COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..536596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(167..3820) product trifunctional nucleotide phosphoesterase protein YfkN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34313 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene yfkN CDS complement(4354..5331) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(5344..5793) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(6108..6566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(6656..6943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964058.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(7055..7579) product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948049.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 7885..9282 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393641.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(9333..10406) product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435926.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(10627..11313) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HHM6 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene pfs CDS complement(11619..12167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(12421..14325) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185T3 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(14318..14632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(14923..15456) product DUF4825 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986665.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(15697..16173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(16384..17355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965555.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(17541..18701) product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966662.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(18834..19313) product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939955.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene dut CDS complement(19412..20239) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399301.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(20321..21217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(21220..22641) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene glpA CDS complement(22846..24933) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861272.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(24923..25726) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896767.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(25916..26116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(26125..26709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(26841..27683) product metallo-hydrolase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860919.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(27689..27946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 28204..28599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(28649..29059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009914334.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(29173..29634) product putative N-acetyltransferase YvbK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32248 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene yvbK CDS 29845..30027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(30134..30724) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102425.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(30972..31652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(31717..32259) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643829.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(32608..33291) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860736.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(33303..35879) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860737.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 36091..37026 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860738.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 37053..37790 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434827.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(37852..38640) product ABC transporter-associated protein EcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454391.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 38833..39471 product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056220.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene ho1 CDS complement(39546..40061) product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186E9 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene cysE CDS complement(40063..40965) product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436514.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene cysK CDS complement(41222..41722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 41964..42446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(42506..43273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 43421..43750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(43985..46096) product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185E5 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene topB2 CDS complement(46208..47059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898089.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(47207..47623) product branched-chain alpha-keto acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546565.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(47617..48258) product pyrrolidone-carboxylate peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186N3 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene pcp CDS complement(48292..49224) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433654.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(49239..49904) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889567.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(50260..50520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(50847..51059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 51644..51982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(52061..53269) product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861646.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(53442..54506) product phosphatidylglycerol lysyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180G3 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene mprF CDS complement(54683..57211) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861274.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(57369..58574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439078.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(58849..59673) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804156.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(59690..60634) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(60699..61997) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(62146..63426) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 63643..64812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(64843..66240) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986317.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(66319..68109) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(68371..70161) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(70455..70751) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438666.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(70830..71750) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182M7 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene rnz CDS 72051..73364 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 73520..74575 product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(74680..75216) product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene rbr CDS complement(75401..75745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(75827..76438) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966864.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(76475..77497) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene potA CDS complement(77484..78287) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(78296..79153) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948769.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene potB CDS complement(79146..80357) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(80444..80638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(80992..81867) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(81889..82389) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(82589..83719) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949066.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 84097..85032 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430615.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 85258..86247 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene yrbG CDS complement(86311..88677) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860956.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(88765..91128) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948260.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 91270..91518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 91704..91880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(91909..93336) product PTS system N-acetylglucosamine-specific EIICB component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34521 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene nagP CDS complement(93471..94421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 94546..95001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986683.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(95041..95757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(95994..96173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(96256..96504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(96465..97079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(97190..97798) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578704.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(97902..99605) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948347.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 100305..100760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(100954..101325) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430159.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(101328..101693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(101787..104789) product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861210.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(104866..105714) product 6-phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890830.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 105962..106516 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454936.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(106582..108246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(108313..108708) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986720.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(108789..109208) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986719.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 109237..109977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(110050..110757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948399.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(110855..111694) product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898793.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(111836..112504) product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879388.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 112777..114375 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LD2 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene prfC CDS complement(114444..114797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(115133..116872) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830004.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(117158..118129) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015945.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 118424..119176 product spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 119163..119966 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861383.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 120056..121093 product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 121301..122365 product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(122433..123404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253916.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(123588..124466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861406.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(124595..125080) product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZ46 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene tpx CDS complement(125225..126073) product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080391.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(126159..126734) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436409.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(126881..128020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(128034..129488) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253150.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(129491..130180) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948336.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(130200..132038) product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436426.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene asnB CDS complement(132237..132440) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423148.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene cspD CDS complement(132551..134395) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(134388..136592) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 136744..137187 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358480.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(137216..140449) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108776.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(140603..140791) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422320.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 141003..141713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(141744..142151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(142207..142596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 142757..143902 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861454.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(143925..145202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(145360..146277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(146312..146950) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454888.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(147133..147525) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181R6 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene ssb1 CDS 147671..148267 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7T6 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene ppiB CDS complement(148298..149659) product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97JC4 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene bioA CDS complement(149675..150361) product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I426 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene bioD CDS complement(150374..151324) product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I427 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene bioB CDS complement(151486..151617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(151745..152314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(152330..153067) product putative serine/threonine-protein kinase YbdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31435 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene ybdM CDS complement(153064..153276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(153439..153936) product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861631.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene ptsG-A CDS 154354..155763 product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861309.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(155808..157787) product fructose-1,6-bisphosphatase class 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B55 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene fbp CDS complement(157975..159537) product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183L8 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene mviN CDS complement(159600..160040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(160050..161402) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(161459..162556) product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BX9 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(162557..163243) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889262.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(163310..164482) product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BX5 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene sigA1 CDS complement(164501..166318) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BX2 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene dnaG CDS complement(166588..167361) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419887.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene aroF CDS complement(167345..167848) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438641.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene folK CDS complement(167841..168206) product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BX1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene folB CDS complement(168214..169005) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BX0 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene folP CDS complement(169016..169588) product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BW7 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene folE CDS complement(169628..170299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896367.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(170292..171038) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438634.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene pabC CDS complement(171028..172371) product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene pabB CDS complement(172365..172958) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene pabA CDS 173176..173340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(173355..173678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426603.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(173771..174466) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896360.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(174493..175494) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861215.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(175684..176496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438621.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(176846..177712) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(177749..178441) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889244.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(178434..178808) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419862.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(178922..179896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(180146..181534) product multiprotein complex assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(181649..183040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861213.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(183145..183948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(184021..184347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 184500..186263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 186692..188116 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(188143..188901) product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454389.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(188915..190069) product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454390.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(190189..191142) product K+-dependent Na+/Ca+ exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 191323..192141 product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BM1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(192178..192681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 192816..193679 product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(193705..194199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(194351..195946) product Na/Pi cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 196068..197534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(197542..198543) product peptidase S55 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene spoIVB CDS complement(198773..199420) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429358.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(199548..201056) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015880.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(201242..202027) product L-beta-lysine 5,6-aminomutase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX8 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(202027..203604) product L-beta-lysine 5,6-aminomutase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX7 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(203623..205011) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX6 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(205096..206115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015883.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(206225..207475) product L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX4 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene kamA CDS complement(207494..208525) product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX3 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene kdd CDS complement(208543..209202) product butyrate--acetoacetate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23673 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene ctfB CDS complement(209203..209856) product butyrate--acetoacetate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33752 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene ctfA CDS complement(209878..210723) product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX2 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene kce CDS complement(210747..211127) product 3-aminobutyryl-CoA ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene kal CDS complement(211204..212178) product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene etfA CDS complement(212233..213030) product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene etfB CDS complement(213058..214182) product butyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene bcd2 CDS complement(214293..215501) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903642.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(215729..216640) product putative HTH-type transcriptional regulator YwbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39592 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene ywbI CDS complement(216880..217308) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 217448..217990 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861206.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 218116..219060 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861205.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(219095..220042) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861204.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 220333..221673 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902485.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(221746..222312) product 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964937.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(222322..223110) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438534.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(223124..224401) product putative competence-damage inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BS8 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene cinA CDS 224547..225695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(225722..225970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 note possible pseudo, internal stop codon CDS complement(225992..226696) product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439905.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 note possible pseudo, internal stop codon CDS complement(226720..227658) product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180U9 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(227636..228511) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966235.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene gatY CDS complement(228530..229723) product tagatose-6-phosphate ketose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263815.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene agaS CDS 229901..230089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 230198..230455 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889719.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(230554..231738) product putative methylmalonyl-CoA decarboxylase, beta-subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269323.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(231772..232155) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269328.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(232173..232559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(232574..234121) product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(234149..234559) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(234575..235510) product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(235525..235926) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(235941..237611) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(237947..239440) product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861532.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene cat1 CDS complement(239480..240853) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861533.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 241074..241943 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 242020..242664 product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357915.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(242679..243881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(243962..244843) product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435130.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 245069..246982 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861202.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(247027..247626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 248104..249483 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071470.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene argW CDS 249717..251864 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861228.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 251934..252134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 252306..252839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 note possible pseudo, frameshifted CDS 252836..253105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 note possible pseudo, frameshifted CDS complement(253186..253761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419758.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(253978..255378) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185B5 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene asnC CDS 255796..256191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(256246..256440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890435.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(256502..258175) product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene cspC CDS complement(258194..259573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(259861..261507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 261647..262735 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430436.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 262878..263621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(263643..265235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440234.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(265495..266532) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186X6 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene gapB CDS complement(266710..266916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(267006..269003) product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227211.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene pbp3 CDS complement(269117..269743) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420189.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(269941..270345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(270433..271302) product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186F1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene map2 CDS complement(271432..271845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(271956..274133) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861168.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(274304..276481) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861168.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(276639..278024) product ligand-binding protein SH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861123.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(278312..278875) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904666.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(278961..279473) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356248.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(279565..280902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 281055..281804 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187V6 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(281849..282124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(282242..282430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(282484..283164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(283226..284293) product antibiotic ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082555.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(284293..285009) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475593.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 285164..285754 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205505.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(285787..286338) product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888695.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene maa CDS complement(286353..288014) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(288166..288954) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771997.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(288959..290614) product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949140.