026 product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI46 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene pepA CDS 7147..7566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(7772..9280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(9450..11891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(12647..14278) product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(14481..15320) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(15399..17357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(17816..19585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(19838..23428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 misc_feature complement(23567..>24788) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942942.1:peptidoglycan-associated lipoprotein locus_tag LOCUS_02180 sequence011 source 1..23624 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 374..937 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIB4 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene def CDS 1029..1226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057514.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(1300..1746) product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM56 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene ndk CDS complement(1910..2653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(2766..3116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 3348..4532 product erythromycin biosynthesis sensory transduction protein EryC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257104.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 4611..5573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 5633..6373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 6877..8181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 8278..10497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 10737..11066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene ycf54 CDS 11333..11836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(11976..12431) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(12469..13419) product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene crtE CDS complement(13508..14449) product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMU0 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene folD CDS 14553..15044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 15037..15684 product cobalt-precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056028.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene cobH CDS 15718..16989 product precorrin-6Y C5,15-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056027.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene cobL CDS complement(17026..17418) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056992.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 18037..18261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(18741..18944) product phycobilisome 7.8 kDa linker polypeptide, allophycocyanin-associated, core inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50036 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene apcC CDS complement(19396..19881) product allophycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50031 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene apcB CDS complement(20002..20487) product allophycocyanin alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50030 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene apcA misc_feature complement(21039..>23624) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058198.1:photosystem I reaction center subunit X locus_tag LOCUS_02420 sequence012 source 1..23011 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1119..1499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(1508..3094) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY2 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene pgi CDS 3417..4424 product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIH3 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene ccsA CDS complement(4455..5123) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056872.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene ycf39 CDS 5598..6179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(6176..7132) product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKP2 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 7716..9884 product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6D2 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene glgX CDS 9927..10325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(10336..10608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(10948..12237) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144167.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(12412..12825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(12984..13415) product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCJ4 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene spoIIAA CDS complement(13611..14825) product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU5 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene carA CDS 15149..16195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(16251..18254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(18716..20074) product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN4 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene argJ CDS 20273..21775 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIC3 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene lnt misc_feature complement(21825..>23011) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056474.1:diguanylate cyclase locus_tag LOCUS_02600 sequence013 source 1..22562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(214..1821) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59177 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene gpmI CDS complement(2761..4491) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 4642..5436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(5440..6450) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCV1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene pyrB CDS 6605..7237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(7311..7925) product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH13 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 8238..9899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056997.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 9991..10782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 10896..12737 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI5 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene ftsH CDS complement(13022..13843) product 6-pyruvoyltetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 14320..14757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056168.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 15080..15586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(15600..16403) product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMQ7 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene rsmG CDS complement(16407..17066) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056125.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 17230..17676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056063.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 17759..18190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 18449..20530 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729174.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 20586..22064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900521.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 sequence014 source 1..22298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(324..2114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(2507..3289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(3286..3750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 4108..4362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(4438..4887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(4943..5908) product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120225.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene axeA CDS 6000..6896 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(7042..7851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(8224..11124) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057179.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene polA CDS 11541..12500 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKE4 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene rnz CDS complement(12519..12944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057567.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(13052..13621) product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene cobU CDS 13720..14091 product putative 30S ribosomal protein PSRP-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59327 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 14401..15012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(15039..15791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258579.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(15929..17068) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056452.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(17250..17663) product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA75 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene atpC CDS complement(17852..19309) product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG8 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene atpD CDS 19768..20079 product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TV92 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene groS CDS 20157..21785 product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD4 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene groL sequence015 source 1..22090 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(306..2054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(2500..2952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(3295..5970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 6371..8926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 9097..9459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 9520..11031 product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7U9 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene ilvA CDS complement(11046..12530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 13074..17675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057482.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 17791..18747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 18869..19396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 20249..20908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(20973..21539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 sequence016 source 1..21948 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1164 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056923.1:modulator of DNA gyrase locus_tag LOCUS_03110 CDS complement(1448..2935) product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118829.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene uxuB CDS complement(2971..4119) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267680.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(4353..5183) product mannitol ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369336.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(5198..6115) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203801.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(6145..7494) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525578.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene smoE CDS 7768..8670 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 8958..9989 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528410.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 10091..10924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(11312..11812) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970782.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene pecS CDS 11941..12801 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058717.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 12798..13208 product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709458.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(13221..14351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 14946..16526 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142505.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(16595..17725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057388.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(17832..18416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 18729..20453 product potassium efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140386.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 sequence017 source 1..21927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 264..3011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 3124..4800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 4793..6478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 6481..7485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 7864..10599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 10671..12017 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 12133..13188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331298.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 13372..14748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 15067..15912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 15945..16652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 16811..17077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 17095..17361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 17533..17829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(18184..20640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 sequence018 source 1..21248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 601..1668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(2003..3646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 4659..5558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 5629..6300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 6355..6963 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH7 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene aroK CDS 6972..7892 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59303 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene argB CDS 7900..8772 product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JS5 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene rimK CDS 8868..9698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143597.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(9705..10379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(10755..10919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 10846..12594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 12791..13528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 14549..16282 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142666.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(16413..17042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(17071..18459) product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403394.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(18590..20098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 misc_feature complement(20082..>21248) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986981.1:capsular polysaccharide biosynthesis protein locus_tag LOCUS_03580 sequence019 source 1..21184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2692..5625) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056203.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(5687..6211) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056202.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene cheW CDS complement(6226..6588) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 7153..8895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 9123..9332 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941132.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 9505..9768 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(9976..10647) product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene lrtA CDS 10830..11513 product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKM7 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene lipB CDS complement(11632..12882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(12872..13843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 14041..15675 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125229.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(15653..16096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(16322..16804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 17379..18569 product adaptive-response sensory-kinase SasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMT2 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene sasA CDS complement(18640..19317) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056138.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(19522..20673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 sequence020 source 1..20972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3130..6582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(6595..7470) product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMS0 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene fabD CDS complement(7528..8562) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL4 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene fabH CDS complement(8568..9656) product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL5 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene plsX CDS complement(9756..10484) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058197.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 10986..12437 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX9 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene radA CDS 12598..12975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(12991..14139) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 14253..14849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124824.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(14846..15742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140468.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(16119..17222) product magnesium-protoporphyrin IX monomethyl ester [oxidative] cyclase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ05 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene acsF1 CDS complement(17309..17479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 17445..17912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(17924..19546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057472.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 19617..20093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057333.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 sequence021 source 1..20875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(925..1593) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142341.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 1815..2486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 2501..3553 product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057463.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene cobW CDS complement(3661..6939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 7071..9191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 9359..10060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(10040..11287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(11427..13499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056794.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 13911..15770 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNY7 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene recN CDS 15884..17470 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(17500..17982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 18693..19001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(19031..19504) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 sequence022 source 1..20693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2626 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7V9F2:UvrABC system protein A locus_tag LOCUS_04030 CDS complement(2668..2925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056228.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(3523..4008) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124513.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene fcbC CDS 4188..5042 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057366.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(5257..6321) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR8 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene gap1 CDS 6842..9469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(9447..9683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 9984..10838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 10856..11491 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 11907..12602 product phycobilisome rod-core linker polypeptide CpcG4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50041 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene cpcG4 CDS complement(12727..13701) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP3 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(13715..14407) product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142574.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene cobA CDS 14487..14660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(14831..15727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 tRNA 16065..16138 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(16301..17110) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023261.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(17450..19021) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA6 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene purF misc_feature complement(19214..>20693) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DIA7:phosphoribosylformylglycinamidine synthase subunit PurL locus_tag LOCUS_04190 sequence023 source 1..20562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(84..575) product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR4 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(771..1286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142895.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(1516..2517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057861.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(2822..3196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057860.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 3422..4840 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(4843..5637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 5886..6419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(6568..6846) product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(6860..7285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(7368..7781) product Fe-S cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 8004..8186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(8274..8900) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL91 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene ispD CDS 9171..10148 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057967.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 10288..10947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(11313..12866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057727.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 12973..13659 product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056120.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene cobO CDS complement(13691..14176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 14338..15246 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948245.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene sagG CDS 15288..15503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(15509..16051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(16201..16485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(16885..19602) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW6 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene recG sequence024 source 1..20229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1052..1963) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 2065..2934 product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR7 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene rsmI CDS 2963..4432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(4488..5141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 5470..5865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889221.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 6217..6513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 6746..7801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(7860..9515) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226038.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene recQ tRNA complement(9791..9863) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(9957..10604) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 11267..12202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 12542..12922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 13056..15185 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056974.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(15232..17706) product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL37 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene pheT CDS 17843..19351 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 19436..19690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144012.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 sequence025 source 1..19787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 434..700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 867..1034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 1208..2368 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057389.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 2692..4176 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 4233..5078 product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887938.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 5233..5943 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056348.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 6042..6515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(6899..7876) product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene nadA CDS complement(8124..8879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 9013..9900 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 tRNA 9975..10061 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 10176..10925 product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS5 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene comB CDS complement(11001..11891) product biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140852.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene bvdR CDS 12454..12753 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene fdx CDS 13053..14222 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(14523..14873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(15044..16555) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057713.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(16769..17128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 17416..19638 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142623.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene recQ sequence026 source 1..19659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 283..510 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141485.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(704..2422) product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058297.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene mutL CDS complement(2715..4271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 4720..6669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(7180..8016) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH2 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene dapB CDS complement(8216..8581) product phospholipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143796.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 8749..9855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057303.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 10173..11294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 11463..11876 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 12079..12558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056418.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 12611..16600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 sequence027 source 1..19557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..661 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058059.1:oxidoreductase locus_tag LOCUS_04860 CDS complement(658..1347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(1475..1849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(1938..2816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(2887..3615) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 3736..4476 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 4652..5452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(5542..6369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 6442..7056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(7288..8658) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141457.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene aspA CDS complement(8742..9269) product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D8P6 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene ogt CDS 9341..10444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(10671..11513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 12254..13240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 13609..15957 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144130.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(15973..17133) product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ7 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene pfkA CDS complement(17301..19085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 sequence028 source 1..19444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(485..967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140611.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(1103..1342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 2000..2992 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJJ6 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene thrC CDS complement(2989..3444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(3472..5010) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056715.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 5158..5853 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056716.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(5850..7136) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141684.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(7171..8355) product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene ctpA CDS 8800..9468 product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8M7 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene petB CDS 9683..10165 product cytochrome b6-f complex subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N3 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene petD CDS 10606..11208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 11263..12264 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ72 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene gmd CDS 12372..13490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 13581..14018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(14039..14335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 14710..15120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene ycf20 CDS complement(15104..15703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(15816..16340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(16691..17578) product glutamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142777.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(17598..17951) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH02 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene rplT CDS complement(18051..18248) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9L2 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene rpmI CDS 18432..19190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene ycf23 sequence029 source 1..19381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1493..2914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143146.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 3088..3648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(3666..4325) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 4536..4826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 5221..6297 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene gmd CDS 6544..7239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(7264..7797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(7842..9410) product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN5 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene purH CDS 9520..10155 product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 10307..10573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 10592..11788 product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058298.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 12039..12974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(13231..13980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 tRNA complement(14241..14314) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 14368..14775 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(14927..15565) product ribosomal-protein-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(15562..16083) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene ycf52 CDS 16370..17089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057518.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 17202..18224 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 misc_feature complement(18221..>19381) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLI9:tRNA N6-adenosine threonylcarbamoyltransferase locus_tag LOCUS_05430 sequence030 source 1..19022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(480..1817) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 2031..2735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 2749..3705 product lactose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(3725..4009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 4669..5553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(5673..6371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 6486..8012 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114099.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(8103..9875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 10414..11604 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056757.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene nifS CDS 11706..12449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 12515..13066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 13684..14289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(14514..15716) product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(15778..16998) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057886.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene gldA CDS complement(17086..17604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056935.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene ycf51 sequence031 source 1..18896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(356..955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 1092..1934 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH54 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene pheA CDS complement(2017..2529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(2640..3305) product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(3411..3731) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA06 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene rpsJ CDS complement(3888..5117) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50064 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene tufA CDS complement(5146..7221) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI43 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene fusA CDS complement(7392..7862) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI44 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene rpsG CDS complement(7997..8371) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59168 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene rpsL CDS complement(8501..8854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(9051..9479) product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(9911..12004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 12848..17497 product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057208.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene glsF CDS 17612..18586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143123.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 sequence032 source 1..18787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(506..907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(1042..1530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(1650..4604) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGS4 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene mutS CDS 4950..7625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 7811..8773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(8960..11848) product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(11966..12646) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ7 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene gmk CDS complement(12821..13576) product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59288 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene pcyA CDS 14007..17108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 17296..18189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(18198..18434) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene secG sequence033 source 1..18777 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(320..1213) product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene phnD CDS 1878..2084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056228.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 2441..3055 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056089.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(3427..4689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(4830..5681) product precorrin-2 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057289.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene cobI CDS complement(5737..7179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 7368..8720 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(8947..10809) product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057278.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(10952..11905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(11977..12606) product fibrillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 12748..12987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 13964..15004 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK95 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene mraY tmRNA complement(15089..15481) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 15858..16319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 16584..17357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(17362..17820) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948156.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 misc_feature complement(17786..>18777) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056694.1:citramalate synthase locus_tag LOCUS_05990 sequence034 source 1..18512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(411..2918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(2948..3415) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 3626..5752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 5868..6203 product photosystem II reaction center Psb28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ8 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene psb28 CDS 6285..6824 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34457 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene moaB CDS 7206..7526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056708.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 7582..8055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(8076..8252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(8344..10806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(11186..11701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(11982..12518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 13088..13258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(13500..14276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(14922..16829) product chaperone protein dnaK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI58 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene dnaK2 CDS 17026..17352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(17446..18078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142166.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 sequence035 source 1..18488 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1222..2829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 4260..8249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 8197..9210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 9328..10056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 10285..11319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 11439..12497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 12807..14117 product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(14269..14757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 14930..16705 product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141553.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 16806..17045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 misc_feature complement(17205..>18488) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920227.1:5-oxoprolinase locus_tag LOCUS_06260 sequence036 source 1..18282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1258..2322) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056195.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(2469..3515) product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142928.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(3677..4246) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709012.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 4526..4960 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143722.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(5025..8114) product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJM9 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 8396..9157 product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055907.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene ccdA CDS 9171..10586 product cytochrome c biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL16 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene ccsB CDS 11160..11423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(11527..12189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 12397..13116 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 13527..14948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(15138..16199) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGD6 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene rfbB CDS complement(16394..17470) product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene rfbA misc_feature complement(17548..>18282) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143224.1:NAD(P)-dependent oxidoreductase locus_tag LOCUS_06400 sequence037 source 1..18041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 574..867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(1132..2604) product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene cry CDS complement(2735..3694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056521.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(3706..4689) product sugar-non-specific nuclease NucA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142295.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 4938..5411 product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 5524..5865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 5894..6373 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141734.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(6385..7218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 7595..8293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 8418..9890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 9887..11395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 11395..12933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(12954..14975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(15122..16111) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064307.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 16356..17828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 sequence038 source 1..17947 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..894 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057960.1:carbon dioxide transporter locus_tag LOCUS_06560 CDS complement(978..2789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 3078..5405 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057757.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(5736..6275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(8182..8805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057402.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene ycf21 tRNA complement(9062..9146) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 9484..10827 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene accC CDS complement(10967..11344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(11847..12335) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC4 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene ispF CDS complement(12398..13099) product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM2 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene trmD CDS complement(13202..14209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(14356..15114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057755.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 15286..15867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 15970..16851 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH03 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene lgt sequence039 source 1..17729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 578..1912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(2017..3408) product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM0 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 3539..4204 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 4725..6137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(6257..6979) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 7482..8123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(8206..9405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 9519..9902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 10018..10887 product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND55 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 11019..11294 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140011.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(11481..12812) product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene opcA CDS complement(12976..14505) product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF3 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene zwf CDS complement(14642..15700) product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF2 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene fbp CDS 16037..17575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056379.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene tldD sequence040 source 1..17581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3343..3894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(4338..5789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 5993..6286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 6696..7070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 7662..7973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 8256..9260 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125344.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene tas CDS 9269..10480 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143013.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 10678..12477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 12656..12979 product bacteriophage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205297.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 12976..13287 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272449.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 13314..13577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_003858613.