>Feature sequence001 253 56 gene locus_tag LOCUS_00010 253 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1580 237 gene locus_tag LOCUS_00020 gene mpl 1580 237 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SV8 protein_id gnl|my_center|LOCUS_00020 2926 1643 gene locus_tag LOCUS_00030 gene hemL2 2926 1643 CDS product glutamate-1-semialdehyde 2,1-aminomutase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817R3 protein_id gnl|my_center|LOCUS_00030 3092 3167 gene locus_tag LOCUS_t00010 3092 3167 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4953 3547 gene locus_tag LOCUS_00040 4953 3547 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478391.1 protein_id gnl|my_center|LOCUS_00040 5334 5089 gene locus_tag LOCUS_00050 5334 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5729 5478 gene locus_tag LOCUS_00060 5729 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6725 5958 gene locus_tag LOCUS_00070 6725 5958 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812740.1 protein_id gnl|my_center|LOCUS_00070 7038 7334 gene locus_tag LOCUS_00080 7038 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7633 7767 gene locus_tag LOCUS_00090 7633 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7911 16625 gene locus_tag LOCUS_00100 7911 16625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 16627 17883 gene locus_tag LOCUS_00110 16627 17883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 17867 19237 gene locus_tag LOCUS_00120 17867 19237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 19261 20052 gene locus_tag LOCUS_00130 19261 20052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_00130 20069 22771 gene locus_tag LOCUS_00140 20069 22771 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_00140 24511 22778 gene locus_tag LOCUS_00150 24511 22778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 25844 24687 gene locus_tag LOCUS_00160 25844 24687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 26177 28456 gene locus_tag LOCUS_00170 26177 28456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 28469 29326 gene locus_tag LOCUS_00180 28469 29326 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940039.1 protein_id gnl|my_center|LOCUS_00180 30407 29367 gene locus_tag LOCUS_00190 30407 29367 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707196.1 protein_id gnl|my_center|LOCUS_00190 31432 30404 gene locus_tag LOCUS_00200 gene yejB 31432 30404 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418068.1 protein_id gnl|my_center|LOCUS_00200 34098 31429 gene locus_tag LOCUS_00210 gene alaS 34098 31429 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61701 protein_id gnl|my_center|LOCUS_00210 35296 34265 gene locus_tag LOCUS_00220 gene recA 35296 34265 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62215 protein_id gnl|my_center|LOCUS_00220 35771 35307 gene locus_tag LOCUS_00230 gene pgpA 35771 35307 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GV2 protein_id gnl|my_center|LOCUS_00230 37060 35837 gene locus_tag LOCUS_00240 37060 35837 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2H4 protein_id gnl|my_center|LOCUS_00240 38199 37063 gene locus_tag LOCUS_00250 38199 37063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861987.1 protein_id gnl|my_center|LOCUS_00250 40483 38426 gene locus_tag LOCUS_00260 gene cooS 40483 38426 CDS product carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_00260 40931 40554 gene locus_tag LOCUS_00270 40931 40554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 41317 40955 gene locus_tag LOCUS_00280 41317 40955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_00280 41723 41340 gene locus_tag LOCUS_00290 41723 41340 CDS product iron-molybdenum cofactor-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250966.1 protein_id gnl|my_center|LOCUS_00290 42636 41737 gene locus_tag LOCUS_00300 42636 41737 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_00300 43502 42633 gene locus_tag LOCUS_00310 43502 42633 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_00310 43758 43564 gene locus_tag LOCUS_00320 43758 43564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 45471 44101 gene locus_tag LOCUS_00330 45471 44101 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_00330 45767 45864 gene locus_tag LOCUS_t00020 45767 45864 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 47373 46213 gene locus_tag LOCUS_00340 47373 46213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 49046 47607 gene locus_tag LOCUS_00350 49046 47607 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040522.1 protein_id gnl|my_center|LOCUS_00350 50005 49121 gene locus_tag LOCUS_00360 50005 49121 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815464.1 protein_id gnl|my_center|LOCUS_00360 51605 50103 gene locus_tag LOCUS_00370 51605 50103 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_00370 52073 51621 gene locus_tag LOCUS_00380 52073 51621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 53081 52131 gene locus_tag LOCUS_00390 53081 52131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807559.1 protein_id gnl|my_center|LOCUS_00390 53947 53114 gene locus_tag LOCUS_00400 53947 53114 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_00400 54752 53976 gene locus_tag LOCUS_00410 54752 53976 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_00410 56206 54899 gene locus_tag LOCUS_00420 56206 54899 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528785.1 protein_id gnl|my_center|LOCUS_00420 57387 56485 gene locus_tag LOCUS_00430 57387 56485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 >Feature sequence002 <1 807 gene locus_tag LOCUS_00440 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q746Z4:ribosomal RNA small subunit methyltransferase B 808 1863 gene locus_tag LOCUS_00450 808 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 1803 2453 gene locus_tag LOCUS_00460 gene rpe 1803 2453 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z3 protein_id gnl|my_center|LOCUS_00460 2482 3651 gene locus_tag LOCUS_00470 2482 3651 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888378.1 protein_id gnl|my_center|LOCUS_00470 3653 5296 gene locus_tag LOCUS_00480 3653 5296 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237994.1 protein_id gnl|my_center|LOCUS_00480 6213 5332 gene locus_tag LOCUS_00490 gene map 6213 5332 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 protein_id gnl|my_center|LOCUS_00490 7577 6210 gene locus_tag LOCUS_00500 gene miaB 7577 6210 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I18 protein_id gnl|my_center|LOCUS_00500 7776 7567 gene locus_tag LOCUS_00510 7776 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 8443 9564 gene locus_tag LOCUS_00520 8443 9564 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480635.1 protein_id gnl|my_center|LOCUS_00520 11676 9712 gene locus_tag LOCUS_00530 11676 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 12669 11935 gene locus_tag LOCUS_00540 12669 11935 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976345.1 protein_id gnl|my_center|LOCUS_00540 13509 15218 gene locus_tag LOCUS_00550 13509 15218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 15301 15726 gene locus_tag LOCUS_00560 15301 15726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 16131 17996 gene locus_tag LOCUS_00570 16131 17996 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392243.1 protein_id gnl|my_center|LOCUS_00570 18071 19756 gene locus_tag LOCUS_00580 gene lcfA 18071 19756 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181877.1 protein_id gnl|my_center|LOCUS_00580 19784 20278 gene locus_tag LOCUS_00590 19784 20278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 21188 20445 gene locus_tag LOCUS_00600 21188 20445 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546570.1 protein_id gnl|my_center|LOCUS_00600 21934 21179 gene locus_tag LOCUS_00610 gene cbiQ 21934 21179 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545677.1 protein_id gnl|my_center|LOCUS_00610 22413 21931 gene locus_tag LOCUS_00620 22413 21931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 23015 22410 gene locus_tag LOCUS_00630 23015 22410 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_00630 23793 23017 gene locus_tag LOCUS_00640 23793 23017 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_00640 24533 23976 gene locus_tag LOCUS_00650 24533 23976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 26703 24511 gene locus_tag LOCUS_00660 26703 24511 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_00660 27190 26819 gene locus_tag LOCUS_00670 27190 26819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 27432 27199 gene locus_tag LOCUS_00680 27432 27199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 29987 27447 gene locus_tag LOCUS_00690 29987 27447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 30951 29977 gene locus_tag LOCUS_00700 30951 29977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 31781 30948 gene locus_tag LOCUS_00710 31781 30948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 31871 32440 gene locus_tag LOCUS_00720 31871 32440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 34656 32437 gene locus_tag LOCUS_00730 34656 32437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 35204 34677 gene locus_tag LOCUS_00740 35204 34677 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK7 protein_id gnl|my_center|LOCUS_00740 36755 35334 gene locus_tag LOCUS_00750 gene cpsB 36755 35334 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586529.1 protein_id gnl|my_center|LOCUS_00750 37685 36774 gene locus_tag LOCUS_00760 37685 36774 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_00760 38381 37704 gene locus_tag LOCUS_00770 38381 37704 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCR8 protein_id gnl|my_center|LOCUS_00770 38785 38393 gene locus_tag LOCUS_00780 38785 38393 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878487.1 protein_id gnl|my_center|LOCUS_00780 39370 38951 gene locus_tag LOCUS_00790 39370 38951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 40627 39755 gene locus_tag LOCUS_00800 40627 39755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 43797 41236 gene locus_tag LOCUS_00810 43797 41236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 45198 44914 gene locus_tag LOCUS_00820 45198 44914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00820 45602 45360 gene locus_tag LOCUS_00830 45602 45360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 46865 45867 gene locus_tag LOCUS_00840 46865 45867 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762399.1 protein_id gnl|my_center|LOCUS_00840 47698 46865 gene locus_tag LOCUS_00850 47698 46865 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_00850 <48878 47711 gene locus_tag LOCUS_00860 <48878 47711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003418888.1:butyryl-CoA dehydrogenase >Feature sequence003 1068 736 gene locus_tag LOCUS_00870 1068 736 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669261.1 protein_id gnl|my_center|LOCUS_00870 1300 1052 gene locus_tag LOCUS_00880 1300 1052 CDS product cytotoxic translational repressor of toxin-antitoxin stability system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669263.1 protein_id gnl|my_center|LOCUS_00880 1756 1358 gene locus_tag LOCUS_00890 1756 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 1968 1774 gene locus_tag LOCUS_00900 1968 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 2207 1914 gene locus_tag LOCUS_00910 2207 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 4267 2204 gene locus_tag LOCUS_00920 4267 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 4759 4340 gene locus_tag LOCUS_00930 4759 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 5283 4756 gene locus_tag LOCUS_00940 5283 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 5539 5294 gene locus_tag LOCUS_00950 5539 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 6169 5582 gene locus_tag LOCUS_00960 6169 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537623.1 protein_id gnl|my_center|LOCUS_00960 7103 6648 gene locus_tag LOCUS_00970 7103 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460150.1 protein_id gnl|my_center|LOCUS_00970 7938 7135 gene locus_tag LOCUS_00980 7938 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 8335 7961 gene locus_tag LOCUS_00990 8335 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 9091 8354 gene locus_tag LOCUS_01000 9091 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 9281 9084 gene locus_tag LOCUS_01010 9281 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 9556 9278 gene locus_tag LOCUS_01020 9556 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 9824 9513 gene locus_tag LOCUS_01030 9824 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 11493 9835 gene locus_tag LOCUS_01040 11493 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 13104 11710 gene locus_tag LOCUS_01050 13104 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 13887 13180 gene locus_tag LOCUS_01060 13887 13180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003572217.1 protein_id gnl|my_center|LOCUS_01060 14236 13880 gene locus_tag LOCUS_01070 14236 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 15001 14291 gene locus_tag LOCUS_01080 15001 14291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 15887 15060 gene locus_tag LOCUS_01090 15887 15060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 16465 16070 gene locus_tag LOCUS_01100 16465 16070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 16698 17987 gene locus_tag LOCUS_01110 16698 17987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 18365 18008 gene locus_tag LOCUS_tm00010 18365 18008 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 18928 18467 gene locus_tag LOCUS_01120 gene smpB 18928 18467 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73MP4 protein_id gnl|my_center|LOCUS_01120 20701 18932 gene locus_tag LOCUS_01130 gene ptsI 20701 18932 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ6 protein_id gnl|my_center|LOCUS_01130 20985 20704 gene locus_tag LOCUS_01140 gene npr 20985 20704 CDS product phosphohistidinoprotein-hexose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162489.1 protein_id gnl|my_center|LOCUS_01140 21213 21887 gene locus_tag LOCUS_01150 21213 21887 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_01150 22110 23942 gene locus_tag LOCUS_01160 gene parE 22110 23942 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQT9 protein_id gnl|my_center|LOCUS_01160 23942 26200 gene locus_tag LOCUS_01170 gene parC 23942 26200 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2M4 protein_id gnl|my_center|LOCUS_01170 26219 27601 gene locus_tag LOCUS_01180 gene mltF 26219 27601 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN1 protein_id gnl|my_center|LOCUS_01180 27714 29183 gene locus_tag LOCUS_01190 27714 29183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 29256 30281 gene locus_tag LOCUS_01200 29256 30281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 30315 30659 gene locus_tag LOCUS_01210 30315 30659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 30680 32251 gene locus_tag LOCUS_01220 gene secD 30680 32251 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X5 protein_id gnl|my_center|LOCUS_01220 32264 33295 gene locus_tag LOCUS_01230 gene secF 32264 33295 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72B21 protein_id gnl|my_center|LOCUS_01230 33300 33827 gene locus_tag LOCUS_01240 33300 33827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 33913 34977 gene locus_tag LOCUS_01250 gene dprA 33913 34977 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_01250 >Feature sequence004 246 88 gene locus_tag LOCUS_01260 246 88 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIZ1 protein_id gnl|my_center|LOCUS_01260 463 1836 gene locus_tag LOCUS_01270 463 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403492.1 protein_id gnl|my_center|LOCUS_01270 1877 2986 gene locus_tag LOCUS_01280 1877 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 3041 4030 gene locus_tag LOCUS_01290 3041 4030 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937763.1 protein_id gnl|my_center|LOCUS_01290 4048 5004 gene locus_tag LOCUS_01300 4048 5004 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_01300 5049 6377 gene locus_tag LOCUS_01310 5049 6377 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388548.1 protein_id gnl|my_center|LOCUS_01310 6395 6586 gene locus_tag LOCUS_01320 6395 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 6869 6711 gene locus_tag LOCUS_01330 gene rd 6869 6711 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AL94 protein_id gnl|my_center|LOCUS_01330 8596 7448 gene locus_tag LOCUS_01340 gene cydB 8596 7448 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851984.1 protein_id gnl|my_center|LOCUS_01340 10133 8598 gene locus_tag LOCUS_01350 gene cydA 10133 8598 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_01350 10608 10330 gene locus_tag LOCUS_01360 10608 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 11706 11065 gene locus_tag LOCUS_01370 11706 11065 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_01370 13338 11707 gene locus_tag LOCUS_01380 13338 11707 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_01380 13927 13577 gene locus_tag LOCUS_01390 13927 13577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 15091 13967 gene locus_tag LOCUS_01400 15091 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 15507 16880 gene locus_tag LOCUS_01410 15507 16880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 17197 17712 gene locus_tag LOCUS_01420 17197 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 17769 18734 gene locus_tag LOCUS_01430 17769 18734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 18734 19180 gene locus_tag LOCUS_01440 18734 19180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 19797 19333 gene locus_tag LOCUS_01450 19797 19333 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_01450 20696 19857 gene locus_tag LOCUS_01460 20696 19857 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104934.1 protein_id gnl|my_center|LOCUS_01460 20921 21670 gene locus_tag LOCUS_01470 gene mtnP 20921 21670 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CXR2 protein_id gnl|my_center|LOCUS_01470 21704 22225 gene locus_tag LOCUS_01480 gene apt 21704 22225 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT52 protein_id gnl|my_center|LOCUS_01480 22272 23147 gene locus_tag LOCUS_01490 gene rarD 22272 23147 CDS product chloramphenicol resistance permease RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939697.1 protein_id gnl|my_center|LOCUS_01490 24945 23224 gene locus_tag LOCUS_01500 24945 23224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 27609 25279 gene locus_tag LOCUS_01510 27609 25279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 28307 31705 gene locus_tag LOCUS_01520 gene recC 28307 31705 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDI2 protein_id gnl|my_center|LOCUS_01520 >Feature sequence005 9 1046 gene locus_tag LOCUS_01530 gene rpoA 9 1046 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B3 protein_id gnl|my_center|LOCUS_01530 1036 1392 gene locus_tag LOCUS_01540 1036 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 1530 2558 gene locus_tag LOCUS_01550 1530 2558 CDS product amino acid lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_01550 3575 2562 gene locus_tag LOCUS_01560 3575 2562 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942515.1 protein_id gnl|my_center|LOCUS_01560 3759 4808 gene locus_tag LOCUS_01570 gene tqsA 3759 4808 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_01570 5754 5284 gene locus_tag LOCUS_01580 5754 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 6349 5768 gene locus_tag LOCUS_01590 6349 5768 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1T4 protein_id gnl|my_center|LOCUS_01590 6819 6379 gene locus_tag LOCUS_01600 6819 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 7849 6968 gene locus_tag LOCUS_01610 gene moaA 7849 6968 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ09 protein_id gnl|my_center|LOCUS_01610 9487 7955 gene locus_tag LOCUS_01620 9487 7955 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_01620 10409 9477 gene locus_tag LOCUS_01630 gene hemC 10409 9477 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJZ4 protein_id gnl|my_center|LOCUS_01630 11777 10833 gene locus_tag LOCUS_01640 11777 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_01640 12339 11770 gene locus_tag LOCUS_01650 gene gmhA 12339 11770 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AV1 protein_id gnl|my_center|LOCUS_01650 13588 12362 gene locus_tag LOCUS_01660 13588 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 14991 13585 gene locus_tag LOCUS_01670 gene selA 14991 13585 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182I2 protein_id gnl|my_center|LOCUS_01670 15558 15073 gene locus_tag LOCUS_01680 gene ilvH 15558 15073 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67703 protein_id gnl|my_center|LOCUS_01680 16007 17401 gene locus_tag LOCUS_01690 gene ibeB 16007 17401 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123112.1 protein_id gnl|my_center|LOCUS_01690 17450 18634 gene locus_tag LOCUS_01700 17450 18634 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106254.1 protein_id gnl|my_center|LOCUS_01700 18631 21756 gene locus_tag LOCUS_01710 gene czcA 18631 21756 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_01710 21787 22515 gene locus_tag LOCUS_01720 gene pyrF 21787 22515 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D58 protein_id gnl|my_center|LOCUS_01720 23766 22546 gene locus_tag LOCUS_01730 23766 22546 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C75 protein_id gnl|my_center|LOCUS_01730 24272 23790 gene locus_tag LOCUS_01740 24272 23790 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_01740 25834 24269 gene locus_tag LOCUS_01750 gene yjeF 25834 24269 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C72 protein_id gnl|my_center|LOCUS_01750 26917 25892 gene locus_tag LOCUS_01760 26917 25892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098754.1 protein_id gnl|my_center|LOCUS_01760 27610 27047 gene locus_tag LOCUS_01770 gene tag 27610 27047 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_01770 27897 28397 gene locus_tag LOCUS_01780 gene ispF 27897 28397 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXW3 protein_id gnl|my_center|LOCUS_01780 28412 29845 gene locus_tag LOCUS_01790 gene cysS 28412 29845 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A2 protein_id gnl|my_center|LOCUS_01790 31676 30003 gene locus_tag LOCUS_01800 gene glnS 31676 30003 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727A5 protein_id gnl|my_center|LOCUS_01800 >Feature sequence006 644 1546 gene locus_tag LOCUS_01810 644 1546 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_01810 2367 1531 gene locus_tag LOCUS_01820 2367 1531 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_01820 5031 2374 gene locus_tag LOCUS_01830 gene valS 5031 2374 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ6 protein_id gnl|my_center|LOCUS_01830 5668 5120 gene locus_tag LOCUS_01840 5668 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 5810 6544 gene locus_tag LOCUS_01850 5810 6544 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I637 protein_id gnl|my_center|LOCUS_01850 6615 6690 gene locus_tag LOCUS_t00030 6615 6690 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7173 10757 gene locus_tag LOCUS_01860 7173 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 10974 12410 gene locus_tag LOCUS_01870 10974 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 13673 12450 gene locus_tag LOCUS_01880 13673 12450 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267305.1 protein_id gnl|my_center|LOCUS_01880 15117 13822 gene locus_tag LOCUS_01890 15117 13822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 16225 15110 gene locus_tag LOCUS_01900 16225 15110 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876664.1 protein_id gnl|my_center|LOCUS_01900 16450 17148 gene locus_tag LOCUS_01910 16450 17148 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105278.1 protein_id gnl|my_center|LOCUS_01910 17206 17376 gene locus_tag LOCUS_01920 17206 17376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 17439 18425 gene locus_tag LOCUS_01930 17439 18425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:18129..18131,aa:Sec) note codon on position 231 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01930 18415 18816 gene locus_tag LOCUS_01940 18415 18816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 19036 18848 gene locus_tag LOCUS_01950 19036 18848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 20033 19104 gene locus_tag LOCUS_01960 20033 19104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 20331 21887 gene locus_tag LOCUS_01970 20331 21887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 22301 22516 gene locus_tag LOCUS_01980 22301 22516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 22491 25679 gene locus_tag LOCUS_01990 22491 25679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 25739 25870 gene locus_tag LOCUS_02000 25739 25870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 26106 26030 gene locus_tag LOCUS_t00040 26106 26030 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence007 1038 2579 gene locus_tag LOCUS_02010 1038 2579 CDS product 4-cresol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 protein_id gnl|my_center|LOCUS_02010 2597 3994 gene locus_tag LOCUS_02020 2597 3994 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_02020 4226 5002 gene locus_tag LOCUS_02030 4226 5002 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_02030 5143 5904 gene locus_tag LOCUS_02040 5143 5904 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CN40 protein_id gnl|my_center|LOCUS_02040 6156 6329 gene locus_tag LOCUS_02050 6156 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 6509 7855 gene locus_tag LOCUS_02060 6509 7855 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_02060 8085 9122 gene locus_tag LOCUS_02070 8085 9122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 9242 9391 gene locus_tag LOCUS_02080 9242 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 9494 10078 gene locus_tag LOCUS_02090 9494 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 10249 11280 gene locus_tag LOCUS_02100 10249 11280 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895799.1 protein_id gnl|my_center|LOCUS_02100 11490 12752 gene locus_tag LOCUS_02110 11490 12752 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_02110 12935 13867 gene locus_tag LOCUS_02120 12935 13867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 13992 15191 gene locus_tag LOCUS_02130 13992 15191 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546390.1 protein_id gnl|my_center|LOCUS_02130 15265 15426 gene locus_tag LOCUS_02140 15265 15426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 16358 15528 gene locus_tag LOCUS_02150 16358 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 16849 17895 gene locus_tag LOCUS_02160 16849 17895 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_02160 18121 18744 gene locus_tag LOCUS_02170 18121 18744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 18775 19812 gene locus_tag LOCUS_02180 18775 19812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073502.1 protein_id gnl|my_center|LOCUS_02180 20058 21506 gene locus_tag LOCUS_02190 20058 21506 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939687.1 protein_id gnl|my_center|LOCUS_02190 21556 21936 gene locus_tag LOCUS_02200 21556 21936 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072256.1 protein_id gnl|my_center|LOCUS_02200 23132 22128 gene locus_tag LOCUS_02210 23132 22128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 23292 23495 gene locus_tag LOCUS_02220 23292 23495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 23533 24423 gene locus_tag LOCUS_02230 23533 24423 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966749.1 protein_id gnl|my_center|LOCUS_02230 25219 24584 gene locus_tag LOCUS_02240 25219 24584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 >Feature sequence008 1685 756 gene locus_tag LOCUS_02250 1685 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938772.1 protein_id gnl|my_center|LOCUS_02250 2037 1666 gene locus_tag LOCUS_02260 2037 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943704.1 protein_id gnl|my_center|LOCUS_02260 2182 3540 gene locus_tag LOCUS_02270 2182 3540 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_02270 3619 4410 gene locus_tag LOCUS_02280 3619 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 4944 4417 gene locus_tag LOCUS_02290 4944 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 5410 5126 gene locus_tag LOCUS_02300 gene ihfB-1 5410 5126 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_02300 6470 5511 gene locus_tag LOCUS_02310 6470 5511 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97DM0 protein_id gnl|my_center|LOCUS_02310 6621 8381 gene locus_tag LOCUS_02320 6621 8381 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878782.1 protein_id gnl|my_center|LOCUS_02320 10282 8411 gene locus_tag LOCUS_02330 10282 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 10725 11969 gene locus_tag LOCUS_02340 10725 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 13287 12028 gene locus_tag LOCUS_02350 gene lysA 13287 12028 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_02350 13763 13302 gene locus_tag LOCUS_02360 13763 13302 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867694.1 protein_id gnl|my_center|LOCUS_02360 13985 15511 gene locus_tag LOCUS_02370 13985 15511 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257549.1 protein_id gnl|my_center|LOCUS_02370 15610 15685 gene locus_tag LOCUS_t00050 15610 15685 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 15702 15779 gene locus_tag LOCUS_t00060 15702 15779 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16141 17007 gene locus_tag LOCUS_02380 16141 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 17020 18297 gene locus_tag LOCUS_02390 gene motB 17020 18297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084326.1 protein_id gnl|my_center|LOCUS_02390 18443 18640 gene locus_tag LOCUS_02400 18443 18640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 18826 19563 gene locus_tag LOCUS_02410 18826 19563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 19568 20620 gene locus_tag LOCUS_02420 19568 20620 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHQ3 protein_id gnl|my_center|LOCUS_02420 20718 22166 gene locus_tag LOCUS_02430 gene der 20718 22166 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX4 protein_id gnl|my_center|LOCUS_02430 <25307 22215 gene locus_tag LOCUS_02440 <25307 22215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258067.1:2-alkenal reductase >Feature sequence009 28 741 gene locus_tag LOCUS_02450 gene sfsA 28 741 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_02450 878 1441 gene locus_tag LOCUS_02460 878 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 1452 2624 gene locus_tag LOCUS_02470 gene nifS-1 1452 2624 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_02470 2621 3157 gene locus_tag LOCUS_02480 2621 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 3132 4022 gene locus_tag LOCUS_02490 gene hdrB 3132 4022 CDS product heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940768.1 protein_id gnl|my_center|LOCUS_02490 5039 7840 gene locus_tag LOCUS_02500 5039 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 7845 9209 gene locus_tag LOCUS_02510 7845 9209 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022107.1 protein_id gnl|my_center|LOCUS_02510 9213 9563 gene locus_tag LOCUS_02520 9213 9563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02520 9624 10874 gene locus_tag LOCUS_02530 gene hsdM 9624 10874 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627748.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02530 10871 12388 gene locus_tag LOCUS_02540 gene hsdS 10871 12388 CDS product type-1 restriction enzyme EcoKI specificity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05719 protein_id gnl|my_center|LOCUS_02540 12385 14139 gene locus_tag LOCUS_02550 12385 14139 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123252.1 protein_id gnl|my_center|LOCUS_02550 14139 15206 gene locus_tag LOCUS_02560 14139 15206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123253.1 protein_id gnl|my_center|LOCUS_02560 16399 15653 gene locus_tag LOCUS_02570 16399 15653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 16951 16676 gene locus_tag LOCUS_02580 16951 16676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_02580 17232 16948 gene locus_tag LOCUS_02590 17232 16948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 18520 17594 gene locus_tag LOCUS_02600 gene cysK2 18520 17594 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I118 protein_id gnl|my_center|LOCUS_02600 19490 18510 gene locus_tag LOCUS_02610 19490 18510 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_02610 19891 19496 gene locus_tag LOCUS_02620 19891 19496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 20105 22702 gene locus_tag LOCUS_02630 gene clpB 20105 22702 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF1 protein_id gnl|my_center|LOCUS_02630 23736 22786 gene locus_tag LOCUS_02640 gene selD 23736 22786 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI12 protein_id gnl|my_center|LOCUS_02640 24746 24000 gene locus_tag LOCUS_02650 24746 24000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 25048 24800 gene locus_tag LOCUS_02660 25048 24800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 >Feature sequence010 2 1429 gene locus_tag LOCUS_02670 2 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 3333 1543 gene locus_tag LOCUS_02680 3333 1543 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_02680 4124 3462 gene locus_tag LOCUS_02690 4124 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 4487 4215 gene locus_tag LOCUS_02700 4487 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 4786 4484 gene locus_tag LOCUS_02710 4786 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 6330 4783 gene locus_tag LOCUS_02720 gene mviN 6330 4783 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL17 protein_id gnl|my_center|LOCUS_02720 6430 6684 gene locus_tag LOCUS_02730 gene rpsT 6430 6684 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AU4 protein_id gnl|my_center|LOCUS_02730 7282 6767 gene locus_tag LOCUS_02740 7282 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 9887 7284 gene locus_tag LOCUS_02750 gene leuS 9887 7284 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AZ0 protein_id gnl|my_center|LOCUS_02750 10135 10590 gene locus_tag LOCUS_02760 10135 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 10613 10888 gene locus_tag LOCUS_02770 gene rpsR 10613 10888 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE3 protein_id gnl|my_center|LOCUS_02770 10908 11864 gene locus_tag LOCUS_02780 10908 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 11926 12384 gene locus_tag LOCUS_02790 gene rplI 11926 12384 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM4 protein_id gnl|my_center|LOCUS_02790 12444 13823 gene locus_tag LOCUS_02800 gene dnaB 12444 13823 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DH0 protein_id gnl|my_center|LOCUS_02800 13820 15442 gene locus_tag LOCUS_02810 gene hflX 13820 15442 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFQ8 protein_id gnl|my_center|LOCUS_02810 17199 15817 gene locus_tag LOCUS_02820 gene glcD-1 17199 15817 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_02820 18591 17200 gene locus_tag LOCUS_02830 gene dnaA 18591 17200 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXP7 protein_id gnl|my_center|LOCUS_02830 19244 20269 gene locus_tag LOCUS_02840 gene pdxA 19244 20269 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKJ4 protein_id gnl|my_center|LOCUS_02840 20262 23093 gene locus_tag LOCUS_02850 gene uvrA 20262 23093 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747E2 protein_id gnl|my_center|LOCUS_02850 23679 23113 gene locus_tag LOCUS_02860 23679 23113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 24406 24819 gene locus_tag LOCUS_02870 24406 24819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 >Feature sequence011 1174 134 gene locus_tag LOCUS_02880 1174 134 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392776.1 protein_id gnl|my_center|LOCUS_02880 2966 1203 gene locus_tag LOCUS_02890 2966 1203 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_02890 3333 4703 gene locus_tag LOCUS_02900 3333 4703 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258069.1 protein_id gnl|my_center|LOCUS_02900 4899 6281 gene locus_tag LOCUS_02910 gene mtbB 4899 6281 CDS product dimethylamine methyltransferase MtbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q8TN68 transl_except (pos:5943..5945,aa:Pyl) note codon on position 349 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_02910 6309 6382 gene locus_tag LOCUS_t00070 6309 6382 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 6775 7248 gene locus_tag LOCUS_02920 6775 7248 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944070.1 protein_id gnl|my_center|LOCUS_02920 7245 8369 gene locus_tag LOCUS_02930 7245 8369 CDS product methylornithine synthase PylB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462269.1 protein_id gnl|my_center|LOCUS_02930 8546 9421 gene locus_tag LOCUS_02940 8546 9421 CDS product 3-methylornithyl-N6-L-lysine dehydrogenase PylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462267.1 protein_id gnl|my_center|LOCUS_02940 9424 9771 gene locus_tag LOCUS_02950 9424 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462266.1 protein_id gnl|my_center|LOCUS_02950 9822 10397 gene locus_tag LOCUS_02960 9822 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_02960 10691 10377 gene locus_tag LOCUS_02970 gene ysgB 10691 10377 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130332.1 protein_id gnl|my_center|LOCUS_02970 11095 11649 gene locus_tag LOCUS_02980 11095 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 12188 11706 gene locus_tag LOCUS_02990 12188 11706 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189B1 protein_id gnl|my_center|LOCUS_02990 12789 13496 gene locus_tag LOCUS_03000 12789 13496 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358553.1 protein_id gnl|my_center|LOCUS_03000 13529 14968 gene locus_tag LOCUS_03010 13529 14968 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_03010 16262 15069 gene locus_tag LOCUS_03020 16262 15069 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501370.1 protein_id gnl|my_center|LOCUS_03020 16447 17187 gene locus_tag LOCUS_03030 16447 17187 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929678.1 protein_id gnl|my_center|LOCUS_03030 17281 18321 gene locus_tag LOCUS_03040 17281 18321 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706102.1 protein_id gnl|my_center|LOCUS_03040 18423 18974 gene locus_tag LOCUS_03050 18423 18974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 18971 20260 gene locus_tag LOCUS_03060 gene dctM 18971 20260 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103397.1 protein_id gnl|my_center|LOCUS_03060 20283 21386 gene locus_tag LOCUS_03070 20283 21386 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MK4 protein_id gnl|my_center|LOCUS_03070 23949 21574 gene locus_tag LOCUS_03080 23949 21574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence012 674 186 gene locus_tag LOCUS_03090 674 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 1378 929 gene locus_tag LOCUS_03100 1378 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_03100 2057 1380 gene locus_tag LOCUS_03110 2057 1380 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978868.1 protein_id gnl|my_center|LOCUS_03110 2733 2059 gene locus_tag LOCUS_03120 2733 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3191 2730 gene locus_tag LOCUS_03130 3191 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 4200 3508 gene locus_tag LOCUS_03140 4200 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 6339 5035 gene locus_tag LOCUS_03150 6339 5035 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZD9 protein_id gnl|my_center|LOCUS_03150 6803 6357 gene locus_tag LOCUS_03160 6803 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 7160 7657 gene locus_tag LOCUS_03170 7160 7657 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932995.1 protein_id gnl|my_center|LOCUS_03170 8083 9027 gene locus_tag LOCUS_03180 8083 9027 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 protein_id gnl|my_center|LOCUS_03180 10946 9024 gene locus_tag LOCUS_03190 10946 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 11236 12576 gene locus_tag LOCUS_03200 11236 12576 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878407.1 protein_id gnl|my_center|LOCUS_03200 14999 12627 gene locus_tag LOCUS_03210 14999 12627 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948260.1 protein_id gnl|my_center|LOCUS_03210 16158 15133 gene locus_tag LOCUS_03220 gene rlmN 16158 15133 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E53 protein_id gnl|my_center|LOCUS_03220 16621 16289 gene locus_tag LOCUS_03230 16621 16289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 17084 16650 gene locus_tag LOCUS_03240 17084 16650 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020956.1 protein_id gnl|my_center|LOCUS_03240 17322 17125 gene locus_tag LOCUS_03250 17322 17125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_03250 18091 17405 gene locus_tag LOCUS_03260 18091 17405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 19085 18078 gene locus_tag LOCUS_03270 19085 18078 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_03270 20702 19104 gene locus_tag LOCUS_03280 20702 19104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063660.1 protein_id gnl|my_center|LOCUS_03280 21673 20711 gene locus_tag LOCUS_03290 gene glpQ 21673 20711 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070132.1 protein_id gnl|my_center|LOCUS_03290 <22635 21790 gene locus_tag LOCUS_03300 <22635 21790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030985.1:membrane protein >Feature sequence013 69 1649 gene locus_tag LOCUS_03310 69 1649 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_03310 1752 2858 gene locus_tag LOCUS_03320 1752 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 3160 5235 gene locus_tag LOCUS_03330 3160 5235 CDS product dimethyl sulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850260.1 protein_id gnl|my_center|LOCUS_03330 5397 6026 gene locus_tag LOCUS_03340 gene dmsB 5397 6026 CDS product anaerobic dimethyl sulfoxide reductase chain B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45003 protein_id gnl|my_center|LOCUS_03340 6019 6852 gene locus_tag LOCUS_03350 6019 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 6954 7685 gene locus_tag LOCUS_03360 6954 7685 CDS product acyl-ACP thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812571.1 protein_id gnl|my_center|LOCUS_03360 7726 10113 gene locus_tag LOCUS_03370 7726 10113 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_03370 10211 10765 gene locus_tag LOCUS_03380 10211 10765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 10911 11675 gene locus_tag LOCUS_03390 10911 11675 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811722.1 protein_id gnl|my_center|LOCUS_03390 11678 12445 gene locus_tag LOCUS_03400 11678 12445 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940624.1 protein_id gnl|my_center|LOCUS_03400 12448 13458 gene locus_tag LOCUS_03410 12448 13458 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_03410 13468 14355 gene locus_tag LOCUS_03420 13468 14355 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546640.1 protein_id gnl|my_center|LOCUS_03420 14423 15760 gene locus_tag LOCUS_03430 14423 15760 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_03430 15733 16950 gene locus_tag LOCUS_03440 15733 16950 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 protein_id gnl|my_center|LOCUS_03440 17235 18467 gene locus_tag LOCUS_03450 17235 18467 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_03450 18476 19849 gene locus_tag LOCUS_03460 18476 19849 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726S8 protein_id gnl|my_center|LOCUS_03460 20532 19840 gene locus_tag LOCUS_03470 gene queC 20532 19840 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSY8 protein_id gnl|my_center|LOCUS_03470 21186 20542 gene locus_tag LOCUS_03480 gene queE 21186 20542 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGD1 protein_id gnl|my_center|LOCUS_03480 21567 21187 gene locus_tag LOCUS_03490 gene queD 21567 21187 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CF4 protein_id gnl|my_center|LOCUS_03490 21743 21667 gene locus_tag LOCUS_t00080 21743 21667 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence014 1794 706 gene locus_tag LOCUS_03500 gene gmd 1794 706 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EX0 protein_id gnl|my_center|LOCUS_03500 3510 1819 gene locus_tag LOCUS_03510 gene sopT 3510 1819 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_03510 4163 3759 gene locus_tag LOCUS_03520 4163 