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(290888..291892) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949137.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(292063..292350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(292480..292707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(292796..294919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 tRNA complement(295000..295088) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(295229..298426) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(298516..300543) product two-component sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252884.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(300707..300907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(301115..301597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 note possible pseudo, internal stop codon CDS complement(301616..302005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 note possible pseudo, internal stop codon CDS complement(302142..303818) product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene cspC CDS complement(303835..306834) product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903108.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene cspBA CDS 307306..307761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892191.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(307819..309006) product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048414.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(309016..310392) product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048413.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene thiH CDS complement(310409..311458) product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048412.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene bioB CDS complement(311736..313136) product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198738.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(313338..313514) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356490.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 313693..314307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(314322..314822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 314938..315750 product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(315779..316219) product UPF0251 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I1K5 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(316189..316662) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948972.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(316680..317036) product nitrogenase iron-molybdenum cofactor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254715.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(317052..317903) product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(317894..318724) product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986700.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(318751..319107) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986701.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 319293..319916 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438469.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(319991..321535) product glycine/betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948787.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene opuD CDS complement(321731..322516) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438785.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(322675..323457) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438785.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(323599..324369) product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965945.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(324474..325817) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861407.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(325979..328597) product calcium-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861573.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(328801..328947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(328988..331606) product calcium-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861573.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 331966..332514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861505.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(332518..333012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(333204..335099) product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene fruABC CDS complement(335105..336022) product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185E1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene fruK CDS complement(336141..337916) product transcription antitermination protein BlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893554.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(338051..338239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 338411..339544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254353.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(339559..340317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(340536..342125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965494.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(342150..342449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(342450..342611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(342675..343007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(343124..343363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(343380..343685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(343706..344440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870576.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(344445..345632) product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(345635..346681) product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 346832..347845 product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986989.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 347856..348710 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182S2 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene fmt CDS 348733..349773 product N-acetylneuraminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255219.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(349863..350306) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986713.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(350320..350784) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(350933..352348) product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene cstA CDS complement(352516..354438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(354567..355280) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(355363..355839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(355979..356854) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q17ZY0 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(357347..358411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860808.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 358889..359317 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935678.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(359512..360015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(360263..360475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(360941..361174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(361164..361688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(361694..362149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(362760..363743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 363847..364029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(364143..364505) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813961.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(364553..367099) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966109.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 367220..367528 product phosphoribosyl-ATP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(367701..369149) product histidine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016319.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(369341..370900) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966133.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(370902..372029) product proline/glycine betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437132.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene opuCA CDS complement(372254..373318) product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254711.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(373558..375495) product signal-transduction and transcriptional-control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254130.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene acoR CDS complement(375757..377142) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891344.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(377549..379537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 379703..380008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(380136..380336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(380645..382519) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene htpG CDS 382706..383368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 383445..385538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582752.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 385541..387409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(387450..389441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 389645..390886 product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene sleC CDS complement(391014..391487) product ethanolamine utilization protein EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893336.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene eutQ CDS complement(391489..392580) product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897061.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene eutH CDS complement(392583..393140) product ethanolamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435395.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(393133..393405) product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435411.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene eutN CDS complement(393419..394099) product ethanolamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861392.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(394114..394746) product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187N2 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene pduL CDS complement(394759..395529) product ethanolamine corrinoid cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861391.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene eutT CDS complement(395605..395892) product carboxysome shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423991.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene eutK CDS complement(395953..397422) product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene eutE CDS complement(397425..397997) product bacterial microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435420.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene eutM CDS complement(398007..398660) product microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423987.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene eutL CDS complement(398683..399564) product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187M6 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene eutC CDS complement(399576..400940) product ethanolamine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861389.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene eutB CDS complement(400958..402391) product ethanolamine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861388.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene eutA CDS complement(402552..403928) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435429.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene eutW CDS complement(403933..404508) product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene eutV CDS complement(404529..404954) product ethanolamine utilization protein EutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861387.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene eutP CDS complement(404958..405308) product propanediol utilization protein PduU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423973.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene eutS CDS complement(405496..406626) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861386.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene eutG CDS complement(406785..408185) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252808.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(408172..408861) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459370.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(408890..410002) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888916.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene mrdB CDS complement(410157..410999) product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y070 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene panC CDS complement(411013..411840) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y071 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene panB CDS complement(411815..412654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287872.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(413014..413943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(414663..415076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(415155..416612) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(416596..417261) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(417544..418587) product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445313.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(418757..419341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 419899..421251 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643131.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 421338..421739 product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(421791..423746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(423901..424122) product spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422115.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene sspB CDS complement(424230..425495) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(425738..426457) product RNase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965843.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 426654..427073 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(427603..428424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(428615..429151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(429287..429793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(429930..431159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(431484..431900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(432113..433111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(433134..433826) product nitrogen-fixing protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(433862..434047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(434276..434749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(434880..435950) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436742.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(436090..436392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918611.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 436589..437881 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(437893..438783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(438875..439414) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434417.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(439613..441151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(441442..442302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436661.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene rsiV CDS complement(442315..442821) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436663.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene csfV CDS complement(443023..444210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531927.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(444329..445150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(445375..446919) product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986430.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 447811..449094 product branched-chain amino acid transport system carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BC4 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene brnQ-2 CDS complement(449237..449701) product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986477.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(449718..450329) product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGH6 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene mobA CDS complement(450425..451705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(451870..454572) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905854.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene mgtA CDS complement(454695..454838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(455234..455491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(455571..456080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(456299..456901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(456873..457538) product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186F8 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene thiE CDS complement(457551..458153) product thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922072.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(458141..458818) product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81HR2 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(458818..459603) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186F4 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene thiM CDS complement(459635..460438) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436492.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene thiD CDS complement(460712..461968) product proton/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895466.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(462289..463170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 463428..463622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(463824..464270) product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986477.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(464263..464733) product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97HL9 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene moaC CDS complement(464902..465543) product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949047.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene modB CDS complement(465545..466309) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene modA CDS complement(466325..466867) product electron transporter HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861901.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene hydN1 CDS complement(466867..468243) product iron hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861902.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene hydA CDS complement(468255..468812) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861903.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene hydN2 CDS complement(468839..470134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(470112..471314) product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272494.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(471432..473567) product formate dehydrogenase H subunit alpha, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861905.1 transl_table 11 codon_start 1 transl_except (pos:473151..473153,aa:Sec) note codon on position 139 is selenocysteine opal codon. locus_tag LOCUS_04540 gene fdhF CDS complement(474082..475530) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene ycaM CDS complement(475992..476180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 476255..476392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(476573..478939) product magnesium-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646275.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(479152..479865) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q17ZX2 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene dapH CDS complement(479880..480626) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q17ZX1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene dapB1 CDS complement(480637..481515) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q17ZW8 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene dapA2 CDS complement(481534..482532) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q17ZW9 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene asd CDS complement(482862..483587) product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438111.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(483799..485319) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897439.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(485727..487436) product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene mtrF CDS complement(487859..488782) product LytR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986984.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(488901..489776) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898391.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(489804..489953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(490002..492314) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738124.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(492369..493259) product glucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897343.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(493388..494761) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037272.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(494754..495401) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865972.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 495586..496122 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861137.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(496287..496760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(496879..498243) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098119.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(498271..498543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(498545..498946) product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463973.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(498964..500979) product transcriptional antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990035.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(501151..501750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(501769..502026) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070523.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(502208..503626) product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860665.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(503788..504543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(504547..504876) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419063.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(505141..506886) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(507187..508377) product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CL7 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene metK CDS complement(508400..509278) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene speB CDS complement(509268..510119) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18A85 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene speE CDS complement(510284..510709) product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18A81 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene speH CDS complement(510740..512239) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860979.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene speA CDS complement(512733..513494) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682019.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(513498..514598) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669987.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(514617..515639) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(516031..516747) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene deoD CDS complement(517088..518713) product Na/Pi cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(518980..519975) product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P70 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene arcB CDS complement(520102..520290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(520392..521768) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0U1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene aldH CDS complement(521997..523376) product L-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(523518..524132) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(524122..525054) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(525063..525932) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(525932..526924) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(526946..528571) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021912.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(528780..530339) product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(530413..531981) product chloride ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 532159..532707 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889535.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(532779..534644) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436553.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(534740..535885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 sequence002 source 1..406219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 999..1127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 1521..2486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 2467..4137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 4124..4609 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884106.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(4618..4806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 4958..5266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(5336..5500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 6585..8921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 9382..10056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 10436..12844 product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721731.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 12870..14561 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356323.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(14739..15347) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005646.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 15538..16347 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 16595..16960 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430051.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 16962..17663 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 17657..18454 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 18532..18708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 18797..19090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 19243..22407 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861482.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 22434..23561 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897312.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(23643..23861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 24275..24466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 24677..24997 product sodium:pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024540.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 24997..26499 product sodium/panthothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104806.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene panF CDS 26676..28226 product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963421.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 28356..29315 product UV DNA damage endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAT6 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene uvsE CDS complement(29403..31067) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q188C8 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene glnS CDS 31380..32882 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436553.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 33212..33841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 note possible pseudo, frameshifted CDS 33957..34394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 note possible pseudo, frameshifted CDS 34422..34640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(34671..35504) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429371.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 35591..36961 product multidrug transporter MatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438549.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(37009..37518) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107482.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 37672..38058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(38097..39059) product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene yrbG CDS 39211..39540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 39712..39891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 39962..40534 product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 40785..41069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(41135..41608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430160.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(41631..42896) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 43661..44959 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q188C1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene lysA CDS 44996..46246 product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253108.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 46475..47212 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569006.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 47327..47488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 47719..48216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 48427..49470 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253681.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 49555..50190 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048417.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 50213..51256 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253681.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 51225..52901 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948803.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 52917..53864 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948804.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 53904..54284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461503.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 54472..55551 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454650.