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 13596..14153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 14250..15440 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056978.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene ndbB CDS 15500..16147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056977.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 sequence041 source 1..17243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(106..1776) product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056162.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 2023..2262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(2382..2606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 3795..5906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 6059..6601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(6750..7292) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(7313..8254) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086042.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 8572..8751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 8799..9677 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene ghr CDS complement(9709..10515) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPE7 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene uppS CDS 11546..14008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 14777..15025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 15417..16721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 sequence042 source 1..17128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 1118..1200 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 1601..2755 product putative glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 2814..3266 product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 4059..5912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 tRNA 6132..6204 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 7020..7625 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene tpx CDS 7673..8218 product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057129.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 tRNA complement(8392..8482) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(8582..9781) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM4 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 10051..10551 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 10684..11889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057105.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 11973..13130 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC5 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 13476..14594 product NAD(P)H-quinone oxidoreductase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL32 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene ndhA CDS 14648..15283 product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL31 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene ndhI CDS 15326..15928 product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene ndhG CDS 16001..16306 product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL29 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene ndhE sequence043 source 1..16938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2653..3855 product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNL4 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene bioF CDS 3872..4096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(4209..5831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056988.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 6238..7335 product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH08 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene ribD CDS complement(7290..7652) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH72 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene trxM2 CDS complement(8198..9040) product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058216.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(9238..9807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(10037..10897) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87X74 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene purU-3 CDS 11209..11772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 12460..13149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(13251..14444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(14920..15165) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 sequence044 source 1..16665 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1212..1460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(1558..2157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(2270..2446) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene rpmF CDS complement(2541..3521) product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGF1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene thiL CDS complement(3534..4655) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 4984..5544 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD3 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene efp CDS 5644..6147 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene accB CDS 6529..6987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(7062..8000) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143278.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(8052..8990) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(9192..9410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 9445..9678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(9686..11344) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118433.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene dnlI CDS 11796..12470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(12539..13687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 14345..14995 product phosphoheptose isomerase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMN3 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene gmhA2 CDS 15100..15816 product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene hddC CDS 15838..16410 product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AI34 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene gmhB sequence045 source 1..16565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 23..207 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcggaaacgcatctaactccctattagggattgaaa CDS 428..766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 871..1602 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEG8 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene pdxJ CDS 1619..2005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886681.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(2037..3146) product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNC3 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene hisC CDS complement(3255..5078) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(5309..6430) product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ26 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene fni CDS complement(6626..7171) product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ7 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene pyrR CDS complement(7436..8428) product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene cobD CDS complement(8520..8975) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 9736..10137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 10274..11917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(11938..13494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 13927..14184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(14290..14859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 misc_feature complement(14990..>16565) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004544542.1:two-component system sensor kinase locus_tag LOCUS_07670 sequence046 source 1..16536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(601..2898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 3422..3928 product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 3943..4542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(4621..5349) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339088.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 5572..6117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 6242..6853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(6850..8052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(8377..9471) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258191.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 tRNA 9667..9740 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(9772..11262) product circadian clock protein kinase KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V60 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene kaiC CDS complement(11466..11804) product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V61 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene kaiB CDS complement(11853..12716) product circadian clock protein KaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V62 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene kaiA CDS 12902..13306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 13311..13853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 13917..14693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 14722..15231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(15329..15937) product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 16037..16432 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088578.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 sequence047 source 1..16527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..573 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DL06:aconitate hydratase B locus_tag LOCUS_07850 CDS complement(799..1668) product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DN5 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(1899..2678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(2675..3319) product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057258.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(3319..3942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(3921..4670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057260.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 5240..5479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 5702..5881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(6193..7389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(7878..10622) product B12-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058092.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(10969..11292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(12584..13027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 13449..13742 product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056066.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene clpS CDS 13844..14722 product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056065.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(14759..15577) product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX4 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene map CDS 15751..16071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 sequence048 source 1..16487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 426..2114 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057147.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene cobJ CDS complement(2089..3636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(4033..4419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 4682..5518 product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A431 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene psbO CDS 5861..6640 product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene sigF CDS 6960..8006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 8196..8525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 8592..9158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 9223..10071 product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDK6 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene mutM CDS 10099..10377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(10574..12907) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA8 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene ppk CDS complement(13089..13295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(13587..15308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056580.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(15627..16193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 sequence049 source 1..16411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(205..1959) product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI64 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene ribA CDS complement(2057..2479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 3537..4331 product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1Z5 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 4684..7020 product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057710.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene zam CDS 7057..7683 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK39 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene ubiX CDS 7687..8910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 9092..10672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(10662..11168) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057974.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(11287..11679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene ycf35 CDS complement(11748..11969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 12195..12713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 12850..13407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 13418..15025 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(15044..15724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 sequence050 source 1..16034 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 219..1082 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836249.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene usp CDS 1228..2163 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene pstS CDS 2537..3463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 3668..4912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(4967..5797) product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ4 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene map CDS 5913..6275 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC4 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene rplS tRNA 6398..6472 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 6679..6990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 7068..7724 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM29 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene nusG CDS 7919..8344 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM28 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene rplK CDS 8429..9154 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM27 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene rplA CDS 9464..9988 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDY7 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene rplJ CDS 10062..10448 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM25 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene rplL CDS 10579..11196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 11207..12607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(12631..13077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(13161..15371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 sequence051 source 1..15976 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1217..1366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(1491..2597) product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM7 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene tgt CDS complement(2745..3185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 3815..4549 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ91 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene cobS CDS 4717..5316 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene leuD CDS complement(5330..5833) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(6046..7017) product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene sds CDS complement(8047..8979) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM3 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene murI CDS complement(9479..10954) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056302.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(11125..11937) product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 12085..13248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 13394..13786 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMF1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene rplU CDS 13889..14149 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NME2 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene rpmA sequence052 source 1..15920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(437..2911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 tRNA complement(2981..3052) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 3259..5580 product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU9 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene topA CDS complement(5551..6006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(6299..7696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 8152..9726 product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene nirA CDS 10000..11628 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene crnA CDS 11821..14088 product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057195.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene narB CDS 14393..14848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(14946..15596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 sequence053 source 1..15807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1279..1683) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WUN1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene infC CDS complement(2129..3937) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225606.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(4183..5982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143667.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(6078..7070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(7398..8312) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene murQ CDS complement(8414..8830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056170.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 8984..11131 product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGX0 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene glyS CDS 11884..13755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 13939..14502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 sequence054 source 1..15792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 176..1486 product putative biofilm formation methyltransferase WspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXT5 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene wspC CDS 1840..3186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 3355..4758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 4758..5387 product chew domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525366.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 5384..7927 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525365.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 8145..9209 product chemotaxis response regulator protein-glutamate methylesterase of group 3 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXT8 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene cheB3 CDS 9276..10712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(10754..11599) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057297.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 11768..13765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(13833..14666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(15152..15613) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027506.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 sequence055 source 1..15725 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(38..607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 1296..3152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 3268..4986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 5084..5563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(5881..6120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(6594..7079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057109.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(7302..7853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(7974..8357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 8492..9574 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKE5 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene dinB CDS complement(9582..10196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(10251..11162) product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946299.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 11467..11835 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057655.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 11825..13273 product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057654.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene ndhD5 CDS 13270..13689 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057653.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 13689..13970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 13981..14400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 14393..14689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 14686..15345 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 sequence056 source 1..15450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 283..843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 940..2289 product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN8 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene murD CDS 2655..3287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(3594..4739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 5068..5868 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124285.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene gst CDS 6021..7304 product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143064.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene glcE CDS 7398..7637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 7727..8560 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972040.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(8844..9710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 9860..10414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 10513..12834 product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB8 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene glgB CDS 12851..13561 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583597.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 13664..13819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 13954..15435 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480254.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 sequence057 source 1..15405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(430..1008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(1069..2211) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228175.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(2453..2962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 3241..3564 product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056468.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 3716..5773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 5846..7432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 7687..9216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 9469..11340 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056078.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 11386..11946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024991.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(12228..12401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(12426..12800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 12944..13750 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227999.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 13858..14334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 14390..14653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 14653..15069 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 sequence058 source 1..15403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 254..652 product virulence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene glod5 CDS 662..913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 note possible pseudo, frameshifted CDS 951..1337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 note possible pseudo, frameshifted CDS 1411..2463 product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A861 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 2450..3499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 3500..3658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 3637..4029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(4070..4297) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML3 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene infA CDS complement(4445..4999) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD15 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene adk CDS complement(4999..6312) product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML5 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene secY CDS complement(6462..6902) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9X9 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene rplO CDS complement(6990..7523) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59126 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene rpsE CDS complement(7607..7963) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EJ4 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene rplR CDS complement(8015..8551) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML8 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene rplF CDS complement(8606..9007) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML9 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene rpsH CDS complement(9046..9591) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM0 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene rplE CDS complement(9659..10003) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene rplX CDS complement(10004..10372) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM2 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene rplN CDS complement(10392..10640) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM3 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene rpsQ CDS complement(10640..10981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(10988..11359) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM5 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene rplP CDS complement(11488..12219) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59187 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene rpsC CDS complement(12264..12626) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM6 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene rplV CDS complement(12649..12897) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM7 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene rpsS CDS complement(12966..13829) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM8 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene rplB CDS complement(13921..14226) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9W4 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene rplW CDS complement(14219..14851) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN0 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene rplD misc_feature complement(14854..>15403) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DMN1:50S ribosomal protein L3 locus_tag LOCUS_09610 sequence059 source 1..15171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1035..1700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140739.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(1721..2224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140739.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(2790..3092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(3356..4312) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939517.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 4693..5496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 5572..6030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 6916..7197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 7190..7480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(7520..9739) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143066.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 10113..10778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(10783..13881) product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 misc_feature complement(13945..>15171) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142490.1:secretion protein HlyD locus_tag LOCUS_09730 sequence060 source 1..15073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(329..634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141186.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene cpeR CDS complement(640..1323) product chromophore lyase CpcT/CpeT 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD3 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene cpcT3 CDS complement(1391..1879) product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD4 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene cpeS CDS complement(2396..3133) product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141264.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene cpeD CDS complement(3248..4129) product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141263.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene cpeC CDS complement(4489..5172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(5185..5745) product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141254.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(5799..6650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(6647..6907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 7100..7774 product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141257.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene nblB CDS 7951..8538 product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKE7 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene cpcS CDS complement(8573..8860) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(8860..9138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(9312..9800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 10019..11440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(11859..12782) product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 sequence061 source 1..15068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(150..1148) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP8 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene menC CDS complement(1200..1970) product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW6 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene menA CDS 2560..4374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 4727..5764 product D-fructose 1,6-bisphosphatase class 2/sedoheptulose 1,7-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE9 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 5918..6091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 6212..7513 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI53 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene hemA CDS complement(7673..8572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 9047..10066 product inward rectifier potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 10224..10775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056704.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(10818..11525) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057523.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene ribC CDS 11932..12423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141860.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 12618..13679 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 sequence062 source 1..14993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1154..1324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(1425..2339) product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE4 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene mtnP CDS 2570..3712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(3776..4648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057694.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 4723..6027 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057579.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene avtA CDS 6027..6704 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK05 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene rimM CDS complement(6841..7734) product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKN7 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene kdsA CDS complement(7738..8508) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFA8 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene kdsB CDS complement(8521..9576) product putative phosphosugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67500 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(9623..11038) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene xapH CDS complement(11041..11817) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN7 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(11960..13216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(13213..14493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 sequence063 source 1..14907 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2024 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DHY6:biosynthetic arginine decarboxylase locus_tag LOCUS_10150 CDS complement(2042..3433) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405421.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(3430..4998) product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene ggt CDS 5271..6035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 6134..6388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056812.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 6664..7881 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(8570..9532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 9659..10768 product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK75 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 10917..11567 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(11722..12717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 13351..14679 product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265553.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 sequence064 source 1..14715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 506..901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(983..4198) product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056145.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(5478..6845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 7143..7919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(7943..8809) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene cdsA CDS complement(8950..9906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(9911..11437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(11538..12599) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene wcaA CDS 13080..14504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 sequence065 source 1..14500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 593..931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 932..1537 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene lipA CDS complement(1573..2001) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(2173..3183) product hopanoid biosynthesis associated radical SAM protein HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 3356..4192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 4309..6981 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141744.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 6971..7684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056940.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(7711..8337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141714.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(8512..9138) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 9346..9933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 10008..11393 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 11406..12452 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 sequence066 source 1..14323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1581..2273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(2915..3124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(3646..4512) product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene gluQ CDS 5111..5362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(5397..6260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 7055..8272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(8358..8651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 8904..10472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 10535..13954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 sequence067 source 1..14289 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 632..2854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 2923..3546 product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGB4 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(3553..3840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(4130..4726) product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141084.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 4777..5049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 5103..5597 product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM0 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene smpB CDS complement(5681..7282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(7536..8276) product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene sigF CDS 8972..9742 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056315.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 10106..10984 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG6 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene prfB CDS 11042..11233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 11243..11740 product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIK0 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene ybeY CDS 11916..12437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 12464..13057 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene trpG CDS 13615..14217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 sequence068 source 1..14269 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 439..1884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 1920..3275 product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084306.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(3612..4883) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701154.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(5282..6415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 6842..8308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 8695..9462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 9967..11418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140470.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(11774..13015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530607.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 sequence069 source 1..14229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(165..1529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 1949..4558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(4679..6406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(6587..7549) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene fcl CDS complement(7709..8821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(8860..9633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(9839..10678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 sequence070 source 1..13896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 367..627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(892..1701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258579.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(1791..2162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(2152..2403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 tRNA complement(2427..2499) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(2643..3083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(3208..3432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 3649..4188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 4299..5423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056254.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 5771..6466 product aldehyde decarbonylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB4 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 6701..7660 product long-chain acyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057152.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 7954..8928 product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB6 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene accA CDS 8938..9672 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 9764..10525 product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB8 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene folE CDS 10545..10769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 10873..11346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056683.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 11346..12086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056083.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(12069..12659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(12707..13297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 misc_feature complement(13319..>13896) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057144.1:site-2 protease family protein locus_tag LOCUS_11040 sequence071 source 1..13697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1527..2363) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG66 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene menB CDS 2475..3056 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(3435..3788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 3891..4745 product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022097.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 4774..5535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 5725..6078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057859.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(6188..7438) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 7934..8785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 9462..10349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(10411..11667) product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056562.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 11741..12022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene ycf34 CDS complement(12085..12948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 sequence072 source 1..13569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(229..3480) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(3631..4584) product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(4738..5160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(5178..5426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 5820..6023 product photosystem II reaction center protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ43 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene psbH CDS 6201..6518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 6535..7173 product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ45 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene pth CDS 7325..9232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 9229..10479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(10508..10870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(10867..11286) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 11373..12344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140544.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 sequence073 source 1..13515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 272..862 product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144254.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(906..1973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(2164..3258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057303.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(3462..4754) product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL40 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene eno CDS 4872..5240 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0T3 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene gloA CDS complement(5393..5614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(5661..6023) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227980.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 6341..8227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(8269..12033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 sequence074 source 1..13451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480254.1:alpha-amylase locus_tag LOCUS_11380 CDS 1618..2490 product TIGR00268 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057083.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 2525..2698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 2785..4680 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene ndhF CDS 4751..6304 product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene ndhD CDS 6331..7632 product carbon dioxide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141007.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene cupA CDS 7704..8105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056075.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(8133..8387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H447 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene ypzJ CDS complement(8401..8724) product UPF0213 protein YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45472 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene yhbQ CDS complement(8696..9622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(9826..10734) product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140187.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(10731..10910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 10923..12137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057862.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 12279..13436 product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 sequence075 source 1..13445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(581..2617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 2790..4259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 4865..7309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 7405..7968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 8204..9640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 sequence076 source 1..13416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 72..965 product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKQ1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene hslO CDS 996..1478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1598..2899 product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHI2 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene sbcD CDS 3331..4356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 4448..5944 product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT38 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene glpK CDS 6000..7736 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887662.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 7741..8598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057340.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(8786..11065) product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNN4 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene katG CDS 11293..12345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056632.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 sequence077 source 1..13241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 113..1348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 1349..2509 product two-component system sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544542.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(2531..3472) product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF59 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene gpsA CDS 3896..4210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 4463..5455 product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(5898..6617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(7026..7433) product plastocyanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125233.