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938912.1 protein_id gnl|my_center|LOCUS_03520 4671 4168 gene locus_tag LOCUS_03530 gene moaB 4671 4168 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34457 protein_id gnl|my_center|LOCUS_03530 5211 4675 gene locus_tag LOCUS_03540 gene pyrR 5211 4675 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HES3 protein_id gnl|my_center|LOCUS_03540 5363 5974 gene locus_tag LOCUS_03550 gene mobA 5363 5974 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGH6 protein_id gnl|my_center|LOCUS_03550 5985 6350 gene locus_tag LOCUS_03560 gene moaE 5985 6350 CDS product molybdopterin converting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546341.1 protein_id gnl|my_center|LOCUS_03560 6356 6832 gene locus_tag LOCUS_03570 gene moaC 6356 6832 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG82 protein_id gnl|my_center|LOCUS_03570 6834 8006 gene locus_tag LOCUS_03580 6834 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_03580 8050 9222 gene locus_tag LOCUS_03590 8050 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 10254 9226 gene locus_tag LOCUS_03600 10254 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 10937 10251 gene locus_tag LOCUS_03610 10937 10251 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938047.1 protein_id gnl|my_center|LOCUS_03610 11792 10950 gene locus_tag LOCUS_03620 11792 10950 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938046.1 protein_id gnl|my_center|LOCUS_03620 12188 11940 gene locus_tag LOCUS_03630 12188 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 13054 12215 gene locus_tag LOCUS_03640 13054 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 13156 13824 gene locus_tag LOCUS_03650 13156 13824 CDS product precorrin-2 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_03650 13821 14654 gene locus_tag LOCUS_03660 13821 14654 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_03660 14681 15958 gene locus_tag LOCUS_03670 gene hemA 14681 15958 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJZ3 protein_id gnl|my_center|LOCUS_03670 16098 16460 gene locus_tag LOCUS_03680 gene dksA 16098 16460 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG2 protein_id gnl|my_center|LOCUS_03680 16479 18041 gene locus_tag LOCUS_03690 16479 18041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 18065 19099 gene locus_tag LOCUS_03700 18065 19099 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965056.1 protein_id gnl|my_center|LOCUS_03700 <21045 19112 gene locus_tag LOCUS_03710 <21045 19112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937936.1:penicillin-binding protein >Feature sequence015 2879 3484 gene locus_tag LOCUS_03720 2879 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 3542 5143 gene locus_tag LOCUS_03730 3542 5143 CDS product transporter divalent anion:Na+ symporter (DASS) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211405.1 protein_id gnl|my_center|LOCUS_03730 5349 9443 gene locus_tag LOCUS_03740 5349 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 9447 12242 gene locus_tag LOCUS_03750 9447 12242 CDS product outer membrane protein, OMP85 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546673.1 protein_id gnl|my_center|LOCUS_03750 12297 13436 gene locus_tag LOCUS_03760 12297 13436 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682144.1 protein_id gnl|my_center|LOCUS_03760 13473 14645 gene locus_tag LOCUS_03770 gene pncB 13473 14645 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022501.1 protein_id gnl|my_center|LOCUS_03770 15841 14657 gene locus_tag LOCUS_03780 15841 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 16874 15852 gene locus_tag LOCUS_03790 16874 15852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 18983 16899 gene locus_tag LOCUS_03800 18983 16899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 19324 19584 gene locus_tag LOCUS_03810 19324 19584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 19604 20380 gene locus_tag LOCUS_03820 19604 20380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026838.1 protein_id gnl|my_center|LOCUS_03820 >Feature sequence016 109 876 gene locus_tag LOCUS_03830 109 876 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767820.1 protein_id gnl|my_center|LOCUS_03830 951 2015 gene locus_tag LOCUS_03840 951 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 2008 3264 gene locus_tag LOCUS_03850 2008 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 3383 4429 gene locus_tag LOCUS_03860 gene rkpQ 3383 4429 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887054.1 protein_id gnl|my_center|LOCUS_03860 4429 5154 gene locus_tag LOCUS_03870 4429 5154 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249618.1 protein_id gnl|my_center|LOCUS_03870 5120 6088 gene locus_tag LOCUS_03880 5120 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 6327 7559 gene locus_tag LOCUS_03890 6327 7559 CDS product aminotransferase class III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_03890 7702 8619 gene locus_tag LOCUS_03900 7702 8619 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869424.1 protein_id gnl|my_center|LOCUS_03900 8653 10041 gene locus_tag LOCUS_03910 8653 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 10421 12343 gene locus_tag LOCUS_03920 10421 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 12336 13814 gene locus_tag LOCUS_03930 gene cps4J 12336 13814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644570.1 protein_id gnl|my_center|LOCUS_03930 13867 14802 gene locus_tag LOCUS_03940 13867 14802 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584122.1 protein_id gnl|my_center|LOCUS_03940 14946 15614 gene locus_tag LOCUS_03950 14946 15614 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583290.1 protein_id gnl|my_center|LOCUS_03950 15614 16261 gene locus_tag LOCUS_03960 15614 16261 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 protein_id gnl|my_center|LOCUS_03960 16428 17180 gene locus_tag LOCUS_03970 16428 17180 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_03970 17195 18112 gene locus_tag LOCUS_03980 17195 18112 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_03980 18219 18986 gene locus_tag LOCUS_03990 18219 18986 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937648.1 protein_id gnl|my_center|LOCUS_03990 >Feature sequence017 1595 93 gene locus_tag LOCUS_04000 1595 93 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_04000 2394 1726 gene locus_tag LOCUS_04010 2394 1726 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_04010 4676 2394 gene locus_tag LOCUS_04020 4676 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 7013 4692 gene locus_tag LOCUS_04030 7013 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 7235 7975 gene locus_tag LOCUS_04040 7235 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 9464 8241 gene locus_tag LOCUS_04050 gene kbl 9464 8241 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2W9M8 protein_id gnl|my_center|LOCUS_04050 10710 9676 gene locus_tag LOCUS_04060 gene tdh 10710 9676 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEM0 protein_id gnl|my_center|LOCUS_04060 11074 12156 gene locus_tag LOCUS_04070 11074 12156 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943270.1 protein_id gnl|my_center|LOCUS_04070 13287 12175 gene locus_tag LOCUS_04080 13287 12175 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546390.1 protein_id gnl|my_center|LOCUS_04080 14057 13371 gene locus_tag LOCUS_04090 14057 13371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030520.1 protein_id gnl|my_center|LOCUS_04090 15736 14174 gene locus_tag LOCUS_04100 15736 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 16761 15733 gene locus_tag LOCUS_04110 16761 15733 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_04110 16996 17820 gene locus_tag LOCUS_04120 16996 17820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870951.1 protein_id gnl|my_center|LOCUS_04120 >Feature sequence018 587 75 gene locus_tag LOCUS_04130 gene rimM 587 75 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY2 protein_id gnl|my_center|LOCUS_04130 818 588 gene locus_tag LOCUS_04140 818 588 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DU1 protein_id gnl|my_center|LOCUS_04140 1131 883 gene locus_tag LOCUS_04150 gene rpsP 1131 883 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CNF4 protein_id gnl|my_center|LOCUS_04150 2473 1148 gene locus_tag LOCUS_04160 gene ffh 2473 1148 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FG7 protein_id gnl|my_center|LOCUS_04160 2571 3608 gene locus_tag LOCUS_04170 gene rlmN 2571 3608 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E53 protein_id gnl|my_center|LOCUS_04170 3619 4215 gene locus_tag LOCUS_04180 3619 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 5313 4276 gene locus_tag LOCUS_04190 5313 4276 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_04190 5327 5962 gene locus_tag LOCUS_04200 gene nth 5327 5962 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HL09 protein_id gnl|my_center|LOCUS_04200 7679 5979 gene locus_tag LOCUS_04210 7679 5979 CDS product ubiquinone biosynthesis protein UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_04210 8000 7704 gene locus_tag LOCUS_04220 8000 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 9874 8027 gene locus_tag LOCUS_04230 gene acd 9874 8027 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970940.1 protein_id gnl|my_center|LOCUS_04230 10058 10897 gene locus_tag LOCUS_04240 10058 10897 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_04240 10971 12215 gene locus_tag LOCUS_04250 10971 12215 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689532.1 protein_id gnl|my_center|LOCUS_04250 12892 13089 gene locus_tag LOCUS_04260 12892 13089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04260 13090 17340 gene locus_tag LOCUS_04270 13090 17340 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392708.1 protein_id gnl|my_center|LOCUS_04270 17418 17777 gene locus_tag LOCUS_04280 17418 17777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04280 >Feature sequence019 85 1062 gene locus_tag LOCUS_04290 85 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876151.1 protein_id gnl|my_center|LOCUS_04290 1162 1302 gene locus_tag LOCUS_04300 1162 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 1383 1574 gene locus_tag LOCUS_04310 1383 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 1571 2815 gene locus_tag LOCUS_04320 1571 2815 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938989.1 protein_id gnl|my_center|LOCUS_04320 2812 3630 gene locus_tag LOCUS_04330 2812 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 3779 4036 gene locus_tag LOCUS_04340 3779 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 4039 5277 gene locus_tag LOCUS_04350 4039 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804170.1 protein_id gnl|my_center|LOCUS_04350 5330 7120 gene locus_tag LOCUS_04360 5330 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804171.1 protein_id gnl|my_center|LOCUS_04360 7078 10386 gene locus_tag LOCUS_04370 7078 10386 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804172.1 protein_id gnl|my_center|LOCUS_04370 10808 11008 gene locus_tag LOCUS_04380 10808 11008 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_04380 11001 11786 gene locus_tag LOCUS_04390 11001 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_04390 11773 12321 gene locus_tag LOCUS_04400 11773 12321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_04400 12333 15773 gene locus_tag LOCUS_04410 12333 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_04410 15770 17878 gene locus_tag LOCUS_04420 15770 17878 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence020 2109 34 gene locus_tag LOCUS_04430 gene fusA-1 2109 34 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_04430 2952 2179 gene locus_tag LOCUS_04440 2952 2179 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_04440 4816 2933 gene locus_tag LOCUS_04450 gene dxs1 4816 2933 CDS product 1-deoxy-D-xylulose-5-phosphate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FC3 protein_id gnl|my_center|LOCUS_04450 5742 4837 gene locus_tag LOCUS_04460 5742 4837 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_04460 5971 5744 gene locus_tag LOCUS_04470 5971 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 7304 5964 gene locus_tag LOCUS_04480 gene xseA 7304 5964 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CA7 protein_id gnl|my_center|LOCUS_04480 7585 8292 gene locus_tag LOCUS_04490 7585 8292 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158923.1 protein_id gnl|my_center|LOCUS_04490 9756 8407 gene locus_tag LOCUS_04500 9756 8407 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808422.1 protein_id gnl|my_center|LOCUS_04500 10990 9770 gene locus_tag LOCUS_04510 10990 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 11132 12760 gene locus_tag LOCUS_04520 gene pgi 11132 12760 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ0 protein_id gnl|my_center|LOCUS_04520 13768 12755 gene locus_tag LOCUS_04530 gene fabH2 13768 12755 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_04530 13899 14831 gene locus_tag LOCUS_04540 gene yrbG 13899 14831 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_04540 14949 15335 gene locus_tag LOCUS_04550 14949 15335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 15351 16421 gene locus_tag LOCUS_04560 15351 16421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04560 16549 17724 gene locus_tag LOCUS_04570 16549 17724 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence021 <1 925 gene locus_tag LOCUS_04580 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H91:DNA polymerase III subunit beta 940 3363 gene locus_tag LOCUS_04590 gene gyrB 940 3363 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H89 protein_id gnl|my_center|LOCUS_04590 3543 3977 gene locus_tag LOCUS_04600 3543 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206287.1 protein_id gnl|my_center|LOCUS_04600 4066 4548 gene locus_tag LOCUS_04610 4066 4548 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929688.1 protein_id gnl|my_center|LOCUS_04610 5282 4623 gene locus_tag LOCUS_04620 5282 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 6560 5361 gene locus_tag LOCUS_04630 6560 5361 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121595.1 protein_id gnl|my_center|LOCUS_04630 9254 6756 gene locus_tag LOCUS_04640 9254 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 9839 10198 gene locus_tag LOCUS_04650 9839 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 11563 10349 gene locus_tag LOCUS_04660 11563 10349 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479994.1 protein_id gnl|my_center|LOCUS_04660 13209 11725 gene locus_tag LOCUS_04670 13209 11725 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405199.1 protein_id gnl|my_center|LOCUS_04670 13961 13266 gene locus_tag LOCUS_04680 gene drrA 13961 13266 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_04680 14057 14239 gene locus_tag LOCUS_04690 14057 14239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 14497 15585 gene locus_tag LOCUS_04700 14497 15585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 17013 15619 gene locus_tag LOCUS_04710 17013 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence022 <1 726 gene locus_tag LOCUS_04720 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942568.1:LPS export ABC transporter permease LptG 847 2046 gene locus_tag LOCUS_04730 gene kdtA 847 2046 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957353.1 protein_id gnl|my_center|LOCUS_04730 2039 3172 gene locus_tag LOCUS_04740 gene lpxK 2039 3172 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8REH3 protein_id gnl|my_center|LOCUS_04740 3165 4061 gene locus_tag LOCUS_04750 3165 4061 CDS product lipid A lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545432.1 protein_id gnl|my_center|LOCUS_04750 4069 5124 gene locus_tag LOCUS_04760 4069 5124 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_04760 5146 6165 gene locus_tag LOCUS_04770 gene rfaF 5146 6165 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_04770 6162 6953 gene locus_tag LOCUS_04780 6162 6953 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_04780 6974 7795 gene locus_tag LOCUS_04790 6974 7795 CDS product alpha-L-glycero-D-manno-heptose beta-1,4-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942894.1 protein_id gnl|my_center|LOCUS_04790 8112 9614 gene locus_tag LOCUS_04800 8112 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 9627 10658 gene locus_tag LOCUS_04810 9627 10658 CDS product dolichyl-phosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227915.1 protein_id gnl|my_center|LOCUS_04810 10661 11320 gene locus_tag LOCUS_04820 10661 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 11337 12191 gene locus_tag LOCUS_04830 11337 12191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 13271 12213 gene locus_tag LOCUS_04840 13271 12213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 14437 13268 gene locus_tag LOCUS_04850 14437 13268 CDS product glycosyl transferase group 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_04850 15177 14434 gene locus_tag LOCUS_04860 gene kdsB 15177 14434 CDS product 8-amino-3,8-dideoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEA9 protein_id gnl|my_center|LOCUS_04860 16256 15189 gene locus_tag LOCUS_04870 gene kdnB 16256 15189 CDS product 3-deoxy-alpha-D-manno-octulosonate 8-oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB0 protein_id gnl|my_center|LOCUS_04870 17446 16259 gene locus_tag LOCUS_04880 gene kdnA 17446 16259 CDS product 8-amino-3,8-dideoxy-alpha-D-manno-octulosonate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence023 1984 1010 gene locus_tag LOCUS_04890 gene hemB 1984 1010 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GV9 protein_id gnl|my_center|LOCUS_04890 3174 1984 gene locus_tag LOCUS_04900 3174 1984 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938157.1 protein_id gnl|my_center|LOCUS_04900 4916 3171 gene locus_tag LOCUS_04910 4916 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 5123 5039 gene locus_tag LOCUS_t00090 5123 5039 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5411 5211 gene locus_tag LOCUS_04920 5411 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 6255 5500 gene locus_tag LOCUS_04930 gene tpi 6255 5500 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7EP62 protein_id gnl|my_center|LOCUS_04930 7282 6275 gene locus_tag LOCUS_04940 gene gap 7282 6275 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HBE9 protein_id gnl|my_center|LOCUS_04940 7735 7322 gene locus_tag LOCUS_04950 7735 7322 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_04950 8607 7732 gene locus_tag LOCUS_04960 8607 7732 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ3 protein_id gnl|my_center|LOCUS_04960 9089 8631 gene locus_tag LOCUS_04970 9089 8631 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_04970 9640 9098 gene locus_tag LOCUS_04980 gene raiA 9640 9098 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_04980 11093 9651 gene locus_tag LOCUS_04990 gene rpoN 11093 9651 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ1 protein_id gnl|my_center|LOCUS_04990 11835 11095 gene locus_tag LOCUS_05000 gene lptB 11835 11095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 protein_id gnl|my_center|LOCUS_05000 12218 11835 gene locus_tag LOCUS_05010 12218 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 12978 12370 gene locus_tag LOCUS_05020 12978 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 13460 12945 gene locus_tag LOCUS_05030 13460 12945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 14278 13466 gene locus_tag LOCUS_05040 gene kdsA 14278 13466 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH30 protein_id gnl|my_center|LOCUS_05040 14492 15808 gene locus_tag LOCUS_05050 14492 15808 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_05050 15857 17020 gene locus_tag LOCUS_05060 15857 17020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583100.1 protein_id gnl|my_center|LOCUS_05060 17042 17695 gene locus_tag LOCUS_05070 gene lepB 17042 17695 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E75 protein_id gnl|my_center|LOCUS_05070 >Feature sequence024 55 2661 gene locus_tag LOCUS_05080 55 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 2998 4497 gene locus_tag LOCUS_05090 gene istA 2998 4497 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974233.1 protein_id gnl|my_center|LOCUS_05090 4494 5255 gene locus_tag LOCUS_05100 gene istB 4494 5255 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_05100 5252 5503 gene locus_tag LOCUS_05110 5252 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 5692 6384 gene locus_tag LOCUS_05120 5692 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 6538 7656 gene locus_tag LOCUS_05130 6538 7656 CDS product porphyromonas-type peptidyl-arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701340.1 protein_id gnl|my_center|LOCUS_05130 9123 7792 gene locus_tag LOCUS_05140 gene paaK-2 9123 7792 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BM0 protein_id gnl|my_center|LOCUS_05140 9930 9166 gene locus_tag LOCUS_05150 gene crt 9930 9166 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_05150 10560 9970 gene locus_tag LOCUS_05160 10560 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 11994 10786 gene locus_tag LOCUS_05170 gene nadA 11994 10786 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EBX6 protein_id gnl|my_center|LOCUS_05170 12612 11998 gene locus_tag LOCUS_05180 12612 11998 CDS product methionine biosynthesis MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_05180 13768 12602 gene locus_tag LOCUS_05190 gene metX 13768 12602 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9J1 protein_id gnl|my_center|LOCUS_05190 15037 13784 gene locus_tag LOCUS_05200 15037 13784 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022675.1 protein_id gnl|my_center|LOCUS_05200 15561 15983 gene locus_tag LOCUS_05210 15561 15983 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938192.1 protein_id gnl|my_center|LOCUS_05210 16178 17329 gene locus_tag LOCUS_05220 gene yjcL 16178 17329 CDS product putative membrane protein YjcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31634 protein_id gnl|my_center|LOCUS_05220 >Feature sequence025 2772 3302 gene locus_tag LOCUS_05230 gene ppiB 2772 3302 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC26 protein_id gnl|my_center|LOCUS_05230 3918 3535 gene locus_tag LOCUS_05240 3918 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938981.1 protein_id gnl|my_center|LOCUS_05240 4122 5510 gene locus_tag LOCUS_05250 4122 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 5514 6674 gene locus_tag LOCUS_05260 gene nqrB 5514 6674 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_05260 6667 7434 gene locus_tag LOCUS_05270 gene nqrC 6667 7434 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43957 protein_id gnl|my_center|LOCUS_05270 7465 8097 gene locus_tag LOCUS_05280 gene nqrD 7465 8097 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 protein_id gnl|my_center|LOCUS_05280 8107 8715 gene locus_tag LOCUS_05290 gene nqrE 8107 8715 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV5 protein_id gnl|my_center|LOCUS_05290 8752 9963 gene locus_tag LOCUS_05300 gene nqrF 8752 9963 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6X5 protein_id gnl|my_center|LOCUS_05300 11004 10009 gene locus_tag LOCUS_05310 11004 10009 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525362.1 protein_id gnl|my_center|LOCUS_05310 11129 11584 gene locus_tag LOCUS_05320 11129 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 12473 11646 gene locus_tag LOCUS_05330 12473 11646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 13082 12900 gene locus_tag LOCUS_05340 13082 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 13168 14883 gene locus_tag LOCUS_05350 13168 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 15173 15421 gene locus_tag LOCUS_05360 15173 15421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 16884 15529 gene locus_tag LOCUS_05370 16884 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 17345 16881 gene locus_tag LOCUS_05380 17345 16881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 >Feature sequence026 8 1642 gene locus_tag LOCUS_05390 8 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 2538 1855 gene locus_tag LOCUS_05400 2538 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251759.2 protein_id gnl|my_center|LOCUS_05400 3034 2609 gene locus_tag LOCUS_05410 3034 2609 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_05410 3297 3572 gene locus_tag LOCUS_05420 3297 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 3760 3990 gene locus_tag LOCUS_05430 3760 3990 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DU1 protein_id gnl|my_center|LOCUS_05430 4273 5493 gene locus_tag LOCUS_05440 4273 5493 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_05440 6264 5485 gene locus_tag LOCUS_05450 gene surE 6264 5485 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJD1 protein_id gnl|my_center|LOCUS_05450 6604 7038 gene locus_tag LOCUS_05460 6604 7038 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067916.1 protein_id gnl|my_center|LOCUS_05460 7363 7830 gene locus_tag LOCUS_05470 gene ybaK 7363 7830 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3V9 protein_id gnl|my_center|LOCUS_05470 8696 8019 gene locus_tag LOCUS_05480 8696 8019 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_05480 9321 9563 gene locus_tag LOCUS_05490 9321 9563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 9957 10328 gene locus_tag LOCUS_05500 9957 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 11834 10821 gene locus_tag LOCUS_05510 11834 10821 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_05510 12599 12147 gene locus_tag LOCUS_05520 12599 12147 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251025.1 protein_id gnl|my_center|LOCUS_05520 12949 12617 gene locus_tag LOCUS_05530 12949 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 15092 13014 gene locus_tag LOCUS_05540 15092 13014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064349.1 protein_id gnl|my_center|LOCUS_05540 15464 15276 gene locus_tag LOCUS_05550 15464 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 16790 15471 gene locus_tag LOCUS_05560 16790 15471 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060759.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence027 1351 1914 gene locus_tag LOCUS_05570 1351 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2103 1915 gene locus_tag LOCUS_05580 2103 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 3418 2201 gene locus_tag LOCUS_05590 3418 2201 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_05590 3609 6110 gene locus_tag LOCUS_05600 3609 6110 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 protein_id gnl|my_center|LOCUS_05600 6244 6594 gene locus_tag LOCUS_05610 6244 6594 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081748.1 protein_id gnl|my_center|LOCUS_05610 6594 8219 gene locus_tag LOCUS_05620 6594 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 8230 8655 gene locus_tag LOCUS_05630 8230 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 10044 8695 gene locus_tag LOCUS_05640 gene gdhA 10044 8695 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_05640 10473 11363 gene locus_tag LOCUS_05650 10473 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207045.1 protein_id gnl|my_center|LOCUS_05650 11375 12265 gene locus_tag LOCUS_05660 11375 12265 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 protein_id gnl|my_center|LOCUS_05660 15439 12314 gene locus_tag LOCUS_05670 15439 12314 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_05670 16797 15436 gene locus_tag LOCUS_05680 16797 15436 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261107.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence028 46 636 gene locus_tag LOCUS_05690 46 636 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877478.1 protein_id gnl|my_center|LOCUS_05690 1390 806 gene locus_tag LOCUS_05700 1390 806 CDS product pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020556.1 protein_id gnl|my_center|LOCUS_05700 3027 1681 gene locus_tag LOCUS_05710 3027 1681 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071020.1 protein_id gnl|my_center|LOCUS_05710 3417 3674 gene locus_tag LOCUS_05720 3417 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 3659 3988 gene locus_tag LOCUS_05730 3659 3988 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH1 protein_id gnl|my_center|LOCUS_05730 4066 4692 gene locus_tag LOCUS_05740 4066 4692 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_05740 4745 5398 gene locus_tag LOCUS_05750 gene rph 4745 5398 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NMR4 protein_id gnl|my_center|LOCUS_05750 5475 5909 gene locus_tag LOCUS_05760 5475 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 5988 7574 gene locus_tag LOCUS_05770 5988 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 8159 9064 gene locus_tag LOCUS_05780 8159 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 10207 9182 gene locus_tag LOCUS_05790 10207 9182 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682079.1 protein_id gnl|my_center|LOCUS_05790 10442 10630 gene locus_tag LOCUS_05800 10442 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 10605 11156 gene locus_tag LOCUS_05810 10605 11156 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844895.1 protein_id gnl|my_center|LOCUS_05810 11169 12023 gene locus_tag LOCUS_05820 11169 12023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 12584 14584 gene locus_tag LOCUS_05830 12584 14584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461059.1 protein_id gnl|my_center|LOCUS_05830 14833 15117 gene locus_tag LOCUS_05840 14833 15117 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201974.1 protein_id gnl|my_center|LOCUS_05840 15114 15389 gene locus_tag LOCUS_05850 15114 15389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 15684 16829 gene locus_tag LOCUS_05860 15684 16829 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence029 2336 1527 gene locus_tag LOCUS_05870 gene fadB 2336 1527 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089105.1 protein_id gnl|my_center|LOCUS_05870 2853 2632 gene locus_tag LOCUS_05880 2853 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 3208 3609 gene locus_tag LOCUS_05890 3208 3609 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919513.1 protein_id gnl|my_center|LOCUS_05890 4130 5314 gene locus_tag LOCUS_05900 4130 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 5311 5532 gene locus_tag LOCUS_05910 5311 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 7113 5584 gene locus_tag LOCUS_05920 7113 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 8847 7279 gene locus_tag LOCUS_05930 8847 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 9362 8907 gene locus_tag LOCUS_05940 9362 8907 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_05940 10086 9373 gene locus_tag LOCUS_05950 10086 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 10329 10162 gene locus_tag LOCUS_05960 10329 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 12273 11392 gene locus_tag LOCUS_05970 12273 11392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05970 13450 12254 gene locus_tag LOCUS_05980 13450 12254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 15406 13562 gene locus_tag LOCUS_05990 15406 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 16328 15831 gene locus_tag LOCUS_06000 16328 15831 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence030 284 823 gene locus_tag LOCUS_06010 284 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 1175 2641 gene locus_tag LOCUS_06020 gene mttB 1175 2641 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_06020 2672 3757 gene locus_tag LOCUS_06030 2672 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 5016 3763 gene locus_tag LOCUS_06040 5016 3763 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 protein_id gnl|my_center|LOCUS_06040 5993 5013 gene locus_tag LOCUS_06050 5993 5013 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CT0 protein_id gnl|my_center|LOCUS_06050 7398 6019 gene locus_tag LOCUS_06060 7398 6019 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229240.1 protein_id gnl|my_center|LOCUS_06060 10011 7468 gene locus_tag LOCUS_06070 10011 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 10902 10063 gene locus_tag LOCUS_06080 10902 10063 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927079.1 protein_id gnl|my_center|LOCUS_06080 11386 11072 gene locus_tag LOCUS_06090 11386 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 11630 12490 gene locus_tag LOCUS_06100 11630 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 12549 13712 gene locus_tag LOCUS_06110 12549 13712 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5X0 protein_id gnl|my_center|LOCUS_06110 14666 13794 gene locus_tag LOCUS_06120 14666 13794 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_06120 15234 14737 gene locus_tag LOCUS_06130 15234 14737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 16293 15751 gene locus_tag LOCUS_06140 16293 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704659.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence031 322 71 gene locus_tag LOCUS_06150 322 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 1776 418 gene locus_tag LOCUS_06160 1776 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 2175 1816 gene locus_tag LOCUS_06170 2175 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06170 2859 2194 gene locus_tag LOCUS_06180 2859 2194 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706361.1 protein_id gnl|my_center|LOCUS_06180 3256 3056 gene locus_tag LOCUS_06190 3256 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 3885 3373 gene locus_tag LOCUS_06200 3885 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 4698 4162 gene locus_tag LOCUS_06210 4698 4162 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_06210 4928 6052 gene locus_tag LOCUS_06220 gene yccM-1 4928 6052 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940802.1 protein_id gnl|my_center|LOCUS_06220 6283 8040 gene locus_tag LOCUS_06230 6283 8040 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_011755.3 protein_id gnl|my_center|LOCUS_06230 8620 8117 gene locus_tag LOCUS_06240 8620 8117 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_06240 10905 8641 gene locus_tag LOCUS_06250 10905 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 11871 11035 gene locus_tag LOCUS_06260 11871 11035 CDS product heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_06260 13485 11872 gene locus_tag LOCUS_06270 13485 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 14774 13482 gene locus_tag LOCUS_06280 14774 13482 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939225.1 protein_id gnl|my_center|LOCUS_06280 16349 14781 gene locus_tag LOCUS_06290 16349 14781 CDS product glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939226.1 protein_id gnl|my_center|LOCUS_06290 >Feature sequence032 1592 309 gene locus_tag LOCUS_06300 1592 309 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176675.1 protein_id gnl|my_center|LOCUS_06300 1954 2979 gene locus_tag LOCUS_06310 1954 2979 CDS product methylcobamide:CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254010.1 protein_id gnl|my_center|LOCUS_06310 3950 3045 gene locus_tag LOCUS_06320 3950 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530905.1 protein_id gnl|my_center|LOCUS_06320 4876 4124 gene locus_tag LOCUS_06330 gene yunE 4876 4124 CDS product UPF0721 transmembrane protein YunE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32134 protein_id gnl|my_center|LOCUS_06330 5404 4925 gene locus_tag LOCUS_06340 5404 4925 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_06340 6523 5408 gene locus_tag LOCUS_06350 gene cbiD 6523 5408 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXP6 protein_id gnl|my_center|LOCUS_06350 7928 6504 gene locus_tag LOCUS_06360 gene cbiA 7928 6504 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748J6 protein_id gnl|my_center|LOCUS_06360 8617 8006 gene locus_tag LOCUS_06370 gene cbiC 8617 8006 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_06370 9356 8715 gene locus_tag LOCUS_06380 gene ynjF 9356 8715 CDS product inner membrane protein YnjF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76226 protein_id gnl|my_center|LOCUS_06380 9998 9360 gene locus_tag LOCUS_06390 9998 9360 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338060.1 protein_id gnl|my_center|LOCUS_06390 11766 10009 gene locus_tag LOCUS_06400 11766 10009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067482.1 protein_id gnl|my_center|LOCUS_06400 12969 11776 gene locus_tag LOCUS_06410 12969 11776 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067483.1 protein_id gnl|my_center|LOCUS_06410 14710 13172 gene locus_tag LOCUS_06420 14710 13172 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869048.1 protein_id gnl|my_center|LOCUS_06420 15869 14718 gene locus_tag LOCUS_06430 15869 14718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 >Feature sequence033 164 3139 gene locus_tag LOCUS_06440 164 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 3136 4428 gene locus_tag LOCUS_06450 3136 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 5278 4397 gene locus_tag LOCUS_06460 5278 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5311 6603 gene locus_tag LOCUS_06470 5311 6603 CDS product translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120707.1 protein_id gnl|my_center|LOCUS_06470 7943 6651 gene locus_tag LOCUS_06480 7943 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 8748 8065 gene locus_tag LOCUS_06490 8748 8065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941994.1 protein_id gnl|my_center|LOCUS_06490 9925 8765 gene locus_tag LOCUS_06500 9925 8765 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941993.1 protein_id gnl|my_center|LOCUS_06500 10350 9922 gene locus_tag LOCUS_06510 10350 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 10761 10366 gene locus_tag LOCUS_06520 10761 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 11130 10825 gene locus_tag LOCUS_06530 11130 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 11321 12316 gene locus_tag LOCUS_06540 11321 12316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 12389 13078 gene locus_tag LOCUS_06550 12389 13078 CDS product branched-chain amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208222.1 protein_id gnl|my_center|LOCUS_06550 13065 13376 gene locus_tag LOCUS_06560 13065 13376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 13666 14847 gene locus_tag LOCUS_06570 13666 14847 CDS product aromatic amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232904.2 protein_id gnl|my_center|LOCUS_06570 15003 14812 gene locus_tag LOCUS_06580 15003 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 <15998 15305 gene locus_tag LOCUS_06590 <15998 15305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393971.1:PAS domain-containing sensor histidine kinase >Feature sequence034 664 2373 gene locus_tag LOCUS_06600 664 2373 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938568.1 protein_id gnl|my_center|LOCUS_06600 2375 3595 gene locus_tag LOCUS_06610 2375 3595 CDS product general secretion pathway protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938567.1 protein_id gnl|my_center|LOCUS_06610 3607 5055 gene locus_tag LOCUS_06620 3607 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5422 5847 gene locus_tag LOCUS_06630 5422 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 6634 5951 gene locus_tag LOCUS_06640 6634 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 6743 7651 gene locus_tag LOCUS_06650 gene rocF 6743 7651 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39138 protein_id gnl|my_center|LOCUS_06650 7648 10548 gene locus_tag LOCUS_06660 7648 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 11394 10609 gene locus_tag LOCUS_06670 gene cobB1 11394 10609 CDS product NAD-dependent protein deacetylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LY4 protein_id gnl|my_center|LOCUS_06670 13013 11379 gene locus_tag LOCUS_06680 gene mviN-1 13013 11379 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938470.1 protein_id gnl|my_center|LOCUS_06680 13157 13435 gene locus_tag LOCUS_06690 13157 13435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 13502 14836 gene locus_tag LOCUS_06700 13502 14836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880602.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence035 1096 2193 gene locus_tag LOCUS_06710 1096 2193 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865294.1 protein_id gnl|my_center|LOCUS_06710 3076 2219 gene locus_tag LOCUS_06720 3076 2219 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064977.1 protein_id gnl|my_center|LOCUS_06720 6327 3094 gene locus_tag LOCUS_06730 6327 3094 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_06730 7632 6331 gene locus_tag LOCUS_06740 7632 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 8857 7781 gene locus_tag LOCUS_06750 8857 7781 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545648.1 protein_id gnl|my_center|LOCUS_06750 11497 8867 gene locus_tag LOCUS_06760 11497 8867 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610939.1 protein_id gnl|my_center|LOCUS_06760 12911 11622 gene locus_tag LOCUS_06770 12911 11622 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_06770 13195 12923 gene locus_tag LOCUS_06780 13195 12923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 13456 14112 gene locus_tag LOCUS_06790 13456 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 14274 15941 gene locus_tag LOCUS_06800 14274 15941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence036 1154 2005 gene locus_tag LOCUS_06810 gene panB 1154 2005 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B8U6 protein_id gnl|my_center|LOCUS_06810 2931 2065 gene locus_tag LOCUS_06820 2931 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3450 2956 gene locus_tag LOCUS_06830 3450 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3735 4694 gene locus_tag LOCUS_06840 gene cpdP 3735 4694 CDS product putative 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZD92 protein_id gnl|my_center|LOCUS_06840 6362 4782 gene locus_tag LOCUS_06850 6362 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 7883 6648 gene locus_tag LOCUS_06860 7883 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 7825 7980 gene locus_tag LOCUS_06870 7825 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 8266 8769 gene locus_tag LOCUS_06880 gene aroK-2 8266 8769 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728T1 protein_id gnl|my_center|LOCUS_06880 8786 9700 gene locus_tag LOCUS_06890 8786 9700 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940451.1 protein_id gnl|my_center|LOCUS_06890 10857 9676 gene locus_tag LOCUS_06900 10857 9676 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI3 protein_id gnl|my_center|LOCUS_06900 11592 10888 gene locus_tag LOCUS_06910 11592 10888 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584046.1 protein_id gnl|my_center|LOCUS_06910 13707 11608 gene locus_tag LOCUS_06920 13707 11608 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_06920 14844 14272 gene locus_tag LOCUS_06930 14844 14272 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458814.