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 55713..56456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 56604..57194 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948225.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 57206..57724 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 57884..58018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 note possible pseudo, frameshifted CDS 58023..59000 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 59110..60321 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861720.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(60384..61496) product amino-acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861701.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 61695..62249 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427638.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 62278..62748 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97E55 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene ada CDS 62836..63216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 63320..64711 product regulatory protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 64714..66057 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(66112..66564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 66786..66905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(67112..67375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(67911..69032) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861579.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(69059..69595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861186.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(69711..70958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(70975..71331) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428185.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 71506..71721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 71797..72672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861756.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 72683..72952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 72972..73280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 73394..73630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 73667..75628 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700554.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 75630..76508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45908 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene yqaK CDS 76511..77233 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001796827.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 77256..78113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860998.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 78156..78695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 78688..79203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 79205..79393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 79403..79573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 79528..79791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 79813..80289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 80485..81093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 81053..81217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 81275..82180 product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97JQ1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 82206..82361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 82499..82942 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861737.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 82963..83466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 83547..84089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 84089..85216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142732.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 85605..85751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 85785..86243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 86475..87125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 87192..89099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 89118..90530 product putative minor capsid protein, phage associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_268920.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 90530..91729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 91726..91962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 92101..92736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 92766..93659 product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861029.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 93663..93923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 93936..94283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 94280..94717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 94717..95082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 95079..95501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 95560..96141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 96189..96737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 96740..97093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 97093..97731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 97932..101828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 101829..102524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 102595..102846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 102848..103234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965185.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 103253..109021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 109039..109296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 109314..109547 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358009.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 109563..109781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 109880..110674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(110760..111662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(111664..112158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166396.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 112591..113097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674335.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 113245..113424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 113663..114121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 114134..114364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 114357..116723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254804.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 117263..118231 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454479.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene iunH CDS 118232..118819 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454478.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 118812..119501 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 119621..120481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 121259..121438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(121477..122061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 122238..122597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(122617..122862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(122955..124181) product sodium:glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861324.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene gltC CDS 124396..125013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 125221..126345 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439447.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 126416..126553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 126658..128370 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 128387..130177 product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861230.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(130218..130781) product putative manganese efflux pump MntP 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I1C7 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene mntP2 CDS complement(130935..131156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 131402..132325 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 132555..133721 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461646.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 133789..134343 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949081.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(134368..135165) product amino acid amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 135303..136442 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180W0 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene alr2 CDS 136445..137374 product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896305.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 137506..138006 product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene moaB CDS 137990..138946 product cyclic pyranopterin phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186S0 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene moaA CDS complement(138980..139387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 139594..140763 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482586.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(140892..141968) product proline dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 142175..142768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427445.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 142883..143680 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454798.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 143891..145306 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 145414..145632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 145796..146740 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 146890..147186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 147595..148224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 148292..149113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 149132..150142 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989636.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 150155..150799 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7T6 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene ppiB CDS 150921..151982 product phosphatidylglycerol lysyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q188H2 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene mprF CDS 152272..152454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 152478..152639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 152844..154193 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 154281..155516 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433135.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 155690..156481 product molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434058.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene xdhB CDS 156475..156924 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434060.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene xdhC CDS 156925..159192 product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene xdhA CDS 159502..160308 product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783346.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 160387..160680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(160736..161581) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436717.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene sseA CDS 161827..163020 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BK6 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene aspB CDS 163179..163838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 163935..165101 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 165116..165826 product hydroxylase accessory protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861443.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 165828..166403 product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 166414..167430 product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 167606..169234 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429004.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 169616..170125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680759.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 170179..170373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 170550..171032 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(171402..172262) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964884.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(172358..173173) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965976.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(173282..174685) product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(175002..175400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(175457..176317) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 176582..177142 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436409.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(177162..177326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 177708..178271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428987.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 178382..180031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 180174..180593 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948763.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 180606..181976 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436703.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 182092..182703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(182746..183840) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 183995..184711 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q188B7 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene rluB CDS 184730..185311 product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424276.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 185763..185960 product tungsten formylmethanofuran dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942113.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene korD CDS 185979..187127 product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942114.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene korA CDS 187109..187921 product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene korB CDS 187940..188479 product 2-oxoglutarate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 188728..189978 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene gltC CDS 190108..190980 product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 190996..191754 product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG98 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene surE CDS complement(191797..192333) product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 192493..192762 product arsenical resistance operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45949 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene arsR CDS 193037..193942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 194112..195017 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964067.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 195039..198635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 198892..199869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587042.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene ydhJ CDS complement(199892..200239) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 200380..201099 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262955.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene ydfG CDS 201146..201862 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107575.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 201999..202739 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene fabG CDS 202763..203467 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902228.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 203606..203932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 204165..205361 product putative nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269861.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene nupC CDS 205519..206874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(207126..207773) product polar amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423753.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(207784..208395) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430270.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(208405..209196) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439548.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 209723..210472 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 210570..211274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 211374..212030 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987083.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 212176..213888 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 213898..214647 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917245.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 214816..215880 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 215893..217197 product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438162.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene pdp CDS 217237..217902 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C22 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene deoC CDS 217966..218787 product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B85 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene pupG CDS 218917..220200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159687.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 220222..220866 product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I1C9 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene tal CDS 221008..221250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 221432..222454 product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435960.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene splB CDS complement(222503..223531) product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G8 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene nhaA CDS complement(224028..224345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 224855..226051 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861801.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 226593..227279 product sporulation-control protein spo0M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71088 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene spo0M CDS 227520..227861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 227883..228998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 229146..230669 product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253926.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(230730..231830) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288357.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 231969..232379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 232383..233177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 233490..233663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 233821..234096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 234233..237559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 237674..237850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 237885..239618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 239838..240053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 240034..240306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 240840..241682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 241855..242256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 242315..242608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 242643..242813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 242859..243122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 243122..243529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 243943..244155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 244182..245888 product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587519.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 245901..247154 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072869.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene B CDS 247155..247895 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0JQM5 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene clpP CDS 247956..249038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 249098..249349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 249349..249657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 249657..249974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 249974..250357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 250362..250700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 250747..251307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 251365..251880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 251898..252230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 252486..256916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 256978..258426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(258474..259127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(259140..259766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 259929..260102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 260238..260636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 260650..260973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 260986..263427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254804.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(263843..264187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(264321..264530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389845.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(264904..265827) product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861353.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(266328..266783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(266968..267102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 267267..267692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 267807..269273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 269632..270729 product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DRE9 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene ribD CDS 270730..271383 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene ribB CDS 271405..272601 product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I5V0 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene ribA CDS 272640..273101 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I5U9 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene ribH CDS 273276..273917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 273957..274763 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263785.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 274881..275108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 275147..275917 product putative methyltransferase YbaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P70976 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene ybaJ CDS 276318..276479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(276547..277347) product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722154.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(277445..278089) product putative N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RDN5 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene nanE CDS complement(278109..279599) product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976602.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene PTS-EII CDS 279815..280483 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 280480..281487 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 281632..282015 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 282015..283127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(283180..283851) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933367.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(283862..284053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 284252..285043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 285154..285918 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 285908..287926 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 288046..289272 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948284.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene pepP CDS 289408..289830 product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZ99 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene mscL CDS 289982..290542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(290576..291067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(291392..291568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 291753..292922 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433873.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 293173..295008 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861500.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(295058..295339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(295410..295994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 296140..297036 product glucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897343.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(297055..298281) product vancomycin resistance protein, vanW family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861472.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 298430..299074 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 299087..300292 product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439456.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 300292..300657 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020790.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene aroQ CDS 300669..301316 product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187C4 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene cmk CDS 301339..301938 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187C7 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 301949..302788 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187C6 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene ispH CDS complement(302833..304059) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 304454..305410 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428624.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 305460..306293 product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(306474..307589) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 307871..308377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(308402..308707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430798.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 308873..309967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 310100..310225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 note possible pseudo, internal stop codon CDS 310307..310435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 310507..311148 product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187Q1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene trmB CDS complement(311159..311422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424072.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 311611..311814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 311894..312463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861395.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 312565..313038 product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428740.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene accB CDS 313052..314407 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435334.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene accC CDS 314426..315322 product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187P6 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene accD CDS 315303..316253 product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187P7 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene accA CDS 316481..316741 product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 316841..317029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(317562..318683) product 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964882.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(318696..320090) product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454646.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene sucD CDS complement(320159..321490) product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454645.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene cat2 CDS complement(321528..323000) product 4-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene abfD CDS 323818..324957 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 325054..325689 product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187P1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene lexA CDS complement(325742..326011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(326301..326948) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861306.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(327035..327658) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435381.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(327648..328985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861393.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 329564..330238 product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 330460..331095 product putative manganese efflux pump MntP 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I1C7 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene mntP2 CDS complement(331187..333088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434025.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 333257..333409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(333460..334125) product sporulation-specific N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06320 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene cwlC CDS complement(334287..334520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434018.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(334612..334893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 335397..336716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 336913..337677 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454428.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(337695..338534) product cyclic pyranopterin phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186S0 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene moaA CDS complement(338563..339363) product xanthine dehydrogenase accessory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386049.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(339364..340173) product molybdenum hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437839.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(340419..341810) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 341969..342448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986832.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 342445..342960 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493254.