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene petE CDS 7750..8139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055984.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(8270..9415) product UPF0284 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGL0 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(9412..10332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(10353..11042) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057970.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 sequence078 source 1..13163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 508..1404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(1416..1949) product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI91 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene cpcS CDS 2133..3197 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBL3 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene hemE CDS 3289..4233 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(4316..4663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(4735..4938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(5226..5714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(5919..6557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 6819..8354 product gluconate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255195.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 8439..9671 product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene ruvB CDS 9824..10687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 11129..12733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 sequence079 source 1..13126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1032 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057032.1:site-2 protease family protein locus_tag LOCUS_11890 CDS 1190..1672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 1912..2754 product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK8 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene cysE CDS complement(2751..3380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 3761..4855 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(4941..6665) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057517.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene ppx CDS complement(6948..7358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(7451..8119) product beta-carotene ketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141726.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene crtO CDS 8441..8941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(9072..9284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 9968..11827 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW0 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene thrS CDS 11909..12454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 sequence080 source 1..13101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(355..996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1243..1797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057906.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(2174..2527) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNH7 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene rpsF CDS 2765..3511 product 5-oxo-1,2,5-tricarboxylic-3-penten acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057118.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(3602..4096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143287.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(4240..4497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(4894..6417) product DEAD-box ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHF7 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene cshA CDS complement(6515..7945) product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL8 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene rimO CDS 8282..9136 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene btpA CDS 9383..10318 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056436.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(10483..11850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 12024..12470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142477.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(12536..13009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 sequence081 source 1..13054 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 429..1892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 1892..3352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(3543..4352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 4589..5095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 5095..6720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene crtH CDS 6727..7272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(7333..8298) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND12 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene prk CDS 8712..11309 product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(11446..11706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 11988..12806 product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P3 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene cphB sequence082 source 1..13030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(244..678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056714.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(722..1708) product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB9 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene secF CDS complement(1846..3285) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB8 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene secD CDS complement(3524..4507) product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(4656..5684) product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ3 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene pdhA CDS 6258..8615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 9090..9746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056685.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 9743..11290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 11371..12978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 sequence083 source 1..13010 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 148..399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057397.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 634..1002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 983..2182 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 2281..5046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055983.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 5374..7338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 7584..8192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(8331..8492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(8834..9442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114316.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 9544..10788 product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH57 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene dapL CDS complement(11027..13009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 sequence084 source 1..13006 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(810..1295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1347..4265) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(4339..6882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(6966..7580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(7577..7942) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(8559..8798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(8835..11630) product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR4 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene topA CDS 11689..11928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 sequence085 source 1..12959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..829 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037121.1:sensor histidine kinase locus_tag LOCUS_12510 CDS complement(892..1938) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 2092..2580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(2696..3574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(3760..7542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(7816..10503) product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058103.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 10783..11235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 11271..11954 product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(12126..12959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 sequence086 source 1..12871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(169..1323) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene lpxB CDS complement(1344..2165) product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJG5 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene lpxA CDS complement(2248..2769) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TV98 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene fabZ CDS complement(2923..3807) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI02 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene lpxC CDS complement(3807..6266) product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057626.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(6611..7372) product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIT5 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene purC CDS complement(7450..7740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(7754..8086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(8230..8442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(8628..8918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090339.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 9099..10154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 10951..11217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 11539..12246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 sequence087 source 1..12830 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 489..1640 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140086.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(1971..2126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 2077..3696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(3810..4805) product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057563.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 4925..6370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(6378..7040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(7065..7403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(7455..9212) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKN4 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene argS CDS 9466..9957 product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 10174..10674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(10861..11391) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGB1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene def2 CDS 11578..12135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 sequence088 source 1..12775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 788..3601 product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058004.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 3737..6781 product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056271.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene putA CDS complement(6935..7501) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 8037..8972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206545.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 sequence089 source 1..12719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1334..2137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(2077..2802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 2894..3445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(3526..4224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(4478..5614) product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9V8 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene recA CDS 5976..6170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(6193..8223) product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267573.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 8466..9692 product tyrosine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883602.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene tyrP_2 CDS complement(10042..11742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(11832..12398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 sequence090 source 1..12645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 792..2174 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG2 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene purA CDS 2321..2956 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNL2 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene rplY CDS 3138..4202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 note possible pseudo, frameshifted CDS 4208..4708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 note possible pseudo, frameshifted CDS 4859..5140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 5163..5957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 6000..6251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(6261..6647) product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227926.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(6921..8372) product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB2 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene sun CDS complement(8369..8554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 8758..9222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(9383..10120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707254.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 10240..10845 product ATP-dependent Clp protease proteolytic subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9L6 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene clpP3 CDS complement(10951..11406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 11591..12058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(12090..12476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 sequence091 source 1..12553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 171..1436 product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH31 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 1800..1937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 2026..2436 product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ7 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene aroQ CDS 2440..3057 product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(3083..4570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 4714..5244 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057216.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 5435..6721 product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y936 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(7895..8497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(8505..10874) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM14 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(10971..12320) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879798.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 sequence092 source 1..12550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(211..936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 1040..1771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1930..2088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(2471..3256) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN7 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene hisF CDS 3343..3546 product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056374.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 3586..4710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 4735..5748 product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057379.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene chlG CDS 6460..8706 product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124578.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene mrcB CDS 8867..10693 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057025.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 10814..11011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 11013..12437 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055871.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 sequence093 source 1..12529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 760..975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 1858..2190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057900.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 2348..3586 product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW4 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene xseA CDS 3637..3882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(3995..5545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(5811..7322) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJI4 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene murE CDS complement(7473..7808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 8014..8796 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK35 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene cysH CDS 8890..10386 product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366535.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(10343..10768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(10983..11282) product UPF0296 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ID1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 11517..11705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 sequence094 source 1..12477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 45..1085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143229.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 1095..2879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 3015..4454 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 4654..5460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 5953..6294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 6984..7679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(7905..8180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 8593..9048 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(9226..9429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 9567..10013 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(10553..11464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 11704..12084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 sequence095 source 1..12389 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(179..898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(1018..1296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 1451..1618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 2103..2486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 2470..2865 product VapC ribonuclease Y4jK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55511 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 2939..3262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 3262..3471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(3479..4300) product lactose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(4300..5205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(5205..6086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 6466..7446 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144236.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 7623..7883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 7864..8427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 8579..8914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(8918..9802) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(9907..11244) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDN9 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene clpX CDS complement(11249..11923) product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI2 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene clpP1 sequence096 source 1..12375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 675..965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 1111..1347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 1344..1730 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(1909..2634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(2666..2956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(2975..3370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 3478..3732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(3840..4454) product FMN-dependent NADH-azoreductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5F3 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene azoR1 CDS 4752..5381 product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(5696..6580) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(6954..7658) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140297.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(7702..8544) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227679.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(8595..8828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(9169..9951) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(9948..10433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(10484..11017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(11098..12135) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403480.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 sequence097 source 1..12279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2176..3414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(3472..4356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(4574..7969) product trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 8150..9649 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 9854..10291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 10488..10985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 11346..12239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 sequence098 source 1..12096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(25..606) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHZ6 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 871..2163 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 2424..2846 product putative large conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_268999.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene mscL CDS complement(3058..3582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056704.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 3688..4287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(4295..6565) product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 6887..7627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(7707..8003) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390816.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(8017..8304) product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390817.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(8472..8771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(8832..9401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(9483..10121) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055917.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 10197..10508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06715 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene yisB CDS 10681..11397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 sequence099 source 1..12094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2919..3995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(3984..4754) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266205.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(4812..5387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 5683..6111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(6084..8726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(8939..9487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 9799..10800 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170110.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 10893..11807 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170112.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 sequence100 source 1..11978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(55..561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(609..1178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(1311..1940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(2277..3356) product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 3925..5496 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057595.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(5780..7000) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK29 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene ispH CDS complement(7037..8044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 8554..9255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(9422..10513) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ8 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene ychF CDS 10709..11344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 11388..11954 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057261.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 sequence101 source 1..11908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 577..1908 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104922.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene gor-2 CDS 2006..2872 product taurine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114312.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 3085..4086 product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726676.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 4361..5167 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031738.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 5239..7182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 7597..9708 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894320.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(9724..11052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920287.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene hfsC sequence102 source 1..11866 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 540..1661 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 tRNA complement(2029..2104) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 2439..2603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(2703..3272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(3374..3622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(3728..4993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(5203..5586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057286.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(5653..5877) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK60 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene rpoZ CDS complement(5980..7314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 7736..8599 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932754.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(8944..10722) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 10889..11503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 sequence103 source 1..11744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..508 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021291.1:ATPase locus_tag LOCUS_14530 CDS 405..641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 651..1094 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143422.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 1306..2652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(2623..4326) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056296.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(4385..4951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(5040..5426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 5777..8095 product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056432.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 8129..9595 product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF6 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(9712..10515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 sequence104 source 1..11577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 194..1759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene crtH CDS 2053..3489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 3718..4269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 4427..5050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529467.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 5171..6529 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 7007..8716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 8789..10924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 sequence105 source 1..11553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(531..1118) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531226.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1417..1773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1883..2203) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727879.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 2310..3227 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(3194..3775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(3976..4179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 4563..5963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(6248..6682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 6726..7292 product topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720561.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 7282..7920 product pyrrolidone-carboxylate peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81BT3 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene pcp CDS 8037..8540 product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975559.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 8557..9357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(9444..9917) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143027.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(10032..10415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 sequence106 source 1..11529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(336..1427) product UDP-glucose--tetrahydrobiopterin glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141885.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(1471..2868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(3537..4673) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 4867..5730 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 5882..6304 product chorismate mutase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHZ0 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene aroH CDS 6455..6937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057109.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 7087..7839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(7849..8763) product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene crtR CDS 9373..11157 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 sequence107 source 1..11444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2477..4528 product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142193.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 4679..5602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(5653..6585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(6905..7546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(7624..8436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140639.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 9320..9967 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 9999..11285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 sequence108 source 1..11384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(205..2280) product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(2422..2637) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCC0 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene rpsR CDS complement(2817..3005) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH99 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene rpmG CDS 3355..3579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(3812..4384) product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU5 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene cpcS CDS complement(4428..5699) product phycocyanin operon protein Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141188.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene cpeY CDS 5700..6605 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141255.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(6671..7435) product putative oxidoreductase YxbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46331 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene yxbG CDS 7829..8635 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531156.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 8648..9472 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140177.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 9508..10299 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140178.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(10426..11073) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG97 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene nth tRNA 11273..11357 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 sequence109 source 1..11379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(141..935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(1142..3148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 3333..3521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 3640..4188 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP4 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene ribH tRNA 4296..4367 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 4993..6237 product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEF6 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene proA CDS complement(6485..7315) product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057490.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene desC2 CDS 7339..8568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057855.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(8698..8871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 9097..9753 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD9 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene hisG sequence110 source 1..11312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(121..2292) product succinoglycan transporter ExoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057604.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(2595..3914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 5293..6378 product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 6998..7843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 8037..8696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 9276..9620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 9626..10534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 sequence111 source 1..11290 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 674..1072 product cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058261.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene cytM CDS 1271..1897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 2005..3429 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene recQ CDS complement(3530..4303) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 4467..5153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057732.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(5204..5674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(5671..6384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(6472..7770) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHP7 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene hisS CDS complement(7817..8176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(8544..9368) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 9513..10412 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143747.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 misc_feature complement(10409..>11290) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057075.1:adenosine deaminase locus_tag LOCUS_15390 sequence112 source 1..11170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(417..761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(795..2741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 2932..3186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143542.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(3274..3942) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(4001..5233) product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125288.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene lcyB CDS 5440..6477 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QW0 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene pyrC CDS 7081..7854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 8105..9484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 9546..10079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 10066..11079 product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA9 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene queG sequence113 source 1..11129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 292..2985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(3243..4802) product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLZ2 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene thiC CDS complement(5049..6620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 7261..9825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 9965..10396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 sequence114 source 1..11046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(400..657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 722..1174 product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK9 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene msrB CDS 1174..2046 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970319.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 2080..3528 product neopullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(3532..4092) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143281.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 4447..6039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 6284..6454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 6729..7082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 7210..7548 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125766.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene glnK CDS complement(7622..8287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 8403..9131 product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM63 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene pyrH CDS 9118..9675 product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM64 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene frr CDS 9709..10887 product geranylgeranyl bacteriochlorophyll reductase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058112.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 sequence115 source 1..10987 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 207..1358 product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146544.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 1449..2159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(2223..2564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 2830..3843 product aldehyde reductase Ahr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309160.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene yjgB CDS complement(3890..4498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858080.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 4591..5715 product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL38 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene bioB CDS 6354..6833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 7008..7760 product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(7763..8197) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057290.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(8285..8758) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 misc_feature complement(8837..>10987) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MAR8:protease HtpX locus_tag LOCUS_15780 sequence116 source 1..10966 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 631..3327 product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 3349..4116 product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene gdh CDS 4186..5424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(5545..6057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 6081..6314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(6390..7640) product carbon dioxide concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(7913..8251) product pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene phhB CDS 8304..9011 product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z0S4 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene lasT CDS complement(9008..9649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142166.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(10593..10964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 sequence117 source 1..10882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..951 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DMR6:NAD(P)H-quinone oxidoreductase subunit 2 locus_tag LOCUS_15890 CDS 981..1628 product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071891.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene satA CDS complement(1743..2297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 2432..3874 product putative bicarbonate transporter, IctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058082.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 3858..4733 product 2-hydroxy-6-oxohepta-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 4921..5937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(5934..6806) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(7013..7525) product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR2 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene ppa CDS complement(7729..7911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(8167..8559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 8627..10699 product glycogen debranching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143985.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 sequence118 source 1..10865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 107..337 product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140405.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene ycf40 CDS 504..1511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057334.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 1692..2795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 2963..4708 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056502.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(4793..6013) product pilus biosynthesis protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene pilC CDS complement(6237..7340) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene pilT CDS complement(7412..9421) product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene pilB CDS 9640..10368 product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB3 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene grpE sequence119 source 1..10858 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 623..859 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG62 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene rpmB CDS 1310..6145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 6145..6852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056526.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 7029..7919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 7968..8540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 8624..9127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(9267..10172) product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHV7 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene prmC misc_feature complement(10173..>10858) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DM46:homoserine dehydrogenase locus_tag LOCUS_16150 sequence120 source 1..10751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1027..1299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(1388..2872) product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene gltD CDS complement(3042..7694) product glutamate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 8008..8346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(8352..9098) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(9151..9450) product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141908.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(9447..9710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(9760..10548) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 sequence121 source 1..10712 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(103..690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115550.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(697..1899) product homoserine/choline kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(2046..2936) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P607 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene cysH CDS complement(3081..3497) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(3710..4729) product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108906.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 5345..7753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 7809..9614 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056425.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 sequence122 source 1..10576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 913..1395 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125105.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 2134..2730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(2809..4827) product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH2 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene acsA CDS 5275..6153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 6214..6798 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(6795..7175) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 7391..7669 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG9 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene purS CDS 7762..8460 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL01 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene purQ CDS complement(8628..9443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057850.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 sequence123 source 1..10575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1425..2846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(2843..4144) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141779.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(4298..5698) product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918387.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene hfsI CDS complement(5701..8157) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974168.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene bme12 CDS complement(8686..9555) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594617.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 sequence124 source 1..10497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(146..1789) product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA5 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene guaA CDS complement(1911..3008) product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT8 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene cbiD CDS 3077..4066 product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCF5 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene moaA CDS complement(4364..4972) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59134 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene rpsD CDS complement(5024..5965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 6280..8250 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene ftsH CDS complement(8393..9028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(9436..10272) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142046.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 sequence125 source 1..10448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(138..1295) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1359..2558) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 2810..3004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(3507..4019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 4124..4897 product CDP-3, 6-dideoxy-D-glycero-L-glycero-4-hexulose-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056807.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 4943..5218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 5565..6725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140031.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 6732..7820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140031.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 7903..8859 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057233.