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence037 2965 287 gene locus_tag LOCUS_06940 gene ccaA 2965 287 CDS product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_06940 3100 4311 gene locus_tag LOCUS_06950 gene pilC 3100 4311 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_06950 4315 5616 gene locus_tag LOCUS_06960 4315 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 5728 7206 gene locus_tag LOCUS_06970 gene lysS 5728 7206 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT0 protein_id gnl|my_center|LOCUS_06970 7211 8434 gene locus_tag LOCUS_06980 gene lolE 7211 8434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_06980 8427 9110 gene locus_tag LOCUS_06990 gene lolD 8427 9110 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0B3 protein_id gnl|my_center|LOCUS_06990 9138 11777 gene locus_tag LOCUS_07000 gene yaeT 9138 11777 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT3 protein_id gnl|my_center|LOCUS_07000 11803 12333 gene locus_tag LOCUS_07010 11803 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 12345 13382 gene locus_tag LOCUS_07020 gene lpxD 12345 13382 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT5 protein_id gnl|my_center|LOCUS_07020 13394 14164 gene locus_tag LOCUS_07030 gene lpxA 13394 14164 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHC0 protein_id gnl|my_center|LOCUS_07030 14151 15041 gene locus_tag LOCUS_07040 14151 15041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence038 3356 375 gene locus_tag LOCUS_07050 3356 375 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887262.1 protein_id gnl|my_center|LOCUS_07050 3789 3427 gene locus_tag LOCUS_07060 3789 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 4100 4357 gene locus_tag LOCUS_07070 4100 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 4354 5202 gene locus_tag LOCUS_07080 gene rsmA 4354 5202 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EX0 protein_id gnl|my_center|LOCUS_07080 5346 6578 gene locus_tag LOCUS_07090 5346 6578 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875692.1 protein_id gnl|my_center|LOCUS_07090 6587 7813 gene locus_tag LOCUS_07100 6587 7813 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545855.1 protein_id gnl|my_center|LOCUS_07100 7846 9774 gene locus_tag LOCUS_07110 gene moeA 7846 9774 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_07110 11128 10013 gene locus_tag LOCUS_07120 11128 10013 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938715.1 protein_id gnl|my_center|LOCUS_07120 11448 12275 gene locus_tag LOCUS_07130 gene uppP 11448 12275 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60941 protein_id gnl|my_center|LOCUS_07130 12286 13641 gene locus_tag LOCUS_07140 12286 13641 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence039 2853 2251 gene locus_tag LOCUS_07150 2853 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 3385 2870 gene locus_tag LOCUS_07160 3385 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 4101 3388 gene locus_tag LOCUS_07170 4101 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4628 4095 gene locus_tag LOCUS_07180 4628 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 6544 6762 gene locus_tag LOCUS_07190 6544 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 6817 7197 gene locus_tag LOCUS_07200 6817 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 7299 8024 gene locus_tag LOCUS_07210 7299 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 8027 8842 gene locus_tag LOCUS_07220 gene xapB 8027 8842 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942145.1 protein_id gnl|my_center|LOCUS_07220 8839 9684 gene locus_tag LOCUS_07230 8839 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942146.1 protein_id gnl|my_center|LOCUS_07230 10483 9704 gene locus_tag LOCUS_07240 10483 9704 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551489.1 protein_id gnl|my_center|LOCUS_07240 10929 10510 gene locus_tag LOCUS_07250 10929 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 12285 10963 gene locus_tag LOCUS_07260 12285 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 12564 13349 gene locus_tag LOCUS_07270 gene mlaF 12564 13349 CDS product putative phospholipid import ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45031 protein_id gnl|my_center|LOCUS_07270 13365 14132 gene locus_tag LOCUS_07280 13365 14132 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545987.1 protein_id gnl|my_center|LOCUS_07280 14150 14587 gene locus_tag LOCUS_07290 14150 14587 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938540.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence040 514 212 gene locus_tag LOCUS_07300 514 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 1679 612 gene locus_tag LOCUS_07310 1679 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 2750 2499 gene locus_tag LOCUS_07320 2750 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 3795 3142 gene locus_tag LOCUS_07330 3795 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 5635 3788 gene locus_tag LOCUS_07340 5635 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 7381 5636 gene locus_tag LOCUS_07350 7381 5636 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_07350 8480 7383 gene locus_tag LOCUS_07360 8480 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064473.1 protein_id gnl|my_center|LOCUS_07360 8734 8483 gene locus_tag LOCUS_07370 8734 8483 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_07370 10328 9294 gene locus_tag LOCUS_07380 10328 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 10957 10379 gene locus_tag LOCUS_07390 10957 10379 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_07390 11587 11108 gene locus_tag LOCUS_07400 11587 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 11942 11598 gene locus_tag LOCUS_07410 11942 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 12170 11943 gene locus_tag LOCUS_07420 12170 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 12917 12375 gene locus_tag LOCUS_07430 12917 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 13293 12952 gene locus_tag LOCUS_07440 13293 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 13564 13262 gene locus_tag LOCUS_07450 13564 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 13903 13568 gene locus_tag LOCUS_07460 13903 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 14100 13921 gene locus_tag LOCUS_07470 14100 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence041 <1 1639 gene locus_tag LOCUS_07480 <1 1639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091593.1:tail-specific protease 1646 4933 gene locus_tag LOCUS_07490 1646 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4923 5420 gene locus_tag LOCUS_07500 4923 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 5410 5895 gene locus_tag LOCUS_07510 gene aspG 5410 5895 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_07510 6147 6584 gene locus_tag LOCUS_07520 6147 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 9499 6659 gene locus_tag LOCUS_07530 9499 6659 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_07530 11403 9508 gene locus_tag LOCUS_07540 11403 9508 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YS0 protein_id gnl|my_center|LOCUS_07540 11584 11659 gene locus_tag LOCUS_t00100 11584 11659 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13205 11787 gene locus_tag LOCUS_07550 gene degP 13205 11787 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_07550 14400 13273 gene locus_tag LOCUS_07560 14400 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence042 610 1470 gene locus_tag LOCUS_07570 610 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3230 1500 gene locus_tag LOCUS_07580 3230 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939485.1 protein_id gnl|my_center|LOCUS_07580 3716 3282 gene locus_tag LOCUS_07590 3716 3282 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545911.1 protein_id gnl|my_center|LOCUS_07590 4000 4437 gene locus_tag LOCUS_07600 gene iscR 4000 4437 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_07600 5068 4541 gene locus_tag LOCUS_07610 5068 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 5787 5128 gene locus_tag LOCUS_07620 5787 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939255.1 protein_id gnl|my_center|LOCUS_07620 7044 5797 gene locus_tag LOCUS_07630 7044 5797 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939254.1 protein_id gnl|my_center|LOCUS_07630 7485 7120 gene locus_tag LOCUS_07640 7485 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 7780 9579 gene locus_tag LOCUS_07650 7780 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 11737 9608 gene locus_tag LOCUS_07660 11737 9608 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948731.1 protein_id gnl|my_center|LOCUS_07660 12668 12267 gene locus_tag LOCUS_07670 12668 12267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07670 13127 12705 gene locus_tag LOCUS_07680 13127 12705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 13764 13186 gene locus_tag LOCUS_07690 13764 13186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070689.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence043 3377 1314 gene locus_tag LOCUS_07700 3377 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 4938 3427 gene locus_tag LOCUS_07710 4938 3427 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461538.1 protein_id gnl|my_center|LOCUS_07710 5182 5364 gene locus_tag LOCUS_07720 5182 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5399 5647 gene locus_tag LOCUS_07730 5399 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 5675 6043 gene locus_tag LOCUS_07740 5675 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07740 6177 7097 gene locus_tag LOCUS_07750 6177 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 7901 7176 gene locus_tag LOCUS_07760 7901 7176 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030890.1 protein_id gnl|my_center|LOCUS_07760 9376 7898 gene locus_tag LOCUS_07770 9376 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 9737 9378 gene locus_tag LOCUS_07780 9737 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 10397 10795 gene locus_tag LOCUS_07790 10397 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 11501 11046 gene locus_tag LOCUS_07800 11501 11046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 12346 11498 gene locus_tag LOCUS_07810 12346 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 12851 12336 gene locus_tag LOCUS_07820 12851 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 13769 13065 gene locus_tag LOCUS_07830 gene ccdA2 13769 13065 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405201.1 protein_id gnl|my_center|LOCUS_07830 14180 13782 gene locus_tag LOCUS_07840 14180 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence044 1443 2060 gene locus_tag LOCUS_07850 1443 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 2182 2841 gene locus_tag LOCUS_07860 2182 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2904 3482 gene locus_tag LOCUS_07870 2904 3482 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_07870 3482 3769 gene locus_tag LOCUS_07880 3482 3769 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902381.1 protein_id gnl|my_center|LOCUS_07880 3802 4128 gene locus_tag LOCUS_07890 3802 4128 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902380.1 protein_id gnl|my_center|LOCUS_07890 4125 4370 gene locus_tag LOCUS_07900 4125 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07900 4367 5197 gene locus_tag LOCUS_07910 4367 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 5200 5619 gene locus_tag LOCUS_07920 5200 5619 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_07920 5823 6299 gene locus_tag LOCUS_07930 5823 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 6616 6311 gene locus_tag LOCUS_07940 6616 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 6663 7859 gene locus_tag LOCUS_07950 6663 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 7856 9379 gene locus_tag LOCUS_07960 7856 9379 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708740.1 protein_id gnl|my_center|LOCUS_07960 9392 9586 gene locus_tag LOCUS_07970 9392 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 9596 9856 gene locus_tag LOCUS_07980 9596 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 9849 11618 gene locus_tag LOCUS_07990 gene nuoM2 9849 11618 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708738.1 protein_id gnl|my_center|LOCUS_07990 11635 13146 gene locus_tag LOCUS_08000 11635 13146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 13190 13543 gene locus_tag LOCUS_08010 13190 13543 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948550.1 protein_id gnl|my_center|LOCUS_08010 13614 14048 gene locus_tag LOCUS_08020 13614 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence045 2101 230 gene locus_tag LOCUS_08030 2101 230 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932614.1 protein_id gnl|my_center|LOCUS_08030 2367 3041 gene locus_tag LOCUS_08040 2367 3041 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_08040 3309 3863 gene locus_tag LOCUS_08050 3309 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 3884 6568 gene locus_tag LOCUS_08060 gene hepA 3884 6568 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT66 protein_id gnl|my_center|LOCUS_08060 7428 6586 gene locus_tag LOCUS_08070 7428 6586 CDS product 2-oxoglutarate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_08070 9188 7428 gene locus_tag LOCUS_08080 9188 7428 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_08080 10249 9218 gene locus_tag LOCUS_08090 10249 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 12087 10306 gene locus_tag LOCUS_08100 12087 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 12365 13018 gene locus_tag LOCUS_08110 12365 13018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939415.1 protein_id gnl|my_center|LOCUS_08110 13022 13654 gene locus_tag LOCUS_08120 13022 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024310.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence046 <1 1328 gene locus_tag LOCUS_08130 <1 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940479.1:two-component sensor histidine kinase 1341 2711 gene locus_tag LOCUS_08140 1341 2711 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_08140 3773 3084 gene locus_tag LOCUS_08150 3773 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4290 3814 gene locus_tag LOCUS_08160 4290 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 6484 4313 gene locus_tag LOCUS_08170 gene feoB-2 6484 4313 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGB2 protein_id gnl|my_center|LOCUS_08170 7472 6486 gene locus_tag LOCUS_08180 7472 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 7652 8677 gene locus_tag LOCUS_08190 7652 8677 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EB7 protein_id gnl|my_center|LOCUS_08190 8987 8691 gene locus_tag LOCUS_08200 8987 8691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 9747 9139 gene locus_tag LOCUS_08210 9747 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 10914 9751 gene locus_tag LOCUS_08220 10914 9751 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_08220 12094 11012 gene locus_tag LOCUS_08230 12094 11012 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_08230 12671 12126 gene locus_tag LOCUS_08240 12671 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 12945 12643 gene locus_tag LOCUS_08250 12945 12643 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence047 <1 848 gene locus_tag LOCUS_08260 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545342.1:FAD-binding protein 867 1814 gene locus_tag LOCUS_08270 867 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 2034 3278 gene locus_tag LOCUS_08280 2034 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393426.1 protein_id gnl|my_center|LOCUS_08280 4970 3282 gene locus_tag LOCUS_08290 4970 3282 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_08290 5828 5190 gene locus_tag LOCUS_08300 5828 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 6040 6387 gene locus_tag LOCUS_08310 6040 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 7576 6377 gene locus_tag LOCUS_08320 gene rocD 7576 6377 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNN5 protein_id gnl|my_center|LOCUS_08320 8674 7805 gene locus_tag LOCUS_08330 8674 7805 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_08330 8805 9803 gene locus_tag LOCUS_08340 8805 9803 CDS product glycoside hydrolase family 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_08340 10807 9806 gene locus_tag LOCUS_08350 gene tsaD 10807 9806 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CP0 protein_id gnl|my_center|LOCUS_08350 11881 10838 gene locus_tag LOCUS_08360 gene purM 11881 10838 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB6 protein_id gnl|my_center|LOCUS_08360 12119 13432 gene locus_tag LOCUS_08370 gene hom 12119 13432 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI0 protein_id gnl|my_center|LOCUS_08370 >Feature sequence048 470 1474 gene locus_tag LOCUS_08380 470 1474 CDS product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088424.1 protein_id gnl|my_center|LOCUS_08380 1499 2989 gene locus_tag LOCUS_08390 1499 2989 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_08390 3094 4047 gene locus_tag LOCUS_08400 3094 4047 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531217.1 protein_id gnl|my_center|LOCUS_08400 4037 4888 gene locus_tag LOCUS_08410 4037 4888 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086015.1 protein_id gnl|my_center|LOCUS_08410 4893 5879 gene locus_tag LOCUS_08420 4893 5879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086016.1 protein_id gnl|my_center|LOCUS_08420 5876 6838 gene locus_tag LOCUS_08430 5876 6838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086017.1 protein_id gnl|my_center|LOCUS_08430 7042 6851 gene locus_tag LOCUS_08440 7042 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 8593 7928 gene locus_tag LOCUS_08450 8593 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 9379 11832 gene locus_tag LOCUS_08460 9379 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 11843 12493 gene locus_tag LOCUS_08470 11843 12493 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence049 417 974 gene locus_tag LOCUS_08480 417 974 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948618.1 protein_id gnl|my_center|LOCUS_08480 2268 982 gene locus_tag LOCUS_08490 2268 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_08490 3271 2261 gene locus_tag LOCUS_08500 gene oleD 3271 2261 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071877.1 protein_id gnl|my_center|LOCUS_08500 3396 3470 gene locus_tag LOCUS_t00110 3396 3470 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4442 3486 gene locus_tag LOCUS_08510 4442 3486 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_08510 4597 5205 gene locus_tag LOCUS_08520 4597 5205 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081580.1 protein_id gnl|my_center|LOCUS_08520 5792 5211 gene locus_tag LOCUS_08530 5792 5211 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_08530 7197 5833 gene locus_tag LOCUS_08540 gene purB 7197 5833 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3W5 protein_id gnl|my_center|LOCUS_08540 7486 7767 gene locus_tag LOCUS_08550 gene ihfA-2 7486 7767 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BC1 protein_id gnl|my_center|LOCUS_08550 7786 9030 gene locus_tag LOCUS_08560 7786 9030 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_08560 9960 9031 gene locus_tag LOCUS_08570 9960 9031 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920114.1 protein_id gnl|my_center|LOCUS_08570 10120 10632 gene locus_tag LOCUS_08580 gene yfcE 10120 10632 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MSF1 protein_id gnl|my_center|LOCUS_08580 10695 12440 gene locus_tag LOCUS_08590 10695 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939173.1 protein_id gnl|my_center|LOCUS_08590 12987 12664 gene locus_tag LOCUS_08600 12987 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence050 1389 559 gene locus_tag LOCUS_08610 1389 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_08610 1514 2059 gene locus_tag LOCUS_08620 1514 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2246 3088 gene locus_tag LOCUS_08630 2246 3088 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 protein_id gnl|my_center|LOCUS_08630 3103 4299 gene locus_tag LOCUS_08640 gene aroB 3103 4299 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_08640 4823 4317 gene locus_tag LOCUS_08650 4823 4317 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545398.1 protein_id gnl|my_center|LOCUS_08650 5595 4879 gene locus_tag LOCUS_08660 gene ubiG 5595 4879 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q820B5 protein_id gnl|my_center|LOCUS_08660 5837 6796 gene locus_tag LOCUS_08670 5837 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 6808 7251 gene locus_tag LOCUS_08680 6808 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 7251 7946 gene locus_tag LOCUS_08690 7251 7946 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074301.1 protein_id gnl|my_center|LOCUS_08690 10191 8329 gene locus_tag LOCUS_08700 10191 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 10702 11241 gene locus_tag LOCUS_08710 10702 11241 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_08710 11659 11339 gene locus_tag LOCUS_08720 11659 11339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 13054 11765 gene locus_tag LOCUS_08730 13054 11765 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072557.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence051 3680 558 gene locus_tag LOCUS_08740 3680 558 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_08740 4745 3681 gene locus_tag LOCUS_08750 4745 3681 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479330.1 protein_id gnl|my_center|LOCUS_08750 5357 4872 gene locus_tag LOCUS_08760 5357 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 5573 6166 gene locus_tag LOCUS_08770 gene ubiX 5573 6166 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32DM5 protein_id gnl|my_center|LOCUS_08770 6243 7592 gene locus_tag LOCUS_08780 6243 7592 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_08780 7677 8171 gene locus_tag LOCUS_08790 7677 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880262.1 protein_id gnl|my_center|LOCUS_08790 9069 8161 gene locus_tag LOCUS_08800 9069 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 10012 9107 gene locus_tag LOCUS_08810 10012 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 10399 11568 gene locus_tag LOCUS_08820 10399 11568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 11900 12688 gene locus_tag LOCUS_08830 11900 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence052 440 159 gene locus_tag LOCUS_08840 gene acyP 440 159 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ES0 protein_id gnl|my_center|LOCUS_08840 1623 430 gene locus_tag LOCUS_08850 gene dinP 1623 430 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FZ2 protein_id gnl|my_center|LOCUS_08850 1751 2545 gene locus_tag LOCUS_08860 1751 2545 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_08860 2639 2842 gene locus_tag LOCUS_08870 2639 2842 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943568.1 protein_id gnl|my_center|LOCUS_08870 3428 2946 gene locus_tag LOCUS_08880 3428 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08880 4099 3425 gene locus_tag LOCUS_08890 4099 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4911 4588 gene locus_tag LOCUS_08900 4911 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 5449 5204 gene locus_tag LOCUS_08910 5449 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5603 5953 gene locus_tag LOCUS_08920 5603 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 6474 7718 gene locus_tag LOCUS_08930 6474 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003909837.1 protein_id gnl|my_center|LOCUS_08930 7734 10817 gene locus_tag LOCUS_08940 7734 10817 CDS product peptidase C14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533561.1 protein_id gnl|my_center|LOCUS_08940 11134 12024 gene locus_tag LOCUS_08950 11134 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 12305 12748 gene locus_tag LOCUS_08960 12305 12748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence053 2113 668 gene locus_tag LOCUS_08970 gene ahcY 2113 668 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EH1 protein_id gnl|my_center|LOCUS_08970 3444 2272 gene locus_tag LOCUS_08980 gene metK 3444 2272 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61946 protein_id gnl|my_center|LOCUS_08980 3750 4730 gene locus_tag LOCUS_08990 3750 4730 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_08990 7230 4831 gene locus_tag LOCUS_09000 gene lon 7230 4831 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5F9 protein_id gnl|my_center|LOCUS_09000 7567 7400 gene locus_tag LOCUS_09010 7567 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 7880 8296 gene locus_tag LOCUS_09020 7880 8296 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_09020 9658 8807 gene locus_tag LOCUS_09030 9658 8807 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705863.1 protein_id gnl|my_center|LOCUS_09030 10178 10363 gene locus_tag LOCUS_09040 10178 10363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 10393 10815 gene locus_tag LOCUS_09050 10393 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 10822 10965 gene locus_tag LOCUS_09060 10822 10965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 10916 11443 gene locus_tag LOCUS_09070 10916 11443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 11440 11685 gene locus_tag LOCUS_09080 11440 11685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 12225 11833 gene locus_tag LOCUS_09090 12225 11833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence054 1325 318 gene locus_tag LOCUS_09100 1325 318 CDS product menaquinol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544992.1 protein_id gnl|my_center|LOCUS_09100 1895 1380 gene locus_tag LOCUS_09110 1895 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810499.1 protein_id gnl|my_center|LOCUS_09110 2211 3401 gene locus_tag LOCUS_09120 2211 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3382 5328 gene locus_tag LOCUS_09130 3382 5328 CDS product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868411.1 protein_id gnl|my_center|LOCUS_09130 5332 5943 gene locus_tag LOCUS_09140 5332 5943 CDS product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249090.1 protein_id gnl|my_center|LOCUS_09140 6019 6363 gene locus_tag LOCUS_09150 6019 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 6508 7245 gene locus_tag LOCUS_09160 6508 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 7496 7405 gene locus_tag LOCUS_t00120 7496 7405 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7659 8111 gene locus_tag LOCUS_09170 7659 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 8120 9811 gene locus_tag LOCUS_09180 gene argS 8120 9811 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CN5 protein_id gnl|my_center|LOCUS_09180 9814 10491 gene locus_tag LOCUS_09190 9814 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 10532 10819 gene locus_tag LOCUS_09200 gene gatC1 10532 10819 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58251 protein_id gnl|my_center|LOCUS_09200 10897 12369 gene locus_tag LOCUS_09210 gene gatA 10897 12369 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y7 protein_id gnl|my_center|LOCUS_09210 12386 12568 gene locus_tag LOCUS_09220 12386 12568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence055 <1 1641 gene locus_tag LOCUS_09230 <1 1641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941395.1:hydrogenase 1727 2647 gene locus_tag LOCUS_09240 gene ehrB 1727 2647 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_09240 2644 3288 gene locus_tag LOCUS_09250 gene ehrC 2644 3288 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_09250 3299 4729 gene locus_tag LOCUS_09260 gene ehrD 3299 4729 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_09260 4726 6237 gene locus_tag LOCUS_09270 gene ehrL 4726 6237 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_09270 6267 7010 gene locus_tag LOCUS_09280 gene ehrS 6267 7010 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_09280 10245 7309 gene locus_tag LOCUS_09290 10245 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 11020 10631 gene locus_tag LOCUS_09300 11020 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 11750 12427 gene locus_tag LOCUS_09310 11750 12427 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence056 <1 1073 gene locus_tag LOCUS_09320 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392504.1:histone deacetylase 1070 1984 gene locus_tag LOCUS_09330 gene genX 1070 1984 CDS product EF-P lysine aminoacylase GenX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_09330 3106 1994 gene locus_tag LOCUS_09340 3106 1994 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903636.1 protein_id gnl|my_center|LOCUS_09340 3815 3123 gene locus_tag LOCUS_09350 gene pcm 3815 3123 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ5 protein_id gnl|my_center|LOCUS_09350 3962 4894 gene locus_tag LOCUS_09360 3962 4894 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938897.1 protein_id gnl|my_center|LOCUS_09360 5505 4918 gene locus_tag LOCUS_09370 5505 4918 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I538 protein_id gnl|my_center|LOCUS_09370 5686 6975 gene locus_tag LOCUS_09380 gene serS 5686 6975 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FH6 protein_id gnl|my_center|LOCUS_09380 6965 8470 gene locus_tag LOCUS_09390 gene thrC 6965 8470 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940468.1 protein_id gnl|my_center|LOCUS_09390 8467 10023 gene locus_tag LOCUS_09400 8467 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 10020 10775 gene locus_tag LOCUS_09410 10020 10775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 <13013 10772 gene locus_tag LOCUS_09420 <13013 10772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266377.1:fimbrial protein >Feature sequence057 476 336 gene locus_tag LOCUS_09430 476 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 976 1743 gene locus_tag LOCUS_09440 976 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1801 2790 gene locus_tag LOCUS_09450 1801 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 2811 3620 gene locus_tag LOCUS_09460 2811 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3617 8236 gene locus_tag LOCUS_09470 3617 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 8260 9177 gene locus_tag LOCUS_09480 8260 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 9356 9571 gene locus_tag LOCUS_09490 9356 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_09490 9762 9688 gene locus_tag LOCUS_t00130 9762 9688 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9845 9771 gene locus_tag LOCUS_t00140 9845 9771 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10480 9914 gene locus_tag LOCUS_09500 gene pgsA 10480 9914 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_09500 11149 10487 gene locus_tag LOCUS_09510 11149 10487 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_09510 11666 11151 gene locus_tag LOCUS_09520 11666 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 12094 11663 gene locus_tag LOCUS_09530 12094 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 <12794 12091 gene locus_tag LOCUS_09540 <12794 12091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GT9:argininosuccinate lyase >Feature sequence058 3349 941 gene locus_tag LOCUS_09550 3349 941 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 protein_id gnl|my_center|LOCUS_09550 3667 4716 gene locus_tag LOCUS_09560 3667 4716 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_09560 4713 5429 gene locus_tag LOCUS_09570 4713 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 7859 5460 gene locus_tag LOCUS_09580 7859 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 9519 7900 gene locus_tag LOCUS_09590 9519 7900 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_09590 10552 9638 gene locus_tag LOCUS_09600 10552 9638 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207504.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence059 784 68 gene locus_tag LOCUS_09610 784 68 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090590.1 protein_id gnl|my_center|LOCUS_09610 1919 855 gene locus_tag LOCUS_09620 1919 855 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_09620 3215 2022 gene locus_tag LOCUS_09630 gene acd 3215 2022 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_09630 3408 4187 gene locus_tag LOCUS_09640 gene etfB 3408 4187 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933796.1 protein_id gnl|my_center|LOCUS_09640 4204 5268 gene locus_tag LOCUS_09650 gene etfA 4204 5268 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94551 protein_id gnl|my_center|LOCUS_09650 5402 7213 gene locus_tag LOCUS_09660 gene acd 5402 7213 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970940.1 protein_id gnl|my_center|LOCUS_09660 7368 8990 gene locus_tag LOCUS_09670 7368 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 9099 10826 gene locus_tag LOCUS_09680 9099 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 10873 11334 gene locus_tag LOCUS_09690 10873 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328395.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence060 1985 312 gene locus_tag LOCUS_09700 1985 312 CDS product hydantoinase/oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392505.1 protein_id gnl|my_center|LOCUS_09700 2194 2916 gene locus_tag LOCUS_09710 2194 2916 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701727.1 protein_id gnl|my_center|LOCUS_09710 4297 3029 gene locus_tag LOCUS_09720 4297 3029 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_09720 4880 4386 gene locus_tag LOCUS_09730 gene coaD 4880 4386 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BV2 protein_id gnl|my_center|LOCUS_09730 5439 4897 gene locus_tag LOCUS_09740 5439 4897 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_09740 6790 5426 gene locus_tag LOCUS_09750 6790 5426 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_09750 9028 6818 gene locus_tag LOCUS_09760 9028 6818 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_09760 9573 9067 gene locus_tag LOCUS_09770 9573 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 10455 9667 gene locus_tag LOCUS_09780 gene lpxC 10455 9667 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ6 protein_id gnl|my_center|LOCUS_09780 >Feature sequence061 722 647 gene locus_tag LOCUS_t00150 722 647 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 864 1325 gene locus_tag LOCUS_09790 864 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1430 1795 gene locus_tag LOCUS_09800 1430 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1863 3134 gene locus_tag LOCUS_09810 1863 3134 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIJ6 protein_id gnl|my_center|LOCUS_09810 3149 4117 gene locus_tag LOCUS_09820 3149 4117 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727R2 protein_id gnl|my_center|LOCUS_09820 4110 4694 gene locus_tag LOCUS_09830 4110 4694 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727R1 protein_id gnl|my_center|LOCUS_09830 4718 5326 gene locus_tag LOCUS_09840 4718 5326 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727R0 protein_id gnl|my_center|LOCUS_09840 5338 5910 gene locus_tag LOCUS_09850 5338 5910 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727Q9 protein_id gnl|my_center|LOCUS_09850 5979 8069 gene locus_tag LOCUS_09860 5979 8069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 8155 9177 gene locus_tag LOCUS_09870 gene yceG 8155 9177 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_09870 9804 9178 gene locus_tag LOCUS_09880 9804 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 9862 11877 gene locus_tag LOCUS_09890 9862 11877 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141615.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence062 1300 557 gene locus_tag LOCUS_09900 1300 557 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812756.1 protein_id gnl|my_center|LOCUS_09900 2685 1498 gene locus_tag LOCUS_09910 2685 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3913 2657 gene locus_tag LOCUS_09920 3913 2657 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938700.1 protein_id gnl|my_center|LOCUS_09920 5872 4217 gene locus_tag LOCUS_09930 5872 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6372 6620 gene locus_tag LOCUS_09940 6372 6620 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_09940 6630 8993 gene locus_tag LOCUS_09950 gene hypF 6630 8993 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GE0 protein_id gnl|my_center|LOCUS_09950 9012 10097 gene locus_tag LOCUS_09960 gene hypD 9012 10097 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545661.1 protein_id gnl|my_center|LOCUS_09960 10130 11140 gene locus_tag LOCUS_09970 gene hypE 10130 11140 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence063 125 1423 gene locus_tag LOCUS_09980 125 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1420 2886 gene locus_tag LOCUS_09990 1420 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 4074 2887 gene locus_tag LOCUS_10000 4074 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 5043 4102 gene locus_tag LOCUS_10010 5043 4102 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783220.1 protein_id gnl|my_center|LOCUS_10010 6206 5259 gene locus_tag LOCUS_10020 6206 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 8151 6370 gene locus_tag LOCUS_10030 8151 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 8749 8153 gene locus_tag LOCUS_10040 gene wbbJ 8749 8153 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231291.1 protein_id gnl|my_center|LOCUS_10040 9576 8845 gene locus_tag LOCUS_10050 9576 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 10558 9659 gene locus_tag LOCUS_10060 10558 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 11486 10551 gene locus_tag LOCUS_10070 11486 10551 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986613.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence064 629 162 gene locus_tag LOCUS_10080 629 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1190 684 gene locus_tag LOCUS_10090 1190 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2976 1204 gene locus_tag LOCUS_10100 2976 1204 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969263.1 protein_id gnl|my_center|LOCUS_10100 3211 2966 gene locus_tag LOCUS_10110 3211 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708739.1 protein_id gnl|my_center|LOCUS_10110 3426 3274 gene locus_tag LOCUS_10120 3426 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 4927 3452 gene locus_tag LOCUS_10130 4927 3452 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708740.1 protein_id gnl|my_center|LOCUS_10130 6450 4960 gene locus_tag LOCUS_10140 6450 4960 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_10140 6870 6454 gene locus_tag LOCUS_10150 6870 6454 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_10150 7703 6879 gene locus_tag LOCUS_10160 7703 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 7945 7700 gene locus_tag LOCUS_10170 7945 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10170 8280 7948 gene locus_tag LOCUS_10180 8280 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 8587 8300 gene locus_tag LOCUS_10190 8587 8300 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902381.1 protein_id gnl|my_center|LOCUS_10190 9135 8584 gene locus_tag LOCUS_10200 9135 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 9648 9175 gene locus_tag LOCUS_10210 9648 9175 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545664.1 protein_id gnl|my_center|LOCUS_10210 10775 9894 gene locus_tag LOCUS_10220 10775 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 11201 10809 gene locus_tag LOCUS_10230 11201 10809 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937569.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence065 1140 208 gene locus_tag LOCUS_10240 1140 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1803 1153 gene locus_tag LOCUS_10250 1803 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2559 1816 gene locus_tag LOCUS_10260 2559 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 4874 2559 gene locus_tag LOCUS_10270 4874 2559 CDS product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461557.1 protein_id gnl|my_center|LOCUS_10270 5234 5007 gene locus_tag LOCUS_10280 5234 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 5562 5245 gene locus_tag LOCUS_10290 5562 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121205.1 protein_id gnl|my_center|LOCUS_10290 5802 7277 gene locus_tag LOCUS_10300 5802 7277 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940888.1 protein_id gnl|my_center|LOCUS_10300 7281 8543 gene locus_tag LOCUS_10310 7281 8543 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GV1 protein_id gnl|my_center|LOCUS_10310 9263 8505 gene locus_tag LOCUS_10320 9263 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 9363 10763 gene locus_tag LOCUS_10330 9363 10763 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence066 <1 1395 gene locus_tag LOCUS_10340 <1 1395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P61185:chaperone protein HtpG 1392 2732 gene locus_tag LOCUS_10350 gene rimO 1392 2732 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BJ2 protein_id gnl|my_center|LOCUS_10350 2729 3712 gene locus_tag LOCUS_10360 gene ispB 2729 3712 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_10360 3718 4929 gene locus_tag LOCUS_10370 3718 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 5038 5113 gene locus_tag LOCUS_t00160 5038 5113 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6123 5323 gene locus_tag LOCUS_10380 6123 5323 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870378.1 protein_id gnl|my_center|LOCUS_10380 6613 6173 gene locus_tag LOCUS_10390 6613 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 7241 7900 gene locus_tag LOCUS_10400 7241 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 8049 7903 gene locus_tag LOCUS_10410 8049 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 8411 9838 gene locus_tag LOCUS_10420 8411 9838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 9813 10172 gene locus_tag LOCUS_10430 9813 10172 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937557.1 protein_id gnl|my_center|LOCUS_10430 <11449 10213 gene locus_tag LOCUS_10440 <11449 10213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393637.1:phosphohydrolase >Feature sequence067 3713 636 gene locus_tag LOCUS_10450 3713 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 5255 3930 gene locus_tag LOCUS_10460 5255 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 6573 5650 gene locus_tag LOCUS_10470 6573 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 6928 7215 gene locus_tag LOCUS_10480 6928 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 7216 8379 gene locus_tag LOCUS_10490 7216 8379 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176724.1 protein_id gnl|my_center|LOCUS_10490 8424 10313 gene locus_tag LOCUS_10500 8424 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence068 178 330 gene locus_tag LOCUS_10510 178 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 366 1214 gene locus_tag LOCUS_10520 366 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1383 1688 gene locus_tag LOCUS_10530 1383 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2592 1864 gene locus_tag LOCUS_10540 2592 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2820 2680 gene locus_tag LOCUS_10550 2820 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2910 8099 gene locus_tag LOCUS_10560 2910 8099 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338366.1 protein_id gnl|my_center|LOCUS_10560 8287 9636 gene locus_tag LOCUS_10570 gene argA 8287 9636 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22567 protein_id gnl|my_center|LOCUS_10570 9663 10832 gene locus_tag LOCUS_10580 9663 10832 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867786.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence069 595 1209 gene locus_tag LOCUS_10590 gene alkA 595 1209 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653302.1 protein_id gnl|my_center|LOCUS_10590 2135 1221 gene locus_tag LOCUS_10600 2135 1221 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_10600 2507 2878 gene locus_tag LOCUS_10610 2507 2878 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_10610 3079 4473 gene locus_tag LOCUS_10620 gene rhlE1 3079 4473 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X42 protein_id gnl|my_center|LOCUS_10620 6011 4464 gene locus_tag LOCUS_10630 6011 4464 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459860.1 protein_id gnl|my_center|LOCUS_10630 6857 6057 gene locus_tag LOCUS_10640 6857 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 7104 7448 gene locus_tag LOCUS_10650 7104 7448 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_10650 7468 7926 gene locus_tag LOCUS_10660 7468 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10660 7990 8544 gene locus_tag LOCUS_10670 7990 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 8892 8617 gene locus_tag LOCUS_10680 8892 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 10093 8852 gene locus_tag LOCUS_10690 10093 8852 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109989.1 protein_id gnl|my_center|LOCUS_10690 10971 10564 gene locus_tag LOCUS_10700 10971 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence070 528 604 gene locus_tag LOCUS_t00170 528 604 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3041 801 gene locus_tag LOCUS_10710 3041 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3985 3059 gene locus_tag LOCUS_10720 3985 3059 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255931.1 protein_id gnl|my_center|LOCUS_10720 4486 4884 gene locus_tag LOCUS_10730 4486 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 4910 7486 gene locus_tag LOCUS_10740 4910 7486 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272623.1 protein_id gnl|my_center|LOCUS_10740 7500 8222 gene locus_tag LOCUS_10750 7500 8222 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461967.1 protein_id gnl|my_center|LOCUS_10750 8222 9370 gene locus_tag LOCUS_10760 8222 9370 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817192.1 protein_id gnl|my_center|LOCUS_10760 9502 10158 gene locus_tag LOCUS_10770 9502 10158 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461608.1 protein_id gnl|my_center|LOCUS_10770 10169 10321 gene locus_tag LOCUS_10780 10169 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 10406 10585 gene locus_tag LOCUS_10790 10406 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 <11253 10672 gene locus_tag LOCUS_10800 <11253 10672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118066.1:arsenical-resistance protein >Feature sequence071 1137 334 gene locus_tag LOCUS_10810 1137 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1774 1142 gene locus_tag LOCUS_10820 1774 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1989 2888 gene locus_tag LOCUS_10830 1989 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 3119 3850 gene locus_tag LOCUS_10840 3119 3850 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004543.1 protein_id gnl|my_center|LOCUS_10840 3984 4826 gene locus_tag LOCUS_10850 gene nfo 3984 4826 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WY5 protein_id gnl|my_center|LOCUS_10850 4884 5342 gene locus_tag LOCUS_10860 4884 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 5400 5945 gene locus_tag LOCUS_10870 5400 5945 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940338.1 protein_id gnl|my_center|LOCUS_10870 5989 7245 gene locus_tag LOCUS_10880 5989 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 7402 7842 gene locus_tag LOCUS_10890 7402 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 7929 8813 gene locus_tag LOCUS_10900 7929 8813 CDS product RNA pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073870.1 protein_id gnl|my_center|LOCUS_10900 8945 9790 gene locus_tag LOCUS_10910 8945 9790 CDS product rhombotarget lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072488.