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 343008..343217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(343289..344353) product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721615.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(344493..345188) product sugar fermentation stimulation protein SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(345207..348428) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(348431..349135) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964140.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(349203..349403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360043.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(349555..351294) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889552.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(351694..352884) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433992.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(353130..353771) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(353774..354649) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861260.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(354727..355725) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186V5 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene add CDS 356485..357093 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420189.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(357175..357306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(357440..359875) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene recQ CDS complement(359993..360193) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292860.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene cspA CDS complement(360316..363546) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861482.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(363701..364456) product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976874.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(364595..365128) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861585.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(365142..366284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(366566..367456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(367596..367826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44300 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(367875..368567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(368671..369954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(370101..371006) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861708.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(371239..371571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 note possible pseudo, internal stop codon CDS complement(371617..371772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 note possible pseudo, internal stop codon CDS complement(371891..373132) product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(373323..374309) product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966736.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene uvrC CDS 374665..375492 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436717.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene sseA CDS 375564..376094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(376198..376941) product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861452.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(377721..378662) product L-lactate dehydrogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HC14 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene ldh2 CDS complement(378787..379677) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966632.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 379857..380678 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966631.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(380826..381332) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437086.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(381450..382343) product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463703.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(382359..383327) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene rbsC CDS complement(383330..384820) product ribose import ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H79 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene rbsA CDS complement(384852..385247) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU60 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene rbsD CDS complement(385252..386160) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A401 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene rbsK CDS complement(386173..387177) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene rbsR CDS complement(387417..388049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 note possible pseudo, internal stop codon, frameshifted CDS complement(388352..391399) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q830R3 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 391615..392436 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(392484..392702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(392756..393727) product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q184I6 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene nrdF CDS complement(393739..395838) product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q184I5 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene nrdE CDS complement(396157..397647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(397650..398153) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182728.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(398280..398993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 399205..399882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 399897..400076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(400062..400967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(401187..402344) product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861380.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(402356..403237) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948651.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(403249..404094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(404054..404641) product RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 repeat_region 404843..406194 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttaaatacatcttatgttaatgttaatc sequence003 source 1..214840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 681..1097 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451642.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1465..3432 product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180R0 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene uvrB CDS 3468..6296 product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Q9 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene uvrA CDS complement(6344..7297) product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166346.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene oppF CDS complement(7290..8321) product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854348.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene oppD CDS complement(8341..9402) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(9402..10346) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534165.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene oppB CDS complement(10468..10827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 11346..13007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 13053..13184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 13200..15011 product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Q8 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene uvrC CDS 15037..15984 product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Q7 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene scoC CDS complement(16036..17808) product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429109.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(17821..19695) product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416938.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(19715..20212) product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416946.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(20403..21680) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Q2 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene cls1 CDS 21664..22011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(21989..22831) product formate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670448.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 23069..23836 product formate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 24010..24924 product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180P9 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene murB CDS 24929..25642 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436256.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 25657..26514 product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180P8 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 26530..27639 product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180P6 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 27704..28129 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 28146..29096 product putative sporulation transcription regulator WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180P5 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene whiA CDS 29303..32788 product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180P3 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene dnaE CDS 32966..33925 product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180P4 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene pfkA CDS 33942..35702 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180P2 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene pyk CDS 35816..37174 product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene rumA CDS complement(37290..38306) product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048233.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene ldhA1 CDS 38883..40115 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427766.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene hadA CDS 40137..40913 product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888223.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene hadI CDS 40932..42158 product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888224.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene hadB CDS 42158..43285 product r-phenyllactate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene hadC CDS 43421..44554 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427762.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene acdB CDS 44603..45388 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427760.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene etfB1 CDS 45402..46454 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene etfA1 CDS 46782..48416 product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434571.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(48597..49058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 49389..50324 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 50424..52445 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180F3 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene ligA CDS 52595..53944 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180F2 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene rph CDS 53944..54414 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180F1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 54437..54958 product UPF0316 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZD5 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 55103..56389 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180E9 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene tig CDS 56473..57057 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180F0 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene clpP1 CDS 57075..58325 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180E8 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene clpX CDS complement(58356..58883) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427941.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene chrA CDS complement(58868..59383) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene chrA CDS 59550..61907 product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180E4 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene lon CDS 61897..62508 product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180E5 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene engB CDS 62727..63803 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435617.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 64141..65466 product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898466.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 65453..66637 product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891769.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 66661..67035 product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 67048..67857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 67860..68315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 68318..68740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 68814..69488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 69564..70601 product protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435630.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 70641..71018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417144.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 71103..72701 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 72845..74467 product Na/Pi cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 74649..76001 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180C9 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene pgi CDS 76151..77233 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435637.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(77293..79221) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180B7 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene feoB2 CDS complement(79233..79451) product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417194.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene feoA CDS 79626..80135 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 80201..80374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 80500..81336 product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 81565..82107 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453991.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 82155..83006 product 6-phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890830.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 83033..84817 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453998.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 85039..85941 product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180A7 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene pstC CDS 85943..86767 product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180A6 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene pstA CDS 86769..87524 product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180A5 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene pstB CDS 87562..88215 product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180A4 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene phoU CDS 88383..89195 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432345.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 89548..92211 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180A1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene valS CDS 92449..93072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473863.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 93390..94685 product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene folC CDS complement(94740..94991) product TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891710.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 95157..96023 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422120.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(96025..96561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891708.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(96740..96937) product spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422115.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene sspB CDS complement(97173..97337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 97461..98225 product deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898387.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 98361..100130 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428097.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene prdR CDS 100465..101643 product proline reductase-associated electron transfer protein PrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431873.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene prdC CDS 101770..103656 product D-proline reductase (dithiol) proprotein PrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene prdA CDS 103694..103963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422102.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 103980..104705 product D-proline reductase (dithiol) protein PrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861888.1 transl_table 11 codon_start 1 transl_except (pos:104430..104432,aa:Sec) note codon on position 151 is selenocysteine opal codon. locus_tag LOCUS_10300 gene prdB CDS 104764..105522 product proline reductase cluster protein PrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428092.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene prdD CDS 105535..106008 product D-proline reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422094.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene prdE CDS 106028..107035 product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q17ZY4 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 107150..108022 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q17ZY0 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 108203..108838 product single-strand DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene ssb CDS 108978..109541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422084.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 109588..109737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 109730..111505 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 111680..112981 product UPF0597 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q17ZX7 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 113058..113597 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454045.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene hpt CDS 113761..114879 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891676.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 114952..115206 product small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438792.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 115193..115939 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 115974..116855 product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q17ZW5 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene hslO CDS 116964..118310 product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421965.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene glnF CDS 118455..119477 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429564.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene cggR CDS 119536..120543 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181T9 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene gapA CDS 120769..121968 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181T8 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene pgk CDS 122081..122827 product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181T6 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene tpi CDS 122843..124372 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181T7 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene gpmI CDS 124482..125774 product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181T5 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene eno CDS 126170..127270 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 127463..128605 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861810.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene garK CDS 128854..129075 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421948.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene secG CDS 129286..131424 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185A2 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene rnr CDS complement(131828..132154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 132421..132876 product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q184Z6 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene smpB tmRNA 133003..133354 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 133650..133919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 134064..134492 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861766.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 135395..136123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37495 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene yybI CDS 136452..136601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 136979..137659 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 137671..140220 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948492.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 140274..140972 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963772.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 140973..142193 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963773.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 143034..143462 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861766.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 143964..144404 product LytTR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 144410..144865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 145074..145742 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 145746..146792 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 146981..147748 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 147732..149756 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254643.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 149969..151222 product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948368.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene rhlE CDS 151646..152212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 152593..154428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680980.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(154485..155096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 155405..156073 product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene hypB CDS 156110..158794 product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252976.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 158825..159760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252978.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 159974..160699 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358333.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 160837..161499 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963972.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 161490..162647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 162747..164144 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986490.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 164149..164844 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933367.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 164885..165241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(165307..166038) product phosphosugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722092.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 166188..168170 product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990051.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 168272..170935 product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990052.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 170928..172622 product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990053.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 172721..174499 product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948579.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene cotA CDS 174779..175174 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930534.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 175232..175855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898085.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 175938..176348 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MTR0 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene fms CDS complement(176403..177713) product xanthine/uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254160.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 177971..179767 product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861870.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 179997..181208 product PLP-dependent lyase/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861869.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene dpaL CDS 181243..182430 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421980.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 182450..184030 product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 184050..185378 product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 185405..186766 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 186831..187934 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891591.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene pyrD CDS 187950..189323 product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 189334..191892 product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(191943..192581) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860883.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(192585..192791) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418105.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 192926..193765 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253548.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 193864..194565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454365.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 194812..196296 product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54417 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene opuD CDS 197054..198484 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 198501..198776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861663.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 198895..199788 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814117.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 199809..201386 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947911.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 201634..202827 product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene mdeA CDS complement(202963..203709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 204039..205106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 205203..205631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 205835..206707 product sulfite/nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986365.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene asrC CDS 206951..207457 product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898107.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 207563..208018 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene bcp CDS 208119..208568 product spermine/spermidine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386596.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 208790..210685 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169820.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene licT CDS 210698..211159 product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897772.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 211162..212559 product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870407.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 212684..213196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964672.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene sodC CDS complement(213294..213731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 sequence004 source 1..176916 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 499..1464 product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1502..2386) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861630.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 2599..3846 product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253108.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 3956..5113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 5265..5828 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889331.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 5849..6760 product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432388.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene pflE CDS 6765..9134 product glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903701.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene pflD CDS 9161..9967 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180C5 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene proC1 CDS complement(10095..10475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(10494..11144) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889750.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 11338..12771 product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187U6 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene miaB CDS 12974..13864 product ferredoxin-NADP+ reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 13867..15267 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420072.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene aspB CDS complement(15312..15920) product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435254.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 16136..17230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(17251..17856) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7T6 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene ppiB CDS 17996..18532 product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene rbr CDS 18560..19717 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964358.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 19804..21441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(21559..22041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 22270..25065 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187T6 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene mutS CDS 25130..27175 product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187T7 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene mutL CDS 27192..28133 product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187T5 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene miaA CDS 28191..28490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 28698..31187 product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 31342..32379 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978090.