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 8856..10088 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 sequence126 source 1..10377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..746 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056490.1:ABC transporter locus_tag LOCUS_16640 CDS 829..1182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 1097..1456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 1583..1930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 2148..3674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(3857..7207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(7200..9524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 misc_feature complement(9743..>10377) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003412725.1:carboxylesterase LipQ locus_tag LOCUS_16710 sequence127 source 1..10347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(66..227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 169..696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 773..1042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056004.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 1078..2133 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057692.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(2141..2908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258579.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(3098..3358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(3657..3986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(3989..4774) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124637.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene xthA CDS complement(4841..5365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 5647..6228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 6291..6689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 sequence128 source 1..10344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 1508..5041 product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEE6 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene dnaE CDS 5090..5377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 5453..5743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 5744..7282 product restriction endonuclease NspV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258690.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 7387..7614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(7621..8250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 8557..9549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 misc_feature complement(9561..>10344) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLF8:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG locus_tag LOCUS_16910 sequence129 source 1..10343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..662 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143165.1:fructosamine kinase family protein locus_tag LOCUS_16920 tRNA 699..769 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(1001..1363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 1354..1974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(2246..2902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(2893..3687) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144247.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(3744..4679) product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(4819..5151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 5223..5402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(5434..6702) product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141145.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(6742..7419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(7419..8378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(8445..8816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(8956..9906) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056119.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene sigD sequence130 source 1..10320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 371..1093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 1090..2082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 2173..3186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 3234..4442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 4408..5412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 5415..6506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 6496..7443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 7509..8378 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 8378..9262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 9299..10108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142195.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 sequence131 source 1..10274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(457..1161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1148..2578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(2776..3600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143123.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(3667..4740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 4927..5781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057453.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 5817..6353 product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene dnaJ CDS 6340..6600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(6709..7158) product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143244.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 7486..8487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 8577..9512 product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCU9 transl_table 11 codon_start 1 locus_tag LOCUS_17240 sequence132 source 1..10263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1212..2801 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH4 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(2848..3861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(4245..4889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 5085..5804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(5719..6873) product FO synthase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DII8 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene cofH CDS complement(7023..8075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 sequence133 source 1..10242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(450..1001) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN99 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene cysC CDS complement(1160..2947) product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(3346..4563) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004752.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(4590..6035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056219.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(6035..7477) product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056233.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 7765..8226 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265871.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 8226..8846 product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 8874..10142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140792.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 sequence134 source 1..10242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(692..1045) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143541.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 1263..1490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 1876..2208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268497.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(2230..2967) product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(3172..4659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(4681..5514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(5585..7075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(7082..7879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476068.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 8059..8574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142303.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 sequence135 source 1..10238 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(791..1099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(1216..2709) product regulator of sigma-B activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 2897..3136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(3223..4083) product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056899.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(4101..4868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(4916..5098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 5304..7877 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143331.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 7945..8415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(8463..8795) product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL6 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(8905..10026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 sequence136 source 1..10223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(533..853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(935..1327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 1381..2655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393799.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 2778..3743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 4133..5488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(5606..6649) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(6681..7364) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH89 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene rnc CDS complement(7848..8792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 8957..9121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 9255..9716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 sequence137 source 1..10218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(132..854) product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA0 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene tpiA CDS 983..2269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 2282..3748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(4009..4917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(5129..7279) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW9 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene pnp CDS 7510..8520 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141070.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(8502..8981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 tRNA complement(9024..9096) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 sequence138 source 1..10207 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(934..2184) product polyketide biosynthesis cytochrome P450 PksS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31785 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene pksS CDS complement(2330..2692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(2745..3479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 4231..5109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(5277..5546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(5614..5934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(6191..6853) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258572.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 7281..9068 product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084066.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 sequence139 source 1..10169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(16..846) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMR1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene proC CDS complement(926..1534) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMR2 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene sepF CDS complement(2318..3040) product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056880.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(3040..3306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057448.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(3435..4943) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056140.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene trpE CDS complement(5024..5971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056139.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(6007..7395) product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene der CDS complement(7510..8229) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056725.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(8263..9210) product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI7 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene cysK CDS complement(9294..9728) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056354.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 sequence140 source 1..10126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 678..1340 product clavaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545430.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(1436..1675) product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057357.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene ftrV CDS complement(1812..3725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056767.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 4159..4584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057975.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 4692..5651 product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058018.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(5675..6076) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707050.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(6201..7016) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140651.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(7214..8074) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735473.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(8076..8852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(9006..9905) product photosystem reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056697.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 sequence141 source 1..10125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..1091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(1463..1840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1991..2437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(2468..2716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 2852..3253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 3776..4162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(4290..4865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 6087..6869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 6869..7174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 7473..8474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(8516..9061) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 misc_feature complement(9164..>10125) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057245.1:cation efflux system protein locus_tag LOCUS_18140 sequence142 source 1..10106 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 182..1447 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140351.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 1566..3200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 3326..3547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(3771..4214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 4308..4979 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140352.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 5346..6119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 6231..6569 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene glnB CDS complement(6555..6710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 6665..7933 product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056045.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene folC CDS complement(7940..8287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 8471..9463 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143431.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 sequence143 source 1..10069 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1488..1832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(1963..2826) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJA3 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene ycf38 CDS complement(2890..3465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 3568..4797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(4828..5172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(5169..5402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(5443..6462) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055865.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(6548..7528) product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHQ2 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene ctaB CDS complement(7635..8687) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 9051..10025 product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE8 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene ctaC sequence144 source 1..9978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(225..1145) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948814.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 1235..2023 product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056155.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 2149..3630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 3842..4261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(4408..4860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(5016..6080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(6135..6950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 7096..7782 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(7862..9484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 sequence145 source 1..9963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1238..2125) product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119848.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 2311..3066 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BAA9 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(3199..3483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678786.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(3446..3721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 4318..5661 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 5887..6300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143509.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(6315..6866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(6876..8561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870224.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(9034..9447) product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(9449..9790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 sequence146 source 1..9937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(19..666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(1455..2141) product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056611.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 2289..3308 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228102.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(3355..3999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 4543..4944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(5002..5889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(6033..6860) product endonuclease 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N9V3 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene nei CDS 7101..8321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057682.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(8326..8724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(8721..9059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530736.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 misc_feature complement(9335..>9937) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223656.1:arginase locus_tag LOCUS_18650 sequence147 source 1..9913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(130..549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143379.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(591..1010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056711.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene ycf57 CDS 1311..2897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142439.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 2937..3275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 3456..3863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 3863..4285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057414.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 4599..5348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056104.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(5364..6155) product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGK9 transl_table 11 codon_start 1 locus_tag LOCUS_18730 sequence148 source 1..9876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(181..798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(818..1939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 2033..3028 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058144.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene cysM CDS 3056..3829 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144264.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 4408..4698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 4937..5803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 note possible pseudo, internal stop codon, frameshifted CDS 5808..7058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 note possible pseudo, internal stop codon, frameshifted CDS complement(7075..7935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(7937..9043) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene aroC misc_feature complement(9211..>9876) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228905.1:peptidase M23 locus_tag LOCUS_18830 sequence149 source 1..9777 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..675 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056776.1:D-alanyl-D-alanine carboxypeptidase locus_tag LOCUS_18840 CDS 699..1478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141964.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(1475..2650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 3426..5957 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH56 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene alaS CDS complement(6003..6884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057503.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(6919..7647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 8114..9175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 sequence150 source 1..9707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(465..863) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390954.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 1352..3853 product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIY2 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene gyrA CDS 3922..5028 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056017.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(5056..5481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(5893..6900) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN2 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene prk CDS 7449..8699 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93RE3 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene petH sequence151 source 1..9671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1215..1520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 1575..1796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 2062..5796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 6022..8925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 9163..9387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 sequence152 source 1..9621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3125..3601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(3643..4398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(4675..5214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(5467..7800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(7913..9091) product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK26 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene sat sequence153 source 1..9620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1963..2916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 2950..3444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(3484..4410) product heparan sulfate glucosamine 3-O-sulfotransferase 3B1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887312.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 4706..5452 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143200.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(5477..6364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(6503..7246) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058233.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 7431..8255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 misc_feature complement(8278..>9620) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142619.1:glycoside hydrolase locus_tag LOCUS_19140 sequence154 source 1..9600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(804..875) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(990..1235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058260.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(1239..2348) product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057238.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 2438..3274 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(3387..4097) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125174.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene tesA CDS complement(4232..5689) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI20 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene glmM CDS 6100..6516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 6797..7189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 7200..7982 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057411.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 8084..9247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene ycf84 sequence155 source 1..9593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1124..2566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(2577..6686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(6697..7737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 sequence156 source 1..9567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 617..1780 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGU6 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene hemH CDS 1803..2411 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(2390..3505) product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU4 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene hrcA CDS 3837..4946 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene ycf30 CDS 5144..6523 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058264.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 6650..8089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 8100..8711 product DNA-3-methyladenine glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889208.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 misc_feature complement(8755..>9567) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707169.1:carbonic anhydrase locus_tag LOCUS_19340 sequence157 source 1..9534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 767..2881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 3123..3530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(3686..4480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(4750..5436) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene fabG CDS complement(5518..5946) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB93 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 6455..8458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 misc_feature complement(8492..>9534) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942602.1:polysaccharide deacetylase locus_tag LOCUS_19410 sequence158 source 1..9507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 413..1735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058262.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 1794..3449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 3962..4897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 5347..5787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(6043..6465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(6646..7035) product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 7109..7768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(7731..8702) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H5 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene argC sequence159 source 1..9493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1204..2241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(2171..3232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 3503..3817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 3888..4322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 4373..4555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(4642..5937) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW4 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene purB CDS complement(6032..6349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(6354..6575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 6781..7380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140730.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(7377..8123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(8493..8825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 misc_feature complement(8953..>9493) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGV7:peptide chain release factor 3 locus_tag LOCUS_19610 sequence160 source 1..9477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 127..786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 845..2872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 2869..4275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 4256..4621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 4614..5021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 5133..5849 product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056304.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene chlM CDS 6700..8199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(8317..9060) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115022.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 sequence161 source 1..9387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(246..665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(929..2497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 3108..3920 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG34 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene gloB CDS 4093..4554 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9J9 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene rplI CDS 4756..8172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(8181..9251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 sequence162 source 1..9386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 744..1232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140674.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 1380..2054 product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057487.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene ntcA CDS 2394..3809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 4475..4936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 sequence163 source 1..9369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..6099 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:nuclease locus_tag LOCUS_19800 CDS complement(6271..8694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 sequence164 source 1..9362 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(135..1118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94474 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene yeaC CDS 1430..3538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 3761..4693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 4690..5790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026802.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(5802..6716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143773.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(6912..7901) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(8144..9151) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 sequence165 source 1..9307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 487..855 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 1039..1878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(1916..2518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 2778..3509 product 2-phytyl-1,4-naphtoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPC8 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene menG CDS 3536..4768 product UPF0754 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM9 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(5024..5647) product phycocyanin operon protein Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141187.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene cpeZ CDS complement(5800..6294) product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141189.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene cpeA CDS complement(6416..6970) product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141190.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene cpeB CDS complement(7623..7808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 8355..8957 product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD5 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene ycf58 sequence166 source 1..9279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(886..1533) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(1594..2340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 2542..6291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 6306..8030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 8340..9104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 sequence167 source 1..9250 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 555..1460 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057510.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 2049..2291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(2370..3836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(3889..4650) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056208.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(4708..5766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(5890..6591) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene surE CDS complement(6644..7519) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM2 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene dapF CDS 7629..7847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058128.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 8178..9083 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057801.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 sequence168 source 1..9203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 684..2354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 2530..4293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(4328..5407) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH0 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene ddl CDS 5850..6329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(6331..8346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 misc_feature complement(8583..>9203) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057484.1:radical SAM protein locus_tag LOCUS_20180 sequence169 source 1..9129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(156..410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125028.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(416..2368) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 2659..3402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(3409..4554) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057332.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(4622..5275) product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN8 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(5272..6342) product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene idiA sequence170 source 1..9110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(681..1358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(1365..2180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(2391..3452) product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 3783..5189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 5271..5957 product putative transcriptional regulatory protein YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34903 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene ykoG CDS complement(6430..7818) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 misc_feature complement(8151..>9110) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035272.1:cardiolipin synthase locus_tag LOCUS_20310 sequence171 source 1..9081 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..1719) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057509.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene trpE CDS complement(1941..2369) product photosystem I protein PsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125882.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene psaD CDS complement(2702..4867) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(5142..6539) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH4 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(7105..7644) product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB0 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene purE CDS 7794..8879 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH66 transl_table 11 codon_start 1 locus_tag LOCUS_20370 sequence172 source 1..9068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 332..1096 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND10 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 1129..1425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 1644..2294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(2331..3806) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 3863..5083 product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 5268..7550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057491.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(7581..8102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(8285..9004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 sequence173 source 1..9063 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 515..1501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(1618..1800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 2124..2678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 2732..3394 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 3450..4028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(4032..4919) product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I583 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(4963..5811) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(6001..7113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 7398..8168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 8200..8823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 sequence174 source 1..8958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(17..982) product LPS biosynthesis-related transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529463.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(1069..1455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(1445..2527) product LPS biosynthesis-related glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523309.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 3130..4392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(4384..5547) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975518.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(5560..6756) product NDP-hexose methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975523.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(6775..8817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 sequence175 source 1..8952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104887.1:DNA ligase-associated DEXH box helicase locus_tag LOCUS_20630 CDS 2174..2962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(3190..4482) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195009.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene codB CDS complement(4654..5085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144145.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(5283..6077) product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141462.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 6152..7456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057390.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 sequence176 source 1..8923 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1450..2178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(2245..4149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 4441..4782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 4981..6129 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 6170..7240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119847.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 misc_feature complement(7260..>8923) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ61:histidine kinase locus_tag LOCUS_20740 sequence177 source 1..8869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2097..2363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 2374..3420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(3397..4989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(5191..7272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(7269..8597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 sequence178 source 1..8845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(501..1064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125563.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(1245..1748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(1748..1993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(2310..3569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 4100..4396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(4516..5265) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324393.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 5422..5793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 5806..7632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 sequence179 source 1..8816 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1598..1963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056846.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 2510..3802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058187.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 4474..6348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(6361..7068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228262.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 7276..8259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056713.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 sequence180 source 1..8803 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2957..3928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(4185..4574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(4805..5227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(5333..6361) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(6460..8109) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057298.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(8265..8654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 note possible pseudo, internal stop codon sequence181 source 1..8777 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1273..1842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(2522..4330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 4818..5450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(5458..6834) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415988.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene cyp136 CDS 6922..7362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 note possible pseudo, internal stop codon CDS 7381..7728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 note possible pseudo, internal stop codon CDS 7923..8483 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene msrA sequence182 source 1..8747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(810..2168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 2556..3134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142559.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 3512..4411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 4496..7543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 sequence183 source 1..8741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(853..1992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 2299..2721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(2809..3066) product hexulose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680062.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 3301..3657 product antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(3675..4853) product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144027.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(4903..5700) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(5741..6925) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142255.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 sequence184 source 1..8740 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(511..1437) product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIH2 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene tilS CDS complement(1561..3666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 4310..5206 product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ40 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene minC CDS 5328..6125 product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE2 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene minD CDS 6216..6875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 7021..7269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(7454..7924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057499.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 sequence185 source 1..8740 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(269..1606) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 1869..4652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 4765..5787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640454.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(5883..8255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 sequence186 source 1..8734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393311.1:malto-oligosyltrehalose synthase locus_tag LOCUS_21280 CDS 3102..4832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 4868..6151 product modulator of DNA gyrase PmbA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(6247..6690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(6756..7229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(7249..8019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 8423..8653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 sequence187 source 1..8703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 344..1306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(1574..5722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 misc_feature complement(5954..>8703) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057066.1:magnesium-transporting ATPase locus_tag LOCUS_21370 sequence188 source 1..8701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(568..918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(1072..1881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(2001..3020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(3052..4479) product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene merA CDS complement(4723..6402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 6623..7189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 7265..7528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 sequence189 source 1..8673 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 177..1094 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058215.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 1162..2445 product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGC1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene bioA CDS 2717..3841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(3797..4789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(5001..5666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(6211..7104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058107.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(7146..7679) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056687.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 7754..8263 product TIGR02652 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058200.