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence072 215 670 gene locus_tag LOCUS_10920 gene argA 215 670 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942702.1 protein_id gnl|my_center|LOCUS_10920 1720 665 gene locus_tag LOCUS_10930 1720 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2930 1755 gene locus_tag LOCUS_10940 gene pgk 2930 1755 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7FK92 protein_id gnl|my_center|LOCUS_10940 3259 2996 gene locus_tag LOCUS_10950 3259 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3980 3252 gene locus_tag LOCUS_10960 3980 3252 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 protein_id gnl|my_center|LOCUS_10960 6465 3952 gene locus_tag LOCUS_10970 gene gyrA 6465 3952 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H88 protein_id gnl|my_center|LOCUS_10970 7547 6480 gene locus_tag LOCUS_10980 7547 6480 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064122.1 protein_id gnl|my_center|LOCUS_10980 7845 7690 gene locus_tag LOCUS_10990 7845 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 9233 7947 gene locus_tag LOCUS_11000 9233 7947 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878693.1 protein_id gnl|my_center|LOCUS_11000 9337 10098 gene locus_tag LOCUS_11010 9337 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_11010 10501 10154 gene locus_tag LOCUS_11020 10501 10154 CDS product zinc chelation protein SecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261999.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence073 1942 122 gene locus_tag LOCUS_11030 1942 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 2340 1942 gene locus_tag LOCUS_11040 2340 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2780 2433 gene locus_tag LOCUS_11050 2780 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 5873 4488 gene locus_tag LOCUS_11060 5873 4488 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965577.1 protein_id gnl|my_center|LOCUS_11060 7936 5849 gene locus_tag LOCUS_11070 7936 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 8561 7989 gene locus_tag LOCUS_11080 8561 7989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 9105 8584 gene locus_tag LOCUS_11090 9105 8584 CDS product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440739.1 protein_id gnl|my_center|LOCUS_11090 11125 9098 gene locus_tag LOCUS_11100 11125 9098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence074 1999 176 gene locus_tag LOCUS_11110 1999 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2177 3076 gene locus_tag LOCUS_11120 2177 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3073 4272 gene locus_tag LOCUS_11130 3073 4272 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968018.1 protein_id gnl|my_center|LOCUS_11130 5066 4269 gene locus_tag LOCUS_11140 5066 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 5709 5299 gene locus_tag LOCUS_11150 5709 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 6044 6292 gene locus_tag LOCUS_11160 6044 6292 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500746.1 protein_id gnl|my_center|LOCUS_11160 6354 6917 gene locus_tag LOCUS_11170 6354 6917 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022735.1 protein_id gnl|my_center|LOCUS_11170 6937 8079 gene locus_tag LOCUS_11180 gene tyrA 6937 8079 CDS product T-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH68 protein_id gnl|my_center|LOCUS_11180 9587 8241 gene locus_tag LOCUS_11190 9587 8241 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368806.1 protein_id gnl|my_center|LOCUS_11190 10909 9605 gene locus_tag LOCUS_11200 10909 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence075 453 812 gene locus_tag LOCUS_11210 453 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_11210 906 1160 gene locus_tag LOCUS_11220 906 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1163 1603 gene locus_tag LOCUS_11230 1163 1603 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903539.1 protein_id gnl|my_center|LOCUS_11230 1743 2693 gene locus_tag LOCUS_11240 1743 2693 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_11240 3565 2768 gene locus_tag LOCUS_11250 3565 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392941.1 protein_id gnl|my_center|LOCUS_11250 3911 3597 gene locus_tag LOCUS_11260 3911 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 4512 4982 gene locus_tag LOCUS_11270 4512 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 5152 4979 gene locus_tag LOCUS_11280 5152 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 5229 6770 gene locus_tag LOCUS_11290 5229 6770 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168981.1 protein_id gnl|my_center|LOCUS_11290 6786 9308 gene locus_tag LOCUS_11300 6786 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 9587 10015 gene locus_tag LOCUS_11310 9587 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 10193 10630 gene locus_tag LOCUS_11320 10193 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence076 <1 725 gene locus_tag LOCUS_11330 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941846.1:rhomboid family intramembrane serine protease 794 5215 gene locus_tag LOCUS_11340 gene pfaC 794 5215 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071757.1 protein_id gnl|my_center|LOCUS_11340 5212 6264 gene locus_tag LOCUS_11350 gene oleA 5212 6264 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071874.1 protein_id gnl|my_center|LOCUS_11350 6258 7172 gene locus_tag LOCUS_11360 gene oleB 6258 7172 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_11360 7233 8882 gene locus_tag LOCUS_11370 7233 8882 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_11370 10191 8893 gene locus_tag LOCUS_11380 10191 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 <10933 10201 gene locus_tag LOCUS_11390 <10933 10201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942647.1:3-octaprenyl-4-hydroxybenzoate carboxy-lyase >Feature sequence077 482 2779 gene locus_tag LOCUS_11400 482 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2797 4506 gene locus_tag LOCUS_11410 2797 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4753 5712 gene locus_tag LOCUS_11420 4753 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 5796 7847 gene locus_tag LOCUS_11430 5796 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 7943 9028 gene locus_tag LOCUS_11440 7943 9028 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_11440 9528 10166 gene locus_tag LOCUS_11450 9528 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 10577 10245 gene locus_tag LOCUS_11460 10577 10245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence078 1560 2504 gene locus_tag LOCUS_11470 1560 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 3694 3981 gene locus_tag LOCUS_11480 3694 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 4590 4045 gene locus_tag LOCUS_11490 gene korC 4590 4045 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_11490 5414 4590 gene locus_tag LOCUS_11500 gene korB 5414 4590 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_11500 6570 5416 gene locus_tag LOCUS_11510 gene korA 6570 5416 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942114.1 protein_id gnl|my_center|LOCUS_11510 6784 6560 gene locus_tag LOCUS_11520 6784 6560 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869714.1 protein_id gnl|my_center|LOCUS_11520 7159 7983 gene locus_tag LOCUS_11530 7159 7983 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_11530 8326 8054 gene locus_tag LOCUS_11540 8326 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 8577 9332 gene locus_tag LOCUS_11550 8577 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence079 1593 277 gene locus_tag LOCUS_11560 1593 277 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584153.1 protein_id gnl|my_center|LOCUS_11560 3966 1714 gene locus_tag LOCUS_11570 3966 1714 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261974.1 protein_id gnl|my_center|LOCUS_11570 4314 5057 gene locus_tag LOCUS_11580 4314 5057 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865221.1 protein_id gnl|my_center|LOCUS_11580 5741 5199 gene locus_tag LOCUS_11590 5741 5199 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941409.1 protein_id gnl|my_center|LOCUS_11590 5843 6703 gene locus_tag LOCUS_11600 gene yusT 5843 6703 CDS product putative HTH-type transcriptional regulator YusT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32186 protein_id gnl|my_center|LOCUS_11600 6830 7909 gene locus_tag LOCUS_11610 6830 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 7997 8158 gene locus_tag LOCUS_11620 7997 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 9158 8166 gene locus_tag LOCUS_11630 9158 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 9255 9938 gene locus_tag LOCUS_11640 9255 9938 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887517.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence080 22 1023 gene locus_tag LOCUS_11650 22 1023 CDS product corrinoid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_11650 1031 1807 gene locus_tag LOCUS_11660 1031 1807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_11660 1833 2708 gene locus_tag LOCUS_11670 1833 2708 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868809.1 protein_id gnl|my_center|LOCUS_11670 2728 3432 gene locus_tag LOCUS_11680 gene cobI 2728 3432 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937949.1 protein_id gnl|my_center|LOCUS_11680 3429 4490 gene locus_tag LOCUS_11690 3429 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937954.1 protein_id gnl|my_center|LOCUS_11690 4492 5730 gene locus_tag LOCUS_11700 gene cbiET 4492 5730 CDS product precorrin-6Y-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_11700 5736 6515 gene locus_tag LOCUS_11710 gene cbiF 5736 6515 CDS product cobalt-precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_11710 6493 7560 gene locus_tag LOCUS_11720 gene cbiG 6493 7560 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943623.1 protein_id gnl|my_center|LOCUS_11720 7557 8345 gene locus_tag LOCUS_11730 7557 8345 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229229.1 protein_id gnl|my_center|LOCUS_11730 8377 8889 gene locus_tag LOCUS_11740 gene cobO 8377 8889 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666509.1 protein_id gnl|my_center|LOCUS_11740 8886 10349 gene locus_tag LOCUS_11750 gene cobQ 8886 10349 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDV6 protein_id gnl|my_center|LOCUS_11750 >Feature sequence081 1218 1045 gene locus_tag LOCUS_11760 1218 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2778 1231 gene locus_tag LOCUS_11770 2778 1231 CDS product lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808649.1 protein_id gnl|my_center|LOCUS_11770 3973 2966 gene locus_tag LOCUS_11780 3973 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 4318 4394 gene locus_tag LOCUS_t00180 4318 4394 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5077 4871 gene locus_tag LOCUS_11790 5077 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 5409 5278 gene locus_tag LOCUS_11800 5409 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 5670 6965 gene locus_tag LOCUS_11810 gene proA 5670 6965 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU1 protein_id gnl|my_center|LOCUS_11810 6975 8105 gene locus_tag LOCUS_11820 gene proB 6975 8105 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ64 protein_id gnl|my_center|LOCUS_11820 8174 8872 gene locus_tag LOCUS_11830 gene gloB 8174 8872 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EK5 protein_id gnl|my_center|LOCUS_11830 9145 9981 gene locus_tag LOCUS_11840 9145 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence082 <1 1123 gene locus_tag LOCUS_11850 <1 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024396.1:NADP oxidoreductase 1344 2285 gene locus_tag LOCUS_11860 1344 2285 CDS product methyl viologen-reducing hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876759.1 protein_id gnl|my_center|LOCUS_11860 2287 3636 gene locus_tag LOCUS_11870 2287 3636 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_11870 4141 3737 gene locus_tag LOCUS_11880 4141 3737 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071479.1 protein_id gnl|my_center|LOCUS_11880 4560 4228 gene locus_tag LOCUS_11890 4560 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_11890 4959 4576 gene locus_tag LOCUS_11900 gene crcB 4959 4576 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z03 protein_id gnl|my_center|LOCUS_11900 5326 6258 gene locus_tag LOCUS_11910 5326 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_11910 6300 7814 gene locus_tag LOCUS_11920 6300 7814 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_11920 7959 8321 gene locus_tag LOCUS_11930 7959 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 8347 9102 gene locus_tag LOCUS_11940 gene guaA 8347 9102 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039158.1 protein_id gnl|my_center|LOCUS_11940 9863 9111 gene locus_tag LOCUS_11950 9863 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence083 2873 2046 gene locus_tag LOCUS_11960 2873 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_11960 3802 2870 gene locus_tag LOCUS_11970 3802 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 4119 3799 gene locus_tag LOCUS_11980 4119 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5086 4148 gene locus_tag LOCUS_11990 5086 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 5704 5375 gene locus_tag LOCUS_12000 5704 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 6058 5705 gene locus_tag LOCUS_12010 6058 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 6575 6303 gene locus_tag LOCUS_12020 6575 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 7165 6743 gene locus_tag LOCUS_12030 7165 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 8551 7859 gene locus_tag LOCUS_12040 8551 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 9069 8632 gene locus_tag LOCUS_12050 9069 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 9377 9225 gene locus_tag LOCUS_12060 9377 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 <10276 9377 gene locus_tag LOCUS_12070 <10276 9377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q52873:transposase for insertion sequence element ISRM5 >Feature sequence084 972 397 gene locus_tag LOCUS_12080 gene rbr 972 397 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24931 protein_id gnl|my_center|LOCUS_12080 1179 988 gene locus_tag LOCUS_12090 1179 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3528 1384 gene locus_tag LOCUS_12100 3528 1384 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_12100 4907 3786 gene locus_tag LOCUS_12110 4907 3786 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939260.1 protein_id gnl|my_center|LOCUS_12110 5552 4977 gene locus_tag LOCUS_12120 5552 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12120 5807 5586 gene locus_tag LOCUS_12130 5807 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12130 6078 5899 gene locus_tag LOCUS_12140 gene rdl 6078 5899 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726L3 protein_id gnl|my_center|LOCUS_12140 6413 6240 gene locus_tag LOCUS_12150 6413 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 6613 6449 gene locus_tag LOCUS_12160 6613 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870242.1 protein_id gnl|my_center|LOCUS_12160 8682 6904 gene locus_tag LOCUS_12170 8682 6904 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_12170 10212 9016 gene locus_tag LOCUS_12180 10212 9016 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence085 2175 1546 gene locus_tag LOCUS_12190 2175 1546 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189288.1 protein_id gnl|my_center|LOCUS_12190 3171 2197 gene locus_tag LOCUS_12200 gene ftsY 3171 2197 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E32 protein_id gnl|my_center|LOCUS_12200 3326 4303 gene locus_tag LOCUS_12210 3326 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 4376 6460 gene locus_tag LOCUS_12220 4376 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 8828 6564 gene locus_tag LOCUS_12230 8828 6564 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545777.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence086 1746 400 gene locus_tag LOCUS_12240 1746 400 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_12240 2181 1756 gene locus_tag LOCUS_12250 2181 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2939 2469 gene locus_tag LOCUS_12260 2939 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3583 2969 gene locus_tag LOCUS_12270 3583 2969 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942192.1 protein_id gnl|my_center|LOCUS_12270 4921 3638 gene locus_tag LOCUS_12280 4921 3638 CDS product UPF0597 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PR7 protein_id gnl|my_center|LOCUS_12280 5604 5086 gene locus_tag LOCUS_12290 5604 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 5858 5646 gene locus_tag LOCUS_12300 5858 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7286 5895 gene locus_tag LOCUS_12310 gene fumC 7286 5895 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71384 protein_id gnl|my_center|LOCUS_12310 7990 7442 gene locus_tag LOCUS_12320 7990 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939699.1 protein_id gnl|my_center|LOCUS_12320 9628 8018 gene locus_tag LOCUS_12330 gene fumA 9628 8018 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NB65 protein_id gnl|my_center|LOCUS_12330 >Feature sequence087 53 1156 gene locus_tag LOCUS_12340 53 1156 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976267.1 protein_id gnl|my_center|LOCUS_12340 1936 1283 gene locus_tag LOCUS_12350 gene ribB 1936 1283 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHV1 protein_id gnl|my_center|LOCUS_12350 2451 2744 gene locus_tag LOCUS_12360 2451 2744 CDS product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767829.1 protein_id gnl|my_center|LOCUS_12360 2953 4269 gene locus_tag LOCUS_12370 2953 4269 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024054.1 protein_id gnl|my_center|LOCUS_12370 4610 6049 gene locus_tag LOCUS_12380 4610 6049 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022107.1 protein_id gnl|my_center|LOCUS_12380 6084 6272 gene locus_tag LOCUS_12390 6084 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12390 6452 7240 gene locus_tag LOCUS_12400 6452 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 7721 7903 gene locus_tag LOCUS_12410 7721 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 8015 8581 gene locus_tag LOCUS_12420 8015 8581 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861340.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence088 267 1136 gene locus_tag LOCUS_12430 267 1136 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986530.1 protein_id gnl|my_center|LOCUS_12430 1168 3171 gene locus_tag LOCUS_12440 1168 3171 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81A99 protein_id gnl|my_center|LOCUS_12440 3201 3593 gene locus_tag LOCUS_12450 3201 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_12450 4043 3612 gene locus_tag LOCUS_12460 4043 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709169.1 protein_id gnl|my_center|LOCUS_12460 5718 4045 gene locus_tag LOCUS_12470 5718 4045 CDS product Na/Pi cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_12470 7140 5809 gene locus_tag LOCUS_12480 7140 5809 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_12480 7600 7130 gene locus_tag LOCUS_12490 7600 7130 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966078.1 protein_id gnl|my_center|LOCUS_12490 8816 7698 gene locus_tag LOCUS_12500 gene mtnA 8816 7698 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6ULQ4 protein_id gnl|my_center|LOCUS_12500 9487 8837 gene locus_tag LOCUS_12510 9487 8837 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence089 <1 1272 gene locus_tag LOCUS_12520 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938147.1:adenylylsulfate reductase subunit alpha 1541 2815 gene locus_tag LOCUS_12530 1541 2815 CDS product heterodisulfide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546111.1 protein_id gnl|my_center|LOCUS_12530 2825 5161 gene locus_tag LOCUS_12540 2825 5161 CDS product heterodisulfide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938149.1 protein_id gnl|my_center|LOCUS_12540 5201 6409 gene locus_tag LOCUS_12550 5201 6409 CDS product heterodisulfide reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938150.1 protein_id gnl|my_center|LOCUS_12550 6627 6827 gene locus_tag LOCUS_12560 gene cspLB 6627 6827 CDS product cold shock-like protein CspLB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A357 protein_id gnl|my_center|LOCUS_12560 7079 8164 gene locus_tag LOCUS_12570 gene leuB 7079 8164 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGM8 protein_id gnl|my_center|LOCUS_12570 9015 8326 gene locus_tag LOCUS_12580 9015 8326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence090 <1 783 gene locus_tag LOCUS_12590 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002078886.1:metal-dependent hydrolase 3120 877 gene locus_tag LOCUS_12600 3120 877 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088025.1 protein_id gnl|my_center|LOCUS_12600 3533 5653 gene locus_tag LOCUS_12610 3533 5653 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_12610 5815 6312 gene locus_tag LOCUS_12620 gene tpx 5815 6312 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57549 protein_id gnl|my_center|LOCUS_12620 6510 8516 gene locus_tag LOCUS_12630 6510 8516 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732543.1 protein_id gnl|my_center|LOCUS_12630 8611 9366 gene locus_tag LOCUS_12640 8611 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence091 78 1 gene locus_tag LOCUS_t00190 78 1 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 169 94 gene locus_tag LOCUS_t00200 169 94 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 434 1501 gene locus_tag LOCUS_12650 gene rho 434 1501 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67031 protein_id gnl|my_center|LOCUS_12650 3854 1509 gene locus_tag LOCUS_12660 gene lon-2 3854 1509 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C84 protein_id gnl|my_center|LOCUS_12660 5138 3879 gene locus_tag LOCUS_12670 gene clpX 5138 3879 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL30 protein_id gnl|my_center|LOCUS_12670 5768 5148 gene locus_tag LOCUS_12680 gene clpP 5768 5148 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA83 protein_id gnl|my_center|LOCUS_12680 7252 5828 gene locus_tag LOCUS_12690 gene tig 7252 5828 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C81 protein_id gnl|my_center|LOCUS_12690 7410 8090 gene locus_tag LOCUS_12700 7410 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 8165 8241 gene locus_tag LOCUS_t00210 8165 8241 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8581 9168 gene locus_tag LOCUS_12710 8581 9168 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence092 148 537 gene locus_tag LOCUS_12720 148 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 524 805 gene locus_tag LOCUS_12730 524 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 894 1349 gene locus_tag LOCUS_12740 894 1349 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_12740 2791 1391 gene locus_tag LOCUS_12750 2791 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3089 2850 gene locus_tag LOCUS_12760 3089 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3403 3125 gene locus_tag LOCUS_12770 3403 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4572 3709 gene locus_tag LOCUS_12780 4572 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 5470 4865 gene locus_tag LOCUS_12790 5470 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 5656 5477 gene locus_tag LOCUS_12800 5656 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 5900 5658 gene locus_tag LOCUS_12810 5900 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902080.1 protein_id gnl|my_center|LOCUS_12810 6162 6806 gene locus_tag LOCUS_12820 6162 6806 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_12820 6808 7470 gene locus_tag LOCUS_12830 6808 7470 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence093 1892 888 gene locus_tag LOCUS_12840 1892 888 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937555.1 protein_id gnl|my_center|LOCUS_12840 4476 1909 gene locus_tag LOCUS_12850 4476 1909 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545874.1 protein_id gnl|my_center|LOCUS_12850 4937 4758 gene locus_tag LOCUS_12860 4937 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 5018 7105 gene locus_tag LOCUS_12870 5018 7105 CDS product thiosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937484.1 protein_id gnl|my_center|LOCUS_12870 8269 7214 gene locus_tag LOCUS_12880 8269 7214 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_12880 8870 8271 gene locus_tag LOCUS_12890 8870 8271 CDS product formylmethanofuran dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889526.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence094 995 231 gene locus_tag LOCUS_12900 995 231 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530944.1 protein_id gnl|my_center|LOCUS_12900 4720 1187 gene locus_tag LOCUS_12910 gene dnaE 4720 1187 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB6 protein_id gnl|my_center|LOCUS_12910 6206 4737 gene locus_tag LOCUS_12920 gene guaB 6206 4737 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B47 protein_id gnl|my_center|LOCUS_12920 6782 7390 gene locus_tag LOCUS_12930 gene yrdC 6782 7390 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_12930 8230 7328 gene locus_tag LOCUS_12940 gene sppA 8230 7328 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_12940 <9305 8332 gene locus_tag LOCUS_12950 <9305 8332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940408.1:30S ribosomal protein S1 >Feature sequence095 655 1611 gene locus_tag LOCUS_12960 655 1611 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943398.1 protein_id gnl|my_center|LOCUS_12960 1644 1889 gene locus_tag LOCUS_12970 1644 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1879 2103 gene locus_tag LOCUS_12980 1879 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2322 2519 gene locus_tag LOCUS_12990 2322 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 2522 2788 gene locus_tag LOCUS_13000 2522 2788 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_13000 3041 3343 gene locus_tag LOCUS_13010 3041 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_13010 3461 4579 gene locus_tag LOCUS_13020 3461 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 4677 4928 gene locus_tag LOCUS_13030 4677 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 4925 5323 gene locus_tag LOCUS_13040 4925 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969348.1 protein_id gnl|my_center|LOCUS_13040 5814 6776 gene locus_tag LOCUS_13050 5814 6776 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943398.1 protein_id gnl|my_center|LOCUS_13050 6918 7106 gene locus_tag LOCUS_13060 6918 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 7516 8895 gene locus_tag LOCUS_13070 7516 8895 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence096 <1 863 gene locus_tag LOCUS_13080 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583044.1:multidrug ABC transporter ATP-binding protein 853 2649 gene locus_tag LOCUS_13090 853 2649 CDS product lipid A ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_13090 2820 3146 gene locus_tag LOCUS_13100 2820 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3151 3708 gene locus_tag LOCUS_13110 3151 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 3795 4862 gene locus_tag LOCUS_13120 gene potD-A 3795 4862 CDS product spermidine/putrescine-binding periplasmic protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44731 protein_id gnl|my_center|LOCUS_13120 4984 6042 gene locus_tag LOCUS_13130 gene potA 4984 6042 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBU2 protein_id gnl|my_center|LOCUS_13130 6047 6901 gene locus_tag LOCUS_13140 gene potB 6047 6901 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_13140 6979 7752 gene locus_tag LOCUS_13150 6979 7752 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_13150 7770 8564 gene locus_tag LOCUS_13160 gene cpdA 7770 8564 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0J3 protein_id gnl|my_center|LOCUS_13160 8633 8893 gene locus_tag LOCUS_13170 8633 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence097 73 792 gene locus_tag LOCUS_13180 73 792 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097507.1 protein_id gnl|my_center|LOCUS_13180 796 2328 gene locus_tag LOCUS_13190 gene hutH 796 2328 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCB3 protein_id gnl|my_center|LOCUS_13190 3063 2335 gene locus_tag LOCUS_13200 3063 2335 CDS product thiamine biosynthesis protein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_13200 4225 3056 gene locus_tag LOCUS_13210 4225 3056 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0E6 protein_id gnl|my_center|LOCUS_13210 5106 4234 gene locus_tag LOCUS_13220 5106 4234 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AZ3 protein_id gnl|my_center|LOCUS_13220 5910 5161 gene locus_tag LOCUS_13230 5910 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 7654 5903 gene locus_tag LOCUS_13240 7654 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_13240 8650 7691 gene locus_tag LOCUS_13250 8650 7691 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BQ0 protein_id gnl|my_center|LOCUS_13250 8797 8873 gene locus_tag LOCUS_t00220 8797 8873 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence098 <1 974 gene locus_tag LOCUS_13260 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E008:serine hydroxymethyltransferase 967 1428 gene locus_tag LOCUS_13270 967 1428 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_13270 1446 1952 gene locus_tag LOCUS_13280 gene nrdR 1446 1952 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6W9 protein_id gnl|my_center|LOCUS_13280 1939 3036 gene locus_tag LOCUS_13290 gene ribD 1939 3036 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI5 protein_id gnl|my_center|LOCUS_13290 3061 3726 gene locus_tag LOCUS_13300 gene ribE 3061 3726 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_13300 3746 4948 gene locus_tag LOCUS_13310 gene ribA 3746 4948 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI3 protein_id gnl|my_center|LOCUS_13310 5091 5564 gene locus_tag LOCUS_13320 gene ribH 5091 5564 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61723 protein_id gnl|my_center|LOCUS_13320 5573 5989 gene locus_tag LOCUS_13330 gene nusB 5573 5989 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI1 protein_id gnl|my_center|LOCUS_13330 5999 6619 gene locus_tag LOCUS_13340 gene ycbL 5999 6619 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_13340 7007 7210 gene locus_tag LOCUS_13350 7007 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 7307 7708 gene locus_tag LOCUS_13360 7307 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 7742 8374 gene locus_tag LOCUS_13370 7742 8374 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942711.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence099 1761 736 gene locus_tag LOCUS_13380 1761 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1991 4249 gene locus_tag LOCUS_13390 1991 4249 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545777.1 protein_id gnl|my_center|LOCUS_13390 5275 4433 gene locus_tag LOCUS_13400 5275 4433 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933758.1 protein_id gnl|my_center|LOCUS_13400 6035 5268 gene locus_tag LOCUS_13410 6035 5268 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876244.1 protein_id gnl|my_center|LOCUS_13410 7057 6101 gene locus_tag LOCUS_13420 7057 6101 CDS product cation ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_13420 7320 8237 gene locus_tag LOCUS_13430 7320 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 8201 8935 gene locus_tag LOCUS_13440 8201 8935 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence100 <1 604 gene locus_tag LOCUS_13450 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877481.1:disulfide reductase 674 853 gene locus_tag LOCUS_13460 674 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13460 956 3796 gene locus_tag LOCUS_13470 956 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13470 3810 4010 gene locus_tag LOCUS_13480 3810 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13480 4071 4232 gene locus_tag LOCUS_13490 4071 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 4246 5193 gene locus_tag LOCUS_13500 4246 5193 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_13500 5223 6275 gene locus_tag LOCUS_13510 gene hydB-2 5223 6275 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932918.1 protein_id gnl|my_center|LOCUS_13510 6296 7141 gene locus_tag LOCUS_13520 gene hdrF 6296 7141 CDS product heterodisulfide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_13520 7277 7594 gene locus_tag LOCUS_13530 gene dsvC 7277 7594 CDS product sulfite reductase, dissimilatory-type subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45573 protein_id gnl|my_center|LOCUS_13530 7688 8143 gene locus_tag LOCUS_13540 7688 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 8140 8949 gene locus_tag LOCUS_13550 8140 8949 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810480.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence101 500 955 gene locus_tag LOCUS_13560 500 955 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939197.1 protein_id gnl|my_center|LOCUS_13560 963 2285 gene locus_tag LOCUS_13570 963 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2491 2925 gene locus_tag LOCUS_13580 2491 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 4362 2992 gene locus_tag LOCUS_13590 4362 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 4889 4359 gene locus_tag LOCUS_13600 4889 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 5329 4886 gene locus_tag LOCUS_13610 5329 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 5841 5335 gene locus_tag LOCUS_13620 5841 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 6224 6655 gene locus_tag LOCUS_13630 6224 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 7022 6660 gene locus_tag LOCUS_13640 7022 6660 CDS product peptide chain release factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545585.1 protein_id gnl|my_center|LOCUS_13640 7903 7133 gene locus_tag LOCUS_13650 gene yngF 7903 7133 CDS product putative enoyl-CoA hydratase/isomerase YngF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34893 protein_id gnl|my_center|LOCUS_13650 <8931 7956 gene locus_tag LOCUS_13660 <8931 7956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902654.1:glutaconyl-CoA decarboxylase subunit alpha >Feature sequence102 696 3902 gene locus_tag LOCUS_13670 696 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 5200 4070 gene locus_tag LOCUS_13680 5200 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 6088 5204 gene locus_tag LOCUS_13690 6088 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 7923 6085 gene locus_tag LOCUS_13700 7923 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence103 923 306 gene locus_tag LOCUS_13710 923 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2381 1101 gene locus_tag LOCUS_13720 gene kdtA 2381 1101 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948046.1 protein_id gnl|my_center|LOCUS_13720 2390 4201 gene locus_tag LOCUS_13730 2390 4201 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_13730 4373 4540 gene locus_tag LOCUS_13740 4373 4540 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIG0 protein_id gnl|my_center|LOCUS_13740 4544 5092 gene locus_tag LOCUS_13750 4544 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865421.1 protein_id gnl|my_center|LOCUS_13750 5085 5966 gene locus_tag LOCUS_13760 5085 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_13760 5994 6254 gene locus_tag LOCUS_13770 5994 6254 CDS product UPF0296 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X216 protein_id gnl|my_center|LOCUS_13770 6259 6828 gene locus_tag LOCUS_13780 gene gmk 6259 6828 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F775 protein_id gnl|my_center|LOCUS_13780 6825 7580 gene locus_tag LOCUS_13790 gene rlmB 6825 7580 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_13790 7816 8628 gene locus_tag LOCUS_13800 7816 8628 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence104 411 2540 gene locus_tag LOCUS_13810 gene qrcB 411 2540 CDS product menaquinone reductase, molybdopterin-binding-like subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E84 protein_id gnl|my_center|LOCUS_13810 2586 3452 gene locus_tag LOCUS_13820 gene qrcC 2586 3452 CDS product menaquinone reductase, iron-sulfur cluster-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E85 protein_id gnl|my_center|LOCUS_13820 3486 4742 gene locus_tag LOCUS_13830 gene qrcD 3486 4742 CDS product menaquinone reductase, integral membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E86 protein_id gnl|my_center|LOCUS_13830 4769 4927 gene locus_tag LOCUS_13840 4769 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 5214 7424 gene locus_tag LOCUS_13850 gene recD2 5214 7424 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN4 protein_id gnl|my_center|LOCUS_13850 7790 7500 gene locus_tag LOCUS_13860 7790 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 8756 7821 gene locus_tag LOCUS_13870 8756 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence105 871 221 gene locus_tag LOCUS_13880 871 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1362 2108 gene locus_tag LOCUS_13890 1362 2108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 protein_id gnl|my_center|LOCUS_13890 2095 2832 gene locus_tag LOCUS_13900 gene tauC 2095 2832 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263203.1 protein_id gnl|my_center|LOCUS_13900 2846 3787 gene locus_tag LOCUS_13910 2846 3787 CDS product thiamine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263204.1 protein_id gnl|my_center|LOCUS_13910 3799 4596 gene locus_tag LOCUS_13920 gene thiM 3799 4596 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JW7 protein_id gnl|my_center|LOCUS_13920 4605 5258 gene locus_tag LOCUS_13930 gene thiE 4605 5258 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0Q4 protein_id gnl|my_center|LOCUS_13930 5255 6064 gene locus_tag LOCUS_13940 gene thiD 5255 6064 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_13940 6835 6083 gene locus_tag LOCUS_13950 6835 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 7808 7044 gene locus_tag LOCUS_13960 7808 7044 CDS product putative response regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87K77 protein_id gnl|my_center|LOCUS_13960 <8731 7805 gene locus_tag LOCUS_13970 <8731 7805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263562.1:ATPase >Feature sequence106 1592 615 gene locus_tag LOCUS_13980 1592 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3268 1895 gene locus_tag LOCUS_13990 gene glcD 3268 1895 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94535 protein_id gnl|my_center|LOCUS_13990 3785 4171 gene locus_tag LOCUS_14000 3785 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919972.1 protein_id gnl|my_center|LOCUS_14000 5622 4285 gene locus_tag LOCUS_14010 5622 4285 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939741.1 transl_except (pos:complement(4873..4875),aa:Sec) note codon on position 250 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_14010 5959 6603 gene locus_tag LOCUS_14020 5959 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939849.1 protein_id gnl|my_center|LOCUS_14020 6614 7336 gene locus_tag LOCUS_14030 6614 7336 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_14030 8493 7381 gene locus_tag LOCUS_14040 8493 7381 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence107 951 1115 gene locus_tag LOCUS_14050 951 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1090 3183 gene locus_tag LOCUS_14060 1090 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3930 3634 gene locus_tag LOCUS_14070 3930 3634 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781370.1 protein_id gnl|my_center|LOCUS_14070 4220 3942 gene locus_tag LOCUS_14080 4220 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605675.1 protein_id gnl|my_center|LOCUS_14080 4684 4944 gene locus_tag LOCUS_14090 4684 4944 CDS product antitoxin ChpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_313229.1 protein_id gnl|my_center|LOCUS_14090 4944 5297 gene locus_tag LOCUS_14100 4944 5297 CDS product mRNA-degrading endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_14100 6091 5465 gene locus_tag LOCUS_14110 gene upp 6091 5465 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DA4 protein_id gnl|my_center|LOCUS_14110 >Feature sequence108 602 57 gene locus_tag LOCUS_14120 602 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1161 676 gene locus_tag LOCUS_14130 1161 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1580 2710 gene locus_tag LOCUS_14140 1580 2710 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460725.1 protein_id gnl|my_center|LOCUS_14140 2868 3854 gene locus_tag LOCUS_14150 2868 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3923 4141 gene locus_tag LOCUS_14160 3923 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 4146 4967 gene locus_tag LOCUS_14170 4146 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 4964 5872 gene locus_tag LOCUS_14180 4964 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 7607 8032 gene locus_tag LOCUS_14190 7607 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 8055 8465 gene locus_tag LOCUS_14200 8055 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence109 408 31 gene locus_tag LOCUS_14210 408 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 642 1217 gene locus_tag LOCUS_14220 642 1217 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_14220 1402 1728 gene locus_tag LOCUS_14230 gene trxA 1402 1728 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UU9 protein_id gnl|my_center|LOCUS_14230 1740 2660 gene locus_tag LOCUS_14240 1740 2660 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFT7 protein_id gnl|my_center|LOCUS_14240 2660 3313 gene locus_tag LOCUS_14250 gene yfiO 2660 3313 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FV2 protein_id gnl|my_center|LOCUS_14250 3399 3593 gene locus_tag LOCUS_14260 gene rpmB1 3399 3593 CDS product 50S ribosomal protein L28-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBR5 protein_id gnl|my_center|LOCUS_14260 5936 3774 gene locus_tag LOCUS_14270 gene relA 5936 3774 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_14270 7457 5946 gene locus_tag LOCUS_14280 gene proS 7457 5946 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ7 protein_id gnl|my_center|LOCUS_14280 8535 7441 gene locus_tag LOCUS_14290 gene ispG 8535 7441 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185R7 protein_id gnl|my_center|LOCUS_14290 >Feature sequence110 1918 2826 gene locus_tag LOCUS_14300 1918 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 3378 2875 gene locus_tag LOCUS_14310 3378 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 3961 4806 gene locus_tag LOCUS_14320 3961 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172618.1 protein_id gnl|my_center|LOCUS_14320 5484 4993 gene locus_tag LOCUS_14330 5484 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 6560 5739 gene locus_tag LOCUS_14340 6560 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724181.1 protein_id gnl|my_center|LOCUS_14340 7940 6666 gene locus_tag LOCUS_14350 gene glyA 7940 6666 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E008 protein_id gnl|my_center|LOCUS_14350 >Feature sequence111 74 1645 gene locus_tag LOCUS_14360 74 1645 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341224.1 protein_id gnl|my_center|LOCUS_14360 1763 2746 gene locus_tag LOCUS_14370 1763 2746 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256717.1 protein_id gnl|my_center|LOCUS_14370 3270 2875 gene locus_tag LOCUS_14380 3270 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 4564 3257 gene locus_tag LOCUS_14390 4564 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14390 5056 5205 gene locus_tag LOCUS_14400 5056 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 5443 7089 gene locus_tag LOCUS_14410 5443 7089 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence112 <1 745 gene locus_tag LOCUS_14420 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q52377:UvrABC system protein C 1917 757 gene locus_tag LOCUS_14430 1917 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2277 5420 gene locus_tag LOCUS_14440 2277 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 5822 7339 gene locus_tag LOCUS_14450 gene rpsA 5822 7339 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938762.1 protein_id gnl|my_center|LOCUS_14450 8236 7343 gene locus_tag LOCUS_14460 8236 7343 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence113 124 1584 gene locus_tag LOCUS_14470 gene mttB 124 1584 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 transl_except (pos:1105..1107,aa:Pyl) note codon on position 328 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_14470 1611 2891 gene locus_tag LOCUS_14480 1611 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3727 2858 gene locus_tag LOCUS_14490 3727 2858 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNZ7 protein_id gnl|my_center|LOCUS_14490 4959 3727 gene locus_tag LOCUS_14500 4959 3727 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_14500 6053 4959 gene locus_tag LOCUS_14510 6053 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 7136 6138 gene locus_tag LOCUS_14520 7136 6138 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_14520 7634 7152 gene locus_tag LOCUS_14530 7634 7152 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940852.1 protein_id gnl|my_center|LOCUS_14530 <8387 7857 gene locus_tag LOCUS_14540 <8387 7857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P96655:UPF0173 protein YddR >Feature sequence114 62 137 gene locus_tag LOCUS_t00230 62 137 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 271 765 gene locus_tag LOCUS_14550 gene rimP 271 765 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y4 protein_id gnl|my_center|LOCUS_14550 784 2226 gene locus_tag LOCUS_14560 784 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2300 5203 gene locus_tag LOCUS_14570 2300 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 5215 5583 gene locus_tag LOCUS_14580 gene rbfA 5215 5583 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBC3 protein_id gnl|my_center|LOCUS_14580 5594 6499 gene locus_tag LOCUS_14590 gene truB 5594 6499 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZW0 protein_id gnl|my_center|LOCUS_14590 6661 6930 gene locus_tag LOCUS_14600 gene rpsO 6661 6930 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT0 protein_id gnl|my_center|LOCUS_14600 >Feature sequence115 897 58 gene locus_tag LOCUS_14610 gene purQ 897 58 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942280.1 protein_id gnl|my_center|LOCUS_14610 3914 894 gene locus_tag LOCUS_14620 gene purSL 3914 894 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN9 protein_id gnl|my_center|LOCUS_14620 4974 3904 gene locus_tag LOCUS_14630 4974 3904 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI08 protein_id gnl|my_center|LOCUS_14630 6135 4987 gene locus_tag LOCUS_14640 gene dxr 6135 4987 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW4 protein_id gnl|my_center|LOCUS_14640 6866 6132 gene locus_tag LOCUS_14650 6866 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 7684 6923 gene locus_tag LOCUS_14660 gene uppS 7684 6923 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_14660 8231 7674 gene locus_tag LOCUS_14670 gene frr 8231 7674 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DQ9 protein_id gnl|my_center|LOCUS_14670 >Feature sequence116 1247 138 gene locus_tag LOCUS_14680 gene mscS-1 1247 138 CDS product small-conductance mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942278.1 protein_id gnl|my_center|LOCUS_14680 2077 1271 gene locus_tag LOCUS_14690 2077 1271 CDS product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392721.1 protein_id gnl|my_center|LOCUS_14690 3301 2378 gene locus_tag LOCUS_14700 3301 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 4650 3691 gene locus_tag LOCUS_14710 4650 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 5214 4678 gene locus_tag LOCUS_14720 5214 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 6430 5354 gene locus_tag LOCUS_14730 6430 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 6877 6605 gene locus_tag LOCUS_14740 6877 6605 CDS product metal resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970463.1 protein_id gnl|my_center|LOCUS_14740 7399 7247 gene locus_tag LOCUS_14750 7399 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 8052 7411 gene locus_tag LOCUS_14760 8052 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087175.