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 32379..33149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 33314..34129 product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186T9 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 34360..35934 product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(35979..36761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(36819..37124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 note possible pseudo, internal stop codon CDS 37298..38623 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416871.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene grdE CDS 38641..39948 product betaine reductase complex component B subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:O69407 transl_table 11 codon_start 1 transl_except (pos:39685..39687,aa:Sec) note codon on position 349 is selenocysteine opal codon. locus_tag LOCUS_11580 gene grdH CDS 39988..41517 product glycine/betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene opuD CDS 41679..42002 product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186R7 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 42004..42144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 42590..43795 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C40 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene tyrS CDS complement(43857..44039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 44201..45043 product 6-phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438997.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(45121..45396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 45562..46908 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001812710.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 47029..47199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 47597..48220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 48348..48503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 48657..49751 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435380.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 49855..50130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 50258..50458 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423148.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene cspD CDS 50674..51978 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869229.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 52275..54197 product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861201.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 54187..54531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889198.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 54704..56629 product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861201.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 56619..56963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889198.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(57014..57619) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAJ0 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene sodA CDS 57850..58563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436655.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 58964..60277 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048319.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(60358..60705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 61012..61230 product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423664.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene feoA CDS 61251..63155 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180B7 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene feoB2 CDS 63173..63496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890712.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 63709..63846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 64102..64803 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 64778..66937 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861604.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 67291..67968 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817367.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(68035..68475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722815.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 68550..69671 product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989529.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 69761..70171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(70277..71542) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831403.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(71709..73052) product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868917.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(73086..73787) product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868622.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 74006..74947 product glutamate formiminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869662.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 74963..76507 product cyclic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 76678..77289 product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530303.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 77472..78026 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRJ8 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene ubiX CDS 78028..79368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 79396..79656 product microcompartment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 79668..79979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 79991..80344 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206281.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 80360..80635 product carboxysome shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 80640..81032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 81035..81307 product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 81310..83112 product adenine deaminase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92YE2 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene ade3 CDS 83353..83835 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428769.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(84054..85244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 85363..86268 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(86615..87427) product non-heme chloroperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948538.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(87529..88134) product DUF1275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966634.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(88413..88769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 88993..89343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813604.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 89346..89792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721849.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 89812..91458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 91464..93563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 93983..95428 product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814I2 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene dbpA CDS 95528..96010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(96110..96784) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 97087..98415 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948741.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene glpT CDS 98577..99203 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393623.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 99203..99901 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964843.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 99901..102138 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964842.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(102185..102979) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861337.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 103257..103565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 103706..104149 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 104226..105590 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 106042..107172 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016972.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 107255..108064 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438030.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 108242..108952 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene rgbR CDS 108946..110283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 110445..113021 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861587.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 113064..113729 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454838.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 114034..115113 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene orr CDS 115228..115386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 115370..117907 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860737.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 118307..118441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(118526..118678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 118930..120915 product 2-enoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene fldZ CDS 121116..121352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 121828..122103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986726.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 122266..123834 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986410.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 123875..124441 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860736.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 124588..125709 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966934.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene xylR CDS 125876..126919 product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06004 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene gutB CDS 126962..128344 product putative glucitol transport protein GutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34368 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene gutA CDS 128379..129308 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246640.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 129500..130276 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 130280..131884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948484.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 131957..132634 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene rgbR CDS 132628..134046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008691078.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 134280..134948 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861120.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 135032..135412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440031.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(135468..136088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 136361..136525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 136703..137560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(137638..138495) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202924.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(138507..139628) product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817161.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(139651..140673) product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene wbjB CDS 140837..141583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(141636..142706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(142722..144560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 144682..145764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 145874..148519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 148793..149674 product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q184M8 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene pip CDS complement(149753..150727) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439901.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 150877..151305 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861766.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 151373..152164 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ED41 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene proC CDS 152367..153266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50742 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene yphB CDS 153286..153480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 153632..154504 product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I5N6 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene pyroA CDS 154686..155489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861791.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 155502..156629 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861790.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 156633..158042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861789.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 158176..158694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 158837..159544 product conjugal transfer protein TraX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(159588..160934) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97J94 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene purF CDS complement(160936..162249) product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EU2 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene thiC CDS 162684..164156 product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I133 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 164275..166284 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439994.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 166551..167288 product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861815.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 167332..168660 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861814.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 168821..169339 product formylmethanofuran dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(169414..169854) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022043.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 170046..171767 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861500.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(171757..172125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(172211..172498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 172733..173236 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107482.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 173455..175158 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97KN0 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene ade CDS complement(175238..175678) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427501.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(175701..176096) product HTH-type transcriptional regulator NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07573 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene nsrR sequence005 source 1..176215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 425..1108 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454838.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1101..3485 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861587.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 3590..3730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(3797..4438) product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182L1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene recX CDS 4579..5268 product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182L2 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene nadD CDS 5271..5834 product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431048.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 6017..6370 product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182L0 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene rsfS CDS 6765..9185 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182K8 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene leuS CDS 9512..10723 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene tdcB CDS 10887..11267 product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 11389..12063 product L-serine dehydratase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356598.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene sdhB CDS 12087..12965 product L-serine dehydratase, iron-sulfur-dependent subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963993.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(12994..14313) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene dacF CDS 14391..15095 product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890711.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene comE CDS 15369..16196 product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q182I1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene selD CDS 16221..17630 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182I2 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene selA CDS 17633..19516 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454786.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene selB CDS complement(19644..20690) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182H0 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 20752..21117 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 21132..21791 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182G9 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene ung tRNA 22003..22099 product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(22151..22870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 22951..23655 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(23801..24625) product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861569.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 24788..25693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 25695..26861 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897664.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 26947..28233 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861568.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 28187..29218 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861567.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(29448..29714) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182G1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene rpsT CDS 29990..30946 product germination protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182F6 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene gpr CDS 30959..31930 product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897656.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene spoIIP CDS 31940..32197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 32331..34136 product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182F4 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene lepA CDS 34396..35727 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897651.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 35922..37052 product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene hemN CDS 37156..38175 product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182F0 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene hrcA CDS 38191..38745 product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182F1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene grpE CDS 38813..40651 product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182E8 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene dnaK CDS 40756..41907 product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182E7 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene dnaJ CDS 42069..43259 product sodium:dicarboxylate symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948034.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 43462..44523 product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253108.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 note possible pseudo, internal stop codon CDS 44542..44730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 note possible pseudo, internal stop codon CDS 44872..45345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 45473..46180 product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760203.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 46238..46477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 46493..46714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 47027..48040 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261333.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 48217..48666 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868208.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 48668..49093 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 49189..49875 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947949.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(49907..50539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 50671..51465 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429191.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(51497..52045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 52348..55479 product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 55652..58357 product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906004.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene ypdB CDS 58429..59034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34378 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene yteU CDS 59059..60762 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285976.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 60755..62236 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304851.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 62407..63336 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 63359..64309 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 64342..65802 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 65875..67149 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369315.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 67168..68541 product 6-phospho-beta-glucosidase GmuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05508 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene gmuD CDS 68703..69584 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261350.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 69615..72617 product endo-beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 72675..75044 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254583.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 75142..75660 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048158.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 75684..76655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435128.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 76848..77789 product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182D8 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene prmA CDS 77799..78551 product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182D6 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 78553..79854 product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 79896..80243 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 80405..80584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 80611..81054 product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 81187..81684 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890655.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 81831..82067 product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416626.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 82081..83385 product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861554.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene spoIV CDS 83398..84399 product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 84403..84861 product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182C6 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene ybeY CDS 84866..85579 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416641.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 85714..86115 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890647.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene cdd CDS 86155..87045 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182C3 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene era CDS 87060..88439 product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182C2 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 88510..88683 product YqzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416649.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 88634..89407 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182C0 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene recO CDS 89400..89975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416653.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 90112..90990 product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182B9 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene glyQ CDS 90990..93056 product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182B8 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene glyS CDS 93297..93938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416703.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 93950..94786 product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181Z6 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 95018..97639 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861547.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene ppdK CDS 97853..98677 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene pstS CDS 98795..99043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454705.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 99112..100026 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775137.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 100135..101520 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987111.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 101684..102394 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene rgbR CDS 102388..103803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 103962..104624 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 104633..107158 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860737.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(107196..108737) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861523.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(108706..109425) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454617.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 109641..112229 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860737.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 112250..112915 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860736.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(113106..114293) product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434490.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene cfa CDS 114436..115815 product multidrug transporter MatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861931.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 115818..116456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861651.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 116620..117246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 117594..118043 product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FB5 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(118177..120345) product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181Z2 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 120603..121952 product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903185.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 122068..122475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(122524..123096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416728.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene cotJC2 CDS complement(123113..123376) product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454698.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene cotJB2 CDS complement(123376..123579) product spore coat associated protein CotJA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416732.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 123855..124715 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 124843..125859 product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897592.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 126011..127024 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416156.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 127240..128406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 128488..128913 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 128928..129866 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437173.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 129983..130888 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861421.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene isp CDS 130987..131490 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454691.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene polC CDS 131675..132736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(132982..133152) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene fdxA CDS 133348..134253 product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 134266..134685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454682.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(134716..135354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 135564..136841 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(136884..137441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 137655..138425 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 138591..139040 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene iscR CDS 139059..140246 product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BE4 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene iscS2 CDS 140248..140703 product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 141104..141799 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454566.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 141774..141998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 142023..144020 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861512.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(144072..147503) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CA4 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene pycA CDS 147843..148553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870951.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 148747..149667 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861241.