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 sequence190 source 1..8629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 197..1069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 1920..3065 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNW0 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene ftsZ CDS 3065..3907 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(3871..4284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(4342..4707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 5173..6867 product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 6989..7984 product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene ubiA CDS 8142..8459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 sequence191 source 1..8606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 462..749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 843..2102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142415.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(2116..3360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(3498..3842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(4073..5305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 5569..6261 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VAS0 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene clpP CDS 6264..6905 product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VAR9 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene clpP2 CDS 6993..7595 product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJZ9 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene clpP2 CDS 7617..8360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 sequence192 source 1..8593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 152..496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 615..2279 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 2320..3657 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMS0 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 3671..5065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 5228..6745 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227510.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 sequence193 source 1..8572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 494..2371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(2383..2676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 2840..3712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 3884..4804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(4821..5207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(5358..5948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(6155..6970) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 7053..7460 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017671.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(7498..8421) product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene ansA sequence194 source 1..8561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 680..1108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 1101..1499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 1533..2003 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143783.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 2013..3434 product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 3483..4079 product precorrin-6B methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene cobL CDS 4558..6498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 6558..7814 product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941287.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 sequence195 source 1..8552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 270..1286 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUG2 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 1351..2712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227755.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 2735..4327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 4373..5494 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 5494..7863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029876.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(8051..8308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 sequence196 source 1..8535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(147..695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056576.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 1133..1981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141339.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(2020..2805) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJS3 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene coaX CDS 3011..3487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(4197..5240) product UDP-3-O-acylglucosamine N-acyltransferase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH24 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene lpxD3 CDS complement(5361..6788) product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKB7 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 7052..7540 product allophycocyanin-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057391.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene apcD CDS 7766..8386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056441.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 sequence197 source 1..8518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJG7:N5-carboxyaminoimidazole ribonucleotide synthase locus_tag LOCUS_22050 CDS 1420..2670 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 2679..3962 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 3972..4901 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141217.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(5076..5582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(5595..5999) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(6027..7748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 7892..8482 product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056210.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene trxA sequence198 source 1..8494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1963..2784) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGJ0 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(2964..3830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 4253..4834 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(4841..5062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(5087..6157) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057983.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene dnaJ CDS complement(6157..8493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 sequence199 source 1..8486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 787..1329 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ09 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 1498..2040 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ09 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(2037..3299) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057373.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene pyrC CDS complement(3312..4679) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057372.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 4788..5732 product FO synthase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR6 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene cofG CDS 6380..7123 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 7950..8252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 sequence200 source 1..8450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 709..1971 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118874.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 1984..2865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192709.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 2915..4147 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461034.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 4318..5739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 5753..6976 product hexosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118866.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 7073..8272 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene bme6 sequence201 source 1..8405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(137..211) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 292..768 product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UER6 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene moaC CDS 795..1046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 1146..1454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057560.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 1584..2054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(2282..3664) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 3805..5391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 5492..6019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056141.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(6016..6873) product lipoyl synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLC2 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene lipA2 CDS 7080..7634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 sequence202 source 1..8404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1567 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057063.1:O-succinylbenzoic acid--CoA ligase locus_tag LOCUS_22410 CDS complement(1503..1976) product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLK3 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(2108..3991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(4150..5310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 5361..5729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144172.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 6074..6841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 6908..7354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 7366..7785 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 sequence203 source 1..8400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 221..772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056693.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(849..1493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 1673..2569 product lipoyl synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL83 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene lipA1 CDS 2927..3403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 3455..4858 product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59109 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene trmFO CDS 5023..5946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 6053..7078 product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942637.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 7164..7547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 sequence204 source 1..8394 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(33..1226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 1751..1960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 note possible pseudo, frameshifted CDS 2051..2440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 note possible pseudo, frameshifted CDS complement(2454..3632) product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(3753..7562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 misc_feature complement(7780..>8394) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057300.1:serine/threonine protein kinase locus_tag LOCUS_22620 sequence205 source 1..8332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3640..4521) product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBE3 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene menH CDS complement(4509..6266) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI6 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene menD CDS complement(6269..7822) product menaquinone-specific isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057055.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 sequence206 source 1..8326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(15..344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 696..2750 product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC6 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene uvrB CDS 2974..7461 product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EW9 transl_table 11 codon_start 1 locus_tag LOCUS_22680 sequence207 source 1..8323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 544..753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 1162..2217 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 2798..4195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 4202..5623 product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 5720..6508 product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 6530..7174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(7543..7986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 sequence208 source 1..8302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(98..1228) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(1355..2218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76482 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene yfbL CDS 2277..3233 product inward rectifier potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 3547..4776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(5021..6217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125209.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(6328..6960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(7057..7254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 7575..8063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 repeat_region 8122..>8302 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggggtcgtaccgctgtcttggtacgcttcc sequence209 source 1..8242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1612..3486 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706407.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 3857..6934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 sequence210 source 1..8222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(777..1781) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHG3 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene trpS CDS complement(1875..2357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(2580..3443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(3791..4774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704985.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(4875..5210) product branched-chain amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461993.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(5334..5999) product branched-chain amino acid efflux pump permease component 1 AzlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071889.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(6216..7076) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106287.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 misc_feature complement(7122..>8222) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143421.1:sensor histidine kinase locus_tag LOCUS_22930 sequence211 source 1..8205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1139..1972) product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG92 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene uppP CDS 2312..3187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 3553..4575 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058242.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 4715..5167 product photosystem II 12 kDa extrinsic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F1L5 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene psbU CDS 5406..7028 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGB1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene nadB CDS complement(7117..7500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142480.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(7493..8074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 sequence212 source 1..8167 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A884:methionine--tRNA ligase locus_tag LOCUS_23010 CDS 586..894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 891..1271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 1295..1927 product RhtB family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 2001..3005 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389859.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(3022..3768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(3818..4096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 4264..4437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 4848..5459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(5471..6109) product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI3 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene hisB CDS 6275..6532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(6569..7468) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086032.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 sequence213 source 1..8079 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1312..1854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 2166..3932 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene ilvG CDS 4555..5118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 5361..6977 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057909.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 7115..7636 product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528493.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 sequence214 source 1..8061 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2..289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(325..567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(657..1679) product DUF1016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(1681..4449) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene hsdM-1 CDS complement(4731..5201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 5278..5964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 tRNA complement(5981..6056) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 6338..7786 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057360.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 sequence215 source 1..8026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1047 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057305.1:class V aminotransferase locus_tag LOCUS_23250 CDS 1456..1803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(1827..2648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(2785..3009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 note possible pseudo, internal stop codon, frameshifted CDS 3344..4399 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XWM4 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene ldh CDS 4392..4871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(4868..6463) product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085767.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(6563..7024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142510.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 7119..7298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 7327..7848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 sequence216 source 1..8020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJI6:glutamine--fructose-6-phosphate aminotransferase [isomerizing] locus_tag LOCUS_23350 CDS 1089..1712 product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811309.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 1874..2056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 2247..3533 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHV4 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene purD CDS 3730..5676 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056292.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 5848..6480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083175.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 6717..7787 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK81 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene tal sequence217 source 1..7978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(278..1657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(1766..2029) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005397239.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 2480..2653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(2818..2937) product photosystem II reaction center protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59087 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene psbJ CDS complement(3218..3361) product cytochrome b559 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMA9 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene psbF CDS complement(3496..3732) product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP0 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene psbE CDS complement(3931..4974) product Ycf48-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI95 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(5059..5529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 5791..6153 product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ02 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene ndhC CDS 6207..6992 product NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ4 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene ndhK CDS 6993..7523 product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ01 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene ndhJ sequence218 source 1..7970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1087..2169) product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA4 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(2353..2880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057249.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 3330..4427 product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL15 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene hemF CDS 4627..4989 product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D91 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene rsbV CDS complement(5003..5608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 5728..6495 product protein Thf1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJT8 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene thf1 CDS complement(6721..7800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 sequence219 source 1..7910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(174..392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(693..1583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(1784..5014) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(5021..6499) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057458.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 6856..7035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 sequence220 source 1..7908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(184..927) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 1679..1927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141287.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(2225..2548) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI5 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene ycf64 CDS complement(2602..2847) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(2960..3550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 4016..6133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(6312..7103) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056649.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(7245..7742) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLR8 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene tadA sequence221 source 1..7870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 713..958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(955..2244) product succinyldiaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143457.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(2307..3080) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057529.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(3181..4308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056519.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(4309..4533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(4546..4866) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(4917..5099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057262.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 5271..5816 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056635.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(5830..6087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 sequence222 source 1..7833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 163..804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143183.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 1028..2221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 2353..3135 product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene gcd1 CDS 3250..4287 product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435695.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 4278..5504 product NDP-hexose 3-C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 5594..6856 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975510.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 6843..7649 product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975514.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 sequence223 source 1..7812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1035 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141947.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(1089..1520) product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCH9 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene rlmH CDS complement(1551..2225) product glutamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392641.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(2379..3182) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210235.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene glnH CDS 3536..4297 product glutamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 4412..5164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(5176..5997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39139 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene yxxB CDS complement(6173..6562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(6710..7597) product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057550.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene nadC sequence224 source 1..7807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1432..2535) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057034.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene hemN2 CDS 2944..4029 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055863.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene ycf81 CDS complement(4410..5501) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868908.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 5659..6243 product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141816.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 6623..6868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 6874..7257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(7220..7540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058117.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 sequence225 source 1..7796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2668..4032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057693.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 4231..5211 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(5825..6169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 6273..6509 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(6602..7015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(7029..7343) product addiction module killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 sequence226 source 1..7791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056770.1:ABC transporter ATP-binding protein locus_tag LOCUS_24110 CDS 1664..2167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 2330..3271 product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene yyaK CDS complement(3237..4049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(4188..4862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(4985..6514) product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 6753..7211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 sequence227 source 1..7788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 482..781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(847..2145) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL02 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene hisD CDS 2397..2693 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN4 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene rpsT CDS 2708..3490 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN5 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene tatD sequence228 source 1..7785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 912..1193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 1657..2580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(2765..3277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 tRNA complement(3713..3797) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(3898..4782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(4901..6301) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS7 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene murA tRNA 6795..6880 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 sequence229 source 1..7778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 268..870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 1145..3070 product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 3101..5245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(5402..5923) product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142877.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 7008..7286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 tRNA 7372..7444 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 sequence230 source 1..7758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 346..1176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 1652..2479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 2764..4053 product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59322 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene argD CDS complement(4050..5216) product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG79 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene recF CDS 5309..6565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 tRNA 6711..6783 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 sequence231 source 1..7715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 287..1612 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058184.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(1724..2524) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(2573..3307) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND39 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(3773..5200) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056769.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(5464..5640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 misc_feature complement(5856..>7715) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056029.1:single-stranded-DNA-specific exonuclease RecJ locus_tag LOCUS_24420 sequence232 source 1..7704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 174..1016 product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 1069..2220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 2379..3656 product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532932.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 3730..5253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 5993..6304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 sequence233 source 1..7703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 530..1051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 1296..3134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(3088..3855) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 4160..4447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057985.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(4501..5493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(5736..6626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(6673..7317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 tRNA 7508..7583 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 sequence234 source 1..7641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 265..1248 product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141699.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(1273..2532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 2784..3008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057657.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene cp12 CDS 3265..3939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057787.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 4005..4310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058081.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 4548..5621 product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL5 transl_table 11 codon_start 1 locus_tag LOCUS_24600 sequence235 source 1..7591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1202..1834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(1853..2656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(2930..4093) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(4356..5426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(5491..7257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 sequence236 source 1..7572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 1272..6761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 sequence237 source 1..7551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 204..920 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083382.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene guaA CDS 1089..1910 product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404448.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 2055..2399 product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH9 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 2411..2848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 2964..3845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(3869..5674) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(5741..7081) product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 sequence238 source 1..7547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(427..936) product phycobilisome core component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene apcF CDS 1469..3640 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene glnN CDS 4002..4859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34423 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene yjqC CDS 5055..6161 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057211.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 6268..6447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 6447..6665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(6660..7325) product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NML1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene trpF sequence239 source 1..7536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(317..1582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144202.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(1662..3065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(3421..3921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(4401..5387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 6153..6638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 sequence240 source 1..7511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(665..3148) product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene clpC CDS complement(3427..4053) product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FA0 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 4273..5697 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI31 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene lysA CDS 5903..6814 product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057599.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 sequence241 source 1..7503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(384..1178) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057285.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene ycf63 CDS 2144..3814 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057178.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 3925..5397 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 sequence242 source 1..7490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1847..4873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 5442..7313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 sequence243 source 1..7446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(400..2628) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056445.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene rne CDS complement(3399..5366) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK3 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene rnj CDS complement(6006..6920) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK4 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene dapA sequence244 source 1..7441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1185..1553) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141555.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(1764..2249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 2628..4961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(4982..5578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 6332..7324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 sequence245 source 1..7410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(386..802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140148.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 941..1198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(1395..1715) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125063.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 1764..2252 product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ7 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene coaD CDS 2350..3213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 3210..3833 product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene ruvA CDS complement(3903..4415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(4653..5324) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819V8 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene rnc CDS complement(5399..7261) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057611.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 sequence246 source 1..7358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1767..2804 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene desA CDS complement(2885..3808) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(3868..4722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 5024..5515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(5780..6892) product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ23 transl_table 11 codon_start 1 locus_tag LOCUS_25170 sequence247 source 1..7317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 470..751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 748..1236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 1432..3168 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMV6 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene ureC CDS 3581..4888 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 5029..6192 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056963.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 sequence248 source 1..7277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..589 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058109.1:GTP-binding protein locus_tag LOCUS_25230 CDS 821..1609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(1625..2206) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056784.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(2225..3013) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056783.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(3102..4145) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056782.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 4524..4916 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9P5 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene ssb misc_feature complement(5165..>7277) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKA7:transcription-repair-coupling factor locus_tag LOCUS_25290 sequence249 source 1..7275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965614.1:acetyl-mannosamine transferase locus_tag LOCUS_25300 CDS 928..1374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 1571..3049 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI74 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene cobQ CDS 3090..3884 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763603.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(4120..4890) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(5047..5610) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529397.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 sequence250 source 1..7128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1119 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001130104.1:two-component sensor histidine kinase locus_tag LOCUS_25360 CDS complement(1128..2810) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057661.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene ilvB CDS complement(3023..4414) product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056076.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 4638..5927 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(5946..6581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022045.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(6658..6921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 sequence251 source 1..7103 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(388..1644) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 2797..4203 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL93 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene dnaA CDS 4805..5941 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG8 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene dnaN CDS complement(6087..6617) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 sequence252 source 1..7041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..571 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141821.1:quercetin 2,3-dioxygenase locus_tag LOCUS_25460 CDS 928..1188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 1160..1579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(1622..2740) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS3 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene aroB CDS complement(3035..4390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(4390..5853) product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937590.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 misc_feature complement(6061..>7041) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189296.1:glycosyl transferase locus_tag LOCUS_25520 sequence253 source 1..7040 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(341..1270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530486.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 1999..3834 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(3913..4479) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464841.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 4658..5059 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(5106..6425) product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403680.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 6439..6921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 sequence254 source 1..7004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(64..1179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(1344..2783) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056280.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene phrA CDS complement(2843..3388) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056278.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(3327..3935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(3972..4295) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGN0 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene trxM1 CDS 4509..5258 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene fabG CDS complement(5302..5535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014745.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(5535..5780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 misc_feature complement(6006..>7004) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124678.1:integrase locus_tag LOCUS_25670 sequence255 source 1..7003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region <1..188 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatccctaatagggagttagatgcgtttccgc CDS complement(453..1265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056121.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(1358..1642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 1858..3330 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644264.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(3327..3920) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036258.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 4004..4717 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500714.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene yjgI CDS 4984..6054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 6109..6918 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814A7 transl_table 11 codon_start 1 locus_tag LOCUS_25740 sequence256 source 1..7003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 409..1053 product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH6 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene trmB CDS 1165..1596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 1603..2073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038676.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 2091..2348 product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116175.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 2583..2969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(3001..3495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(3518..5407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(5584..6747) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 sequence257 source 1..6975 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2512..2835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(2926..3159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(3218..3661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 3895..4239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 4601..5284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 sequence258 source 1..6971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..975 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7V9I9:valine--tRNA ligase locus_tag LOCUS_25880 CDS 992..1363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(1368..2198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057340.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(2225..3991) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257581.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(3993..5669) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 5905..6276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 6409..6612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 sequence259 source 1..6969 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLW0:argininosuccinate lyase locus_tag LOCUS_25950 CDS complement(902..1492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 1586..2803 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056224.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(2822..3427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(3555..4055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(4257..5615) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057215.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 misc_feature complement(6049..>6969) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057813.1:CHAT domain-containing protein locus_tag LOCUS_26010 sequence260 source 1..6967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 253..1482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 1653..2114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 2289..3467 product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene moeB CDS 3618..4073 product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 sequence261 source 1..6947 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 56..985 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(982..2331) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF32 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene cbiA CDS 2601..3581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056124.