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence117 <1 1570 gene locus_tag LOCUS_14770 <1 1570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q725N5:DNA topoisomerase 1 2144 1581 gene locus_tag LOCUS_14780 gene efp2 2144 1581 CDS product elongation factor P 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CC2 protein_id gnl|my_center|LOCUS_14780 2311 3840 gene locus_tag LOCUS_14790 gene guaA 2311 3840 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY9 protein_id gnl|my_center|LOCUS_14790 3864 4838 gene locus_tag LOCUS_14800 3864 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 4960 5124 gene locus_tag LOCUS_14810 4960 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 6237 5128 gene locus_tag LOCUS_14820 6237 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 6803 7660 gene locus_tag LOCUS_14830 gene rbgA 6803 7660 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE00 protein_id gnl|my_center|LOCUS_14830 >Feature sequence118 785 1270 gene locus_tag LOCUS_14840 785 1270 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454093.1 protein_id gnl|my_center|LOCUS_14840 1569 3203 gene locus_tag LOCUS_14850 1569 3203 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545924.1 protein_id gnl|my_center|LOCUS_14850 3364 3101 gene locus_tag LOCUS_14860 3364 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4563 3322 gene locus_tag LOCUS_14870 gene deaD-2 4563 3322 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_14870 4825 5232 gene locus_tag LOCUS_14880 4825 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 5219 5827 gene locus_tag LOCUS_14890 gene ABC-NBD 5219 5827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565531.1 protein_id gnl|my_center|LOCUS_14890 5832 6626 gene locus_tag LOCUS_14900 gene ybbM 5832 6626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263654.1 protein_id gnl|my_center|LOCUS_14900 7044 8003 gene locus_tag LOCUS_14910 7044 8003 CDS product cobalt chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932081.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence119 145 960 gene locus_tag LOCUS_14920 gene trpA 145 960 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0D4 protein_id gnl|my_center|LOCUS_14920 1053 2465 gene locus_tag LOCUS_14930 1053 2465 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482730.1 protein_id gnl|my_center|LOCUS_14930 3344 2514 gene locus_tag LOCUS_14940 3344 2514 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256670.1 protein_id gnl|my_center|LOCUS_14940 4355 3423 gene locus_tag LOCUS_14950 4355 3423 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_14950 4712 4506 gene locus_tag LOCUS_14960 4712 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 5264 5452 gene locus_tag LOCUS_14970 5264 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5442 5687 gene locus_tag LOCUS_14980 5442 5687 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_14980 7008 6622 gene locus_tag LOCUS_14990 7008 6622 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759699.1 protein_id gnl|my_center|LOCUS_14990 7303 7001 gene locus_tag LOCUS_15000 7303 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870896.1 protein_id gnl|my_center|LOCUS_15000 7429 7650 gene locus_tag LOCUS_15010 7429 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence120 160 828 gene locus_tag LOCUS_15020 160 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021925.1 protein_id gnl|my_center|LOCUS_15020 825 2678 gene locus_tag LOCUS_15030 825 2678 CDS product type I-B CRISPR-associated protein Cas8b/Csh1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582997.1 protein_id gnl|my_center|LOCUS_15030 2682 3674 gene locus_tag LOCUS_15040 2682 3674 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_15040 3674 4384 gene locus_tag LOCUS_15050 3674 4384 CDS product type I-B CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582995.1 protein_id gnl|my_center|LOCUS_15050 4371 6770 gene locus_tag LOCUS_15060 4371 6770 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_15060 6822 7376 gene locus_tag LOCUS_15070 6822 7376 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879370.1 protein_id gnl|my_center|LOCUS_15070 7535 8157 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctgaattccatatccagaaaaacaaggattgaaac >Feature sequence121 57 641 gene locus_tag LOCUS_15080 57 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 805 1680 gene locus_tag LOCUS_15090 805 1680 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932324.1 protein_id gnl|my_center|LOCUS_15090 1689 2180 gene locus_tag LOCUS_15100 gene ruvC 1689 2180 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US71 protein_id gnl|my_center|LOCUS_15100 2177 2800 gene locus_tag LOCUS_15110 gene ruvA 2177 2800 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B875 protein_id gnl|my_center|LOCUS_15110 2804 3829 gene locus_tag LOCUS_15120 gene ruvB 2804 3829 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183N8 protein_id gnl|my_center|LOCUS_15120 3970 5208 gene locus_tag LOCUS_15130 3970 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 5172 6098 gene locus_tag LOCUS_15140 5172 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 6104 7591 gene locus_tag LOCUS_15150 6104 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 7624 8025 gene locus_tag LOCUS_15160 7624 8025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence122 221 787 gene locus_tag LOCUS_15170 gene yjqB 221 787 CDS product UPF0714 protein YjqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34785 protein_id gnl|my_center|LOCUS_15170 866 1801 gene locus_tag LOCUS_15180 866 1801 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_15180 2878 1832 gene locus_tag LOCUS_15190 gene yibQ 2878 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942413.1 protein_id gnl|my_center|LOCUS_15190 4202 2868 gene locus_tag LOCUS_15200 gene ctpA-2 4202 2868 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_15200 5356 4205 gene locus_tag LOCUS_15210 5356 4205 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_15210 6198 5323 gene locus_tag LOCUS_15220 gene ftsX 6198 5323 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CA0 protein_id gnl|my_center|LOCUS_15220 6886 6218 gene locus_tag LOCUS_15230 gene ftsE 6886 6218 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361935.1 protein_id gnl|my_center|LOCUS_15230 7120 7905 gene locus_tag LOCUS_15240 7120 7905 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815002.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence123 1850 615 gene locus_tag LOCUS_15250 1850 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1941 2432 gene locus_tag LOCUS_15260 1941 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2475 3863 gene locus_tag LOCUS_15270 2475 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 3863 4522 gene locus_tag LOCUS_15280 3863 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 4576 5004 gene locus_tag LOCUS_15290 4576 5004 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_15290 5133 6605 gene locus_tag LOCUS_15300 5133 6605 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546144.1 protein_id gnl|my_center|LOCUS_15300 6629 7192 gene locus_tag LOCUS_15310 6629 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 7787 7287 gene locus_tag LOCUS_15320 7787 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence124 348 1001 gene locus_tag LOCUS_15330 348 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 998 1411 gene locus_tag LOCUS_15340 998 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1413 1964 gene locus_tag LOCUS_15350 1413 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2002 5199 gene locus_tag LOCUS_15360 2002 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 5212 5505 gene locus_tag LOCUS_15370 5212 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 5728 6054 gene locus_tag LOCUS_15380 5728 6054 CDS product bacteriophage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205297.1 protein_id gnl|my_center|LOCUS_15380 6047 6340 gene locus_tag LOCUS_15390 6047 6340 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272449.1 protein_id gnl|my_center|LOCUS_15390 7220 7693 gene locus_tag LOCUS_15400 7220 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence125 1830 604 gene locus_tag LOCUS_15410 1830 604 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_15410 2957 1845 gene locus_tag LOCUS_15420 gene fldC 2957 1845 CDS product R-phenyllactate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255773.1 protein_id gnl|my_center|LOCUS_15420 3279 3893 gene locus_tag LOCUS_15430 3279 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 4070 6025 gene locus_tag LOCUS_15440 4070 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 7428 6136 gene locus_tag LOCUS_15450 7428 6136 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438661.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence126 1653 244 gene locus_tag LOCUS_15460 1653 244 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_15460 3307 1778 gene locus_tag LOCUS_15470 gene lcfB 3307 1778 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07610 protein_id gnl|my_center|LOCUS_15470 3677 3411 gene locus_tag LOCUS_15480 3677 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3872 4489 gene locus_tag LOCUS_15490 gene pmtA 3872 4489 CDS product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_15490 5971 4571 gene locus_tag LOCUS_15500 5971 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 6968 6195 gene locus_tag LOCUS_15510 gene glpR 6968 6195 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035615.1 protein_id gnl|my_center|LOCUS_15510 <7811 7065 gene locus_tag LOCUS_15520 <7811 7065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJ21:glycerol kinase >Feature sequence127 3025 218 gene locus_tag LOCUS_15530 3025 218 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_15530 4780 3026 gene locus_tag LOCUS_15540 4780 3026 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582944.1 protein_id gnl|my_center|LOCUS_15540 5415 4777 gene locus_tag LOCUS_15550 5415 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence128 859 137 gene locus_tag LOCUS_15560 859 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_15560 1708 872 gene locus_tag LOCUS_15570 1708 872 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97JI0 protein_id gnl|my_center|LOCUS_15570 1919 1843 gene locus_tag LOCUS_t00240 1919 1843 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3885 1990 gene locus_tag LOCUS_15580 gene rpoD 3885 1990 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B8 protein_id gnl|my_center|LOCUS_15580 5682 3910 gene locus_tag LOCUS_15590 gene dnaG 5682 3910 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B7 protein_id gnl|my_center|LOCUS_15590 6436 5777 gene locus_tag LOCUS_15600 gene hisA 6436 5777 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60581 protein_id gnl|my_center|LOCUS_15600 7139 6552 gene locus_tag LOCUS_15610 gene hisB 7139 6552 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60885 protein_id gnl|my_center|LOCUS_15610 >Feature sequence129 <1 675 gene locus_tag LOCUS_15620 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090652.1:fatty-acid--CoA ligase 2029 800 gene locus_tag LOCUS_15630 2029 800 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942830.1 protein_id gnl|my_center|LOCUS_15630 3780 2014 gene locus_tag LOCUS_15640 3780 2014 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942831.1 protein_id gnl|my_center|LOCUS_15640 4074 5288 gene locus_tag LOCUS_15650 4074 5288 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941532.1 protein_id gnl|my_center|LOCUS_15650 5700 5482 gene locus_tag LOCUS_15660 5700 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 6916 5723 gene locus_tag LOCUS_15670 6916 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942086.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence130 1164 373 gene locus_tag LOCUS_15680 1164 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1907 1161 gene locus_tag LOCUS_15690 1907 1161 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939814.1 protein_id gnl|my_center|LOCUS_15690 2713 1979 gene locus_tag LOCUS_15700 2713 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 4434 2791 gene locus_tag LOCUS_15710 gene hcp 4434 2791 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31101 protein_id gnl|my_center|LOCUS_15710 4581 5288 gene locus_tag LOCUS_15720 gene fnr-1 4581 5288 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944031.1 protein_id gnl|my_center|LOCUS_15720 5503 7230 gene locus_tag LOCUS_15730 gene aor 5503 7230 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938476.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence131 659 240 gene locus_tag LOCUS_15740 gene ndk 659 240 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGI5 protein_id gnl|my_center|LOCUS_15740 790 1404 gene locus_tag LOCUS_15750 gene coaE 790 1404 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCU7 protein_id gnl|my_center|LOCUS_15750 1556 2803 gene locus_tag LOCUS_15760 gene rho 1556 2803 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748A7 protein_id gnl|my_center|LOCUS_15760 2859 3077 gene locus_tag LOCUS_15770 gene rpmE 2859 3077 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73MK4 protein_id gnl|my_center|LOCUS_15770 3188 4252 gene locus_tag LOCUS_15780 gene prfA 3188 4252 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B1 protein_id gnl|my_center|LOCUS_15780 4259 5131 gene locus_tag LOCUS_15790 gene prmC 4259 5131 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B2 protein_id gnl|my_center|LOCUS_15790 5285 6151 gene locus_tag LOCUS_15800 gene rpsB 5285 6151 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW1 protein_id gnl|my_center|LOCUS_15800 6157 6753 gene locus_tag LOCUS_15810 gene tsf 6157 6753 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_15810 6758 7480 gene locus_tag LOCUS_15820 gene pyrH 6758 7480 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGE1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence132 310 1950 gene locus_tag LOCUS_15830 310 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940448.1 protein_id gnl|my_center|LOCUS_15830 2093 3145 gene locus_tag LOCUS_15840 2093 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 3281 4477 gene locus_tag LOCUS_15850 3281 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 5192 4530 gene locus_tag LOCUS_15860 5192 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 6633 5206 gene locus_tag LOCUS_15870 gene gatB 6633 5206 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL60 protein_id gnl|my_center|LOCUS_15870 7128 7319 gene locus_tag LOCUS_15880 7128 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence133 25 1620 gene locus_tag LOCUS_15890 25 1620 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974597.1 protein_id gnl|my_center|LOCUS_15890 1835 2497 gene locus_tag LOCUS_15900 1835 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002345695.1 protein_id gnl|my_center|LOCUS_15900 2648 2893 gene locus_tag LOCUS_15910 2648 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2922 3281 gene locus_tag LOCUS_15920 2922 3281 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_15920 3509 4099 gene locus_tag LOCUS_15930 gene gmhA 3509 4099 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPY2 protein_id gnl|my_center|LOCUS_15930 4857 6260 gene locus_tag LOCUS_15940 4857 6260 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729117.1 protein_id gnl|my_center|LOCUS_15940 6862 6623 gene locus_tag LOCUS_15950 6862 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence134 1115 27 gene locus_tag LOCUS_15960 1115 27 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986423.1 protein_id gnl|my_center|LOCUS_15960 1534 3606 gene locus_tag LOCUS_15970 1534 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 3606 4772 gene locus_tag LOCUS_15980 3606 4772 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_15980 4797 5516 gene locus_tag LOCUS_15990 4797 5516 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944007.1 protein_id gnl|my_center|LOCUS_15990 5942 7018 gene locus_tag LOCUS_16000 5942 7018 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence135 2 241 gene locus_tag LOCUS_16010 2 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 839 450 gene locus_tag LOCUS_16020 839 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2802 898 gene locus_tag LOCUS_16030 2802 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2967 3839 gene locus_tag LOCUS_16040 2967 3839 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_16040 4071 5108 gene locus_tag LOCUS_16050 4071 5108 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478363.1 protein_id gnl|my_center|LOCUS_16050 6570 5161 gene locus_tag LOCUS_16060 6570 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 7268 6567 gene locus_tag LOCUS_16070 gene ompR 7268 6567 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199523.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence136 <1 638 gene locus_tag LOCUS_16080 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937570.1:universal stress protein 698 1126 gene locus_tag LOCUS_16090 698 1126 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937569.1 protein_id gnl|my_center|LOCUS_16090 1160 2626 gene locus_tag LOCUS_16100 1160 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2816 3406 gene locus_tag LOCUS_16110 2816 3406 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861642.1 protein_id gnl|my_center|LOCUS_16110 5353 3395 gene locus_tag LOCUS_16120 5353 3395 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868773.1 protein_id gnl|my_center|LOCUS_16120 5534 6442 gene locus_tag LOCUS_16130 5534 6442 CDS product PHP-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_16130 6439 6891 gene locus_tag LOCUS_16140 6439 6891 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence137 219 653 gene locus_tag LOCUS_16150 219 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 672 1871 gene locus_tag LOCUS_16160 672 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2187 3215 gene locus_tag LOCUS_16170 2187 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 4442 3300 gene locus_tag LOCUS_16180 4442 3300 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 protein_id gnl|my_center|LOCUS_16180 4805 6694 gene locus_tag LOCUS_16190 4805 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence138 2742 3521 gene locus_tag LOCUS_16200 2742 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 3622 4095 gene locus_tag LOCUS_16210 3622 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 5777 4914 gene locus_tag LOCUS_16220 5777 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 6655 5873 gene locus_tag LOCUS_16230 6655 5873 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096479.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence139 1429 113 gene locus_tag LOCUS_16240 1429 113 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090914.1 protein_id gnl|my_center|LOCUS_16240 2225 2737 gene locus_tag LOCUS_16250 2225 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2751 3743 gene locus_tag LOCUS_16260 2751 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 4406 3918 gene locus_tag LOCUS_16270 4406 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4890 4570 gene locus_tag LOCUS_16280 4890 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 5408 5193 gene locus_tag LOCUS_16290 5408 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence140 440 1567 gene locus_tag LOCUS_16300 440 1567 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_16300 1845 5363 gene locus_tag LOCUS_16310 gene poR 1845 5363 CDS product pyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726T1 protein_id gnl|my_center|LOCUS_16310 5689 6945 gene locus_tag LOCUS_16320 5689 6945 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940649.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence141 777 2150 gene locus_tag LOCUS_16330 gene trpB-2 777 2150 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFX8 protein_id gnl|my_center|LOCUS_16330 2228 2536 gene locus_tag LOCUS_16340 2228 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2533 3261 gene locus_tag LOCUS_16350 2533 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 protein_id gnl|my_center|LOCUS_16350 3272 4519 gene locus_tag LOCUS_16360 3272 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 4698 5645 gene locus_tag LOCUS_16370 4698 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 5708 7081 gene locus_tag LOCUS_16380 gene trpB-2 5708 7081 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFX8 protein_id gnl|my_center|LOCUS_16380 >Feature sequence142 2665 1094 gene locus_tag LOCUS_16390 2665 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3843 3169 gene locus_tag LOCUS_16400 3843 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4210 4058 gene locus_tag LOCUS_16410 4210 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 4550 4368 gene locus_tag LOCUS_16420 4550 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 5036 4626 gene locus_tag LOCUS_16430 5036 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 5146 6333 gene locus_tag LOCUS_16440 5146 6333 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_16440 <7190 6369 gene locus_tag LOCUS_16450 <7190 6369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479332.1:acriflavine resistance protein B >Feature sequence143 97 339 gene locus_tag LOCUS_16460 97 339 CDS product putative HTH-type transcriptional regulator y4mF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55565 protein_id gnl|my_center|LOCUS_16460 342 1601 gene locus_tag LOCUS_16470 342 1601 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639983.1 protein_id gnl|my_center|LOCUS_16470 1712 1930 gene locus_tag LOCUS_16480 1712 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1923 2174 gene locus_tag LOCUS_16490 1923 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2345 3247 gene locus_tag LOCUS_16500 2345 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 3252 3401 gene locus_tag LOCUS_16510 3252 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 3666 4400 gene locus_tag LOCUS_16520 3666 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144320.1 protein_id gnl|my_center|LOCUS_16520 4495 5322 gene locus_tag LOCUS_16530 4495 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_16530 5571 6746 gene locus_tag LOCUS_16540 5571 6746 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_16540 6927 7169 gene locus_tag LOCUS_16550 6927 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence144 938 1312 gene locus_tag LOCUS_16560 gene hisI 938 1312 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62386 protein_id gnl|my_center|LOCUS_16560 1312 2187 gene locus_tag LOCUS_16570 gene hisG 1312 2187 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62364 protein_id gnl|my_center|LOCUS_16570 2188 3345 gene locus_tag LOCUS_16580 2188 3345 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E6 protein_id gnl|my_center|LOCUS_16580 3342 3935 gene locus_tag LOCUS_16590 gene engB 3342 3935 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748I9 protein_id gnl|my_center|LOCUS_16590 3928 4824 gene locus_tag LOCUS_16600 gene era 3928 4824 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX3 protein_id gnl|my_center|LOCUS_16600 5972 5175 gene locus_tag LOCUS_16610 5972 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 6298 6702 gene locus_tag LOCUS_16620 6298 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence145 118 1050 gene locus_tag LOCUS_16630 118 1050 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ84 protein_id gnl|my_center|LOCUS_16630 1160 1465 gene locus_tag LOCUS_16640 1160 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1837 2097 gene locus_tag LOCUS_16650 1837 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2090 5632 gene locus_tag LOCUS_16660 2090 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 5636 7081 gene locus_tag LOCUS_16670 5636 7081 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence146 819 1397 gene locus_tag LOCUS_16680 819 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1407 1991 gene locus_tag LOCUS_16690 1407 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1988 2551 gene locus_tag LOCUS_16700 1988 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 2538 3257 gene locus_tag LOCUS_16710 2538 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 3244 4068 gene locus_tag LOCUS_16720 3244 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 4093 5358 gene locus_tag LOCUS_16730 4093 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 5611 6801 gene locus_tag LOCUS_16740 5611 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence147 272 913 gene locus_tag LOCUS_16750 272 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 894 3329 gene locus_tag LOCUS_16760 894 3329 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_16760 3360 4169 gene locus_tag LOCUS_16770 3360 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_16770 4265 5746 gene locus_tag LOCUS_16780 4265 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 6099 6389 gene locus_tag LOCUS_16790 6099 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 6382 6969 gene locus_tag LOCUS_16800 6382 6969 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Z9 protein_id gnl|my_center|LOCUS_16800 >Feature sequence148 947 102 gene locus_tag LOCUS_16810 947 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1819 1163 gene locus_tag LOCUS_16820 1819 1163 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_16820 4475 1872 gene locus_tag LOCUS_16830 4475 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 4885 4490 gene locus_tag LOCUS_16840 4885 4490 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867372.1 protein_id gnl|my_center|LOCUS_16840 5470 7026 gene locus_tag LOCUS_16850 5470 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence149 745 275 gene locus_tag LOCUS_16860 745 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082056.1 protein_id gnl|my_center|LOCUS_16860 1438 905 gene locus_tag LOCUS_16870 1438 905 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208430.1 protein_id gnl|my_center|LOCUS_16870 4450 1847 gene locus_tag LOCUS_16880 gene hrpB 4450 1847 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_16880 5301 4432 gene locus_tag LOCUS_16890 gene ilvY 5301 4432 CDS product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_16890 5522 6991 gene locus_tag LOCUS_16900 gene ilvC 5522 6991 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN4 protein_id gnl|my_center|LOCUS_16900 >Feature sequence150 1819 1634 gene locus_tag LOCUS_16910 1819 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2083 1823 gene locus_tag LOCUS_16920 2083 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2836 2144 gene locus_tag LOCUS_16930 2836 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 3157 3819 gene locus_tag LOCUS_16940 3157 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_16940 4900 3833 gene locus_tag LOCUS_16950 4900 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814543.1 protein_id gnl|my_center|LOCUS_16950 5849 5034 gene locus_tag LOCUS_16960 5849 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 <7102 5908 gene locus_tag LOCUS_16970 <7102 5908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083710.1:acyl CoA:acetate/3-ketoacid CoA transferase >Feature sequence151 924 526 gene locus_tag LOCUS_16980 gene rpsH 924 526 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A1 protein_id gnl|my_center|LOCUS_16980 1107 925 gene locus_tag LOCUS_16990 1107 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1721 1182 gene locus_tag LOCUS_17000 gene rplE 1721 1182 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z9 protein_id gnl|my_center|LOCUS_17000 2072 1743 gene locus_tag LOCUS_17010 gene rplX 2072 1743 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG9 protein_id gnl|my_center|LOCUS_17010 2468 2100 gene locus_tag LOCUS_17020 gene rplN 2468 2100 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z8 protein_id gnl|my_center|LOCUS_17020 2745 2485 gene locus_tag LOCUS_17030 2745 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2960 2763 gene locus_tag LOCUS_17040 gene rpmC 2960 2763 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0D2 protein_id gnl|my_center|LOCUS_17040 3373 2963 gene locus_tag LOCUS_17050 gene rplP 3373 2963 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z5 protein_id gnl|my_center|LOCUS_17050 4061 3411 gene locus_tag LOCUS_17060 gene rpsC 4061 3411 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z4 protein_id gnl|my_center|LOCUS_17060 4412 4074 gene locus_tag LOCUS_17070 4412 4074 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_17070 4715 4440 gene locus_tag LOCUS_17080 gene rpsS 4715 4440 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH6 protein_id gnl|my_center|LOCUS_17080 5573 4740 gene locus_tag LOCUS_17090 gene rplB 5573 4740 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60401 protein_id gnl|my_center|LOCUS_17090 5874 5587 gene locus_tag LOCUS_17100 gene rplW 5874 5587 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5X3 protein_id gnl|my_center|LOCUS_17100 6496 5876 gene locus_tag LOCUS_17110 gene rplD 6496 5876 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61063 protein_id gnl|my_center|LOCUS_17110 >Feature sequence152 923 144 gene locus_tag LOCUS_17120 923 144 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083898.1 protein_id gnl|my_center|LOCUS_17120 1427 936 gene locus_tag LOCUS_17130 1427 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2265 1432 gene locus_tag LOCUS_17140 2265 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3930 2278 gene locus_tag LOCUS_17150 3930 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008530230.1 protein_id gnl|my_center|LOCUS_17150 6580 3935 gene locus_tag LOCUS_17160 6580 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 6785 7051 gene locus_tag LOCUS_17170 6785 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence153 <1 1267 gene locus_tag LOCUS_17180 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836506.1:LuxR family transcriptional regulator 2255 1380 gene locus_tag LOCUS_17190 2255 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 3030 2317 gene locus_tag LOCUS_17200 3030 2317 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939751.1 protein_id gnl|my_center|LOCUS_17200 6136 3047 gene locus_tag LOCUS_17210 gene fdhA 6136 3047 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q934F5 transl_except (pos:complement(5561..5563),aa:Sec) note codon on position 192 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_17210 >Feature sequence154 249 899 gene locus_tag LOCUS_17220 249 899 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_17220 1023 2168 gene locus_tag LOCUS_17230 1023 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 4053 2266 gene locus_tag LOCUS_17240 gene aspS 4053 2266 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D56 protein_id gnl|my_center|LOCUS_17240 5328 4072 gene locus_tag LOCUS_17250 gene hisS 5328 4072 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60915 protein_id gnl|my_center|LOCUS_17250 6730 5435 gene locus_tag LOCUS_17260 gene hisD 6730 5435 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I241 protein_id gnl|my_center|LOCUS_17260 >Feature sequence155 1179 19 gene locus_tag LOCUS_17270 1179 19 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986530.1 protein_id gnl|my_center|LOCUS_17270 2298 1378 gene locus_tag LOCUS_17280 2298 1378 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146242.1 protein_id gnl|my_center|LOCUS_17280 3621 2326 gene locus_tag LOCUS_17290 3621 2326 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947065.1 protein_id gnl|my_center|LOCUS_17290 4158 4012 gene locus_tag LOCUS_17300 4158 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 5102 4356 gene locus_tag LOCUS_17310 5102 4356 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_17310 6304 5750 gene locus_tag LOCUS_17320 6304 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence156 728 288 gene locus_tag LOCUS_17330 gene rpiB 728 288 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_17330 976 743 gene locus_tag LOCUS_17340 gene acpP 976 743 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CS8 protein_id gnl|my_center|LOCUS_17340 1183 998 gene locus_tag LOCUS_17350 gene rpmF 1183 998 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS3 protein_id gnl|my_center|LOCUS_17350 1364 2767 gene locus_tag LOCUS_17360 gene gltX 1364 2767 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DU6 protein_id gnl|my_center|LOCUS_17360 3606 2752 gene locus_tag LOCUS_17370 3606 2752 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2D9 protein_id gnl|my_center|LOCUS_17370 4289 3621 gene locus_tag LOCUS_17380 gene hypB 4289 3621 CDS product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_17380 4821 4474 gene locus_tag LOCUS_17390 4821 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 5908 4826 gene locus_tag LOCUS_17400 gene tgt-2 5908 4826 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X3 protein_id gnl|my_center|LOCUS_17400 6934 5960 gene locus_tag LOCUS_17410 gene queA 6934 5960 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X2 protein_id gnl|my_center|LOCUS_17410 >Feature sequence157 135 1514 gene locus_tag LOCUS_17420 gene asnS 135 1514 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72G53 protein_id gnl|my_center|LOCUS_17420 1547 2782 gene locus_tag LOCUS_17430 1547 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943907.1 protein_id gnl|my_center|LOCUS_17430 2887 4473 gene locus_tag LOCUS_17440 2887 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 5065 4487 gene locus_tag LOCUS_17450 5065 4487 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_17450 5341 6588 gene locus_tag LOCUS_17460 5341 6588 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989388.1 protein_id gnl|my_center|LOCUS_17460 6924 6589 gene locus_tag LOCUS_17470 6924 6589 CDS product mRNA interferase PemK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458809.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence158 76 924 gene locus_tag LOCUS_17480 76 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1000 1755 gene locus_tag LOCUS_17490 gene lasT 1000 1755 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBF1 protein_id gnl|my_center|LOCUS_17490 1739 2203 gene locus_tag LOCUS_17500 1739 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2634 2287 gene locus_tag LOCUS_17510 2634 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5269 2804 gene locus_tag LOCUS_17520 5269 2804 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533043.1 protein_id gnl|my_center|LOCUS_17520 6873 5407 gene locus_tag LOCUS_17530 gene mttB 6873 5407 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 transl_except (pos:complement(5890..5892),aa:Pyl) note codon on position 328 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_17530 >Feature sequence159 <1 1663 gene locus_tag LOCUS_17540 <1 1663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q746Q2:membrane protein insertase YidC 1676 2494 gene locus_tag LOCUS_17550 1676 2494 CDS product RNA-binding protein Jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387430.1 protein_id gnl|my_center|LOCUS_17550 2501 3889 gene locus_tag LOCUS_17560 gene mnmE 2501 3889 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I816 protein_id gnl|my_center|LOCUS_17560 3956 4606 gene locus_tag LOCUS_17570 3956 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940532.1 protein_id gnl|my_center|LOCUS_17570 4599 4952 gene locus_tag LOCUS_17580 4599 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 5552 5091 gene locus_tag LOCUS_17590 5552 5091 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_17590 5738 6361 gene locus_tag LOCUS_17600 5738 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 6736 6416 gene locus_tag LOCUS_17610 6736 6416 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938537.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence160 235 1719 gene locus_tag LOCUS_17620 235 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1721 2065 gene locus_tag LOCUS_17630 1721 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2077 3771 gene locus_tag LOCUS_17640 2077 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 3777 4889 gene locus_tag LOCUS_17650 3777 4889 CDS product secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_17650 5005 5517 gene locus_tag LOCUS_17660 5005 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 5540 6064 gene locus_tag LOCUS_17670 5540 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 6057 6464 gene locus_tag LOCUS_17680 6057 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence161 <1 1168 gene locus_tag LOCUS_17690 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545949.1:sensor histidine kinase 1182 2576 gene locus_tag LOCUS_17700 1182 2576 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938245.1 protein_id gnl|my_center|LOCUS_17700 2807 3010 gene locus_tag LOCUS_17710 2807 3010 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975209.1 protein_id gnl|my_center|LOCUS_17710 3928 3152 gene locus_tag LOCUS_17720 3928 3152 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 protein_id gnl|my_center|LOCUS_17720 4931 3930 gene locus_tag LOCUS_17730 4931 3930 CDS product glutaconate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902658.1 protein_id gnl|my_center|LOCUS_17730 6858 4912 gene locus_tag LOCUS_17740 6858 4912 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261721.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence162 2317 1046 gene locus_tag LOCUS_17750 2317 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 3074 2304 gene locus_tag LOCUS_17760 gene lgt 3074 2304 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1A4 protein_id gnl|my_center|LOCUS_17760 3579 3079 gene locus_tag LOCUS_17770 gene lspA 3579 3079 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Y0 protein_id gnl|my_center|LOCUS_17770 6429 3628 gene locus_tag LOCUS_17780 gene ileS 6429 3628 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747X9 protein_id gnl|my_center|LOCUS_17780 >Feature sequence163 964 5142 gene locus_tag LOCUS_17790 964 5142 CDS product phosphoenolpyruvate synthase/pyruvate phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545209.1 protein_id gnl|my_center|LOCUS_17790 5227 6420 gene locus_tag LOCUS_17800 5227 6420 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546756.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence164 638 1267 gene locus_tag LOCUS_17810 638 1267 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090671.1 protein_id gnl|my_center|LOCUS_17810 1886 1458 gene locus_tag LOCUS_17820 1886 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 2991 1972 gene locus_tag LOCUS_17830 2991 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3338 4159 gene locus_tag LOCUS_17840 gene pstS 3338 4159 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_17840 4362 6587 gene locus_tag LOCUS_17850 4362 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence165 819 1751 gene locus_tag LOCUS_17860 819 1751 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_17860 2988 2293 gene locus_tag LOCUS_17870 2988 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5099 3015 gene locus_tag LOCUS_17880 gene fusA 5099 3015 CDS product elongation factor G 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30913 protein_id gnl|my_center|LOCUS_17880 5397 5966 gene locus_tag LOCUS_17890 gene rsmG 5397 5966 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Q5 protein_id gnl|my_center|LOCUS_17890 6470 5946 gene locus_tag LOCUS_17900 6470 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence166 1540 1076 gene locus_tag LOCUS_17910 1540 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1838 2944 gene locus_tag LOCUS_17920 gene asd 1838 2944 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51344 protein_id gnl|my_center|LOCUS_17920 3832 2948 gene locus_tag LOCUS_17930 3832 2948 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937979.1 protein_id gnl|my_center|LOCUS_17930 4616 3822 gene locus_tag LOCUS_17940 4616 3822 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937978.1 protein_id gnl|my_center|LOCUS_17940 5424 4651 gene locus_tag LOCUS_17950 5424 4651 CDS product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479143.