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(149728..150144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861899.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 150362..150781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 150839..151924 product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BE2 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene mnmA CDS 152280..154925 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BE7 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene alaS CDS 154964..155224 product UPF0297 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BE6 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 155234..157402 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861168.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 157545..157973 product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BF1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 158042..158311 product UPF0473 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BF0 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 158409..159170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897033.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 159256..160227 product LytR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454115.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 160402..160836 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419428.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene fur CDS complement(160858..161595) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 161827..163497 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BF6 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene rnj CDS 163554..163889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 164004..165113 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861561.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 165210..165983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861562.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 166077..167237 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene dacF CDS 167339..167932 product peptidase M25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902398.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 167966..168691 product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BF7 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene scpA CDS 168693..169220 product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BG3 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene scpB CDS 169290..169967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438288.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 169921..170352 product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428254.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 170587..171027 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419459.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 171106..172539 product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BF9 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene pepA CDS 172786..173424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(173430..174101) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 174309..175265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965165.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 175296..176087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 sequence006 source 1..169699 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 40..447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(526..912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1364..1540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 1652..2086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 2179..3723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 3841..5088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 5189..5965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(5995..6774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 6861..7748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 7754..8644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 8649..9536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 9614..10396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 10400..10753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 10755..11912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 11914..12900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 12980..13714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 13798..15687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 15705..16505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(16543..18837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(18923..19582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(19584..21506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 21720..22724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(22769..23293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(23600..26323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(26408..26614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(26666..27001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(27017..27259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(27270..27731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(27728..28243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(28246..28575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(28589..29041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(29038..29541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(29561..29896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(29959..30729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(31191..31460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(31517..31870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(31944..32612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(32626..32892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(32903..33121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(33125..34912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(34905..35543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(35625..36233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(36351..37982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(38034..40349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(40350..42611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(42701..43942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(44033..44422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(44483..44767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(44869..45822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(45834..46952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(47004..47546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(47562..48380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(48441..48575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(48660..49382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(49357..49725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 49834..52635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 52653..52919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 52922..53788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 53802..54686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 54709..55284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 55277..56944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 56957..58615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(58921..59580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(59640..60068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(60070..60738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(60738..61250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(61255..61395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(61479..62660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(62755..62994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(63014..63310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(63322..63615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(63764..64306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(64306..64620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(64638..65060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(65140..67482) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E096 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene gyrA CDS complement(67589..67981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(68049..68720) product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(68806..71163) product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55992 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene gyrB CDS complement(71270..72139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(72235..72567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(72600..73055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(73078..73524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(73817..75025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(74973..75368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(75416..75898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 75981..76364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 76327..76755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(76765..76938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(76941..78740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(78875..80149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(80177..81340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(81406..82005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(82022..82642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(82647..83879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(83990..84580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(84543..85133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(85178..85870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(85921..86466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 86583..87521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 87522..89873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(90078..90833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 90955..91734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 91748..92737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 92858..93715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 93780..95501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 95631..98312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 98314..99441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(99475..99948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(99960..100424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(100437..101918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(102008..104590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(104686..104976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(104978..105388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(105403..105825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(105843..106565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(106667..107086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(107105..107584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(107680..108261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(108242..108463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(108550..109926) product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(109913..110284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(110268..111779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(111852..112442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 112543..113256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 113354..114121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 114126..116786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(116822..117331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(117363..117824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 117931..118431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(118446..119747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(119837..120073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(120075..121034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(121111..122622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(122730..123089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(123091..123777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(123839..124774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(124761..125168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(125183..125596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(125601..126200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(126380..127129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(127163..127753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(127756..128097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 128256..130688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 130725..131561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(131609..131905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(131992..132423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(132426..133103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(133165..133437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(133543..133851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(134010..134525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(134538..135323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(135614..135811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 135955..137229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 137321..138577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(138621..139454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(139460..140008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(140005..140688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(140701..141921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(141934..142944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(143004..143861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(143945..144610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(144607..145056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(145097..145567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(145579..146007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(146094..146660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(146774..147253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(147332..148123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(148214..148519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(148526..149941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(149973..151091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(151072..151596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(151610..152131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(152128..152574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(152681..159112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(159212..159433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(159823..160638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(160658..161917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(162005..162262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(162352..163404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(163437..164417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(164519..165049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(165120..165254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(165424..166230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(166345..166938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 sequence007 source 1..131809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..1178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 1402..1686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 1882..2556 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459370.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 2546..3964 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252808.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 4221..5345 product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434503.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(5672..5914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(6057..6359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(6546..6959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(6956..7396) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027999.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(7484..7702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 7948..8484 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132535.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene yhjG CDS complement(8588..8734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(9438..9941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(10359..11525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(11916..12425) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963638.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 12614..12994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(13037..13210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(13282..13947) product antibiotic resistance protein VanZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893393.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 14084..14359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(14416..14649) product phage-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253285.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(14690..14875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 15168..15398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(15481..16470) product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948306.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(16859..17425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674335.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(17764..18534) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433833.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(18554..19522) product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433832.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene asrC CDS complement(19534..20325) product anaerobic sulfite reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433831.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene asrB CDS complement(20326..21336) product anaerobic sulfite reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433830.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene asrA CDS complement(21482..22156) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433829.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(22347..23105) product thioester oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875755.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(23305..23598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760150.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 23958..25385 product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485353.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(25460..26788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(27499..28497) product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948306.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 28741..29121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 29171..29686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 29772..30662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 30972..31505 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390032.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 31507..32607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 32771..34174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(34271..34603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(34604..35416) product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene parA CDS 35907..36257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 36254..37012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 37303..37974 product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001256131.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(38609..39412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(39448..39621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(39719..40360) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(40535..41584) product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180X9 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(41705..42559) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213640.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(42818..43234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(43231..43695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(44290..44724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(44829..45347) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817486.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(45403..46035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(46416..47195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(47705..49672) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475586.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(50216..50917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(51028..51534) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948314.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(51697..52170) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(52294..54006) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948315.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(54493..54966) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(55004..55633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948313.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(55626..56978) product radical SAM/SPASM domain Clo7bot peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948312.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(57099..57272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(57367..57510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(57534..57665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(57684..57812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(58323..58484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(58507..58668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(58689..58850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(60206..60355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(60408..60530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(60564..60686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(61257..61412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(61793..62440) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440185.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(62425..63300) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986585.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(63339..64610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(65078..65215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(65196..65801) product accessory gene regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454130.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene agrB CDS complement(65863..67191) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860860.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(67185..67895) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene rgaR CDS complement(68995..69870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(70211..70546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 70820..71710 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948331.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(71821..72273) product membrane protein, VanZ family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255292.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 72541..73356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(73518..75623) product cadmium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(75786..77075) product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948698.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene aspC CDS complement(77563..78270) product catabolite gene activator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 78389..78808 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282237.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 78825..79280 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965811.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 79483..80175 product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303626.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(80360..81289) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(81294..81785) product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193467.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene sigX CDS 82195..82782 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948039.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 83157..83468 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184004.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 83486..84004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459652.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(84082..84822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28671 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene yoxB CDS 85139..85513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 85529..86227 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923927.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(86313..86978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(87010..88080) product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460649.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 note possible pseudo, frameshifted CDS complement(88043..88294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 note possible pseudo, frameshifted CDS complement(88451..89137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(89147..89275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(89290..89721) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949080.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(89903..90772) product Ndr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812933.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(90788..91144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986635.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(91164..91652) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(91899..92513) product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene thgA1 CDS 92716..93042 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 93044..93958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(94159..95229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(95522..96553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(96557..97063) product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864755.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(97503..98669) product putative MFS-type transporter YxaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42112 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene yxaM CDS complement(99094..100194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 101078..101920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 102408..102803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 103027..103389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 103472..103870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 103883..104170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 104607..105611 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene mreB1 CDS complement(105694..105945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(106184..106987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(107005..107310) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556078.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(107511..108542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(108547..109077) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390032.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 109387..109599 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814946.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 109589..110026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(110093..111343) product gluconate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893258.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 111537..112082 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454415.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(112182..112973) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene modA CDS 113299..113511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(113839..114408) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357101.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 114837..115157 product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417824.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(115286..117526) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZQ5 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(117783..117986) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423163.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(117991..118353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(118646..118828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(118846..119070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(119462..119647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(119850..120134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 120323..120835 product DNA topology modulation protein FlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897695.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene flaR CDS complement(120974..121957) product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337569.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene cbaH CDS complement(122085..122237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(122492..122770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 123062..123457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 123568..123720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(123834..125129) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FJ7 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene hisS CDS complement(125435..125755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(125767..126174) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 126915..127115 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423148.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene cspD CDS 127215..127349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 127634..128356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957281.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(128588..129175) product arsenite S-adenosylmethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 note possible pseudo, internal stop codon CDS complement(129207..130259) product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948469.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene arsB CDS complement(130279..131022) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2I9 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(131042..131422) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890787.