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(3869..5731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(5960..6946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 sequence262 source 1..6944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 824..1045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 1076..2431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(2492..3643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 3789..4112 product UPF0145 protein YbjQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67287 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene ybjQ CDS complement(4132..4848) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204341.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 sequence263 source 1..6927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 983..1594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(1672..2061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(2073..3368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 3501..4460 product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VD89 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene hemC CDS 4696..5118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 5292..6713 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU2 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene glgA sequence264 source 1..6925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1592 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003020815.1:deoxyribodipyrimidine photo-lyase locus_tag LOCUS_26220 CDS 1833..3041 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZD9 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 3105..4013 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143200.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(4230..5321) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144332.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 sequence265 source 1..6912 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 755..2281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 2379..3512 product spore photoproduct lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971741.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 3590..4756 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140060.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(4767..4982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 5161..5823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(5831..6460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 sequence266 source 1..6888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 47..814 product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 952..1827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057174.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(1890..3683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(3767..4246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057015.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(4304..5425) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC2 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene anmK CDS complement(5560..6279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056267.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 sequence267 source 1..6836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(202..3393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(3626..4510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(4610..5047) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(5066..6313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 sequence268 source 1..6817 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 479..991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 1020..2180 product geranylgeranyl bacteriochlorophyll reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057244.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 2319..3800 product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124464.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(3797..4963) product glutathione-dependent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(5025..5726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140738.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 6072..6746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 sequence269 source 1..6804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1959 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NP12:glycine dehydrogenase (decarboxylating) locus_tag LOCUS_26480 CDS 2238..4628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(5009..6169) product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB7 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene pyrD sequence270 source 1..6801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DI39:UvrABC system protein C locus_tag LOCUS_26510 CDS 2458..2745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(2894..3067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 3669..4652 product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKF1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene gshB CDS 4675..6108 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 sequence271 source 1..6797 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(93..1874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057554.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(2091..3320) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408560.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(3317..3928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 4025..4912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(4931..5161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(5259..6224) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141878.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(6360..6692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 sequence272 source 1..6742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003020819.1:cryptochrome/photolyase family protein locus_tag LOCUS_26630 CDS complement(1112..1426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(1710..1964) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(2263..2517) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(2788..3675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(3757..4794) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229321.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 4993..5913 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970995.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 misc_feature complement(5973..>6742) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NFU6:4-hydroxybenzoate solanesyltransferase locus_tag LOCUS_26700 sequence273 source 1..6679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(27..695) product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHL9 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene msrA CDS 869..1591 product thymidylate synthase (FAD) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289309.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 2435..3667 product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL79 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene sigA CDS 3988..4593 product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VAW7 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene lexA CDS 4791..6482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 sequence274 source 1..6634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..738 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057422.1:rod shape-determining protein RodA locus_tag LOCUS_26760 CDS 900..1241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 1238..1636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(1792..2055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 2310..2615 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK85 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene ureA CDS 2705..3052 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX2 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene ureB CDS 3049..3678 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883F4 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene ureG-1 CDS 3690..4562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 4562..5098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 5108..5794 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYJ9 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene ureF sequence275 source 1..6591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(336..530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(910..1632) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 2280..5525 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142413.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 5541..6374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142412.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 sequence276 source 1..6570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1233..2471) product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E56 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene purT CDS 2951..4042 product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058174.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene pilM CDS 4060..4812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058175.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 4812..5633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058176.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 sequence277 source 1..6562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(227..315) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 473..895 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 899..1726 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 1967..3010 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070687.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 3212..4774 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480254.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 4905..5810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 sequence278 source 1..6553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1192..1626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(1751..2194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(2284..3441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 4091..5077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 misc_feature complement(5274..>6553) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056806.1:ABC transporter ATP-binding protein locus_tag LOCUS_27030 sequence279 source 1..6543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3080..4366 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389104.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 4384..5526 product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035292.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(5564..6085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 sequence280 source 1..6539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(341..2347) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS5 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(2831..4090) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS4 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(4326..4565) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43709 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene acpP misc_feature complement(5684..>6539) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NMW7:cell division protein FtsX locus_tag LOCUS_27100 sequence281 source 1..6530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 282..1805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(1789..1917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 1957..2847 product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123656.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 2858..3073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 3227..3706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(3738..5225) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480254.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(5471..6334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 sequence282 source 1..6490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(68..1138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(1462..2397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(2552..3958) product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431680.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 4093..4815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224502.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(4906..5793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 sequence283 source 1..6482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(247..639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(801..1247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 1401..1943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 2065..2625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 2726..3589 product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142863.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 3639..4253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(4263..5912) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ32 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene leuA sequence284 source 1..6478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2892 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056204.1:two-component hybrid sensor and regulator locus_tag LOCUS_27300 CDS 2939..4444 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene glcD CDS 4457..5269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142610.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 5624..6214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 sequence285 source 1..6460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 186..1973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(2313..2573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 3315..4796 product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene hsdM CDS 4831..5418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 5461..5697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 5791..5943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 sequence286 source 1..6440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1490..3961) product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene clpC CDS complement(4472..4969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 sequence287 source 1..6408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 957..3158 product bacteriocin cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 3151..4476 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533171.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 4576..5433 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095112.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(5392..5580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 5662..6036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27460 sequence288 source 1..6400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1245..1730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(1738..2175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 2146..3618 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704114.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene codA CDS complement(3724..4611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140768.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(4608..5051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140769.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 misc_feature complement(5168..>6400) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DK88:S-adenosylmethionine synthase locus_tag LOCUS_27520 sequence289 source 1..6383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 434..1135 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057791.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(1296..2087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(2084..2806) product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK22 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene pyrF CDS complement(2891..4147) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene tyrS sequence290 source 1..6381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(230..661) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326711.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(988..2724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 2909..3724 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 3787..4845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 4993..5523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(5930..6079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(6076..6216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 sequence291 source 1..6300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 548..1795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 1973..3151 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 3372..3926 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 4010..4969 product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142475.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 5373..5909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 sequence292 source 1..6282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 338..622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 692..1393 product racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815911.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 1836..3053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27710 sequence293 source 1..6245 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..692 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VD39:light-independent protochlorophyllide reductase iron-sulfur ATP-binding protein locus_tag LOCUS_27720 CDS 789..1124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 1135..1380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 1461..3380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 3457..3999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(4006..4266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(4662..5339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057912.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 sequence294 source 1..6167 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(526..1311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 1739..3895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(3924..4511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935899.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(4627..5241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 sequence295 source 1..6166 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1146..1700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 1763..2368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 2772..4286 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887389.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 sequence296 source 1..6142 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2465..2854) product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(2841..3086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(3293..3601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(3598..3954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44031 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 4273..5262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(5628..5924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 5923..6090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 sequence297 source 1..6141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(165..1223) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene dnaJ CDS complement(1480..3009) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 3250..3687 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(3705..4124) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(4121..4510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(4565..5128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 5337..5723 product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 sequence298 source 1..6115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(869..1645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(1739..2626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(2623..3273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142458.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(3529..4932) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG51 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene asnS CDS complement(4970..5404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 5480..5770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 sequence299 source 1..6110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(274..1410) product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729583.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(1457..1939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 2347..3624 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(3652..4824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 5140..5778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 sequence300 source 1..6108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1263..1919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(1993..4422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 4560..5123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144386.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(5138..5911) product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY72 transl_table 11 codon_start 1 locus_tag LOCUS_28140 sequence301 source 1..6084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1506..2612) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(2645..4549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 4747..5310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 sequence302 source 1..5990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 795..2519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(2533..3180) product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM88 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene hisI CDS 3546..4847 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLK8 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene hemL CDS 4989..5747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 sequence303 source 1..5978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2112..2321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(2400..3902) product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHL2 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene nusA CDS complement(4006..4479) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHL1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene rimP CDS complement(4931..5236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(5480..5977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 sequence304 source 1..5959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 164..331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 428..1456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 1692..2147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(2195..4108) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL74 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene dxs CDS 4272..4799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(4838..5728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28320 sequence305 source 1..5933 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 351..1121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143458.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 1272..1541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(1635..2108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 2722..5514 product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHU4 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene secA sequence306 source 1..5925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(560..895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(883..1299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(1430..1798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(2199..3122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(3183..3554) product CRISPR-associated protein Csx3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582986.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 3553..3750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 3753..5165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 5170..5784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 sequence307 source 1..5920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(456..1157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(1150..1479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(2246..2425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(2520..3509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(3518..4321) product chromosome partitioning ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068015.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(5147..5920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 sequence308 source 1..5874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1606..2484) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460068.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 2677..4824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(4913..5116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 sequence309 source 1..5840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(420..3017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(3085..4593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 misc_feature complement(4644..>5840) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLT5:bifunctional protein GlmU locus_tag LOCUS_28560 sequence310 source 1..5816 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..519 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003891989.1:radical SAM protein locus_tag LOCUS_28570 CDS 542..1054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 1054..2061 product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 2054..2350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 2709..2945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 3019..3300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 sequence311 source 1..5814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(168..1811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 2343..3281 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057199.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene ntcB CDS 3306..4526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057198.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(4515..4907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 misc_feature complement(5058..>5814) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DK42:lysozyme locus_tag LOCUS_28670 sequence312 source 1..5809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(721..2058) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461637.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 2286..2699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 2711..4147 product D-hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69809 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene hyuA CDS complement(4178..4963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28710 sequence313 source 1..5808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(184..1350) product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(1522..2730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 2948..5377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 sequence314 source 1..5796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1140 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056830.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 1506..2117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(2273..3160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(3214..4200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 4353..4871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938916.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 sequence315 source 1..5793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 323..1771 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI5 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene gltX CDS 2170..4062 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW7 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene ftsH CDS 4282..5391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 sequence316 source 1..5778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1279..2670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 2877..3434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(3551..5569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 sequence317 source 1..5772 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..585 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529592.1:ribosylpyrimidine nucleosidase locus_tag LOCUS_28860 CDS 621..1208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 1232..1882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 1988..2323 product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene ccmK CDS 2335..2727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 2724..3155 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 3316..3666 product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142094.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 sequence318 source 1..5754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(182..808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 1268..2551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(2652..3536) product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 3729..5063 product Na+-transporting ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056159.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 misc_feature complement(5060..>5754) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886674.1:methyltransferase locus_tag LOCUS_28970 sequence319 source 1..5746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 224..1489 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 2091..3533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(3577..4659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057667.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(4938..5258) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NM87 transl_table 11 codon_start 1 locus_tag LOCUS_29010 sequence320 source 1..5723 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 189..923 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 1131..2006 product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057433.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene ycf53 CDS complement(2108..2785) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181645.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene gph CDS complement(2952..4655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141468.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 misc_feature complement(4814..>5723) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038863.1:isocitrate dehydrogenase, NADP-dependent locus_tag LOCUS_29060 sequence321 source 1..5710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(532..1344) product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I615 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(1573..2538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 2762..4501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 4495..4923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(4938..5636) product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG61 transl_table 11 codon_start 1 locus_tag LOCUS_29110 sequence322 source 1..5692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(977..2071) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097237.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(2366..3466) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEB1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(3808..4299) product photosystem I reaction center subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGB4 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene psaL CDS complement(4635..5135) product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A401 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene psaF sequence323 source 1..5666 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(514..2235) product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET5 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene deaD-1 CDS 2561..5329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 sequence324 source 1..5613 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2265..2528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(2549..3688) product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 3741..4226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143485.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 4322..5491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058308.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 sequence325 source 1..5600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 581..1360 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMK3 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene panB CDS 1563..2972 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I685 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene ahcY CDS 3125..3679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(3696..4970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 misc_feature complement(4970..>5600) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529573.1:hybrid sensor histidine kinase/response regulator locus_tag LOCUS_29260 sequence326 source 1..5595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 170..604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(746..1117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(1234..2844) product putative alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3R8 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene aglA CDS complement(2894..3163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(3268..3909) product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058094.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 4156..4878 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene ycf29 misc_feature complement(4903..>5595) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974445.1:LysR family transcriptional regulator locus_tag LOCUS_29330 sequence327 source 1..5581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(812..1441) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 1509..2981 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057361.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 3452..3931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 3931..4362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545804.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(4648..5181) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141610.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(5139..5480) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141611.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 sequence328 source 1..5506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1545..3452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(3473..4315) product arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058267.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene tyrA sequence329 source 1..5497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(405..1868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(2150..2929) product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(3053..4714) product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140869.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene pds CDS complement(4711..4998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 sequence330 source 1..5494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(493..735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(739..972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(1111..1413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 1775..2419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 2796..3065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 3086..3325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(3369..3758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142417.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(3904..4140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(4242..4541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056708.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(4741..5019) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 sequence331 source 1..5487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 891..2174 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP5 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 2174..2797 product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene nadD CDS 2755..3507 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 3525..5222 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene nadE sequence332 source 1..5474 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1790..3220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056881.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 3466..3861 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140008.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 4246..5199 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 sequence333 source 1..5473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..903 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545777.1:adenylate/guanylate cyclase domain-containing protein locus_tag LOCUS_29630 CDS 916..1176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 1173..1391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 1482..2651 product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(2788..4038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 misc_feature complement(4307..>5473) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331491.1:hemolysin-type calcium-binding protein locus_tag LOCUS_29680 sequence334 source 1..5455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(592..1674) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056402.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene pilT CDS 1628..1957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 2275..3093 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA2 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene rpsB CDS 3333..3992 product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCB5 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene tsf sequence335 source 1..5432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(621..2210) product NAD(P)H-quinone oxidoreductase chain 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHX4 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene ndhD2 CDS complement(2567..3178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(3340..4269) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI27 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene thrB CDS complement(4376..4735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 sequence336 source 1..5414 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 257..478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS 625..1263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 1589..3268 product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A337 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene groL2 CDS complement(3466..3780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(3833..4948) product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 sequence337 source 1..5412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1958..3091) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228271.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(3197..4369) product galactosyldiacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(4375..5268) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807954.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 sequence338 source 1..5407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1736..2374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(2385..2741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(2746..3417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(3429..3782) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055899.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(3775..4605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141512.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 misc_feature complement(4737..>5407) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140627.1:prolyl endopeptidase locus_tag LOCUS_29910 sequence339 source 1..5335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1064..2092) product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089304.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 2218..3297 product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202512.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(3301..4437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 misc_feature complement(4430..>5335) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970431.1:serine/threonine protein kinase locus_tag LOCUS_29950 sequence340 source 1..5306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(345..788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 981..2207 product cysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(2245..2583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(2771..4573) product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJS8 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene aspS sequence341 source 1..5301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1938 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142463.1:type I-D CRISPR-associated helicase Cas3' locus_tag LOCUS_30000 CDS 1986..2876 product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229076.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 2873..3475 product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 3522..4523 product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEP2 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene cas1 CDS 4534..4806 product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDC5 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene cas2 repeat_region 5082..5263 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgacaaaagctcttaaaccctcataggga sequence342 source 1..5293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 245..406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(520..1872) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene suc1 CDS complement(2042..3436) product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 3567..3896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 4027..4200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30090 sequence343 source 1..5293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1487..2245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(2247..2492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(2530..3375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(3449..4384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(4402..5040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 sequence344 source 1..5272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 211..897 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 901..2409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 2456..3952 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142768.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 sequence345 source 1..5254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(193..1209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 1698..2417 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJZ1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene deoC CDS 2425..3609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 3593..5170 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140087.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 sequence346 source 1..5252 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 942..2129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056882.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 2425..4653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 misc_feature complement(4720..>5252) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057331.1:penicillin-binding protein locus_tag LOCUS_30240 sequence347 source 1..5252 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 487..843 product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPU4 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene folB CDS complement(863..1552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 1943..2470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(2843..4075) product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(4148..4960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 4959..5138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 sequence348 source 1..5239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 595..1794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 2013..2564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 2687..3412 product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP8 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene atpB CDS 3562..3807 product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP7 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene atpE CDS 3995..4483 product ATP synthase subunit b' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP6 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene atpG CDS 4571..5095 product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP5 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene atpF sequence349 source 1..5226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(383..1891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS 2144..3079 product delta-9 desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057556.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene desC3 CDS complement(3098..4612) product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 4774..5127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 sequence350 source 1..5223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(127..882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(978..1607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(1645..3177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(3204..3797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 4041..4979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 sequence351 source 1..5222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192732.1:multidrug DMT transporter permease locus_tag LOCUS_30460 CDS 801..986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 1146..1598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(1763..2536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143024.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 2535..3662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 3872..4450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 sequence352 source 1..5221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 660..5147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 sequence353 source 1..5213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 100..1986 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG5 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene ftsH CDS 2335..3018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124316.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 3141..3899 product nitrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057403.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 sequence354 source 1..5203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(600..1466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142464.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 1465..1722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 1923..4613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30580 sequence355 source 1..5195 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 244..1491 product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene corA CDS 1543..2058 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH9 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene apt CDS 2165..3220 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 3261..3671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 3757..4281 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 4278..4733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(4781..5122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30650 sequence356 source 1..5181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..933 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87M30:elongation factor G 2 locus_tag LOCUS_30660 CDS 1097..1456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057913.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(1757..2566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(2615..3832) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975188.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(4003..4971) product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene ispE CDS complement(5019..5180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 sequence357 source 1..5162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1456..2943 product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203595.