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence167 1093 188 gene locus_tag LOCUS_17960 1093 188 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684417.1 protein_id gnl|my_center|LOCUS_17960 1327 1980 gene locus_tag LOCUS_17970 1327 1980 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938963.1 protein_id gnl|my_center|LOCUS_17970 2071 2367 gene locus_tag LOCUS_17980 2071 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2664 4040 gene locus_tag LOCUS_17990 2664 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 4967 4101 gene locus_tag LOCUS_18000 4967 4101 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966631.1 protein_id gnl|my_center|LOCUS_18000 5417 5049 gene locus_tag LOCUS_18010 5417 5049 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence168 338 1447 gene locus_tag LOCUS_18020 338 1447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_18020 1448 2368 gene locus_tag LOCUS_18030 1448 2368 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_18030 2441 3937 gene locus_tag LOCUS_18040 2441 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938869.1 protein_id gnl|my_center|LOCUS_18040 6000 3976 gene locus_tag LOCUS_18050 gene fusA 6000 3976 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG50 protein_id gnl|my_center|LOCUS_18050 <6496 5997 gene locus_tag LOCUS_18060 <6496 5997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392053.1:germination protein >Feature sequence169 <1 782 gene locus_tag LOCUS_18070 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083706.1:branched-chain amino acid ABC transporter permease 796 1857 gene locus_tag LOCUS_18080 796 1857 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083705.1 protein_id gnl|my_center|LOCUS_18080 2707 1901 gene locus_tag LOCUS_18090 2707 1901 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022650.1 protein_id gnl|my_center|LOCUS_18090 4466 2721 gene locus_tag LOCUS_18100 4466 2721 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940093.1 protein_id gnl|my_center|LOCUS_18100 5413 4574 gene locus_tag LOCUS_18110 gene bdh 5413 4574 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227748.1 protein_id gnl|my_center|LOCUS_18110 5584 6219 gene locus_tag LOCUS_18120 5584 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence170 1373 72 gene locus_tag LOCUS_18130 1373 72 CDS product outer membrane efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545993.1 protein_id gnl|my_center|LOCUS_18130 1600 2487 gene locus_tag LOCUS_18140 gene purC 1600 2487 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF0 protein_id gnl|my_center|LOCUS_18140 2480 3454 gene locus_tag LOCUS_18150 2480 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 3451 4557 gene locus_tag LOCUS_18160 3451 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 4571 5458 gene locus_tag LOCUS_18170 4571 5458 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583958.1 protein_id gnl|my_center|LOCUS_18170 5605 6162 gene locus_tag LOCUS_18180 5605 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence171 2721 1456 gene locus_tag LOCUS_18190 2721 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3615 2767 gene locus_tag LOCUS_18200 gene panB 3615 2767 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM79 protein_id gnl|my_center|LOCUS_18200 4118 3651 gene locus_tag LOCUS_18210 4118 3651 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 protein_id gnl|my_center|LOCUS_18210 4445 5128 gene locus_tag LOCUS_18220 4445 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 5132 6382 gene locus_tag LOCUS_18230 5132 6382 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940464.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence172 337 3024 gene locus_tag LOCUS_18240 337 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3030 3407 gene locus_tag LOCUS_18250 3030 3407 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390954.1 protein_id gnl|my_center|LOCUS_18250 3410 5836 gene locus_tag LOCUS_18260 3410 5836 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933715.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence173 2147 264 gene locus_tag LOCUS_18270 2147 264 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545360.1 protein_id gnl|my_center|LOCUS_18270 4303 2171 gene locus_tag LOCUS_18280 4303 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 6311 4410 gene locus_tag LOCUS_18290 6311 4410 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence174 1741 173 gene locus_tag LOCUS_18300 1741 173 CDS product IS1182 family transposase ISMac1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020521.1 protein_id gnl|my_center|LOCUS_18300 2374 1898 gene locus_tag LOCUS_18310 2374 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2913 2416 gene locus_tag LOCUS_18320 2913 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 3981 2917 gene locus_tag LOCUS_18330 3981 2917 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256572.1 protein_id gnl|my_center|LOCUS_18330 5114 4557 gene locus_tag LOCUS_18340 5114 4557 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203194.1 protein_id gnl|my_center|LOCUS_18340 5595 5119 gene locus_tag LOCUS_18350 5595 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence175 881 141 gene locus_tag LOCUS_18360 gene fabG-2 881 141 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_18360 2986 1172 gene locus_tag LOCUS_18370 gene acd 2986 1172 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970940.1 protein_id gnl|my_center|LOCUS_18370 3313 3783 gene locus_tag LOCUS_18380 3313 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112945.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence176 <1 1370 gene locus_tag LOCUS_18390 <1 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257951.1:thiamine pyrophosphate protein central region 1559 2488 gene locus_tag LOCUS_18400 1559 2488 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_18400 2493 3299 gene locus_tag LOCUS_18410 2493 3299 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_18410 4235 3294 gene locus_tag LOCUS_18420 4235 3294 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_18420 4381 5451 gene locus_tag LOCUS_18430 gene ychF 4381 5451 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182Z7 protein_id gnl|my_center|LOCUS_18430 6181 5492 gene locus_tag LOCUS_18440 6181 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence177 85 405 gene locus_tag LOCUS_18450 85 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 464 1114 gene locus_tag LOCUS_18460 464 1114 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544975.1 protein_id gnl|my_center|LOCUS_18460 1167 1257 gene locus_tag LOCUS_t00250 1167 1257 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1287 3050 gene locus_tag LOCUS_18470 gene dnaX 1287 3050 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_18470 3070 3378 gene locus_tag LOCUS_18480 3070 3378 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPZ1 protein_id gnl|my_center|LOCUS_18480 3536 4135 gene locus_tag LOCUS_18490 gene recR 3536 4135 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y3X7 protein_id gnl|my_center|LOCUS_18490 4128 4574 gene locus_tag LOCUS_18500 4128 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 4743 4922 gene locus_tag LOCUS_18510 4743 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 5734 5183 gene locus_tag LOCUS_18520 5734 5183 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939708.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence178 <1 1532 gene locus_tag LOCUS_18530 <1 1532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_229828.2:peptide ABC transporter substrate-binding protein 1631 2611 gene locus_tag LOCUS_18540 1631 2611 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105601.1 protein_id gnl|my_center|LOCUS_18540 2608 3528 gene locus_tag LOCUS_18550 2608 3528 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937478.1 protein_id gnl|my_center|LOCUS_18550 3538 4500 gene locus_tag LOCUS_18560 3538 4500 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937477.1 protein_id gnl|my_center|LOCUS_18560 4526 5548 gene locus_tag LOCUS_18570 4526 5548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937476.1 protein_id gnl|my_center|LOCUS_18570 5774 5583 gene locus_tag LOCUS_18580 5774 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence179 4133 1326 gene locus_tag LOCUS_18590 4133 1326 CDS product type III restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_18590 4750 5406 gene locus_tag LOCUS_18600 4750 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 5544 6128 gene locus_tag LOCUS_18610 5544 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence180 934 104 gene locus_tag LOCUS_18620 gene nadK 934 104 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH6 protein_id gnl|my_center|LOCUS_18620 1964 1227 gene locus_tag LOCUS_18630 1964 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2314 1961 gene locus_tag LOCUS_18640 2314 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 5069 2388 gene locus_tag LOCUS_18650 gene polA 5069 2388 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FR5 protein_id gnl|my_center|LOCUS_18650 5399 6124 gene locus_tag LOCUS_18660 gene purN 5399 6124 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12040 protein_id gnl|my_center|LOCUS_18660 >Feature sequence181 301 1665 gene locus_tag LOCUS_18670 301 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2480 1815 gene locus_tag LOCUS_18680 2480 1815 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867423.1 protein_id gnl|my_center|LOCUS_18680 3891 2452 gene locus_tag LOCUS_18690 3891 2452 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_18690 4063 4251 gene locus_tag LOCUS_18700 4063 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 4233 4877 gene locus_tag LOCUS_18710 4233 4877 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_18710 4964 5155 gene locus_tag LOCUS_18720 4964 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 5155 5721 gene locus_tag LOCUS_18730 5155 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence182 <1 2227 gene locus_tag LOCUS_18740 <1 2227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073358.1:type IV pili system adhesin PilY 2263 2610 gene locus_tag LOCUS_18750 2263 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 4006 2612 gene locus_tag LOCUS_18760 gene pilR 4006 2612 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_18760 5294 3996 gene locus_tag LOCUS_18770 gene pyrC 5294 3996 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP4 protein_id gnl|my_center|LOCUS_18770 6216 5278 gene locus_tag LOCUS_18780 gene pyrB 6216 5278 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP5 protein_id gnl|my_center|LOCUS_18780 >Feature sequence183 459 1124 gene locus_tag LOCUS_18790 459 1124 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066452.1 protein_id gnl|my_center|LOCUS_18790 1420 1154 gene locus_tag LOCUS_18800 1420 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_18800 2806 1430 gene locus_tag LOCUS_18810 2806 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 3682 2912 gene locus_tag LOCUS_18820 gene trn2 3682 2912 CDS product tropinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_18820 5977 3941 gene locus_tag LOCUS_18830 5977 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence184 2201 1494 gene locus_tag LOCUS_18840 gene fklB 2201 1494 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIT4 protein_id gnl|my_center|LOCUS_18840 2948 2373 gene locus_tag LOCUS_18850 2948 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 3892 2978 gene locus_tag LOCUS_18860 3892 2978 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477256.1 protein_id gnl|my_center|LOCUS_18860 4321 3899 gene locus_tag LOCUS_18870 4321 3899 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463375.1 protein_id gnl|my_center|LOCUS_18870 4990 4739 gene locus_tag LOCUS_18880 4990 4739 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975209.1 protein_id gnl|my_center|LOCUS_18880 5545 5141 gene locus_tag LOCUS_18890 5545 5141 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_18890 5922 5575 gene locus_tag LOCUS_18900 5922 5575 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence185 186 3578 gene locus_tag LOCUS_18910 186 3578 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747J9 protein_id gnl|my_center|LOCUS_18910 3640 4011 gene locus_tag LOCUS_18920 3640 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4020 4595 gene locus_tag LOCUS_18930 4020 4595 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_18930 5474 4602 gene locus_tag LOCUS_18940 5474 4602 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSH8 protein_id gnl|my_center|LOCUS_18940 >Feature sequence186 161 1198 gene locus_tag LOCUS_18950 gene argC 161 1198 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748X6 protein_id gnl|my_center|LOCUS_18950 1249 2178 gene locus_tag LOCUS_18960 1249 2178 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940498.1 protein_id gnl|my_center|LOCUS_18960 2374 4896 gene locus_tag LOCUS_18970 2374 4896 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_18970 4909 5217 gene locus_tag LOCUS_18980 gene clpS 4909 5217 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJD6 protein_id gnl|my_center|LOCUS_18980 >Feature sequence187 777 64 gene locus_tag LOCUS_18990 777 64 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZH1 protein_id gnl|my_center|LOCUS_18990 2421 841 gene locus_tag LOCUS_19000 gene serA 2421 841 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKK8 protein_id gnl|my_center|LOCUS_19000 3509 2421 gene locus_tag LOCUS_19010 gene serC 3509 2421 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y3L0 protein_id gnl|my_center|LOCUS_19010 5359 3755 gene locus_tag LOCUS_19020 gene prfC 5359 3755 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GV6 protein_id gnl|my_center|LOCUS_19020 5762 5526 gene locus_tag LOCUS_19030 5762 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence188 404 2521 gene locus_tag LOCUS_19040 404 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2525 3163 gene locus_tag LOCUS_19050 2525 3163 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810448.1 protein_id gnl|my_center|LOCUS_19050 3704 3252 gene locus_tag LOCUS_19060 3704 3252 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732153.1 protein_id gnl|my_center|LOCUS_19060 5813 3921 gene locus_tag LOCUS_19070 5813 3921 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256665.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence189 863 2281 gene locus_tag LOCUS_19080 863 2281 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_19080 3803 2349 gene locus_tag LOCUS_19090 3803 2349 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_19090 4360 4193 gene locus_tag LOCUS_19100 4360 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 4506 4898 gene locus_tag LOCUS_19110 4506 4898 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903539.1 protein_id gnl|my_center|LOCUS_19110 4975 5361 gene locus_tag LOCUS_19120 4975 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 5590 5970 gene locus_tag LOCUS_19130 5590 5970 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430159.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence190 1855 512 gene locus_tag LOCUS_19140 1855 512 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_19140 3042 1855 gene locus_tag LOCUS_19150 3042 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19150 4503 3163 gene locus_tag LOCUS_19160 4503 3163 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6B2 protein_id gnl|my_center|LOCUS_19160 4798 4520 gene locus_tag LOCUS_19170 4798 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence191 2481 916 gene locus_tag LOCUS_19180 2481 916 CDS product type II/III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938569.1 protein_id gnl|my_center|LOCUS_19180 3087 2578 gene locus_tag LOCUS_19190 3087 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3666 3091 gene locus_tag LOCUS_19200 3666 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 5408 3666 gene locus_tag LOCUS_19210 5408 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 5935 5519 gene locus_tag LOCUS_19220 5935 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence192 472 870 gene locus_tag LOCUS_19230 gene atpC 472 870 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E05 protein_id gnl|my_center|LOCUS_19230 1101 1850 gene locus_tag LOCUS_19240 1101 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 1918 2184 gene locus_tag LOCUS_19250 1918 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2213 2506 gene locus_tag LOCUS_19260 2213 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 2894 4459 gene locus_tag LOCUS_19270 gene rny 2894 4459 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E27 protein_id gnl|my_center|LOCUS_19270 4473 5759 gene locus_tag LOCUS_19280 gene tyrS 4473 5759 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I748 protein_id gnl|my_center|LOCUS_19280 >Feature sequence193 1211 561 gene locus_tag LOCUS_19290 1211 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2223 1267 gene locus_tag LOCUS_19300 2223 1267 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250927.1 protein_id gnl|my_center|LOCUS_19300 2657 4021 gene locus_tag LOCUS_19310 2657 4021 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481438.1 protein_id gnl|my_center|LOCUS_19310 4117 5505 gene locus_tag LOCUS_19320 4117 5505 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533037.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence194 1538 2671 gene locus_tag LOCUS_19330 1538 2671 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_19330 2683 3534 gene locus_tag LOCUS_19340 2683 3534 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811895.1 protein_id gnl|my_center|LOCUS_19340 3776 4531 gene locus_tag LOCUS_19350 3776 4531 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941950.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence195 2143 485 gene locus_tag LOCUS_19360 2143 485 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392693.1 protein_id gnl|my_center|LOCUS_19360 2964 2560 gene locus_tag LOCUS_19370 2964 2560 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940111.1 protein_id gnl|my_center|LOCUS_19370 3397 4884 gene locus_tag LOCUS_19380 gene trpE 3397 4884 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_19380 4881 5456 gene locus_tag LOCUS_19390 4881 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19390 >Feature sequence196 317 1258 gene locus_tag LOCUS_19400 317 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 1461 1847 gene locus_tag LOCUS_19410 1461 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1962 2999 gene locus_tag LOCUS_19420 1962 2999 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707808.1 protein_id gnl|my_center|LOCUS_19420 3160 5307 gene locus_tag LOCUS_19430 3160 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 5308 5874 gene locus_tag LOCUS_19440 5308 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence197 476 27 gene locus_tag LOCUS_19450 476 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 814 1227 gene locus_tag LOCUS_19460 814 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2445 1270 gene locus_tag LOCUS_19470 2445 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 4044 2794 gene locus_tag LOCUS_19480 4044 2794 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085877.1 protein_id gnl|my_center|LOCUS_19480 4914 4114 gene locus_tag LOCUS_19490 4914 4114 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898500.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence198 <1 531 gene locus_tag LOCUS_19500 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869461.1:allophanate hydrolase 531 1478 gene locus_tag LOCUS_19510 531 1478 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_19510 2774 1551 gene locus_tag LOCUS_19520 2774 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 5122 2774 gene locus_tag LOCUS_19530 5122 2774 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DA3 protein_id gnl|my_center|LOCUS_19530 5452 5661 gene locus_tag LOCUS_19540 5452 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence199 354 145 gene locus_tag LOCUS_19550 354 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 757 2964 gene locus_tag LOCUS_19560 757 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3261 5588 gene locus_tag LOCUS_19570 3261 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence200 <5844 531 gene locus_tag LOCUS_19580 <5844 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144210.1:polyketide synthase >Feature sequence201 955 794 gene locus_tag LOCUS_19590 955 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1647 1862 gene locus_tag LOCUS_19600 1647 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2241 2074 gene locus_tag LOCUS_19610 2241 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 2636 3634 gene locus_tag LOCUS_19620 2636 3634 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272317.1 protein_id gnl|my_center|LOCUS_19620 3697 4026 gene locus_tag LOCUS_19630 3697 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 4648 4271 gene locus_tag LOCUS_19640 4648 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 5122 4871 gene locus_tag LOCUS_19650 5122 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 5786 5622 gene locus_tag LOCUS_19660 5786 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence202 602 1111 gene locus_tag LOCUS_19670 602 1111 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813563.1 protein_id gnl|my_center|LOCUS_19670 1108 2388 gene locus_tag LOCUS_19680 1108 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 5447 2550 gene locus_tag LOCUS_19690 gene glnE 5447 2550 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGC3 protein_id gnl|my_center|LOCUS_19690 >Feature sequence203 1298 123 gene locus_tag LOCUS_19700 1298 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 1663 1295 gene locus_tag LOCUS_19710 1663 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19710 3203 1602 gene locus_tag LOCUS_19720 gene metG 3203 1602 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AE2 protein_id gnl|my_center|LOCUS_19720 4012 3203 gene locus_tag LOCUS_19730 4012 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 5063 4005 gene locus_tag LOCUS_19740 gene holB 5063 4005 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_19740 5342 5067 gene locus_tag LOCUS_19750 gene ihfB-1 5342 5067 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence204 694 476 gene locus_tag LOCUS_19760 694 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1012 752 gene locus_tag LOCUS_19770 1012 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1346 2227 gene locus_tag LOCUS_19780 1346 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2777 2388 gene locus_tag LOCUS_19790 2777 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 3114 3812 gene locus_tag LOCUS_19800 gene ccdA 3114 3812 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_19800 3834 5084 gene locus_tag LOCUS_19810 3834 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence205 300 761 gene locus_tag LOCUS_19820 300 761 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249777.1 protein_id gnl|my_center|LOCUS_19820 1058 2425 gene locus_tag LOCUS_19830 1058 2425 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250831.1 protein_id gnl|my_center|LOCUS_19830 2419 3114 gene locus_tag LOCUS_19840 2419 3114 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249420.1 protein_id gnl|my_center|LOCUS_19840 3161 3952 gene locus_tag LOCUS_19850 gene exoA 3161 3952 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949043.1 protein_id gnl|my_center|LOCUS_19850 5178 3961 gene locus_tag LOCUS_19860 gene icd 5178 3961 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39126 protein_id gnl|my_center|LOCUS_19860 >Feature sequence206 51 473 gene locus_tag LOCUS_19870 51 473 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095862.1 protein_id gnl|my_center|LOCUS_19870 3063 1132 gene locus_tag LOCUS_19880 3063 1132 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263947.1 protein_id gnl|my_center|LOCUS_19880 3370 3552 gene locus_tag LOCUS_19890 3370 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4455 3748 gene locus_tag LOCUS_19900 4455 3748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937857.1 protein_id gnl|my_center|LOCUS_19900 5239 4448 gene locus_tag LOCUS_19910 5239 4448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937856.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence207 1218 3002 gene locus_tag LOCUS_19920 1218 3002 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119127.1 protein_id gnl|my_center|LOCUS_19920 3736 2993 gene locus_tag LOCUS_19930 gene truA 3736 2993 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EL1 protein_id gnl|my_center|LOCUS_19930 4175 3720 gene locus_tag LOCUS_19940 4175 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 4632 4961 gene locus_tag LOCUS_19950 4632 4961 CDS product NIF3 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769887.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence208 <1 501 gene locus_tag LOCUS_19960 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229130.1:amidase 1027 1782 gene locus_tag LOCUS_19970 1027 1782 CDS product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204139.1 protein_id gnl|my_center|LOCUS_19970 1870 4230 gene locus_tag LOCUS_19980 1870 4230 CDS product glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048172.1 protein_id gnl|my_center|LOCUS_19980 5230 4250 gene locus_tag LOCUS_19990 5230 4250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence209 724 254 gene locus_tag LOCUS_20000 gene rpsG 724 254 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CI4 protein_id gnl|my_center|LOCUS_20000 1134 763 gene locus_tag LOCUS_20010 gene rpsL 1134 763 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CI5 protein_id gnl|my_center|LOCUS_20010 <5570 1238 gene locus_tag LOCUS_20020 <5570 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to I7EPD8:DNA-directed RNA polymerase subunit beta' >Feature sequence210 935 1183 gene locus_tag LOCUS_20030 935 1183 CDS product putative HTH-type transcriptional regulator y4mF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55565 protein_id gnl|my_center|LOCUS_20030 1176 2429 gene locus_tag LOCUS_20040 gene hipA 1176 2429 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021208.1 protein_id gnl|my_center|LOCUS_20040 2440 2643 gene locus_tag LOCUS_20050 2440 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3448 3900 gene locus_tag LOCUS_20060 3448 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 4281 4087 gene locus_tag LOCUS_20070 4281 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 4605 4354 gene locus_tag LOCUS_20080 4605 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 4815 5048 gene locus_tag LOCUS_20090 4815 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 5035 5292 gene locus_tag LOCUS_20100 5035 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence211 319 71 gene locus_tag LOCUS_20110 gene acpP 319 71 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57433 protein_id gnl|my_center|LOCUS_20110 506 291 gene locus_tag LOCUS_20120 506 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1140 1421 gene locus_tag LOCUS_20130 1140 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 1584 2351 gene locus_tag LOCUS_20140 1584 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2500 5289 gene locus_tag LOCUS_20150 2500 5289 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454869.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence212 909 130 gene locus_tag LOCUS_20160 909 130 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYZ1 protein_id gnl|my_center|LOCUS_20160 1590 970 gene locus_tag LOCUS_20170 gene trmH 1590 970 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SM16 protein_id gnl|my_center|LOCUS_20170 3073 1610 gene locus_tag LOCUS_20180 3073 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462279.1 protein_id gnl|my_center|LOCUS_20180 4053 3154 gene locus_tag LOCUS_20190 4053 3154 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_20190 4269 4892 gene locus_tag LOCUS_20200 4269 4892 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357285.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence213 815 1150 gene locus_tag LOCUS_20210 815 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1280 3169 gene locus_tag LOCUS_20220 gene mnmG 1280 3169 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJL3 protein_id gnl|my_center|LOCUS_20220 3237 4187 gene locus_tag LOCUS_20230 3237 4187 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence214 <1 666 gene locus_tag LOCUS_20240 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001128510.1:sensor histidine kinase 828 2012 gene locus_tag LOCUS_20250 828 2012 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_20250 2149 2448 gene locus_tag LOCUS_20260 2149 2448 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175594.1 protein_id gnl|my_center|LOCUS_20260 2527 3630 gene locus_tag LOCUS_20270 2527 3630 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089728.1 protein_id gnl|my_center|LOCUS_20270 4658 3717 gene locus_tag LOCUS_20280 gene prs 4658 3717 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHU3 protein_id gnl|my_center|LOCUS_20280 5481 5215 gene locus_tag LOCUS_20290 5481 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence215 1802 2236 gene locus_tag LOCUS_20300 1802 2236 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939217.1 protein_id gnl|my_center|LOCUS_20300 2233 3291 gene locus_tag LOCUS_20310 gene mnmA 2233 3291 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZP1 protein_id gnl|my_center|LOCUS_20310 3288 4601 gene locus_tag LOCUS_20320 gene mtaB 3288 4601 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence216 105 1247 gene locus_tag LOCUS_20330 105 1247 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583471.1 protein_id gnl|my_center|LOCUS_20330 3163 1244 gene locus_tag LOCUS_20340 gene selB 3163 1244 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_20340 3357 3178 gene locus_tag LOCUS_20350 3357 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3509 3584 gene locus_tag LOCUS_t00260 3509 3584 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3701 4321 gene locus_tag LOCUS_20360 3701 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4919 4341 gene locus_tag LOCUS_20370 gene mtgA 4919 4341 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB02 protein_id gnl|my_center|LOCUS_20370 5145 5444 gene locus_tag LOCUS_20380 5145 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence217 889 458 gene locus_tag LOCUS_20390 889 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2345 1239 gene locus_tag LOCUS_20400 gene rodA 2345 1239 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_20400 4193 2349 gene locus_tag LOCUS_20410 gene mrdA 4193 2349 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_20410 4725 4177 gene locus_tag LOCUS_20420 4725 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 <5446 4755 gene locus_tag LOCUS_20430 <5446 4755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BG0:cell shape-determining protein MreC >Feature sequence218 352 1578 gene locus_tag LOCUS_20440 352 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 1894 2328 gene locus_tag LOCUS_20450 1894 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2441 2797 gene locus_tag LOCUS_20460 2441 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2761 3216 gene locus_tag LOCUS_20470 2761 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 3402 4121 gene locus_tag LOCUS_20480 gene guaA 3402 4121 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972471.1 protein_id gnl|my_center|LOCUS_20480 4401 4814 gene locus_tag LOCUS_20490 4401 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence219 2025 841 gene locus_tag LOCUS_20500 2025 841 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_20500 3116 2103 gene locus_tag LOCUS_20510 3116 2103 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815070.1 protein_id gnl|my_center|LOCUS_20510 3355 4023 gene locus_tag LOCUS_20520 3355 4023 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_20520 4307 4882 gene locus_tag LOCUS_20530 4307 4882 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889720.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence220 1300 179 gene locus_tag LOCUS_20540 1300 179 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_20540 2936 1416 gene locus_tag LOCUS_20550 2936 1416 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389142.1 protein_id gnl|my_center|LOCUS_20550 3101 3763 gene locus_tag LOCUS_20560 3101 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 3769 4344 gene locus_tag LOCUS_20570 gene cobU 3769 4344 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943640.1 protein_id gnl|my_center|LOCUS_20570 4349 5293 gene locus_tag LOCUS_20580 4349 5293 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903868.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence221 331 3684 gene locus_tag LOCUS_20590 331 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 3718 5064 gene locus_tag LOCUS_20600 3718 5064 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939741.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence222 2777 315 gene locus_tag LOCUS_20610 2777 315 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951087.1 protein_id gnl|my_center|LOCUS_20610 3479 2964 gene locus_tag LOCUS_20620 3479 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 3707 3480 gene locus_tag LOCUS_20630 3707 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 3987 3712 gene locus_tag LOCUS_20640 3987 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 4480 4226 gene locus_tag LOCUS_20650 4480 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 <5351 4508 gene locus_tag LOCUS_20660 <5351 4508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268423.1:peptidase S41 >Feature sequence223 <1 501 gene locus_tag LOCUS_20670 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000238605.1:TetR family transcriptional regulator 739 4008 gene locus_tag LOCUS_20680 gene mcm 739 4008 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D452 protein_id gnl|my_center|LOCUS_20680 4030 5205 gene locus_tag LOCUS_20690 gene thl 4030 5205 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255689.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence224 787 128 gene locus_tag LOCUS_20700 787 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2498 804 gene locus_tag LOCUS_20710 2498 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2903 2532 gene locus_tag LOCUS_20720 2903 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3658 2900 gene locus_tag LOCUS_20730 3658 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4100 3651 gene locus_tag LOCUS_20740 4100 3651 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405616.1 protein_id gnl|my_center|LOCUS_20740 4350 4135 gene locus_tag LOCUS_20750 4350 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 <5259 4368 gene locus_tag LOCUS_20760 <5259 4368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813982.1:hydrogenase >Feature sequence225 2808 1858 gene locus_tag LOCUS_20770 2808 1858 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939167.1 protein_id gnl|my_center|LOCUS_20770 2917 3438 gene locus_tag LOCUS_20780 2917 3438 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256853.1 protein_id gnl|my_center|LOCUS_20780 3426 4217 gene locus_tag LOCUS_20790 3426 4217 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_20790 4759 4358 gene locus_tag LOCUS_20800 4759 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 >Feature sequence226 1057 2121 gene locus_tag LOCUS_20810 gene corA 1057 2121 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_20810 3018 2137 gene locus_tag LOCUS_20820 3018 2137 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404577.1 protein_id gnl|my_center|LOCUS_20820 3161 3493 gene locus_tag LOCUS_20830 3161 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 3543 3755 gene locus_tag LOCUS_20840 3543 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 3864 4442 gene locus_tag LOCUS_20850 3864 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 4508 4801 gene locus_tag LOCUS_20860 4508 4801 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945908.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence227 557 1930 gene locus_tag LOCUS_20870 557 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 1945 2961 gene locus_tag LOCUS_20880 1945 2961 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583756.1 protein_id gnl|my_center|LOCUS_20880 4605 3358 gene locus_tag LOCUS_20890 4605 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence228 98 535 gene locus_tag LOCUS_20900 98 535 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_20900 603 2303 gene locus_tag LOCUS_20910 gene recD 603 2303 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDI0 protein_id gnl|my_center|LOCUS_20910 2336 3697 gene locus_tag LOCUS_20920 2336 3697 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_20920 3703 4536 gene locus_tag LOCUS_20930 3703 4536 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence229 2004 1054 gene locus_tag LOCUS_20940 gene fmt 2004 1054 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_20940 2525 2001 gene locus_tag LOCUS_20950 gene def 2525 2001 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIL7 protein_id gnl|my_center|LOCUS_20950 3456 2512 gene locus_tag LOCUS_20960 gene ribF 3456 2512 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJY1 protein_id gnl|my_center|LOCUS_20960 3578 3664 gene locus_tag LOCUS_t00270 3578 3664 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3939 3805 gene locus_tag LOCUS_20970 3939 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 4591 3974 gene locus_tag LOCUS_20980 4591 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence230 <1 600 gene locus_tag LOCUS_20990 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YK96:tRNA (guanine-N(1)-)-methyltransferase 587 1150 gene locus_tag LOCUS_21000 587 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941308.1 protein_id gnl|my_center|LOCUS_21000 1195 1545 gene locus_tag LOCUS_21010 gene rplS 1195 1545 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DU4 protein_id gnl|my_center|LOCUS_21010 1569 2189 gene locus_tag LOCUS_21020 gene rnhB 1569 2189 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FG0 protein_id gnl|my_center|LOCUS_21020 2179 2544 gene locus_tag LOCUS_21030 2179 2544 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4L8 protein_id gnl|my_center|LOCUS_21030 2558 3415 gene locus_tag LOCUS_21040 gene rsmI 2558 3415 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3N052 protein_id gnl|my_center|LOCUS_21040 3653 4225 gene locus_tag LOCUS_21050 3653 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 <5135 4415 gene locus_tag LOCUS_21060 <5135 4415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938590.1:sulfate adenylyltransferase >Feature sequence231 380 1090 gene locus_tag LOCUS_21070 380 1090 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_21070 1147 2172 gene locus_tag LOCUS_21080 1147 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_21080 2633 2175 gene locus_tag LOCUS_21090 2633 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099253.1 protein_id gnl|my_center|LOCUS_21090 3261 2647 gene locus_tag LOCUS_21100 3261 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_21100 <5111 3251 gene locus_tag LOCUS_21110 <5111 3251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943733.1:DNA translocase FtsK >Feature sequence232 319 1950 gene locus_tag LOCUS_21120 319 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 3271 1940 gene locus_tag LOCUS_21130 gene pfkA 3271 1940 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AD6 protein_id gnl|my_center|LOCUS_21130 4238 3252 gene locus_tag LOCUS_21140 4238 3252 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_21140 4486 4758 gene locus_tag LOCUS_21150 4486 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942657.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence233 945 262 gene locus_tag LOCUS_21160 gene pspA 945 262 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940247.1 protein_id gnl|my_center|LOCUS_21160 1227 2318 gene locus_tag LOCUS_21170 1227 2318 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462315.1 protein_id gnl|my_center|LOCUS_21170 2352 2711 gene locus_tag LOCUS_21180 2352 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21180 2660 2839 gene locus_tag LOCUS_21190 2660 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3234 3716 gene locus_tag LOCUS_21200 gene gpt 3234 3716 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D63 protein_id gnl|my_center|LOCUS_21200 5029 3800 gene locus_tag LOCUS_21210 gene argG 5029 3800 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2A1 protein_id gnl|my_center|LOCUS_21210 >Feature sequence234 <1 1997 gene locus_tag LOCUS_21220 <1 1997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74B17:histidine kinase 3262 2420 gene locus_tag LOCUS_21230 3262 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755976.1 protein_id gnl|my_center|LOCUS_21230 4877 3729 gene locus_tag LOCUS_21240 4877 3729 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887673.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence235 1081 674 gene locus_tag LOCUS_21250 gene ycf52 1081 674 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142347.1 protein_id gnl|my_center|LOCUS_21250 1601 1398 gene locus_tag LOCUS_21260 1601 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 1960 2142 gene locus_tag LOCUS_21270 1960 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2331 2861 gene locus_tag LOCUS_21280 2331 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2861 3085 gene locus_tag LOCUS_21290 2861 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 3889 3101 gene locus_tag LOCUS_21300 3889 3101 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066916.1 protein_id gnl|my_center|LOCUS_21300 4881 3961 gene locus_tag LOCUS_21310 gene ugpE 4881 3961 CDS product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CEN7 protein_id gnl|my_center|LOCUS_21310 >Feature sequence236 2418 688 gene locus_tag LOCUS_21320 2418 688 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365019.1 protein_id gnl|my_center|LOCUS_21320 2925 2494 gene locus_tag LOCUS_21330 2925 2494 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700867.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence237 1316 87 gene locus_tag LOCUS_21340 1316 87 CDS product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_21340 1442 1618 gene locus_tag LOCUS_21350 1442 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940431.1 protein_id gnl|my_center|LOCUS_21350 1602 2588 gene locus_tag LOCUS_21360 1602 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926398.1 protein_id gnl|my_center|LOCUS_21360 2548 4254 gene locus_tag LOCUS_21370 gene recN 2548 4254 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH7 protein_id gnl|my_center|LOCUS_21370 4313 4561 gene locus_tag LOCUS_21380 4313 4561 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393102.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence238 2399 525 gene locus_tag LOCUS_21390 2399 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3391 2396 gene locus_tag LOCUS_21400 3391 2396 CDS product aerotolerance protein BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_21400 3948 3391 gene locus_tag LOCUS_21410 3948 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 4827 3949 gene locus_tag LOCUS_21420 4827 3949 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence239 621 181 gene locus_tag LOCUS_21430 621 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 967 1791 gene locus_tag LOCUS_21440 967 1791 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203438.1 protein_id gnl|my_center|LOCUS_21440 1870 3189 gene locus_tag LOCUS_21450 1870 3189 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_21450 3122 3298 gene locus_tag LOCUS_21460 3122 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence240 185 1516 gene locus_tag LOCUS_21470 185 1516 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_21470 2006 1551 gene locus_tag LOCUS_21480 2006 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2332 2583 gene locus_tag LOCUS_21490 2332 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 2844 2710 gene locus_tag LOCUS_21500 2844 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 3134 3364 gene locus_tag LOCUS_21510 3134 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 4032 3433 gene locus_tag LOCUS_21520 4032 3433 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531208.1 protein_id gnl|my_center|LOCUS_21520 <4985 4111 gene locus_tag LOCUS_21530 <4985 4111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933715.1:hybrid sensor histidine kinase/response regulator >Feature sequence241 1938 553 gene locus_tag LOCUS_21540 1938 553 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21540 2354 3772 gene locus_tag LOCUS_21550 2354 3772 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462282.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence242 1103 1798 gene locus_tag LOCUS_21560 1103 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2384 2154 gene locus_tag LOCUS_21570 2384 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 3545 3069 gene locus_tag LOCUS_21580 3545 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937534.1 protein_id gnl|my_center|LOCUS_21580 3774 3547 gene locus_tag LOCUS_21590 3774 3547 CDS product addiction module toxin, HicA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103638.1 protein_id gnl|my_center|LOCUS_21590 4179 4598 gene locus_tag LOCUS_21600 4179 4598 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463517.