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene arsr sequence008 source 1..119780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(436..1680) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183G0 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene glyA CDS 2148..2939 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422952.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 2939..3529 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454155.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(3565..4005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454154.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(4016..4306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422948.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(4409..6199) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene aspS CDS complement(6239..7501) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183H5 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene hisS CDS complement(7491..8966) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861664.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene hemZ CDS complement(9004..9621) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454137.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(9635..10084) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183H9 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene dtd CDS complement(10094..12301) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene relA CDS complement(12376..12888) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183I0 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene apt CDS complement(12899..15343) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861665.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene recJ CDS complement(15356..17020) product ubiquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891005.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(17106..17606) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454132.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(17612..18985) product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(19126..19269) product six-cysteine peptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(19337..19699) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861693.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(19770..20036) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426573.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(20115..21236) product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene tgt CDS complement(21256..21756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426576.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(21776..22801) product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183N9 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene queA CDS complement(22907..23920) product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183N8 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene ruvB CDS complement(23938..24540) product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P4 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene ruvA CDS complement(24533..25042) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P3 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene ruvC CDS complement(25179..25778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426585.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 25949..26266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 26367..26690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422812.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(26721..27443) product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189Y9 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(27601..28356) product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189Z0 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene nadE CDS 28465..28833 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189Z1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 28833..29204 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189Y4 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(29259..29897) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(29997..30425) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437525.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(30538..31203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437523.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(31212..32495) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189Y8 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene hflX CDS 32593..32859 product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437519.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(32940..33584) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437518.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(33599..35149) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902156.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(35281..35991) product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255131.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(36088..36900) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860957.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 37054..37380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 37541..38494 product peptidase S55 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437515.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene spoIVB CDS complement(38505..39203) product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(39245..40465) product tyrosine--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97KY6 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene tyrS2 CDS 40654..43386 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860956.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(43430..43792) product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418423.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene spoVAE CDS complement(43805..44818) product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437476.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene spoVAD CDS complement(44834..45271) product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene spoVAC CDS complement(45359..46123) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189W8 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene sigF CDS complement(46134..46568) product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189W4 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene spoIIAB CDS complement(46561..46917) product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189W5 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene spoIIAA CDS 47081..48316 product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870908.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(48365..48679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(48751..50340) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(50490..51446) product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902145.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 51727..53958 product formate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437454.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene plfB CDS 54220..54954 product pyruvate formate-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189V6 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene pflA CDS complement(54996..56174) product putative tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189U8 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene thiI CDS complement(56191..57342) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene iscS1 CDS 58030..59025 product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431031.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene ansB CDS complement(59069..61111) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189U3 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 61189..62094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964296.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 tRNA complement(62148..62239) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(62353..62640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(62653..63069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418377.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(63115..63306) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418375.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(63469..64284) product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189T1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene lipM CDS complement(64266..65243) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860937.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(65240..66106) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436928.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(66111..68039) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436926.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(68211..68588) product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189S4 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene gcvH CDS complement(68620..70755) product acetyl-CoA decarbonylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418359.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(70803..71615) product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418356.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(71653..73023) product acetyl-CoA synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436924.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(73052..73996) product acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432254.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(74015..74785) product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(74831..76225) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189R5 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(76247..77128) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189R6 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene metF CDS complement(77160..77831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436912.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(77858..78730) product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189R8 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene folD CDS complement(78789..79421) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432265.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene fchA CDS complement(79664..81343) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189R2 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene fhs CDS complement(81393..82166) product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888532.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(82204..84126) product carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860935.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene cooS CDS complement(84286..85197) product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436909.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene ptb CDS complement(85365..86510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860934.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(86520..88280) product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 88458..88658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418305.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(88655..89578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860932.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(89854..91554) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189Q7 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene argS CDS complement(91625..92074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860931.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(92086..94464) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189Q3 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene mutS2 CDS 94607..96055 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436882.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene pepD CDS complement(96093..98627) product phosphatidylglycerol lysyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6I9 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene mprF CDS complement(98929..101328) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860926.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(101402..101980) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189P5 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(102009..104399) product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189P6 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene pheT CDS complement(104415..105434) product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189P4 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene pheS CDS complement(105782..106579) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860924.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(106583..107254) product potassium transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418257.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(107275..108651) product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(108960..109316) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189N4 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene rplT CDS complement(109375..109572) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189N0 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene rpmI CDS complement(109600..110001) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189N1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene infC CDS 110465..111865 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189M8 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene ftsH CDS complement(111904..113823) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189B8 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene thrS CDS complement(114199..114801) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439009.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(114883..115683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417993.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(115689..115889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 note possible pseudo, internal stop codon CDS complement(115941..116453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 note possible pseudo, internal stop codon CDS complement(116604..117539) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008856.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(117539..118633) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074497.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 misc_feature complement(118626..>119780) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289202.1:heme ABC transporter ATP-binding protein locus_tag LOCUS_19140 sequence009 source 1..104513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 565..2793 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CM1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene recD2 CDS 3119..3538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 4157..4708 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434417.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 4832..7504 product protein translocase subunit SecA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CN0 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene secA1 CDS 7640..8632 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CN5 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene prfB CDS 8689..10839 product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 10849..12012 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 12305..12910 product riboflavin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CN8 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(13056..13904) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249187.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 14073..14525 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 14525..15241 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 15231..15689 product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CP1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene rimI CDS 15691..16707 product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CP0 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene tsaD CDS 17083..18990 product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHN4 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene glgB CDS 19027..20154 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18A75 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene glgC CDS 20167..21294 product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene glgD CDS 21308..22765 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18A79 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene glgA CDS 22768..25188 product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18A78 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene glgP CDS 25221..27059 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437164.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(27300..28676) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425390.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(28785..30698) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434478.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 30830..31459 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CR5 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene rex CDS complement(31515..31685) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene fdxA CDS 31867..32952 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 33106..35007 product carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888019.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene cooS CDS 35000..35470 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860659.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 35445..36674 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895268.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 36834..37643 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888021.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 37776..39074 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYQ5 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene gluD CDS 39541..40809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 41178..42104 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CS8 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene pyrB CDS 42097..43272 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6W9 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene pyrC CDS 43272..43964 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434506.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene pyrK CDS 43957..44859 product dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CS6 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene pyrD CDS 45044..45628 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CS5 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene pyrE CDS 45888..48518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(48625..49509) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435002.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(49703..50356) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067261.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(50349..51011) product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148218.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 51181..52056 product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 52072..53562 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CT1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene cls CDS 53734..54018 product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CT6 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene groS CDS 54042..55664 product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CT5 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene groL CDS 55949..56692 product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435015.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 56714..57448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 note possible pseudo, frameshifted CDS 57478..57882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 note possible pseudo, frameshifted CDS 58299..59762 product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FM8 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene guaB CDS 59765..61303 product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CT8 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene guaA CDS 61415..62749 product xanthine/uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 62990..64324 product xanthine/uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(64466..65047) product Rubrerythrin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FZ9 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene rbr1 CDS 65239..65607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 65664..65795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 65992..66468 product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CV6 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene purE CDS 66474..67169 product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CV5 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene purC CDS 67186..68556 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CV9 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene purF CDS 68550..69578 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CW2 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene purG CDS 69572..70165 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CW1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene purN CDS 70158..71690 product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CW0 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene purH CDS 71702..72961 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CW4 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene purD CDS 72999..76820 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860677.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene purL CDS 77163..78014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454225.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 78032..79249 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895871.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 79246..79437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 79575..80414 product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186T9 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 80606..80968 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430296.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(80996..82129) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433873.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 82279..83202 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261350.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 83307..83477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(83538..83810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 84182..84835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 84865..85257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 note possible pseudo, frameshifted CDS 85332..85595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(85809..86387) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186A4 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene cynT CDS 86599..88500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(88546..89007) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436793.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 89154..90107 product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433953.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene msrAB CDS 90192..90857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 90891..91367 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E2 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 91383..91736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 91828..92919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462288.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 93191..94042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 94020..94466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425143.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 94476..94967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435902.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(95131..95895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(95911..96639) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421079.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 96838..97920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425141.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 98003..98389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428669.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 98391..98723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428670.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(98872..99375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 99580..99957 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 99983..102349 product cadmium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860727.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 102461..103462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(103508..104155) product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995363.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 sequence010 source 1..90319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 271..374 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS 668..1780 product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437003.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene mnaA CDS 1855..2037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 2158..4062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861077.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 4046..6256 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AN6 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 6249..7010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428590.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 7000..10446 product ATP-dependent helicase/deoxyribonuclease subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AP0 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene addB CDS 10446..14204 product ATP-dependent helicase/nuclease subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AN9 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene addA CDS complement(14539..15213) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 15448..16704 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 16882..18108 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AP6 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene pepT CDS complement(18162..18719) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AQ0 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(18739..19539) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AP9 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene ppnK CDS 19691..20593 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AQ9 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 20604..21608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861084.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(21641..21868) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AR4 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene acpP CDS 22015..22446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 22493..22699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888870.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 22905..23114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428556.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 23281..23454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418911.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 23508..23678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418667.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 23819..24019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428556.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 24192..25205 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888871.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene ccpA CDS 25414..26979 product histidine ammonia-lyase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFC2 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene hutH1 CDS 27003..29048 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFC1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene hutU CDS 29152..30045 product glutamate formiminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791589.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 30051..31337 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFG1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene hutI CDS 31372..32025 product formiminotetrahydrofolate cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902437.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(32099..32575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 32780..33673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(33983..34999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 35182..36345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437985.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(36413..37006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(37020..38342) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437987.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(38455..39267) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 39383..40807 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437991.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 40819..41037 product UPF0291 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AS6 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 41116..42510 product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AS5 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(42534..43454) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438004.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 43644..44366 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861088.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 44506..48036 product pyruvate-flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183B6 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene pfo CDS 48148..48369 product spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416009.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene sspA tRNA complement(48557..48643) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 48782..51406 product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AY7 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene polA CDS 51415..52017 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AZ0 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene coaE CDS 52010..52579 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438043.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 52566..54299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 54354..54566 product heavy metal-associated domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428495.