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 sequence358 source 1..5154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(620..1150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 1512..2603 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055927.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(2818..3051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(3526..3984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258848.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(4008..4688) product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WQU7 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene mipB CDS complement(4999..5154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 sequence359 source 1..5148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(196..636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 749..1348 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW5 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene pyrE sequence360 source 1..5142 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(37..969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141161.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(1313..3409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS complement(3426..4502) product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 sequence361 source 1..5121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..609 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142003.1:oxidoreductase locus_tag LOCUS_30840 CDS 935..2335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(2587..2769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 2990..4198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057303.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 4436..4927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 sequence362 source 1..5119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1432..2775) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 2970..3845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(4192..5064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 sequence363 source 1..5107 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(789..1385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(1752..2198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(2230..3327) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(3372..4157) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068524.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(4195..4662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30960 sequence364 source 1..5104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(501..1307) product phycocyanobilin lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50037 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene cpcE CDS complement(1622..2110) product C-phycocyanin alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50032 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene cpcA CDS complement(2184..2702) product C-phycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50033 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene cpcB CDS complement(2974..3726) product phycoerythrobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL65 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene pebB CDS complement(3906..4637) product 15,16-dihydrobiliverdin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL66 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene pebA sequence365 source 1..5075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(454..1224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(1553..1840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(2133..2492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(2558..3568) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4V3 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene rbsK CDS complement(3654..3935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31060 sequence366 source 1..5053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(219..2108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(2501..3823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144101.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(3839..4624) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056183.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 sequence367 source 1..5000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1066..2241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(2509..4629) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 sequence368 source 1..4992 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 469..759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 807..1115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(1142..3496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(3493..3975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 sequence369 source 1..4985 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(310..2421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(2561..3688) product glycosyl transferase group 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546788.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(3688..4488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 misc_feature complement(4485..>4985) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012602870.1:acyl-CoA synthetase locus_tag LOCUS_31190 sequence370 source 1..4946 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(463..1155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 1668..2852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(3086..3619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(3761..4030) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJL5 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene rpsO sequence371 source 1..4930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970927.1:exopolysaccharide biosynthesis protein locus_tag LOCUS_31240 CDS 803..1861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(2295..3503) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061719.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 sequence372 source 1..4919 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256681.1:ABC transporter substrate-binding protein locus_tag LOCUS_31270 CDS complement(733..2973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(3036..3755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31290 sequence373 source 1..4915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(3589..>4915) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DL56:DNA-directed RNA polymerase subunit gamma locus_tag LOCUS_31300 sequence374 source 1..4911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1164..3095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 3143..3460 product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL6 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(3586..4734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 sequence375 source 1..4908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 62..994 product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 1083..1286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(1320..2324) product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104885.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 2452..3384 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207505.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene gltC CDS 3398..4045 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065091.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 4088..4648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144386.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 sequence376 source 1..4862 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 368..440 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(486..1256) product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9H8 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene queC CDS complement(1285..1911) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene queE CDS complement(2186..2575) product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H7H8 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 3045..3836 product ketoacyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777089.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(3875..4702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 sequence377 source 1..4858 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 245..2677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 2789..3316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 3492..4076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 misc_feature complement(4067..>4858) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055870.1:lignostilbene alpha-beta-dioxygenase locus_tag LOCUS_31480 sequence378 source 1..4851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1251..2543 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057127.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene glgC CDS 2568..3068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 3185..4750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 tRNA complement(4774..4851) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 sequence379 source 1..4831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(148..1233) product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG98 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene rlmN CDS complement(1247..2020) product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142171.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 2303..2956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(3055..4764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31550 sequence380 source 1..4827 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(71..379) product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142094.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 1126..2961 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057958.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene ndhF4 CDS 3002..4549 product NAD(P)H-quinone oxidoreductase subunit D4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142080.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene ndhD sequence381 source 1..4814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 198..1433 product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071025.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene tnpA CDS complement(1702..2736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS complement(2808..3143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(3125..3781) product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666923.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(3894..4547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 sequence382 source 1..4812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1174..3189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(3320..3895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(4069..4401) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 sequence383 source 1..4811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(165..908) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UP1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene cynT CDS 1188..2588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 2602..3135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 3189..4055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107829.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 misc_feature complement(4064..>4811) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGG4:GTPase Obg locus_tag LOCUS_31710 sequence384 source 1..4807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055904.1:penicillin-binding protein locus_tag LOCUS_31720 CDS 1143..1382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(1508..1825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057879.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(1937..2932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 3019..3504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 3529..4062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(4093..4731) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ09 transl_table 11 codon_start 1 locus_tag LOCUS_31780 sequence385 source 1..4805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 606..1472 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DC82 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 1475..2293 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHQ5 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 2336..3895 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(3904..4704) product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926759.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 sequence386 source 1..4796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(374..550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 707..961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 1096..2286 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682079.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(2436..3653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228342.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 misc_feature complement(3684..>4796) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975513.1:esterase locus_tag LOCUS_31870 sequence387 source 1..4793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(722..1927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(1920..3407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(3493..4740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31900 sequence388 source 1..4753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(137..772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(931..1239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(1524..2891) product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC8 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(3262..3705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057140.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 misc_feature complement(3920..>4753) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057141.1:long-chain-fatty-acid--CoA ligase locus_tag LOCUS_31950 sequence389 source 1..4751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(304..1134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 1545..2687 product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFJ5 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene gcvT CDS 2778..3176 product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFJ4 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene gcvH sequence390 source 1..4726 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 431..706 product UPF0367 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VE69 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 710..1402 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056429.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 1480..2022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 tRNA 2160..2233 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 2702..3439 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144148.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 3461..3853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057643.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 misc_feature complement(3991..>4726) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142091.1:carbon dioxide concentrating mechanism protein CcmM locus_tag LOCUS_32040 sequence391 source 1..4694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 88..279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 424..1320 product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970198.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(1335..2810) product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DPS3 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene glgA CDS 3178..4071 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 4235..4681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 sequence392 source 1..4678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1124..1357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 sequence393 source 1..4672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1503 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142684.1:phosphoenolpyruvate synthase locus_tag LOCUS_32110 CDS 1622..2521 product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011733.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene pldB CDS 2693..4213 product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPJ8 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene rhlE sequence394 source 1..4672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 117..932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027099.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 978..2462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 2588..3679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 sequence395 source 1..4672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(297..1181) product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHQ1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 1298..1495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057323.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene ycf33 CDS 1543..1959 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF9 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene rbfA CDS 1972..3645 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056886.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 3669..3851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 4005..4370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 sequence396 source 1..4652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 622..888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528614.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 1118..2773 product fused response regulator/thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 2888..4306 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142209.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 sequence397 source 1..4647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 465..1613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 1761..1952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 2365..2556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 2592..3257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143006.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 3273..4442 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969962.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 sequence398 source 1..4646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..1934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125671.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(2037..2465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(2478..2750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061339.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 2918..4090 product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229643.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 sequence399 source 1..4639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 459..1394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 1451..2281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(2474..4324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 sequence400 source 1..4625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(294..370) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(471..1424) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056905.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(1491..2006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140851.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 gene ycf36 CDS complement(2126..2683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 2962..3285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 3343..3762 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VC00 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene ppiB CDS 3866..4555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 sequence401 source 1..4625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 276..1688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 1812..2972 product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37956 transl_table 11 codon_start 1 locus_tag LOCUS_32460 gene splB CDS complement(2985..3785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(3905..4366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141996.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 sequence402 source 1..4612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1110..2075) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057872.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 2732..3736 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057413.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 3889..4377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 sequence403 source 1..4607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 267..1220 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 1308..1928 product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153597.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene wcaF CDS 2140..4392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 sequence404 source 1..4604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1417 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119569.1:alginate O-acetyltransferase locus_tag LOCUS_32550 CDS complement(1949..2365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 2747..4279 product photosystem II CP47 reaction center protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene psbB sequence405 source 1..4576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1209..1982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32580 misc_feature complement(1996..>4576) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387720.1:glycosyl transferase group 1 locus_tag LOCUS_32590 sequence406 source 1..4562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..573 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DM20:elongation factor 4 locus_tag LOCUS_32600 CDS 833..1813 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene rfbB CDS 1909..3291 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 sequence407 source 1..4544 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 69..767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 1109..3280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32640 sequence408 source 1..4491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 862..1062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 1096..2670 product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC3 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene nnr CDS complement(2717..3328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 sequence409 source 1..4479 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2307..2645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918611.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 2655..2918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 2915..3436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 4003..4248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 sequence410 source 1..4422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(630..1106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(1109..2263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 2438..2698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 2698..2967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 sequence411 source 1..4406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..1312) product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHK2 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene thiE CDS 1798..3678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 sequence412 source 1..4398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 488..1141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 1122..1727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS complement(1986..2195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(2182..2487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(2513..2908) product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ERI7 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene mvpA CDS complement(2908..3114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 sequence413 source 1..4383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(587..1399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(1513..2196) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142237.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(2601..2861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(3605..4279) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene purN sequence414 source 1..4361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 390..656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 1222..1749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 note possible pseudo, frameshifted CDS complement(1766..2332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144386.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(2449..2787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(2775..3191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32930 sequence415 source 1..4357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1964..2665) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(2699..3883) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 sequence416 source 1..4357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(6..1055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(1204..1896) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706202.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 2113..2460 product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKF6 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene ndhM sequence417 source 1..4343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 84..1124 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194045.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene hddA CDS 1182..2402 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(2464..3087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33010 sequence418 source 1..4340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(252..932) product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976220.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 1950..3527 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020815.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 sequence419 source 1..4313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(243..710) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086784.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(720..1361) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388742.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(1457..1948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057705.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(1956..2456) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG73 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene ruvC CDS complement(2523..3593) product Mg-protoporphyrin IX chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS0 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene chlI CDS complement(3737..3958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 note possible pseudo, internal stop codon, frameshifted CDS complement(4123..4311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 sequence420 source 1..4294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4..1518 product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP3 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene atpA CDS 1575..2528 product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLU1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene atpG CDS complement(2972..3658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143129.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 sequence421 source 1..4289 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1381..2316 product mRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene wcaG CDS 2346..3332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(3374..3808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(3796..4050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 sequence422 source 1..4256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(958..1794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 2004..2906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056522.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(2932..4101) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ5 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene era sequence423 source 1..4254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence424 source 1..4239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(213..1130) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403071.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(1420..3330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(3646..4011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 sequence425 source 1..4226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..574 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816283.1:HlyD family type I secretion periplasmic adaptor subunit locus_tag LOCUS_33240 CDS 1181..1333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 1647..1853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(1935..2537) product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH13 transl_table 11 codon_start 1 locus_tag LOCUS_33270 sequence426 source 1..4210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(94..783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33280 sequence427 source 1..4209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1692..3038 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM9 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene murF CDS complement(3607..3987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 sequence428 source 1..4168 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(742..1185) product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8F4 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 1485..1967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 2283..2921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 2961..3860 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057997.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 3876..4073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 sequence429 source 1..4156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1341..2519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730934.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 tRNA complement(2897..2970) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 3099..3902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058307.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 sequence430 source 1..4141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(472..2292) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142407.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 2637..3617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(3624..3881) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 sequence431 source 1..4096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(357..1070) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056116.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(1093..2022) product NAD kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene nadK1 CDS 2299..2565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058048.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(2619..3077) product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL47 transl_table 11 codon_start 1 locus_tag LOCUS_33450 sequence432 source 1..4092 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 392..1306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS 1391..3475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS 3575..3850 product CRISPR-associated endoribonuclease Cas2 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJV5 transl_table 11 codon_start 1 locus_tag LOCUS_33490 gene cas2-3 sequence433 source 1..4087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(375..1583) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(1598..2641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 2860..3876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 sequence434 source 1..4073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 280..582 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW7 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene rpsN CDS complement(707..1054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056249.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 1173..1748 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKJ8 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene aat CDS complement(1764..2330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(2425..3591) product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125189.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 sequence435 source 1..4068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(784..945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS 1047..1394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 1532..1915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 1908..2345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 2480..3886 product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB2 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene miaB sequence436 source 1..4068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 161..2356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 2485..3564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 sequence437 source 1..4059 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 159..1268 product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK79 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene rsgA CDS complement(1281..1673) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462120.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(1696..3138) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW6 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene cysS sequence438 source 1..4054 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1672 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058113.1:adenylate/guanylate cyclase domain-containing protein locus_tag LOCUS_33680 CDS complement(1701..1880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS 1888..2799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 sequence439 source 1..4029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(212..877) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP5 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene hisH CDS 939..1520 product pyrrolidone-carboxylate peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H6J0 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene pcp CDS 1537..3156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058234.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS 3354..3641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 sequence440 source 1..4009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 178..1173 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS 1232..1843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(1786..2640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS 3097..3615 product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138584.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene speG sequence441 source 1..4000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 168..1031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS 1209..2666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 2784..3023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS complement(3047..3418) product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UI12 transl_table 11 codon_start 1 locus_tag LOCUS_33820 sequence442 source 1..3978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(327..1142) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092883.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(1181..3679) product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143682.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 sequence443 source 1..3968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 852..1325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(1336..1671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS 1760..2698 product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(2732..3967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 sequence444 source 1..3963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 281..766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 1266..3188 product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHI0 transl_table 11 codon_start 1 locus_tag LOCUS_33900 sequence445 source 1..3958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..548 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058023.1:glycoside hydrolase locus_tag LOCUS_33910 CDS complement(821..1597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(1757..3052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(3140..3343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 misc_feature complement(3446..>3958) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DK30:1-deoxy-D-xylulose 5-phosphate reductoisomerase locus_tag LOCUS_33950 sequence446 source 1..3951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(525..833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS complement(867..1418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141208.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(1463..2230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 2348..3340 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 sequence447 source 1..3914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..939 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P59029:3-isopropylmalate dehydrogenase locus_tag LOCUS_34010 CDS 1303..1590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS 1839..2663 product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL0 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 2811..3755 product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE7 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene accD sequence448 source 1..3913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(637..>3913) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122759.1:cycloinulo-oligosaccharide fructanotransferase locus_tag LOCUS_34050 sequence449 source 1..3900 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..1594) product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(1591..2685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 2787..3722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056522.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 sequence450 source 1..3899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(902..1993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 sequence451 source 1..3875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 573..998 product TIGR02588 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142148.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 1015..1479 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142677.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS 1484..1900 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 1900..2262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(2410..2619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(2657..2947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(2901..3188) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 sequence452 source 1..3873 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(574..1245) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU21 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene rmlC CDS complement(1500..2675) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(2715..3731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34190 sequence453 source 1..3859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1904..2644 product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 3007..3651 product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 sequence454 source 1..3854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1185..2264) product SBC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125746.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene tlyC sequence455 source 1..3804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(38..187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS 514..1473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 1522..3105 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057989.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene hemD CDS 3102..3686 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIP9 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene coaE sequence456 source 1..3797 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 380..916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(913..2529) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDU0 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene hflX CDS 3141..3557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 sequence457 source 1..3784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1435..2043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057957.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 2059..2808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34310 sequence458 source 1..3781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057883.1:sugar ABC transporter substrate-binding protein locus_tag LOCUS_34320 CDS complement(615..1388) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250977.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(1385..2413) product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 2677..3375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34350 sequence459 source 1..3766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence460 source 1..3759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1209..1352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(1417..2172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 2859..3227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 sequence461 source 1..3738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(896..2857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 misc_feature complement(3166..>3738) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140747.1:polysaccharide pyruvyl transferase CsaB locus_tag LOCUS_34400 sequence462 source 1..3737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 739..2004 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS 2012..2548 product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140681.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS complement(2633..3046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS complement(3030..3371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34440 sequence463 source 1..3716 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1044 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058177.1:general secretion pathway protein GspD locus_tag LOCUS_34450 CDS 1430..1717 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140834.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene hup CDS 1757..2845 product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058099.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 sequence464 source 1..3698 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(287..679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS complement(828..1649) product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082339.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS complement(1783..2871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34500 sequence465 source 1..3695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 225..2879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 sequence466 source 1..3670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 434..2323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 sequence467 source 1..3634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(356..2092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 misc_feature complement(2539..>3634) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLY3:3-phosphoshikimate 1-carboxyvinyltransferase locus_tag LOCUS_34540 sequence468 source 1..3627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 882..1376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(1386..3155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 sequence469 source 1..3625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1519..>3625) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011181512.1:GTPase locus_tag LOCUS_34570 sequence470 source 1..3607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056832.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(309..1433) product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR7 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene dnaJ misc_feature complement(1799..>3607) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKR6:chaperone protein dnaK1 locus_tag LOCUS_34600 sequence471 source 1..3596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1741 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DK04:translation initiation factor IF-2 locus_tag LOCUS_34610 CDS 1766..2458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 2553..2753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(2940..3491) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGV8 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene recR sequence472 source 1..3593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 395..847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002249008.2 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 860..1060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(1169..1375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(1379..1852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(1849..2745) product tartronate semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(2884..3081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 sequence473 source 1..3585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(37..1218) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(1374..2588) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142192.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 sequence474 source 1..3575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(787..2307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34730 sequence475 source 1..3568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1002 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947219.1:adenylate cyclase locus_tag LOCUS_34740 sequence476 source 1..3550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 327..521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 1469..1762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 1897..2670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS complement(2750..3034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(3024..3320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679319.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 sequence477 source 1..3537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 278..2275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(2272..2613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 2834..3385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701028.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 sequence478 source 1..3531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1164 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001142835.1:glycerol-3-phosphate dehydrogenase locus_tag LOCUS_34830 CDS 1847..2632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS 2649..3395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34850 sequence479 source 1..3510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 392..3313 product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DV4 transl_table 11 codon_start 1 locus_tag LOCUS_34860 sequence480 source 1..3508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..887 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7V9N7:magnesium transporter MgtE locus_tag LOCUS_34870 CDS 1186..1905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 1936..2784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34890 sequence481 source 1..3502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 144..866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143042.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 866..1459 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143043.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(1403..2875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143044.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 sequence482 source 1..3501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(944..2653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(2640..3419) product phosphonates import ATP-binding protein PhnC 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYT0 transl_table 11 codon_start 1 locus_tag LOCUS_34950 gene phnC1 sequence483 source 1..3494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 26..364 product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 gene ccmK1 CDS 426..728 product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene ccmL CDS 752..2920 product carbon dioxide concentrating mechanism protein CcmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142091.