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence243 397 1347 gene locus_tag LOCUS_21610 gene yeaC 397 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94474 protein_id gnl|my_center|LOCUS_21610 1355 2710 gene locus_tag LOCUS_21620 1355 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2707 4692 gene locus_tag LOCUS_21630 2707 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence244 1113 2192 gene locus_tag LOCUS_21640 1113 2192 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117808.1 protein_id gnl|my_center|LOCUS_21640 2314 3396 gene locus_tag LOCUS_21650 2314 3396 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140372.1 protein_id gnl|my_center|LOCUS_21650 3698 4747 gene locus_tag LOCUS_21660 3698 4747 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence245 853 1986 gene locus_tag LOCUS_21670 853 1986 CDS product 1,3-propanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705363.1 protein_id gnl|my_center|LOCUS_21670 2059 2397 gene locus_tag LOCUS_21680 2059 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 3696 2443 gene locus_tag LOCUS_21690 3696 2443 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence246 2601 3578 gene locus_tag LOCUS_21700 2601 3578 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence247 1375 593 gene locus_tag LOCUS_21710 1375 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 1833 1447 gene locus_tag LOCUS_21720 1833 1447 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869964.1 protein_id gnl|my_center|LOCUS_21720 2903 1902 gene locus_tag LOCUS_21730 2903 1902 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533002.1 protein_id gnl|my_center|LOCUS_21730 3857 2919 gene locus_tag LOCUS_21740 3857 2919 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849352.1 protein_id gnl|my_center|LOCUS_21740 4828 4493 gene locus_tag LOCUS_21750 4828 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence248 245 1135 gene locus_tag LOCUS_21760 245 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 1140 2822 gene locus_tag LOCUS_21770 gene speE1 1140 2822 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence249 267 761 gene locus_tag LOCUS_21780 267 761 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785712.1 protein_id gnl|my_center|LOCUS_21780 886 1272 gene locus_tag LOCUS_21790 886 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 1443 2573 gene locus_tag LOCUS_21800 1443 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940547.1 protein_id gnl|my_center|LOCUS_21800 2537 4171 gene locus_tag LOCUS_21810 2537 4171 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940548.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence250 572 1219 gene locus_tag LOCUS_21820 572 1219 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461975.1 protein_id gnl|my_center|LOCUS_21820 1316 1954 gene locus_tag LOCUS_21830 1316 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:1640..1642,aa:Sec) note codon on position 109 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_21830 3109 2462 gene locus_tag LOCUS_21840 3109 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 3307 3179 gene locus_tag LOCUS_21850 3307 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3844 3389 gene locus_tag LOCUS_21860 3844 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 4211 3897 gene locus_tag LOCUS_21870 4211 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence251 545 45 gene locus_tag LOCUS_21880 545 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 865 1650 gene locus_tag LOCUS_21890 865 1650 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940707.1 protein_id gnl|my_center|LOCUS_21890 1643 2128 gene locus_tag LOCUS_21900 gene tagD1 1643 2128 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_21900 2115 2888 gene locus_tag LOCUS_21910 2115 2888 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182X4 protein_id gnl|my_center|LOCUS_21910 3168 3386 gene locus_tag LOCUS_21920 gene atpZ 3168 3386 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941004.1 protein_id gnl|my_center|LOCUS_21920 3386 3787 gene locus_tag LOCUS_21930 3386 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 3788 4477 gene locus_tag LOCUS_21940 gene atpB 3788 4477 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GB2 protein_id gnl|my_center|LOCUS_21940 >Feature sequence252 990 412 gene locus_tag LOCUS_21950 990 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 1282 1082 gene locus_tag LOCUS_21960 1282 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21960 3592 1829 gene locus_tag LOCUS_21970 3592 1829 CDS product guanylyl cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706209.1 protein_id gnl|my_center|LOCUS_21970 3853 4419 gene locus_tag LOCUS_21980 3853 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence253 857 1321 gene locus_tag LOCUS_21990 857 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2286 1792 gene locus_tag LOCUS_22000 2286 1792 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7X1 protein_id gnl|my_center|LOCUS_22000 2935 2726 gene locus_tag LOCUS_22010 2935 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 4245 2977 gene locus_tag LOCUS_22020 gene rhlE-2 4245 2977 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence254 507 893 gene locus_tag LOCUS_22030 507 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 1017 1292 gene locus_tag LOCUS_22040 1017 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 1338 1892 gene locus_tag LOCUS_22050 1338 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2059 2970 gene locus_tag LOCUS_22060 2059 2970 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887795.1 protein_id gnl|my_center|LOCUS_22060 3401 3069 gene locus_tag LOCUS_22070 3401 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392788.1 protein_id gnl|my_center|LOCUS_22070 4315 3446 gene locus_tag LOCUS_22080 4315 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence255 573 100 gene locus_tag LOCUS_22090 573 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 1021 2406 gene locus_tag LOCUS_22100 1021 2406 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272364.1 protein_id gnl|my_center|LOCUS_22100 3129 2692 gene locus_tag LOCUS_22110 3129 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 4368 3325 gene locus_tag LOCUS_22120 4368 3325 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence256 1127 1744 gene locus_tag LOCUS_22130 1127 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1728 2672 gene locus_tag LOCUS_22140 1728 2672 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJH8 protein_id gnl|my_center|LOCUS_22140 2705 4069 gene locus_tag LOCUS_22150 2705 4069 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2VFK6 protein_id gnl|my_center|LOCUS_22150 >Feature sequence257 119 571 gene locus_tag LOCUS_22160 119 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 568 1623 gene locus_tag LOCUS_22170 568 1623 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392522.1 protein_id gnl|my_center|LOCUS_22170 1626 2834 gene locus_tag LOCUS_22180 1626 2834 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392521.1 protein_id gnl|my_center|LOCUS_22180 3008 3802 gene locus_tag LOCUS_22190 3008 3802 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_22190 <4717 3875 gene locus_tag LOCUS_22200 <4717 3875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJ84:methylenetetrahydrofolate reductase >Feature sequence258 1631 582 gene locus_tag LOCUS_22210 1631 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 2397 1705 gene locus_tag LOCUS_22220 2397 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 4395 2632 gene locus_tag LOCUS_22230 4395 2632 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940093.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence259 1724 1104 gene locus_tag LOCUS_22240 1724 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2240 2434 gene locus_tag LOCUS_22250 2240 2434 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence260 159 758 gene locus_tag LOCUS_22260 159 758 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_22260 818 1321 gene locus_tag LOCUS_22270 818 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 1318 2520 gene locus_tag LOCUS_22280 gene coaBC 1318 2520 CDS product peptidase ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_22280 2529 3113 gene locus_tag LOCUS_22290 2529 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 3103 3999 gene locus_tag LOCUS_22300 gene xerC 3103 3999 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFZ8 protein_id gnl|my_center|LOCUS_22300 4009 4557 gene locus_tag LOCUS_22310 gene hslV 4009 4557 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62EZ9 protein_id gnl|my_center|LOCUS_22310 >Feature sequence261 1097 339 gene locus_tag LOCUS_22320 1097 339 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_22320 2914 1112 gene locus_tag LOCUS_22330 2914 1112 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889509.1 protein_id gnl|my_center|LOCUS_22330 4267 2948 gene locus_tag LOCUS_22340 4267 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272661.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence262 473 826 gene locus_tag LOCUS_22350 473 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938073.1 protein_id gnl|my_center|LOCUS_22350 1773 916 gene locus_tag LOCUS_22360 1773 916 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_22360 3440 1923 gene locus_tag LOCUS_22370 3440 1923 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706349.1 protein_id gnl|my_center|LOCUS_22370 3682 4458 gene locus_tag LOCUS_22380 3682 4458 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence263 1307 261 gene locus_tag LOCUS_22390 gene mreB-1 1307 261 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_22390 2440 1430 gene locus_tag LOCUS_22400 2440 1430 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_22400 3364 2519 gene locus_tag LOCUS_22410 3364 2519 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence264 206 1429 gene locus_tag LOCUS_22420 gene ybfB 206 1429 CDS product putative MFS-type transporter YbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31444 protein_id gnl|my_center|LOCUS_22420 1575 2495 gene locus_tag LOCUS_22430 gene ppaC 1575 2495 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073874.1 protein_id gnl|my_center|LOCUS_22430 <4572 2580 gene locus_tag LOCUS_22440 <4572 2580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NFU0:histidine kinase >Feature sequence265 1078 311 gene locus_tag LOCUS_22450 1078 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1579 1163 gene locus_tag LOCUS_22460 gene ypeA 1579 1163 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804508.1 protein_id gnl|my_center|LOCUS_22460 2285 1656 gene locus_tag LOCUS_22470 gene rhtB 2285 1656 CDS product flagellar biosynthesis protein FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261935.1 protein_id gnl|my_center|LOCUS_22470 2811 2344 gene locus_tag LOCUS_22480 2811 2344 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840937.1 protein_id gnl|my_center|LOCUS_22480 3571 2873 gene locus_tag LOCUS_22490 3571 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 4394 3552 gene locus_tag LOCUS_22500 4394 3552 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940707.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence266 2154 91 gene locus_tag LOCUS_22510 2154 91 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018338.1 protein_id gnl|my_center|LOCUS_22510 2889 2284 gene locus_tag LOCUS_22520 gene fadR 2889 2284 CDS product fatty acid metabolism regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94548 protein_id gnl|my_center|LOCUS_22520 3188 4477 gene locus_tag LOCUS_22530 3188 4477 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941850.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence267 432 1100 gene locus_tag LOCUS_22540 432 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 1429 1758 gene locus_tag LOCUS_22550 1429 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 1887 2219 gene locus_tag LOCUS_22560 1887 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2240 3889 gene locus_tag LOCUS_22570 gene rnj 2240 3889 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748A2 protein_id gnl|my_center|LOCUS_22570 >Feature sequence268 2040 547 gene locus_tag LOCUS_22580 2040 547 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262671.1 protein_id gnl|my_center|LOCUS_22580 3727 2093 gene locus_tag LOCUS_22590 3727 2093 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_22590 4477 3731 gene locus_tag LOCUS_22600 4477 3731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680283.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence269 194 107 gene locus_tag LOCUS_t00280 194 107 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 289 879 gene locus_tag LOCUS_22610 289 879 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A46 protein_id gnl|my_center|LOCUS_22610 894 1586 gene locus_tag LOCUS_22620 gene yggS 894 1586 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_22620 1583 2131 gene locus_tag LOCUS_22630 1583 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941742.1 protein_id gnl|my_center|LOCUS_22630 4346 2142 gene locus_tag LOCUS_22640 gene pilB1 4346 2142 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence270 1686 1162 gene locus_tag LOCUS_22650 1686 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1860 3095 gene locus_tag LOCUS_22660 1860 3095 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence271 525 1817 gene locus_tag LOCUS_22670 gene kynU 525 1817 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81CK0 protein_id gnl|my_center|LOCUS_22670 1920 2498 gene locus_tag LOCUS_22680 1920 2498 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229504.1 protein_id gnl|my_center|LOCUS_22680 2834 3952 gene locus_tag LOCUS_22690 2834 3952 CDS product branched chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937853.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence272 1157 453 gene locus_tag LOCUS_22700 1157 453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_22700 2119 1163 gene locus_tag LOCUS_22710 2119 1163 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_22710 2755 2180 gene locus_tag LOCUS_22720 2755 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 3796 3041 gene locus_tag LOCUS_22730 gene cbiQ 3796 3041 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CJ3 protein_id gnl|my_center|LOCUS_22730 <4359 3784 gene locus_tag LOCUS_22740 <4359 3784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870600.1:cobalt ABC transporter ATP-binding protein >Feature sequence273 679 1401 gene locus_tag LOCUS_22750 gene plsC 679 1401 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW5 protein_id gnl|my_center|LOCUS_22750 1582 2022 gene locus_tag LOCUS_22760 gene mraZ 1582 2022 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WT94 protein_id gnl|my_center|LOCUS_22760 2026 2964 gene locus_tag LOCUS_22770 gene rsmH 2026 2964 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97H81 protein_id gnl|my_center|LOCUS_22770 2968 3297 gene locus_tag LOCUS_22780 2968 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence274 2891 1215 gene locus_tag LOCUS_22790 gene hcp 2891 1215 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31101 protein_id gnl|my_center|LOCUS_22790 3376 4050 gene locus_tag LOCUS_22800 gene adk 3376 4050 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AR0 protein_id gnl|my_center|LOCUS_22800 >Feature sequence275 1410 2744 gene locus_tag LOCUS_22810 1410 2744 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943105.1 protein_id gnl|my_center|LOCUS_22810 2981 4213 gene locus_tag LOCUS_22820 2981 4213 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879310.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence276 439 1299 gene locus_tag LOCUS_22830 439 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971568.1 protein_id gnl|my_center|LOCUS_22830 3520 1304 gene locus_tag LOCUS_22840 3520 1304 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226412.1 protein_id gnl|my_center|LOCUS_22840 4114 3521 gene locus_tag LOCUS_22850 4114 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence277 1610 1254 gene locus_tag LOCUS_22860 1610 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 1876 2652 gene locus_tag LOCUS_22870 1876 2652 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358553.1 protein_id gnl|my_center|LOCUS_22870 2666 4111 gene locus_tag LOCUS_22880 2666 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 >Feature sequence278 134 319 gene locus_tag LOCUS_22890 134 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 316 1011 gene locus_tag LOCUS_22900 316 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1023 1754 gene locus_tag LOCUS_22910 1023 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073771.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence279 >Feature sequence280 1315 89 gene locus_tag LOCUS_22920 gene ftsA 1315 89 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E0 protein_id gnl|my_center|LOCUS_22920 2201 1317 gene locus_tag LOCUS_22930 2201 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 3114 2194 gene locus_tag LOCUS_22940 gene murB 3114 2194 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WSZ5 protein_id gnl|my_center|LOCUS_22940 <4202 3124 gene locus_tag LOCUS_22950 <4202 3124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P61679:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence281 3938 3465 gene locus_tag LOCUS_22960 3938 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence282 1553 885 gene locus_tag LOCUS_22970 1553 885 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_22970 2290 1835 gene locus_tag LOCUS_22980 2290 1835 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_22980 2704 2402 gene locus_tag LOCUS_22990 2704 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_22990 3120 2710 gene locus_tag LOCUS_23000 3120 2710 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_23000 3509 3240 gene locus_tag LOCUS_23010 3509 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_23010 3810 3502 gene locus_tag LOCUS_23020 3810 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence283 1734 817 gene locus_tag LOCUS_23030 gene argF 1734 817 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GU2 protein_id gnl|my_center|LOCUS_23030 2921 1749 gene locus_tag LOCUS_23040 gene argD 2921 1749 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG65 protein_id gnl|my_center|LOCUS_23040 3824 2946 gene locus_tag LOCUS_23050 gene argB 3824 2946 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 protein_id gnl|my_center|LOCUS_23050 >Feature sequence284 532 906 gene locus_tag LOCUS_23060 532 906 CDS product RutC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25598 protein_id gnl|my_center|LOCUS_23060 985 2667 gene locus_tag LOCUS_23070 985 2667 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_23070 2678 3547 gene locus_tag LOCUS_23080 2678 3547 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813147.1 protein_id gnl|my_center|LOCUS_23080 4128 3628 gene locus_tag LOCUS_23090 4128 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 >Feature sequence285 34 312 gene locus_tag LOCUS_23100 34 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 1213 680 gene locus_tag LOCUS_23110 1213 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2496 1396 gene locus_tag LOCUS_23120 2496 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 3903 2551 gene locus_tag LOCUS_23130 3903 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence286 2081 141 gene locus_tag LOCUS_23140 2081 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2561 2346 gene locus_tag LOCUS_23150 2561 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 3257 2694 gene locus_tag LOCUS_23160 3257 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3705 3490 gene locus_tag LOCUS_23170 3705 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 3969 3763 gene locus_tag LOCUS_23180 3969 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence287 790 542 gene locus_tag LOCUS_23190 790 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 1608 907 gene locus_tag LOCUS_23200 1608 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 2657 2097 gene locus_tag LOCUS_23210 2657 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 3599 2676 gene locus_tag LOCUS_23220 3599 2676 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence288 759 118 gene locus_tag LOCUS_23230 759 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 2519 756 gene locus_tag LOCUS_23240 2519 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 3475 2516 gene locus_tag LOCUS_23250 gene ddl 3475 2516 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFT1 protein_id gnl|my_center|LOCUS_23250 3878 3507 gene locus_tag LOCUS_23260 3878 3507 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545729.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence289 679 212 gene locus_tag LOCUS_23270 679 212 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940578.1 protein_id gnl|my_center|LOCUS_23270 1201 698 gene locus_tag LOCUS_23280 1201 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2759 1419 gene locus_tag LOCUS_23290 2759 1419 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_23290 3927 2761 gene locus_tag LOCUS_23300 3927 2761 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence290 1158 268 gene locus_tag LOCUS_23310 1158 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 3633 1585 gene locus_tag LOCUS_23320 3633 1585 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393721.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence291 819 1400 gene locus_tag LOCUS_23330 819 1400 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933158.1 protein_id gnl|my_center|LOCUS_23330 2535 1609 gene locus_tag LOCUS_23340 2535 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2911 2525 gene locus_tag LOCUS_23350 2911 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence292 <1 846 gene locus_tag LOCUS_23360 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941506.1:histidine kinase 1390 3828 gene locus_tag LOCUS_23370 1390 3828 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975818.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence293 384 1196 gene locus_tag LOCUS_23380 gene tatC 384 1196 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D88 protein_id gnl|my_center|LOCUS_23380 1347 1820 gene locus_tag LOCUS_23390 1347 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 3381 1948 gene locus_tag LOCUS_23400 gene cobB 3381 1948 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545628.1 protein_id gnl|my_center|LOCUS_23400 3684 3427 gene locus_tag LOCUS_23410 gene dsvD 3684 3427 CDS product protein DsvD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q46582 protein_id gnl|my_center|LOCUS_23410 >Feature sequence294 <1 1040 gene locus_tag LOCUS_23420 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83DS5:lipid-A-disaccharide synthase 1131 2363 gene locus_tag LOCUS_23430 1131 2363 CDS product gliding motility protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583682.1 protein_id gnl|my_center|LOCUS_23430 2366 3262 gene locus_tag LOCUS_23440 2366 3262 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867574.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence295 376 726 gene locus_tag LOCUS_23450 376 726 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937568.1 protein_id gnl|my_center|LOCUS_23450 754 3039 gene locus_tag LOCUS_23460 754 3039 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937579.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence296 <1 1002 gene locus_tag LOCUS_23470 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004537510.1:aspartate aminotransferase family protein 1671 1039 gene locus_tag LOCUS_23480 gene rhtB 1671 1039 CDS product flagellar biosynthesis protein FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261935.1 protein_id gnl|my_center|LOCUS_23480 3558 1687 gene locus_tag LOCUS_23490 3558 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 3987 3820 gene locus_tag LOCUS_23500 3987 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence297 1112 276 gene locus_tag LOCUS_23510 gene fabG 1112 276 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_23510 1749 1132 gene locus_tag LOCUS_23520 1749 1132 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263256.1 protein_id gnl|my_center|LOCUS_23520 2302 1997 gene locus_tag LOCUS_23530 gene yhbY 2302 1997 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071425.1 protein_id gnl|my_center|LOCUS_23530 2764 2979 gene locus_tag LOCUS_23540 2764 2979 CDS product heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723406.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence298 35 202 gene locus_tag LOCUS_23550 35 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 303 752 gene locus_tag LOCUS_23560 303 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 2492 849 gene locus_tag LOCUS_23570 gene pyrG 2492 849 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BL2 protein_id gnl|my_center|LOCUS_23570 3286 2513 gene locus_tag LOCUS_23580 3286 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 <4043 3406 gene locus_tag LOCUS_23590 <4043 3406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72F92:enolase >Feature sequence299 575 790 gene locus_tag LOCUS_23600 575 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 1150 2313 gene locus_tag LOCUS_23610 1150 2313 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957928.1 protein_id gnl|my_center|LOCUS_23610 2387 2773 gene locus_tag LOCUS_23620 2387 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 3221 2805 gene locus_tag LOCUS_23630 3221 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 3528 3253 gene locus_tag LOCUS_23640 3528 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 3917 3555 gene locus_tag LOCUS_23650 3917 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence300 2715 796 gene locus_tag LOCUS_23660 2715 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 3121 3804 gene locus_tag LOCUS_23670 3121 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence301 1775 1590 gene locus_tag LOCUS_23680 gene tatA 1775 1590 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747S5 protein_id gnl|my_center|LOCUS_23680 2005 2856 gene locus_tag LOCUS_23690 2005 2856 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence302 2398 3069 gene locus_tag LOCUS_23700 2398 3069 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707362.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence303 276 2339 gene locus_tag LOCUS_23710 gene prkA 276 2339 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943953.1 protein_id gnl|my_center|LOCUS_23710 2353 3525 gene locus_tag LOCUS_23720 2353 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943954.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence304 1194 1739 gene locus_tag LOCUS_23730 1194 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 2522 1743 gene locus_tag LOCUS_23740 2522 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 3590 2580 gene locus_tag LOCUS_23750 gene galE 3590 2580 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55180 protein_id gnl|my_center|LOCUS_23750 >Feature sequence305 776 24 gene locus_tag LOCUS_23760 776 24 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_23760 1002 1730 gene locus_tag LOCUS_23770 gene cmoA 1002 1730 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEE7 protein_id gnl|my_center|LOCUS_23770 1846 2817 gene locus_tag LOCUS_23780 gene cmoB 1846 2817 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XZ85 protein_id gnl|my_center|LOCUS_23780 3627 3127 gene locus_tag LOCUS_23790 3627 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence306 581 27 gene locus_tag LOCUS_23800 581 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 858 1976 gene locus_tag LOCUS_23810 858 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 <3955 2032 gene locus_tag LOCUS_23820 <3955 2032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390078.1:ATP-dependent helicase >Feature sequence307 1153 704 gene locus_tag LOCUS_23830 1153 704 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877157.1 protein_id gnl|my_center|LOCUS_23830 1960 1523 gene locus_tag LOCUS_23840 1960 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939911.1 protein_id gnl|my_center|LOCUS_23840 2902 1973 gene locus_tag LOCUS_23850 gene rluD1 2902 1973 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I1V5 protein_id gnl|my_center|LOCUS_23850 3503 2970 gene locus_tag LOCUS_23860 3503 2970 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810219.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence308 729 157 gene locus_tag LOCUS_23870 729 157 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876297.1 protein_id gnl|my_center|LOCUS_23870 2117 774 gene locus_tag LOCUS_23880 2117 774 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_23880 2687 2163 gene locus_tag LOCUS_23890 2687 2163 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_23890 3774 2692 gene locus_tag LOCUS_23900 3774 2692 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_23900 >Feature sequence309 811 584 gene locus_tag LOCUS_23910 811 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 1454 837 gene locus_tag LOCUS_23920 1454 837 CDS product outer membrane channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941429.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence310 709 350 gene locus_tag LOCUS_23930 gene rnpA 709 350 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7EPF8 protein_id gnl|my_center|LOCUS_23930 857 723 gene locus_tag LOCUS_23940 gene rpmH 857 723 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z40 protein_id gnl|my_center|LOCUS_23940 2658 1087 gene locus_tag LOCUS_23950 gene cafA 2658 1087 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_23950 <3931 2722 gene locus_tag LOCUS_23960 <3931 2722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943854.1:B12-binding protein >Feature sequence311 <1 1519 gene locus_tag LOCUS_23970 <1 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071756.1:2-nitropropane dioxygenase >Feature sequence312 132 809 gene locus_tag LOCUS_23980 132 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 816 1709 gene locus_tag LOCUS_23990 816 1709 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_23990 1726 2538 gene locus_tag LOCUS_24000 1726 2538 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085975.1 protein_id gnl|my_center|LOCUS_24000 2560 3396 gene locus_tag LOCUS_24010 2560 3396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814793.1 protein_id gnl|my_center|LOCUS_24010 3464 3649 gene locus_tag LOCUS_24020 3464 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence313 188 397 gene locus_tag LOCUS_24030 gene rpoZ 188 397 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q725M7 protein_id gnl|my_center|LOCUS_24030 485 1252 gene locus_tag LOCUS_24040 gene folE2 485 1252 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW8 protein_id gnl|my_center|LOCUS_24040 1409 1639 gene locus_tag LOCUS_24050 1409 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1651 2052 gene locus_tag LOCUS_24060 gene vapC 1651 2052 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_24060 2274 2495 gene locus_tag LOCUS_24070 2274 2495 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL05 protein_id gnl|my_center|LOCUS_24070 2502 2897 gene locus_tag LOCUS_24080 2502 2897 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence314 <1 1083 gene locus_tag LOCUS_24090 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941535.1:B12-binding domain-containing radical SAM protein 1076 2845 gene locus_tag LOCUS_24100 1076 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2885 3607 gene locus_tag LOCUS_24110 2885 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence315 933 112 gene locus_tag LOCUS_24120 gene lgt 933 112 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDG0 protein_id gnl|my_center|LOCUS_24120 1791 958 gene locus_tag LOCUS_24130 1791 958 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_24130 2513 1812 gene locus_tag LOCUS_24140 gene aat 2513 1812 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC5 protein_id gnl|my_center|LOCUS_24140 <3878 2514 gene locus_tag LOCUS_24150 <3878 2514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938893.1:ATP-dependent Clp protease ATP-binding subunit ClpA >Feature sequence316 <1 944 gene locus_tag LOCUS_24160 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958440.1:ATPase 3600 952 gene locus_tag LOCUS_24170 3600 952 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 protein_id gnl|my_center|LOCUS_24170 >Feature sequence317 56 328 gene locus_tag LOCUS_24180 56 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2732 375 gene locus_tag LOCUS_24190 2732 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 3569 2808 gene locus_tag LOCUS_24200 3569 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence318 2623 1829 gene locus_tag LOCUS_24210 gene ubiE 2623 1829 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_24210 2983 2807 gene locus_tag LOCUS_24220 2983 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 3587 2994 gene locus_tag LOCUS_24230 3587 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence319 819 355 gene locus_tag LOCUS_24240 819 355 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937578.1 protein_id gnl|my_center|LOCUS_24240 2244 847 gene locus_tag LOCUS_24250 2244 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33393 protein_id gnl|my_center|LOCUS_24250 2958 2278 gene locus_tag LOCUS_24260 2958 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33392 protein_id gnl|my_center|LOCUS_24260 3126 3004 gene locus_tag LOCUS_24270 3126 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence320 74 1753 gene locus_tag LOCUS_24280 74 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1937 2248 gene locus_tag LOCUS_24290 gene rplU 1937 2248 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747M9 protein_id gnl|my_center|LOCUS_24290 2267 2521 gene locus_tag LOCUS_24300 gene rpmA 2267 2521 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NME2 protein_id gnl|my_center|LOCUS_24300 2518 3513 gene locus_tag LOCUS_24310 gene obg 2518 3513 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20964 protein_id gnl|my_center|LOCUS_24310 >Feature sequence321 852 1943 gene locus_tag LOCUS_24320 gene hisC 852 1943 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_24320 1954 2622 gene locus_tag LOCUS_24330 gene cmk 1954 2622 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749Y7 protein_id gnl|my_center|LOCUS_24330 >Feature sequence322 364 1218 gene locus_tag LOCUS_24340 gene panB 364 1218 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM79 protein_id gnl|my_center|LOCUS_24340 1223 2170 gene locus_tag LOCUS_24350 1223 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876595.1 protein_id gnl|my_center|LOCUS_24350 2197 3363 gene locus_tag LOCUS_24360 2197 3363 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249503.1 protein_id gnl|my_center|LOCUS_24360 >Feature sequence323 1306 371 gene locus_tag LOCUS_24370 1306 371 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878705.1 protein_id gnl|my_center|LOCUS_24370 1823 1341 gene locus_tag LOCUS_24380 1823 1341 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_24380 3205 1865 gene locus_tag LOCUS_24390 3205 1865 CDS product glutamate-1-semialdehyde-2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence324 <1 1782 gene locus_tag LOCUS_24400 <1 1782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942202.1:histidine kinase >Feature sequence325 <1 1017 gene locus_tag LOCUS_24410 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404834.1:molybdopterin oxidoreductase iron-sulfur-binding subunit 1042 2346 gene locus_tag LOCUS_24420 1042 2346 CDS product molybdopterin oxidoreductase membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_24420 2350 2865 gene locus_tag LOCUS_24430 2350 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence326 1969 1196 gene locus_tag LOCUS_24440 1969 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2195 1938 gene locus_tag LOCUS_24450 2195 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 3763 2255 gene locus_tag LOCUS_24460 3763 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 >Feature sequence327 455 57 gene locus_tag LOCUS_24470 gene gcvH 455 57 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPW8 protein_id gnl|my_center|LOCUS_24470 1891 641 gene locus_tag LOCUS_24480 1891 641 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_24480 2364 1921 gene locus_tag LOCUS_24490 gene asnC 2364 1921 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230688.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence328 1449 874 gene locus_tag LOCUS_24500 1449 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763834.1 protein_id gnl|my_center|LOCUS_24500 2547 1453 gene locus_tag LOCUS_24510 2547 1453 CDS product ATP/GTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25711 protein_id gnl|my_center|LOCUS_24510 3225 3046 gene locus_tag LOCUS_24520 3225 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 3517 3275 gene locus_tag LOCUS_24530 3517 3275 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DU1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence329 993 262 gene locus_tag LOCUS_24540 993 262 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_24540 2581 1331 gene locus_tag LOCUS_24550 gene thlA 2581 1331 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AR0 protein_id gnl|my_center|LOCUS_24550 <3748 2703 gene locus_tag LOCUS_24560 <3748 2703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105272.1:acyl-CoA dehydrogenase >Feature sequence330 756 499 gene locus_tag LOCUS_24570 756 499 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_24570 1433 2449 gene locus_tag LOCUS_24580 gene epd 1433 2449 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB2 protein_id gnl|my_center|LOCUS_24580 3280 2498 gene locus_tag LOCUS_24590 3280 2498 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_24590 3607 3299 gene locus_tag LOCUS_24600 3607 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 >Feature sequence331 7 363 gene locus_tag LOCUS_24610 7 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 416 1363 gene locus_tag LOCUS_24620 416 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 1376 2566 gene locus_tag LOCUS_24630 1376 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460369.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence332 434 1549 gene locus_tag LOCUS_24640 434 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 1578 1751 gene locus_tag LOCUS_24650 1578 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 1830 2093 gene locus_tag LOCUS_24660 1830 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 3132 3314 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccttgtttttctggatatggaattcagac >Feature sequence333 2 397 gene locus_tag LOCUS_24670 2 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 416 1096 gene locus_tag LOCUS_24680 416 1096 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941994.1 protein_id gnl|my_center|LOCUS_24680 2227 1166 gene locus_tag LOCUS_24690 gene cobT 2227 1166 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748J3 protein_id gnl|my_center|LOCUS_24690 3090 2641 gene locus_tag LOCUS_24700 3090 2641 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251084.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence334 45 254 gene locus_tag LOCUS_24710 45 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 346 2352 gene locus_tag LOCUS_24720 346 2352 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_24720 2502 3179 gene locus_tag LOCUS_24730 2502 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence335 16 606 gene locus_tag LOCUS_24740 16 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1194 685 gene locus_tag LOCUS_24750 1194 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2246 1260 gene locus_tag LOCUS_24760 2246 1260 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJG0 protein_id gnl|my_center|LOCUS_24760 2738 2259 gene locus_tag LOCUS_24770 2738 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 <3633 2755 gene locus_tag LOCUS_24780 <3633 2755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121514.1:peptidase >Feature sequence336 <1 826 gene locus_tag LOCUS_24790 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002666565.1:carboxylesterase >Feature sequence337 396 791 gene locus_tag LOCUS_24800 396 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 797 1783 gene locus_tag LOCUS_24810 797 1783 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_24810 1767 2693 gene locus_tag LOCUS_24820 1767 2693 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_24820 3593 2703 gene locus_tag LOCUS_24830 gene hdrB 3593 2703 CDS product heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940768.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence338 323 691 gene locus_tag LOCUS_24840 gene rplR 323 691 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZAE3 protein_id gnl|my_center|LOCUS_24840 708 1202 gene locus_tag LOCUS_24850 gene rpsE 708 1202 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG3 protein_id gnl|my_center|LOCUS_24850 1216 1398 gene locus_tag LOCUS_24860 gene rpmD 1216 1398 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73PL4 protein_id gnl|my_center|LOCUS_24860 1400 1834 gene locus_tag LOCUS_24870 gene rplO 1400 1834 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR6 protein_id gnl|my_center|LOCUS_24870 1868 3187 gene locus_tag LOCUS_24880 gene secY 1868 3187 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A7 protein_id gnl|my_center|LOCUS_24880 3221 3439 gene locus_tag LOCUS_24890 gene infA 3221 3439 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20458 protein_id gnl|my_center|LOCUS_24890 >Feature sequence339 794 126 gene locus_tag LOCUS_24900 gene lolA 794 126 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39917 protein_id gnl|my_center|LOCUS_24900 2439 850 gene locus_tag LOCUS_24910 gene lcfB 2439 850 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07610 protein_id gnl|my_center|LOCUS_24910 <3587 2542 gene locus_tag LOCUS_24920 <3587 2542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H59:chaperone protein DnaK >Feature sequence340 82 792 gene locus_tag LOCUS_24930 82 792 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932317.1 protein_id gnl|my_center|LOCUS_24930 792 1208 gene locus_tag LOCUS_24940 792 1208 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_24940 1218 2141 gene locus_tag LOCUS_24950 1218 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2144 3520 gene locus_tag LOCUS_24960 gene tolB 2144 3520 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEQ0 protein_id gnl|my_center|LOCUS_24960 >Feature sequence341 2011 77 gene locus_tag LOCUS_24970 2011 77 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545662.1 protein_id gnl|my_center|LOCUS_24970 3448 2228 gene locus_tag LOCUS_24980 3448 2228 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_24980 3540 3466 gene locus_tag LOCUS_t00290 3540 3466 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence342 1561 449 gene locus_tag LOCUS_24990 gene ftsW 1561 449 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D5 protein_id gnl|my_center|LOCUS_24990 2927 1563 gene locus_tag LOCUS_25000 gene murD 2927 1563 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182Y7 protein_id gnl|my_center|LOCUS_25000 <3530 2928 gene locus_tag LOCUS_25010 <3530 2928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q728U5:phospho-N-acetylmuramoyl-pentapeptide-transferase >Feature sequence343 291 1943 gene locus_tag LOCUS_25020 291 1943 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942466.1 protein_id gnl|my_center|LOCUS_25020 1965 2753 gene locus_tag LOCUS_25030 gene crt 1965 2753 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52046 protein_id gnl|my_center|LOCUS_25030 2772 3203 gene locus_tag LOCUS_25040 2772 3203 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence344 1136 2053 gene locus_tag LOCUS_25050 1136 2053 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 protein_id gnl|my_center|LOCUS_25050 2912 2139 gene locus_tag LOCUS_25060 2912 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence345 1481 279 gene locus_tag LOCUS_25070 gene trpB 1481 279 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6F2B7 protein_id gnl|my_center|LOCUS_25070 2170 1481 gene locus_tag LOCUS_25080 gene trpF 2170 1481 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AH7 protein_id gnl|my_center|LOCUS_25080 2980 2186 gene locus_tag LOCUS_25090 gene trpC 2980 2186 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX99 protein_id gnl|my_center|LOCUS_25090 >Feature sequence346 1176 16 gene locus_tag LOCUS_25100 gene dacB 1176 16 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175403.1 protein_id gnl|my_center|LOCUS_25100 2776 1280 gene locus_tag LOCUS_25110 gene apeA 2776 1280 CDS product putative M18 family aminopeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97K30 protein_id gnl|my_center|LOCUS_25110 >Feature sequence347 881 24 gene locus_tag LOCUS_25120 881 24 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_25120 993 1802 gene locus_tag LOCUS_25130 993 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2402 1875 gene locus_tag LOCUS_25140 2402 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence348 116 901 gene locus_tag LOCUS_25150 116 901 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_25150 904 1872 gene locus_tag LOCUS_25160 904 1872 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_25160 2308 3009 gene locus_tag LOCUS_25170 2308 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence349 735 16 gene locus_tag LOCUS_25180 735 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 980 777 gene locus_tag LOCUS_25190 980 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 1218 2465 gene locus_tag LOCUS_25200 1218 2465 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941367.