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene ccmM sequence484 source 1..3490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1125..1895) product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DME3 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(2027..3148) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIT6 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene glk sequence485 source 1..3486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 898..1347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 sequence486 source 1..3479 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1679..2305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(2338..2649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35030 misc_feature complement(2911..>3479) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DK65:glutamyl-tRNA(Gln) amidotransferase subunit A locus_tag LOCUS_35040 sequence487 source 1..3478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 289..1632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 sequence488 source 1..3432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1028..1699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 1783..3162 product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 sequence489 source 1..3427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 434..961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 1183..2085 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 2134..3135 product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700854.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 sequence490 source 1..3416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(265..1029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(1132..1764) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140806.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS 1905..3248 product monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 sequence491 source 1..3412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1239 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973686.1:FAD-dependent oxidoreductase locus_tag LOCUS_35140 CDS 1417..2511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 sequence492 source 1..3405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(131..1978) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057670.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 sequence493 source 1..3400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(270..1202) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJW4 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene argF CDS 1329..1943 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(2042..2863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141258.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 sequence494 source 1..3394 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2107..2739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142166.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 sequence495 source 1..3393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1914 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DG52:endonuclease MutS2 locus_tag LOCUS_35210 CDS complement(1986..2708) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA4 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene rph sequence496 source 1..3367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1205..2278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704432.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 2364..3239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35240 sequence497 source 1..3364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(978..2540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 sequence498 source 1..3360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(133..771) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR9 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(944..1738) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140178.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(1774..2652) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140177.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 misc_feature complement(2741..>3360) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003891971.1:ABC transporter substrate-binding protein locus_tag LOCUS_35290 sequence499 source 1..3358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence500 source 1..3354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1491..2351) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 gene omt sequence501 source 1..3351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..966 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056941.1:serine/threonine protein kinase locus_tag LOCUS_35310 sequence502 source 1..3349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1011..1805 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 gene sigG CDS 1973..2782 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143437.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 misc_feature complement(2797..>3349) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NFV7:3-isopropylmalate dehydratase large subunit locus_tag LOCUS_35340 sequence503 source 1..3322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(408..752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142157.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS complement(754..1080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142926.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 1304..2614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057293.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 sequence504 source 1..3316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 878..1726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 1805..2377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35390 note possible pseudo, internal stop codon CDS 2429..2902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35400 note possible pseudo, internal stop codon, frameshifted sequence505 source 1..3310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 390..656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 656..1063 product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P2L6 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene vapc26 CDS 1108..2232 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(2287..2679) product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QRY6 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene vapC CDS complement(2679..2981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35450 sequence506 source 1..3303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 814..984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35460 sequence507 source 1..3297 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..565 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118576.1:NrfA- nitrite reduction protein locus_tag LOCUS_35470 CDS 660..1322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS 1328..2017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 2098..2589 product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141717.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene trxA CDS 2647..2865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35510 sequence508 source 1..3294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1309 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DIN0:serine--tRNA ligase locus_tag LOCUS_35520 CDS 1386..2486 product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE8 transl_table 11 codon_start 1 locus_tag LOCUS_35530 sequence509 source 1..3290 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 275..526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 527..928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS 1061..3130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 sequence510 source 1..3273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 886..1053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(1135..1929) product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLN9 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene trpA CDS complement(2022..2342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056554.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS complement(2367..2603) product NAD(P)H-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ3 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene ndhL tRNA 2826..2911 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 sequence511 source 1..3265 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1341..2951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35610 sequence512 source 1..3255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(354..608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS complement(614..844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS 927..1256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 1249..1608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS complement(1616..2437) product lactose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 sequence513 source 1..3254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(136..1032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058247.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS complement(1254..1436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 1870..3072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143041.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 sequence514 source 1..3247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(620..2413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057554.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 misc_feature complement(2473..>3247) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKK2:DNA ligase locus_tag LOCUS_35710 sequence515 source 1..3233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(943..1905) product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056703.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 gene ycf39 sequence516 source 1..3220 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 356..1996 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 sequence517 source 1..3217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(951..1946) product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR0 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene ilvC CDS 2131..2733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058161.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 sequence518 source 1..3217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(937..1797) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 sequence519 source 1..3214 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 626..1240 product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS 1233..1493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS 1553..2599 product DUF1016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 sequence520 source 1..3211 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1283 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257750.1:succinate dehydrogenase flavoprotein subunit locus_tag LOCUS_35800 CDS 1303..1581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 1578..1808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS complement(1917..2351) product toxin YhaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347267.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(2344..2664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 sequence521 source 1..3209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(799..1413) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS 1635..2063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229702.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS 2125..2616 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 sequence522 source 1..3204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(500..2872) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG65 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene pcrA sequence523 source 1..3193 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 43..855 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS complement(842..1690) product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056352.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(1732..2508) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057898.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 misc_feature complement(2501..>3193) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057897.1:ABC transporter substrate-binding protein locus_tag LOCUS_35920 sequence524 source 1..3187 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(290..2008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056105.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 2475..3026 product oligoketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125274.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 sequence525 source 1..3183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1643..2683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 sequence526 source 1..3177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(131..838) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232471.2 transl_table 11 codon_start 1 locus_tag LOCUS_35960 sequence527 source 1..3176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..2121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058075.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(2435..2767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 sequence528 source 1..3171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(143..994) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561538.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS complement(1022..2338) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339221.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 misc_feature complement(2374..>3171) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MGL2:polyamine-transporting ATPase locus_tag LOCUS_36010 sequence529 source 1..3155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 817..1326 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene hspA CDS 1592..3043 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141482.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 sequence530 source 1..3154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1797..2213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 sequence531 source 1..3149 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1417..2487) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS 2576..2719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36060 sequence532 source 1..3130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 608..802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS 1078..1344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(1372..2616) product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHJ8 transl_table 11 codon_start 1 locus_tag LOCUS_36090 sequence533 source 1..3130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2285..2959 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142214.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 sequence534 source 1..3106 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 312..1808 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC4 transl_table 11 codon_start 1 locus_tag LOCUS_36110 gene gatB sequence535 source 1..3100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..984 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731061.1:histidine kinase locus_tag LOCUS_36120 CDS 1232..1804 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene rcp1 sequence536 source 1..3100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1271..1957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36140 sequence537 source 1..3093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 50..823 product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNP3 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene aqpZ CDS complement(1022..1204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(1334..1480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 1835..2158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056944.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 2315..2866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36190 sequence538 source 1..3087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..861 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144065.1:EEP domain-containing protein locus_tag LOCUS_36200 CDS 895..2370 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144064.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene cls sequence539 source 1..3079 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 908..2419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36220 sequence540 source 1..3072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 785..2008 product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056005.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene chlP CDS 2172..3065 product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIA2 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene hslO sequence541 source 1..3066 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(119..1285) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH42 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene proB CDS complement(1690..2211) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056346.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 sequence542 source 1..3062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 63..1256 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056455.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 1355..2176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 2492..2893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36290 sequence543 source 1..3052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..617 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124630.1:short-chain dehydrogenase locus_tag LOCUS_36300 CDS complement(614..1057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(1100..1450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(1538..1948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 2160..2894 product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI83 transl_table 11 codon_start 1 locus_tag LOCUS_36340 sequence544 source 1..3037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(525..1574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 1791..2948 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 sequence545 source 1..3034 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 445..1470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36370 sequence546 source 1..3034 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence547 source 1..3033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(292..1170) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 sequence548 source 1..3020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(314..1531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 1699..2034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 misc_feature complement(2118..>3020) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140808.1:acriflavine resistance protein B locus_tag LOCUS_36410 sequence549 source 1..3020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1181..1495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 1623..2822 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140589.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 sequence550 source 1..3017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707240.1:type I secretion C-terminal target domain-containing protein locus_tag LOCUS_36440 CDS 1049..2533 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 sequence551 source 1..3003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(233..1480) product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK70 transl_table 11 codon_start 1 locus_tag LOCUS_36460 gene ispG CDS complement(1612..2082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(2357..2788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36480 sequence552 source 1..2975 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(569..1195) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(1302..2171) product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 sequence553 source 1..2962 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 955..1539 product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056745.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 1731..2102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36520 sequence554 source 1..2961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 375..722 product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 733..1035 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS complement(1053..1280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(1501..1716) product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(2066..2959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36570 sequence555 source 1..2961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 357..914 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(949..1068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS complement(1217..1366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 1540..1791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 1791..2183 product nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 sequence556 source 1..2956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 358..981 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(1164..1355) product high light inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056299.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 1731..2882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 sequence557 source 1..2948 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 756..1748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122391.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(2150..2512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 sequence558 source 1..2945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 487..1788 product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(1820..2008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36690 misc_feature complement(2005..>2945) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957528.1:MFS transporter locus_tag LOCUS_36700 sequence559 source 1..2945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(294..488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 866..1147 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143413.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS complement(1268..1939) product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 1998..2456 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS 2467..2700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36750 sequence560 source 1..2943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(280..1224) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141432.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 gene dnaX CDS complement(1197..1922) product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHA4 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene tmk CDS 2085..2435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36780 sequence561 source 1..2943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..589 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S6C2:protease HtpX locus_tag LOCUS_36790 CDS complement(727..2229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 2438..2818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 sequence562 source 1..2926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1692..2399 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE8 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene rpe CDS 2538..2738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36830 tRNA complement(2811..2882) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 sequence563 source 1..2921 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence564 source 1..2918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 505..1104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS complement(1191..2348) product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM42 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene hisC sequence565 source 1..2875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 933..2291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36860 sequence566 source 1..2864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(280..2214) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB0 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene dnaG sequence567 source 1..2861 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2325 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141551.1:serine/threonine protein kinase locus_tag LOCUS_36880 sequence568 source 1..2859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(947..2023) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene desA misc_feature complement(2251..>2859) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142493.1:DUF159 family protein locus_tag LOCUS_36900 sequence569 source 1..2840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(496..1395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057461.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 sequence570 source 1..2839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 206..1774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(1821..2735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726965.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 sequence571 source 1..2832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 93..719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058196.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 sequence572 source 1..2824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1322..1582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 1912..2505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058161.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 sequence573 source 1..2815 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 688..2058 product alpha-glucoside ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337812.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene aglE sequence574 source 1..2815 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..1884) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGM7 transl_table 11 codon_start 1 locus_tag LOCUS_36980 gene ftsH CDS 2230..2544 product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJY3 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene clpS sequence575 source 1..2810 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(156..617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 922..1119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37010 misc_feature complement(1452..>2810) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057380.1:serine/threonine protein kinase locus_tag LOCUS_37020 sequence576 source 1..2805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence577 source 1..2782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1047..1400 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS 1454..2314 product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS4 transl_table 11 codon_start 1 locus_tag LOCUS_37040 sequence578 source 1..2765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 443..1750 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056295.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 gene ftsW CDS 1828..2112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 2109..2558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 sequence579 source 1..2762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence580 source 1..2762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence581 source 1..2761 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(46..888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(1384..2562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37090 sequence582 source 1..2760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 260..856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS complement(919..2097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37110 misc_feature complement(2223..>2760) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056653.1:peptide ABC transporter substrate-binding protein locus_tag LOCUS_37120 sequence583 source 1..2745 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 255..1163 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 1261..2331 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143449.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 sequence584 source 1..2741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 303..1619 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143371.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 1619..2032 product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI8 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 2149..2730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141131.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 sequence585 source 1..2709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 420..884 product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHT4 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene nrdR CDS 1235..2203 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene rps1 sequence586 source 1..2698 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(830..1822) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057568.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 sequence587 source 1..2690 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 4..509 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttaccgagccattgagttcggaatagttggaaac CDS complement(1007..1633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS complement(1942..2118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS complement(2146..2319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37230 sequence588 source 1..2659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1450..1569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(1662..2003) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBF6 transl_table 11 codon_start 1 locus_tag LOCUS_37250 gene trxA sequence589 source 1..2651 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 565..2289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37260 sequence590 source 1..2601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence591 source 1..2578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(379..1167) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMH9 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(1335..1937) product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ41 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene ycf4 sequence592 source 1..2571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(250..420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS 374..1585 product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056246.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS 1612..2223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141116.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 sequence593 source 1..2565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1409..1777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37320 sequence594 source 1..2547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 193..711 product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A386 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene psbV CDS 890..2080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37340 sequence595 source 1..2534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(205..1218) product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTX4 transl_table 11 codon_start 1 locus_tag LOCUS_37350 gene dusA CDS 1672..2121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37360 sequence596 source 1..2493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 515..1777 product alpha-glucoside ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706893.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 sequence597 source 1..2490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1365..>2490) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104865.1:hybrid sensor histidine kinase/response regulator locus_tag LOCUS_37380 sequence598 source 1..2488 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(280..350) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(502..1437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37390 misc_feature complement(1697..>2488) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257013.1:adenylate cyclase locus_tag LOCUS_37400 sequence599 source 1..2468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1599..2027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37410 sequence600 source 1..2467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 123..677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143316.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 779..1066 product toxin, RelE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942190.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 1077..1379 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(1607..1957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37450 sequence601 source 1..2458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence602 source 1..2457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 729..1028 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 gene fdx CDS 1236..1538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 1541..1954 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393269.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 sequence603 source 1..2449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(288..1859) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA9 transl_table 11 codon_start 1 locus_tag LOCUS_37490 gene lysS sequence604 source 1..2447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 405..1685 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 sequence605 source 1..2443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence606 source 1..2437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 868..1917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37510 sequence607 source 1..2417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(655..972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37520 sequence608 source 1..2416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence609 source 1..2413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1214..1366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 misc_feature complement(1644..>2413) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VDZ4:phosphoglycerate kinase locus_tag LOCUS_37540 sequence610 source 1..2392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence611 source 1..2382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..965 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P44999:putative type-2 restriction enzyme HindVP locus_tag LOCUS_37550 CDS 962..1939 product modification methylase HindV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45000 transl_table 11 codon_start 1 locus_tag LOCUS_37560 gene hindVM sequence612 source 1..2380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..486 product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056210.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 gene trxA CDS 504..794 product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140099.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 795..1139 product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140100.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS complement(1613..2209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37600 sequence613 source 1..2378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(409..759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057512.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 misc_feature complement(1044..>2378) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120142.1:acriflavine resistance protein B locus_tag LOCUS_37620 sequence614 source 1..2375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence615 source 1..2369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5..973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS complement(1069..1476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37640 sequence616 source 1..2355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8RE47:serine protease locus_tag LOCUS_37650 CDS 1285..1848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 sequence617 source 1..2347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(295..1959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37670 sequence618 source 1..2325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence619 source 1..2317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence620 source 1..2314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(268..915) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141001.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 978..1676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 sequence621 source 1..2307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(929..1312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(1360..1590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37710 sequence622 source 1..2302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 325..2109 product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125785.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene putP sequence623 source 1..2295 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence624 source 1..2285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1775..2284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 sequence625 source 1..2276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(242..>2276) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NLX1:alpha-1,4 glucan phosphorylase locus_tag LOCUS_37740 sequence626 source 1..2258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence627 source 1..2258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence628 source 1..2255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(310..1203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37750 sequence629 source 1..2234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(323..742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS complement(732..965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS 1107..1439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141200.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 1423..1932 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 sequence630 source 1..2233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 219..1796 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026997.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 sequence631 source 1..2226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(360..1109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37810 sequence632 source 1..2204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(208..414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(433..1377) product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM00 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene prmA misc_feature complement(1562..>2204) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DM01:D-3-phosphoglycerate dehydrogenase locus_tag LOCUS_37840 sequence633 source 1..2194 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(226..1524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37850 misc_feature complement(1583..>2194) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGG7:putative lipid II flippase MurJ locus_tag LOCUS_37860 sequence634 source 1..2187 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 348..692 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(719..1681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37880 sequence635 source 1..2185 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(158..230) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 426..674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS 796..2154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 sequence636 source 1..2170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 593..1192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 1214..1966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37920 sequence637 source 1..2163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence638 source 1..2162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..904 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391327.1:membrane protein locus_tag LOCUS_37930 CDS 1090..2049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 sequence639 source 1..2160 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(201..497) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706250.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS complement(635..1819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 sequence640 source 1..2140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(661..>2140) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DH61:leucine--tRNA ligase locus_tag LOCUS_37970 sequence641 source 1..2113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 82..1617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene ycf46 sequence642 source 1..2109 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence643 source 1..2100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 155..1204 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene speB sequence644 source 1..2063 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..508 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120143.1:RND transporter locus_tag LOCUS_38000 sequence645 source 1..2025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 233..430 product antitoxin VapB32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 435..803 product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P2V9 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene vapc32 CDS complement(1071..1463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(1460..1837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38040 sequence646 source 1..2024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 912..1796 product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM5 transl_table 11 codon_start 1 locus_tag LOCUS_38050 gene miaA sequence647 source 1..2022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence648 source 1..2019 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence649 source 1..2016 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..634 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941434.1:TetR family transcriptional regulator locus_tag LOCUS_38060 CDS 718..1455 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 sequence650 source 1..2013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(308..1648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(1645..2013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38090 sequence651 source 1..1985 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence652 source 1..1982 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 495..728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 721..1017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(1038..1727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 sequence653 source 1..1966 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 252..1115 product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124329.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 sequence654 source 1..1965 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(384..1349) product protochlorophyllide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene por sequence655 source 1..1964 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence656 source 1..1956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(482..1057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38150 misc_feature complement(1372..>1956) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141571.1:flavohemoprotein locus_tag LOCUS_38160 sequence657 source 1..1954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence658 source 1..1947 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1270..1746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38170 sequence659 source 1..1945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1251 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056978.1:NADH dehydrogenase locus_tag LOCUS_38180 sequence660 source 1..1934 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence661 source 1..1926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence662 source 1..1906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(189..1214) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 sequence663 source 1..1905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..582 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WCU8:phosphate transport system permease protein PstA locus_tag LOCUS_38200 CDS 583..1461 product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCZ3 transl_table 11 codon_start 1 locus_tag LOCUS_38210 gene pstB sequence664 source 1..1904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(321..1109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38220 sequence665 source 1..1893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(176..1414) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 sequence666 source 1..1888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence667 source 1..1870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 614..1621 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104356.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 sequence668 source 1..1855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 42..635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 706..1440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38260 sequence669 source 1..1842 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(473..1759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38270 sequence670 source 1..1840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence671 source 1..1837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(106..963) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207505.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 gene gltC CDS 1105..1593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38290 sequence672 source 1..1824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1113..1601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140266.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 sequence673 source 1..1814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence674 source 1..1802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence675 source 1..1783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 951..1517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38310 sequence676 source 1..1770 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence677 source 1..1764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 303..608 product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767829.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 601..996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS complement(1016..1243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38340 misc_feature complement(1245..>1764) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DM00:ribosomal protein L11 methyltransferase locus_tag LOCUS_38350 sequence678 source 1..1743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence679 source 1..1740 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence680 source 1..1733 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence681 source 1..1710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 874..1170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38370 sequence682 source 1..1701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(925..1701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38380 sequence683 source 1..1684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence684 source 1..1679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence685 source 1..1676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(466..1401) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 sequence686 source 1..1673 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(360..1271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38400 sequence687 source 1..1630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence688 source 1..1611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1296 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141773.1:diflavin flavoprotein A locus_tag LOCUS_38410 sequence689 source 1..1611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence690 source 1..1610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 157..630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38420 sequence691 source 1..1600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence692 source 1..1597 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(158..>1597) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933671.1:mechanosensitive ion channel protein MscS locus_tag LOCUS_38430 sequence693 source 1..1587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence694 source 1..1585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence695 source 1..1563 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 67..864 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene nagB CDS complement(1017..1433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38450