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence350 1 291 gene locus_tag LOCUS_25210 1 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 943 488 gene locus_tag LOCUS_25220 943 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2438 948 gene locus_tag LOCUS_25230 2438 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence351 1561 1136 gene locus_tag LOCUS_25240 1561 1136 CDS product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423284.1 protein_id gnl|my_center|LOCUS_25240 2826 1591 gene locus_tag LOCUS_25250 2826 1591 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941367.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence352 3056 387 gene locus_tag LOCUS_25260 gene mutS 3056 387 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61667 protein_id gnl|my_center|LOCUS_25260 >Feature sequence353 1779 1108 gene locus_tag LOCUS_25270 1779 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940530.1 protein_id gnl|my_center|LOCUS_25270 1985 3019 gene locus_tag LOCUS_25280 1985 3019 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence354 203 463 gene locus_tag LOCUS_25290 203 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 460 726 gene locus_tag LOCUS_25300 460 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170383.1 protein_id gnl|my_center|LOCUS_25300 2437 998 gene locus_tag LOCUS_25310 2437 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 2703 2443 gene locus_tag LOCUS_25320 2703 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2983 3234 gene locus_tag LOCUS_25330 2983 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence355 <1 1434 gene locus_tag LOCUS_25340 <1 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261091.1:transporter 1447 1884 gene locus_tag LOCUS_25350 1447 1884 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088599.1 protein_id gnl|my_center|LOCUS_25350 1999 2970 gene locus_tag LOCUS_25360 1999 2970 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261092.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence356 579 238 gene locus_tag LOCUS_25370 579 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 1345 590 gene locus_tag LOCUS_25380 1345 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 3007 1529 gene locus_tag LOCUS_25390 3007 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence357 199 531 gene locus_tag LOCUS_25400 199 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 662 901 gene locus_tag LOCUS_25410 662 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 870 1115 gene locus_tag LOCUS_25420 870 1115 CDS product redox-active disulfide protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_25420 1149 2198 gene locus_tag LOCUS_25430 1149 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 2834 2205 gene locus_tag LOCUS_25440 2834 2205 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022718.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence358 453 653 gene locus_tag LOCUS_25450 453 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1499 864 gene locus_tag LOCUS_25460 gene thiN 1499 864 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454892.1 protein_id gnl|my_center|LOCUS_25460 1687 2775 gene locus_tag LOCUS_25470 1687 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919040.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence359 1416 355 gene locus_tag LOCUS_25480 1416 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 3002 1539 gene locus_tag LOCUS_25490 3002 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 3169 3002 gene locus_tag LOCUS_25500 3169 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence360 884 243 gene locus_tag LOCUS_25510 gene pilO 884 243 CDS product pilus assembly protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_25510 1467 892 gene locus_tag LOCUS_25520 gene pilN 1467 892 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_25520 2522 1464 gene locus_tag LOCUS_25530 gene pilM 2522 1464 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence361 277 1023 gene locus_tag LOCUS_25540 277 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 1038 2321 gene locus_tag LOCUS_25550 1038 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 2603 3004 gene locus_tag LOCUS_25560 2603 3004 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence362 1555 218 gene locus_tag LOCUS_25570 1555 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 2326 1571 gene locus_tag LOCUS_25580 2326 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 3151 2354 gene locus_tag LOCUS_25590 3151 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence363 81 1298 gene locus_tag LOCUS_25600 81 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 1925 1500 gene locus_tag LOCUS_25610 1925 1500 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114423.1 protein_id gnl|my_center|LOCUS_25610 2333 1926 gene locus_tag LOCUS_25620 2333 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence364 2074 503 gene locus_tag LOCUS_25630 2074 503 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368538.1 protein_id gnl|my_center|LOCUS_25630 3150 2113 gene locus_tag LOCUS_25640 3150 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence365 509 1243 gene locus_tag LOCUS_25650 509 1243 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240270.1 protein_id gnl|my_center|LOCUS_25650 1261 1617 gene locus_tag LOCUS_25660 gene hit 1261 1617 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence366 972 160 gene locus_tag LOCUS_25670 972 160 CDS product adenine nucleotide alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357133.1 protein_id gnl|my_center|LOCUS_25670 1272 988 gene locus_tag LOCUS_25680 1272 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 1423 1496 gene locus_tag LOCUS_t00300 1423 1496 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2544 2720 gene locus_tag LOCUS_25690 2544 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence367 <1 513 gene locus_tag LOCUS_25700 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940634.1:ribonucleotide-diphosphate reductase subunit alpha 723 1202 gene locus_tag LOCUS_25710 723 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 1344 1640 gene locus_tag LOCUS_25720 1344 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 1615 1845 gene locus_tag LOCUS_25730 1615 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1951 2262 gene locus_tag LOCUS_25740 1951 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence368 513 2399 gene locus_tag LOCUS_25750 513 2399 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707195.1 protein_id gnl|my_center|LOCUS_25750 >Feature sequence369 832 377 gene locus_tag LOCUS_25760 832 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2678 819 gene locus_tag LOCUS_25770 2678 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence370 290 2575 gene locus_tag LOCUS_25780 290 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence371 731 2275 gene locus_tag LOCUS_25790 731 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence372 359 799 gene locus_tag LOCUS_25800 359 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_25800 826 2430 gene locus_tag LOCUS_25810 826 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140695.1 protein_id gnl|my_center|LOCUS_25810 <3170 2427 gene locus_tag LOCUS_25820 <3170 2427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941506.1:histidine kinase >Feature sequence373 1198 530 gene locus_tag LOCUS_25830 1198 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 1391 1816 gene locus_tag LOCUS_25840 1391 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_25840 2514 1996 gene locus_tag LOCUS_25850 2514 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2981 2565 gene locus_tag LOCUS_25860 2981 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence374 525 2024 gene locus_tag LOCUS_25870 525 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2337 2897 gene locus_tag LOCUS_25880 gene mntP 2337 2897 CDS product putative manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727E5 protein_id gnl|my_center|LOCUS_25880 >Feature sequence375 1867 686 gene locus_tag LOCUS_25890 1867 686 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence376 586 386 gene locus_tag LOCUS_25900 586 386 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_25900 1932 997 gene locus_tag LOCUS_25910 1932 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399477.1 protein_id gnl|my_center|LOCUS_25910 2365 1937 gene locus_tag LOCUS_25920 2365 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 <3132 2388 gene locus_tag LOCUS_25930 <3132 2388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EXA3:polyamine aminopropyltransferase 2 >Feature sequence377 778 2025 gene locus_tag LOCUS_25940 778 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 2047 2706 gene locus_tag LOCUS_25950 2047 2706 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072670.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence378 2888 1353 gene locus_tag LOCUS_25960 2888 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence379 1281 334 gene locus_tag LOCUS_25970 1281 334 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 protein_id gnl|my_center|LOCUS_25970 2153 1593 gene locus_tag LOCUS_25980 2153 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 <3045 2150 gene locus_tag LOCUS_25990 <3045 2150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Y8I9:aldehyde dehydrogenase >Feature sequence380 1711 1193 gene locus_tag LOCUS_26000 1711 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence381 404 931 gene locus_tag LOCUS_26010 404 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 1005 2261 gene locus_tag LOCUS_26020 1005 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 <3006 2461 gene locus_tag LOCUS_26030 <3006 2461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582487.1:WYL domain-containing protein >Feature sequence382 1195 1749 gene locus_tag LOCUS_26040 1195 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 >Feature sequence383 754 608 gene locus_tag LOCUS_26050 754 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 <2981 751 gene locus_tag LOCUS_26060 <2981 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to I7F9Q4:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence384 <1 526 gene locus_tag LOCUS_26070 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707194.1:ABC transporter ATP-binding protein 706 906 gene locus_tag LOCUS_26080 706 906 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_26080 1158 2123 gene locus_tag LOCUS_26090 1158 2123 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_26090 <2973 2120 gene locus_tag LOCUS_26100 <2973 2120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933715.1:hybrid sensor histidine kinase/response regulator >Feature sequence385 247 1278 gene locus_tag LOCUS_26110 gene apbE 247 1278 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0M9 protein_id gnl|my_center|LOCUS_26110 1606 2631 gene locus_tag LOCUS_26120 1606 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26120 >Feature sequence386 <1 1503 gene locus_tag LOCUS_26130 <1 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259750.1:acyl-CoA synthetase 1533 2087 gene locus_tag LOCUS_26140 1533 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2089 2388 gene locus_tag LOCUS_26150 2089 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence387 248 502 gene locus_tag LOCUS_26160 248 502 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654684.1 protein_id gnl|my_center|LOCUS_26160 631 786 gene locus_tag LOCUS_26170 631 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939290.1 protein_id gnl|my_center|LOCUS_26170 1006 830 gene locus_tag LOCUS_26180 1006 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 1211 1873 gene locus_tag LOCUS_26190 1211 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence388 >Feature sequence389 1209 1637 gene locus_tag LOCUS_26200 1209 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 1646 2011 gene locus_tag LOCUS_26210 1646 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 2205 2723 gene locus_tag LOCUS_26220 2205 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26220 >Feature sequence390 2235 574 gene locus_tag LOCUS_26230 2235 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence391 97 2559 gene locus_tag LOCUS_26240 gene lon-3 97 2559 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747S2 protein_id gnl|my_center|LOCUS_26240 >Feature sequence392 202 438 gene locus_tag LOCUS_26250 202 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1227 424 gene locus_tag LOCUS_26260 1227 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 1779 1273 gene locus_tag LOCUS_26270 1779 1273 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BR6 protein_id gnl|my_center|LOCUS_26270 2791 1928 gene locus_tag LOCUS_26280 2791 1928 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence393 503 2305 gene locus_tag LOCUS_26290 503 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2298 2681 gene locus_tag LOCUS_26300 gene cheY 2298 2681 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493773.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence394 1224 193 gene locus_tag LOCUS_26310 1224 193 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_26310 2803 1406 gene locus_tag LOCUS_26320 gene fadD13 2803 1406 CDS product long-chain-fatty-acid--CoA ligase FadD13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416081.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence395 1521 640 gene locus_tag LOCUS_26330 gene glyQ 1521 640 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5K3 protein_id gnl|my_center|LOCUS_26330 2593 1553 gene locus_tag LOCUS_26340 2593 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence396 >Feature sequence397 917 1582 gene locus_tag LOCUS_26350 917 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 1633 2091 gene locus_tag LOCUS_26360 1633 2091 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038584.1 protein_id gnl|my_center|LOCUS_26360 2586 2095 gene locus_tag LOCUS_26370 2586 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087770.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence398 2089 1457 gene locus_tag LOCUS_26380 2089 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 >Feature sequence399 1552 245 gene locus_tag LOCUS_26390 1552 245 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403690.1 protein_id gnl|my_center|LOCUS_26390 2282 1545 gene locus_tag LOCUS_26400 2282 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 >Feature sequence400 1792 2703 gene locus_tag LOCUS_26410 gene miaA 1792 2703 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I21 protein_id gnl|my_center|LOCUS_26410 >Feature sequence401 376 525 gene locus_tag LOCUS_26420 376 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 568 864 gene locus_tag LOCUS_26430 568 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 1081 914 gene locus_tag LOCUS_26440 1081 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 2005 1361 gene locus_tag LOCUS_26450 2005 1361 CDS product riboflavin deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887768.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence402 1290 367 gene locus_tag LOCUS_26460 1290 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 2017 1883 gene locus_tag LOCUS_26470 2017 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence403 102 974 gene locus_tag LOCUS_26480 102 974 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029335.1 protein_id gnl|my_center|LOCUS_26480 1708 989 gene locus_tag LOCUS_26490 gene pdxJ 1708 989 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8C9 protein_id gnl|my_center|LOCUS_26490 2133 1729 gene locus_tag LOCUS_26500 gene ybeY 2133 1729 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AR8 protein_id gnl|my_center|LOCUS_26500 <2744 2090 gene locus_tag LOCUS_26510 <2744 2090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942922.1:HD family phosphohydrolase >Feature sequence404 548 1858 gene locus_tag LOCUS_26520 548 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 1914 2591 gene locus_tag LOCUS_26530 gene ispD 1914 2591 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CD1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence405 319 393 gene locus_tag LOCUS_t00310 319 393 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 435 1373 gene locus_tag LOCUS_26540 gene prsA 435 1373 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE8 protein_id gnl|my_center|LOCUS_26540 1429 2085 gene locus_tag LOCUS_26550 gene rplY 1429 2085 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMV5 protein_id gnl|my_center|LOCUS_26550 2097 2690 gene locus_tag LOCUS_26560 gene spoVC 2097 2690 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37470 protein_id gnl|my_center|LOCUS_26560 >Feature sequence406 742 1752 gene locus_tag LOCUS_26570 gene ltaA 742 1752 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943783.1 protein_id gnl|my_center|LOCUS_26570 <2731 1733 gene locus_tag LOCUS_26580 <2731 1733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F801:citrate synthase >Feature sequence407 207 416 gene locus_tag LOCUS_26590 207 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 562 2208 gene locus_tag LOCUS_26600 562 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence408 1 648 gene locus_tag LOCUS_26610 gene nadD 1 648 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ5 protein_id gnl|my_center|LOCUS_26610 645 1031 gene locus_tag LOCUS_26620 gene rsfS 645 1031 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92BM7 protein_id gnl|my_center|LOCUS_26620 1033 2589 gene locus_tag LOCUS_26630 gene gpmI 1033 2589 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Q8 protein_id gnl|my_center|LOCUS_26630 >Feature sequence409 561 1571 gene locus_tag LOCUS_26640 gene aroG-1 561 1571 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943946.1 protein_id gnl|my_center|LOCUS_26640 1571 2605 gene locus_tag LOCUS_26650 gene aroB 1571 2605 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AJ2 protein_id gnl|my_center|LOCUS_26650 >Feature sequence410 767 1285 gene locus_tag LOCUS_26660 767 1285 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545501.1 protein_id gnl|my_center|LOCUS_26660 >Feature sequence411 30 1676 gene locus_tag LOCUS_26670 30 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1744 2457 gene locus_tag LOCUS_26680 1744 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 >Feature sequence412 75 1 gene locus_tag LOCUS_t00320 75 1 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 340 134 gene locus_tag LOCUS_26690 340 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 1136 351 gene locus_tag LOCUS_26700 1136 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 <2672 1462 gene locus_tag LOCUS_26710 <2672 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C40:glutamine synthetase >Feature sequence413 832 404 gene locus_tag LOCUS_26720 832 404 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774559.1 protein_id gnl|my_center|LOCUS_26720 1495 1049 gene locus_tag LOCUS_26730 1495 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 1902 1663 gene locus_tag LOCUS_26740 1902 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence414 <2656 1796 gene locus_tag LOCUS_26750 <2656 1796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943956.1:ATPase AAA >Feature sequence415 663 1898 gene locus_tag LOCUS_26760 663 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 >Feature sequence416 2336 852 gene locus_tag LOCUS_26770 2336 852 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943658.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence417 390 2228 gene locus_tag LOCUS_26780 gene uup 390 2228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_26780 2237 2446 gene locus_tag LOCUS_26790 2237 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence418 1439 66 gene locus_tag LOCUS_26800 1439 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2085 1456 gene locus_tag LOCUS_26810 2085 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 <2579 2076 gene locus_tag LOCUS_26820 <2579 2076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000453372.1:membrane protein >Feature sequence419 >Feature sequence420 346 675 gene locus_tag LOCUS_26830 346 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_26830 723 1184 gene locus_tag LOCUS_26840 723 1184 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876282.1 protein_id gnl|my_center|LOCUS_26840 1187 2071 gene locus_tag LOCUS_26850 1187 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence421 354 1280 gene locus_tag LOCUS_26860 gene hslO 354 1280 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q034W5 protein_id gnl|my_center|LOCUS_26860 1657 1959 gene locus_tag LOCUS_26870 1657 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence422 260 1207 gene locus_tag LOCUS_26880 gene birA 260 1207 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CI75 protein_id gnl|my_center|LOCUS_26880 1220 1750 gene locus_tag LOCUS_26890 1220 1750 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867279.1 protein_id gnl|my_center|LOCUS_26890 1775 2530 gene locus_tag LOCUS_26900 1775 2530 CDS product cobalt ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870600.1 protein_id gnl|my_center|LOCUS_26900 >Feature sequence423 1699 518 gene locus_tag LOCUS_26910 1699 518 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903548.1 protein_id gnl|my_center|LOCUS_26910 2062 1733 gene locus_tag LOCUS_26920 2062 1733 CDS product ferredoxin:thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938183.1 protein_id gnl|my_center|LOCUS_26920 2318 2052 gene locus_tag LOCUS_26930 2318 2052 CDS product NrdH-redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938182.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence424 >Feature sequence425 345 1802 gene locus_tag LOCUS_26940 gene gcvP' 345 1802 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZP2 protein_id gnl|my_center|LOCUS_26940 >Feature sequence426 1647 2138 gene locus_tag LOCUS_26950 1647 2138 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496594.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence427 1567 44 gene locus_tag LOCUS_26960 1567 44 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732434.1 protein_id gnl|my_center|LOCUS_26960 <2528 1869 gene locus_tag LOCUS_26970 <2528 1869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065465.1:alcohol dehydrogenase >Feature sequence428 2281 392 gene locus_tag LOCUS_26980 2281 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence429 1693 1001 gene locus_tag LOCUS_26990 1693 1001 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709520.1 protein_id gnl|my_center|LOCUS_26990 1828 2079 gene locus_tag LOCUS_27000 1828 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 >Feature sequence430 211 726 gene locus_tag LOCUS_27010 gene greB 211 726 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY5 protein_id gnl|my_center|LOCUS_27010 787 2034 gene locus_tag LOCUS_27020 gene rhlB-2 787 2034 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186962.1 protein_id gnl|my_center|LOCUS_27020 2071 2328 gene locus_tag LOCUS_27030 2071 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence431 220 2184 gene locus_tag LOCUS_27040 gene cooS 220 2184 CDS product carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence432 487 1059 gene locus_tag LOCUS_27050 gene resA 487 1059 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence433 116 676 gene locus_tag LOCUS_27060 116 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 688 1962 gene locus_tag LOCUS_27070 688 1962 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813565.1 protein_id gnl|my_center|LOCUS_27070 >Feature sequence434 <1 925 gene locus_tag LOCUS_27080 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E7B9:RecBCD enzyme subunit RecB 1156 1614 gene locus_tag LOCUS_27090 1156 1614 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249777.1 protein_id gnl|my_center|LOCUS_27090 2327 1674 gene locus_tag LOCUS_27100 2327 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence435 1 600 gene locus_tag LOCUS_27110 1 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 648 2015 gene locus_tag LOCUS_27120 648 2015 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence436 992 321 gene locus_tag LOCUS_27130 992 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1442 1526 gene locus_tag LOCUS_t00330 1442 1526 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2113 1577 gene locus_tag LOCUS_27140 2113 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 >Feature sequence437 <1 885 gene locus_tag LOCUS_27150 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVX6:tryptophan--tRNA ligase 1566 874 gene locus_tag LOCUS_27160 1566 874 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q812Q1 protein_id gnl|my_center|LOCUS_27160 <2409 1568 gene locus_tag LOCUS_27170 <2409 1568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P62061:arginine biosynthesis bifunctional protein ArgJ >Feature sequence438 >Feature sequence439 >Feature sequence440 776 345 gene locus_tag LOCUS_27180 776 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 1950 793 gene locus_tag LOCUS_27190 1950 793 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546010.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence441 1409 1846 gene locus_tag LOCUS_27200 1409 1846 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706462.1 protein_id gnl|my_center|LOCUS_27200 >Feature sequence442 1099 200 gene locus_tag LOCUS_27210 1099 200 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E09 protein_id gnl|my_center|LOCUS_27210 <2379 1355 gene locus_tag LOCUS_27220 <2379 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A6B2:glutamate dehydrogenase >Feature sequence443 281 856 gene locus_tag LOCUS_27230 281 856 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023860.1 protein_id gnl|my_center|LOCUS_27230 1202 1417 gene locus_tag LOCUS_27240 1202 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 1624 2085 gene locus_tag LOCUS_27250 1624 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence444 1365 223 gene locus_tag LOCUS_27260 1365 223 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252562.1 protein_id gnl|my_center|LOCUS_27260 <2340 1394 gene locus_tag LOCUS_27270 <2340 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530414.1:ABC transporter >Feature sequence445 3 890 gene locus_tag LOCUS_27280 3 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 1687 908 gene locus_tag LOCUS_27290 1687 908 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_27290 2201 1692 gene locus_tag LOCUS_27300 2201 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence446 86 1330 gene locus_tag LOCUS_27310 86 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1350 2285 gene locus_tag LOCUS_27320 1350 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 >Feature sequence447 <1 1803 gene locus_tag LOCUS_27330 <1 1803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869551.1:aldehyde ferredoxin oxidoreductase 1807 2004 gene locus_tag LOCUS_27340 1807 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence448 1334 9 gene locus_tag LOCUS_27350 1334 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2250 1726 gene locus_tag LOCUS_27360 2250 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence449 351 1514 gene locus_tag LOCUS_27370 351 1514 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_27370 1926 1663 gene locus_tag LOCUS_27380 1926 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence450 58 843 gene locus_tag LOCUS_27390 58 843 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_27390 846 1586 gene locus_tag LOCUS_27400 846 1586 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_27400 1623 2075 gene locus_tag LOCUS_27410 1623 2075 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938540.1 protein_id gnl|my_center|LOCUS_27410 >Feature sequence451 491 147 gene locus_tag LOCUS_27420 491 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 841 1221 gene locus_tag LOCUS_27430 841 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1236 1682 gene locus_tag LOCUS_27440 gene arsC 1236 1682 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_27440 >Feature sequence452 808 1380 gene locus_tag LOCUS_27450 808 1380 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_27450 2125 1523 gene locus_tag LOCUS_27460 2125 1523 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence453 1333 485 gene locus_tag LOCUS_27470 1333 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 2069 1482 gene locus_tag LOCUS_27480 2069 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 >Feature sequence454 1735 818 gene locus_tag LOCUS_27490 1735 818 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385788.1 protein_id gnl|my_center|LOCUS_27490 <2255 1735 gene locus_tag LOCUS_27500 <2255 1735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963501.1:peptide ABC transporter permease >Feature sequence455 602 135 gene locus_tag LOCUS_27510 gene greA 602 135 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJG9 protein_id gnl|my_center|LOCUS_27510 1378 635 gene locus_tag LOCUS_27520 gene pssA 1378 635 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_27520 2058 1396 gene locus_tag LOCUS_27530 gene psd 2058 1396 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IM1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence456 199 894 gene locus_tag LOCUS_27540 199 894 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528167.1 protein_id gnl|my_center|LOCUS_27540 996 1859 gene locus_tag LOCUS_27550 gene dapF 996 1859 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV61 protein_id gnl|my_center|LOCUS_27550 >Feature sequence457 <1 986 gene locus_tag LOCUS_27560 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061160.1:methanogenesis marker 2 protein 1043 1375 gene locus_tag LOCUS_27570 1043 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence458 1154 468 gene locus_tag LOCUS_27580 1154 468 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948859.1 protein_id gnl|my_center|LOCUS_27580 <2207 1210 gene locus_tag LOCUS_27590 <2207 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261736.1:ABC transporter permease >Feature sequence459 <1 996 gene locus_tag LOCUS_27600 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261889.1:aminopeptidase N <2183 1041 gene locus_tag LOCUS_27610 <2183 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942461.1:UDP-glucose 6-dehydrogenase >Feature sequence460 362 1840 gene locus_tag LOCUS_27620 362 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 >Feature sequence461 2091 484 gene locus_tag LOCUS_27630 2091 484 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943955.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence462 1717 527 gene locus_tag LOCUS_27640 1717 527 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706369.1 protein_id gnl|my_center|LOCUS_27640 2130 1762 gene locus_tag LOCUS_27650 gene gloA 2130 1762 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419037.1 protein_id gnl|my_center|LOCUS_27650 >Feature sequence463 60 1088 gene locus_tag LOCUS_27660 60 1088 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943187.1 protein_id gnl|my_center|LOCUS_27660 <2158 1130 gene locus_tag LOCUS_27670 <2158 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096276.1:secretion pathway ATPase >Feature sequence464 1655 267 gene locus_tag LOCUS_27680 1655 267 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_27680 2149 1658 gene locus_tag LOCUS_27690 2149 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence465 700 305 gene locus_tag LOCUS_27700 gene rpsI 700 305 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748X5 protein_id gnl|my_center|LOCUS_27700 1160 726 gene locus_tag LOCUS_27710 gene rplM 1160 726 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728T4 protein_id gnl|my_center|LOCUS_27710 1636 1235 gene locus_tag LOCUS_27720 1636 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence466 955 308 gene locus_tag LOCUS_27730 955 308 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496455.1 protein_id gnl|my_center|LOCUS_27730 >Feature sequence467 1194 22 gene locus_tag LOCUS_27740 1194 22 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DT8 protein_id gnl|my_center|LOCUS_27740 1832 1251 gene locus_tag LOCUS_27750 1832 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence468 1735 581 gene locus_tag LOCUS_27760 gene rhlB 1735 581 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887N8 protein_id gnl|my_center|LOCUS_27760 >Feature sequence469 1135 509 gene locus_tag LOCUS_27770 1135 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 1541 1128 gene locus_tag LOCUS_27780 1541 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence470 1054 104 gene locus_tag LOCUS_27790 1054 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55451 protein_id gnl|my_center|LOCUS_27790 <2121 1063 gene locus_tag LOCUS_27800 <2121 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528031.1:FAD-dependent oxidoreductase >Feature sequence471 1720 143 gene locus_tag LOCUS_27810 1720 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 >Feature sequence472 430 783 gene locus_tag LOCUS_27820 430 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496603.1 protein_id gnl|my_center|LOCUS_27820 1817 918 gene locus_tag LOCUS_27830 1817 918 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence473 133 1527 gene locus_tag LOCUS_27840 133 1527 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence474 <1 540 gene locus_tag LOCUS_27850 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109491.1:carbohydrate kinase >Feature sequence475 1337 306 gene locus_tag LOCUS_27860 gene fcl 1337 306 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 protein_id gnl|my_center|LOCUS_27860 <2073 1307 gene locus_tag LOCUS_27870 <2073 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87UA9:dTDP-glucose 4,6-dehydratase >Feature sequence476 <1 1786 gene locus_tag LOCUS_27880 <1 1786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CZ9:phenylalanine--tRNA ligase beta subunit >Feature sequence477 590 378 gene locus_tag LOCUS_27890 590 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 1463 810 gene locus_tag LOCUS_27900 1463 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 1514 1723 gene locus_tag LOCUS_27910 1514 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence478 <1 591 gene locus_tag LOCUS_27920 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808106.1:histidine kinase 2057 612 gene locus_tag LOCUS_27930 2057 612 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258445.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence479 <2057 924 gene locus_tag LOCUS_27940 <2057 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393389.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence480 <1 1021 gene locus_tag LOCUS_27950 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941262.1:two-component sensor histidine kinase >Feature sequence481 <2025 1133 gene locus_tag LOCUS_27960 <2025 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000553997.1:magnesium chelatase >Feature sequence482 >Feature sequence483 308 1177 gene locus_tag LOCUS_27970 gene lipA 308 1177 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHM6 protein_id gnl|my_center|LOCUS_27970 <2011 1337 gene locus_tag LOCUS_27980 <2011 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MR8:pyruvate kinase >Feature sequence484 1692 817 gene locus_tag LOCUS_27990 1692 817 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021957.1 protein_id gnl|my_center|LOCUS_27990 2011 1712 gene locus_tag LOCUS_28000 2011 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence485 >Feature sequence486 1500 1425 gene locus_tag LOCUS_t00340 1500 1425 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence487 682 245 gene locus_tag LOCUS_28010 gene yqaA 682 245 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941021.1 protein_id gnl|my_center|LOCUS_28010 1560 688 gene locus_tag LOCUS_28020 gene ykwC 1560 688 CDS product putative oxidoreductase YkwC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34948 protein_id gnl|my_center|LOCUS_28020 >Feature sequence488 481 236 gene locus_tag LOCUS_28030 481 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 1212 868 gene locus_tag LOCUS_28040 1212 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence489 1362 922 gene locus_tag LOCUS_28050 1362 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 1595 1422 gene locus_tag LOCUS_28060 1595 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28060 >Feature sequence490 327 1787 gene locus_tag LOCUS_28070 gene katA 327 1787 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72WJ8 protein_id gnl|my_center|LOCUS_28070 >Feature sequence491 1264 59 gene locus_tag LOCUS_28080 1264 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 <1898 1397 gene locus_tag LOCUS_28090 <1898 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74B17:histidine kinase >Feature sequence492 <1 1704 gene locus_tag LOCUS_28100 <1 1704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940549.1:pyridine nucleotide-disulfide oxidoreductase >Feature sequence493 >Feature sequence494 108 1244 gene locus_tag LOCUS_28110 gene murG 108 1244 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D6 protein_id gnl|my_center|LOCUS_28110 >Feature sequence495 792 166 gene locus_tag LOCUS_28120 792 166 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185713.1 protein_id gnl|my_center|LOCUS_28120 1610 834 gene locus_tag LOCUS_28130 1610 834 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942276.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence496 494 33 gene locus_tag LOCUS_28140 494 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 1369 596 gene locus_tag LOCUS_28150 1369 596 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971063.1 protein_id gnl|my_center|LOCUS_28150 1867 1406 gene locus_tag LOCUS_28160 1867 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence497 1483 761 gene locus_tag LOCUS_28170 1483 761 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728378.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence498 1210 476 gene locus_tag LOCUS_28180 1210 476 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460218.1 protein_id gnl|my_center|LOCUS_28180 >Feature sequence499 1584 538 gene locus_tag LOCUS_28190 1584 538 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533036.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence500 >Feature sequence501 <1 975 gene locus_tag LOCUS_28200 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881164.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence502 104 1357 gene locus_tag LOCUS_28210 gene murA 104 1357 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKS2 protein_id gnl|my_center|LOCUS_28210 1559 1380 gene locus_tag LOCUS_28220 1559 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence503 1348 218 gene locus_tag LOCUS_28230 1348 218 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence504 <1 1257 gene locus_tag LOCUS_28240 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YJS7:2-isopropylmalate synthase 1360 1809 gene locus_tag LOCUS_28250 1360 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_28250 >Feature sequence505 <1821 463 gene locus_tag LOCUS_28260 <1821 463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083710.1:acyl CoA:acetate/3-ketoacid CoA transferase note possible pseudo, internal stop codon >Feature sequence506 <1 1207 gene locus_tag LOCUS_28270 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879017.1:MBL fold metallo-hydrolase 1293 1760 gene locus_tag LOCUS_28280 1293 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence507 1260 718 gene locus_tag LOCUS_28290 1260 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 >Feature sequence508 88 1221 gene locus_tag LOCUS_28300 gene phnW 88 1221 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64V97 protein_id gnl|my_center|LOCUS_28300 >Feature sequence509 <1785 35 gene locus_tag LOCUS_28310 <1785 35 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048452.1:nucleoid occlusion protein >Feature sequence510 <1782 687 gene locus_tag LOCUS_28320 <1782 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870226.1:aspartate aminotransferase family protein >Feature sequence511 <1 1372 gene locus_tag LOCUS_28330 <1 1372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545811.1:peptide-binding protein >Feature sequence512 1169 444 gene locus_tag LOCUS_28340 1169 444 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RI8 protein_id gnl|my_center|LOCUS_28340 >Feature sequence513 <1 609 gene locus_tag LOCUS_28350 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945170.1:trimethylamine methyltransferase 642 806 gene locus_tag LOCUS_28360 642 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 1393 1575 gene locus_tag LOCUS_28370 1393 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence514 >Feature sequence515 >Feature sequence516 1 651 gene locus_tag LOCUS_28380 1 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 >Feature sequence517 1516 227 gene locus_tag LOCUS_28390 1516 227 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence518 389 892 gene locus_tag LOCUS_28400 389 892 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808807.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence519 <1 1334 gene locus_tag LOCUS_28410 <1 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762837.1:serine hydroxymethyltransferase >Feature sequence520 >Feature sequence521 <1 620 gene locus_tag LOCUS_28420 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228885.1:fatty-acyl-CoA synthase 965 1210 gene locus_tag LOCUS_28430 965 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence522 >Feature sequence523 1329 394 gene locus_tag LOCUS_28440 gene prmA 1329 394 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I638 protein_id gnl|my_center|LOCUS_28440 >Feature sequence524 780 1226 gene locus_tag LOCUS_28450 780 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1223 1441 gene locus_tag LOCUS_28460 1223 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence525 >Feature sequence526 1265 861 gene locus_tag LOCUS_28470 1265 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 >Feature sequence527 >Feature sequence528 1610 33 gene locus_tag LOCUS_28480 1610 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence529 207 926 gene locus_tag LOCUS_28490 207 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1646 978 gene locus_tag LOCUS_28500 1646 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence530 919 353 gene locus_tag LOCUS_28510 919 353 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMD9 protein_id gnl|my_center|LOCUS_28510 >Feature sequence531 1432 119 gene locus_tag LOCUS_28520 1432 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence532 374 1381 gene locus_tag LOCUS_28530 374 1381 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_28530 >Feature sequence533 655 1431 gene locus_tag LOCUS_28540 655 1431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_28540 >Feature sequence534 477 758 gene locus_tag LOCUS_28550 477 758 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103157.1 protein_id gnl|my_center|LOCUS_28550 878 1495 gene locus_tag LOCUS_28560 878 1495 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528636.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence535 >Feature sequence536 >Feature sequence537 1192 287 gene locus_tag LOCUS_28570 1192 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence538 >Feature sequence539 765 1448 gene locus_tag LOCUS_28580 765 1448 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545398.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence540 695 471 gene locus_tag LOCUS_28590 695 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 1386 994 gene locus_tag LOCUS_28600 1386 994 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKP7 protein_id gnl|my_center|LOCUS_28600 >Feature sequence541 62 955 gene locus_tag LOCUS_28610 62 955 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972040.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence542 1391 1140 gene locus_tag LOCUS_28620 1391 1140 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061274.1 protein_id gnl|my_center|LOCUS_28620 >Feature sequence543 1086 238 gene locus_tag LOCUS_28630 gene ligA-2 1086 238 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225694.1 protein_id gnl|my_center|LOCUS_28630 >Feature sequence544 <1547 681 gene locus_tag LOCUS_28640 <1547 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001882433.1:ABC transporter substrate-binding protein >Feature sequence545 1181 360 gene locus_tag LOCUS_28650 1181 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence546 366 527 gene locus_tag LOCUS_28660 366 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence547 >Feature sequence548 >Feature sequence549 883 23 gene locus_tag LOCUS_28670 883 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 >Feature sequence550 >Feature sequence551 1242 136 gene locus_tag LOCUS_28680 1242 136 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009348598.1 protein_id gnl|my_center|LOCUS_28680