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(54627..55088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 note possible pseudo, internal stop codon CDS complement(55167..55337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 55881..56489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419035.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 56559..57311 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433980.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 57374..58318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438046.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 58484..59818 product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AZ5 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene rnfC CDS 59837..60817 product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B00 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene rnfD CDS 60818..61843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 61847..62443 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AZ8 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene rnfE CDS 62455..63030 product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B02 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene rnfA CDS 63047..64018 product electron transport complex protein RnfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861124.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene rnfB CDS 64177..64755 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B07 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 64776..65471 product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B06 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 65500..66573 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428483.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene mreB2 CDS 66592..67473 product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B04 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene mreC CDS 67489..67977 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861127.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 67988..70984 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861128.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 71044..71721 product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B13 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene minC CDS 71745..72542 product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B12 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene minD CDS 72560..72844 product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B11 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene minE CDS 72938..74056 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888916.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene mrdB CDS 74074..74487 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B16 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene mgsA CDS complement(74540..75733) product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428474.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene norV CDS 76006..77853 product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419074.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 77856..78554 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 78845..80242 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438072.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene rng CDS 80359..80670 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B24 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene rplU CDS 80682..80999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438074.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 81014..81298 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B22 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene rpmA CDS 81428..82705 product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B27 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene obg CDS 82736..83104 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428464.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 83292..84626 product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861590.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(84799..84972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 85202..86095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 86416..87549 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599321.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 87746..88459 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948600.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 88592..89284 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861589.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 sequence011 source 1..88259 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1374 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q182K1:aminotransferase locus_tag LOCUS_20920 CDS complement(1414..2886) product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387166.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene alsT CDS complement(2994..3917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897436.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(4100..5641) product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986430.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(5992..7434) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BJ9 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene purB CDS complement(7512..8420) product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889110.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 8560..9372 product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BJ5 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene uppP1 CDS complement(9398..11179) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861177.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(11353..11631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(11696..12619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023996.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(12757..14265) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BJ3 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene rny CDS complement(14437..15489) product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BJ4 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene recA CDS complement(15797..16339) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene pgsA CDS complement(16326..17660) product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BJ2 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene rimO CDS complement(17661..18710) product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861175.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(18713..21064) product cell division protein FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438328.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene ftsK CDS complement(21201..21953) product Clp protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428224.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene tepA CDS complement(21984..22136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(22198..23409) product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BI5 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene dapG CDS complement(23419..23664) product sporulation protein YlmC/YmxH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419503.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(23731..24975) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438321.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(25095..25838) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438319.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(26167..28296) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BI4 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene pnp CDS complement(28487..29320) product 6-phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889099.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(29497..29751) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BI0 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene rpsO CDS complement(29858..30781) product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BI2 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene ribC CDS complement(30806..31711) product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BH7 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene truB CDS complement(31723..32703) product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(32707..33096) product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BH6 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene rbfA CDS complement(33118..35055) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BH4 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene infB CDS complement(35070..35390) product 50S ribosomal protein L7ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419470.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(35383..35655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(35674..36747) product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BH2 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene nusA CDS complement(36784..37245) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BH3 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene rimP CDS complement(37437..38381) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454199.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 tRNA complement(38492..38566) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(38572..38647) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(38657..38730) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(38824..39483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(39589..43896) product DNA polymerase III PolC-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BG8 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene polC CDS 44031..44699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(44727..46964) product mannosyl-glycoprotein endo-beta-N-acetylglucosamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861172.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene acd CDS complement(47298..47645) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440244.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(47733..48731) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185D5 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene prsA CDS complement(49036..49620) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889920.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(49767..51467) product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438014.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(51591..52553) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861284.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(52610..53365) product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889549.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(53362..54357) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861283.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(54344..55300) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454520.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(55593..56333) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897796.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(56346..58004) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815872.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 58240..58584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890447.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(58631..59569) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 59784..60521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(60589..61146) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(61228..61350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(61426..62037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437313.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(62215..63762) product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183L8 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene mviN CDS 63940..64242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(64297..64527) product D-alanine--poly(phosphoribitol) ligase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183T8 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene dltC CDS complement(64545..65693) product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426712.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene dltB CDS complement(65693..67207) product D-alanine--poly(phosphoribitol) ligase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183T6 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene dltA CDS complement(67329..68519) product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439587.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene dltD CDS complement(68896..69477) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358515.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(69818..70795) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(71081..71422) product hydrogenase nickel incorporation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254713.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(71438..72853) product Ni/Fe hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359027.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene hupL CDS complement(72863..73729) product Ni/Fe hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890825.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene mbhs CDS complement(73726..74562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(74566..75024) product HybD peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890827.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(75043..76050) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964127.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene hypE CDS complement(76057..77163) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(77176..77394) product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(77372..79675) product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97KV6 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene hypF CDS complement(79867..80049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965255.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 80106..80354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(80571..80819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(80844..81245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 note possible pseudo, internal stop codon CDS complement(81600..81986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 82490..82978 product prolyl-tRNA editing protein proX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 83343..83951 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262310.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 83962..85227 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123037.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(85497..85670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 85850..86005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(86175..86774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 87303..87962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54525 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene yqiI sequence012 source 1..74345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1008..1208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(1208..1675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(1672..2112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(2112..2420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(2423..3343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(3401..3691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(3785..4174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(4167..4586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(4588..5013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(5129..5521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(5523..5975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(5968..6333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(6335..6706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(6703..7104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(7123..7491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(7475..7693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(7697..7879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(7866..8108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(8099..8287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(8284..8778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(8866..9327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(9414..9617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(9628..9780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(9896..10135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 10604..10933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 10938..11285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 11252..11494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 11487..11831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 11828..12163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 12165..12860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 12860..14467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 14521..15234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 15231..17990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 18005..20164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 20307..22322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 22453..23688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(23713..24270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 24355..24624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 24626..25072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 25059..25445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964411.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(25435..25593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 25670..26017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 26028..26516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 26526..26846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 26847..29006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 29066..29392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 29410..30552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 30595..32019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 32076..32720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 32734..33417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 33476..35665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 35675..36112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 36114..37499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 37571..46789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(46800..47003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(47010..47339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(47349..47915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214145.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(48001..48726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(48831..49556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(49549..51714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(51792..52343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(52353..53366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(53363..53677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(53658..53831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(53794..56427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(56429..57004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(57001..58299) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019893.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(58301..58606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(58599..58751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(58753..59088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(59090..59461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(59463..59774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(59828..60022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(60003..61202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(61215..62405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(62468..63169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(63159..63338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(63325..63789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(63786..64274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(64261..64809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(64823..65224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(65221..65565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(65555..65707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(65704..65982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(65979..66224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(66274..67719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(68233..68739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 tRNA complement(69288..69364) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(69549..69866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(69939..70637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(70621..71628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(71630..72217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(72219..72428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(72407..72613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(72600..73133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(73106..73525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(73530..74132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 sequence013 source 1..74116 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 622..1500 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183E9 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene gtaB CDS 2094..4598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(4636..5628) product LytR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454115.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 6429..7115 product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966354.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 7198..8583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 8939..10078 product glycosyltransferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101303.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene cps2F CDS 10079..11191 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 11566..12639 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene manC CDS 12676..14379 product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454107.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene pgm CDS 14404..15318 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 15334..16173 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 16422..16553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 16546..17154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 note possible pseudo, frameshifted CDS 17175..18044 product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN3 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene spsI CDS 18044..18616 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 18621..19643 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 19661..20527 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875981.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 20626..22893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(22933..23895) product LytR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454115.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 24047..24580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 24585..25106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(25148..26092) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454782.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene pmi CDS complement(26398..26865) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891020.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 27020..27664 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422884.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene uppS CDS 27737..28522 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861670.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 28633..30369 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431790.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 30418..30762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 30962..32167 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431793.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 32227..32487 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene ptsH CDS 32569..34281 product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183J1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene ptsI CDS 34921..35925 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183C9 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene asnA CDS 35997..36383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861647.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(36388..37473) product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861645.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 37696..38217 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene hpt CDS 38320..39258 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416574.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 39434..39910 product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 39926..40693 product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406214.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 40683..41522 product PTS N-acetylgalactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098890.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 41535..41939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 42016..42861 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861644.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 42867..44090 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 44286..44501 product spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416009.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene sspA CDS 44662..44829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416012.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(44859..45332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427085.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 45431..45919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455001.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 45952..47721 product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861643.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 47732..48322 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861642.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 48367..49539 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269921.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene aroC CDS 49524..50552 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2G0 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene aroB CDS 50545..51807 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20691 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene aroA CDS 51891..52460 product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183B8 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(52604..52999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 53250..53924 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HK62 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene deoC CDS 54152..57691 product pyruvate-flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183B6 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene pfo CDS 57890..59344 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182Z8 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene murE CDS complement(59693..60790) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182Z7 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene ychF CDS 60904..62010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 62020..63282 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 63292..64578 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 64820..65599 product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110492.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 65610..66365 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182Z4 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene lgt CDS 66369..67304 product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182Z2 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene rsmH CDS 67438..67794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427009.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 67806..69785 product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene spoVD CDS 70034..71404 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182Y9 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene murF CDS 71447..72409 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182Y8 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene mraY CDS 72428..73786 product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182Y7 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene murD sequence014 source 1..73730 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(287..586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 829..1872 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990093.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 1972..2745 product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836669.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(2769..4139) product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861591.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(4272..4604) product transcriptional regulator, HxlR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431984.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(4807..5685) product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357673.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene trxB3 CDS complement(5710..6024) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q184M2 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene trxA1 CDS complement(6231..6830) product 30S ribosomal protein S4 B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7D0 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene rpsD2 CDS complement(7210..7713) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R6B0 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(7730..8674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(8828..9367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(9469..9645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(9826..11001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(11401..12564) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454855.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(12580..13986) product alginate regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(14004..14474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(14490..15254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(15468..16358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 16567..17460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(17528..18919) product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I341 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene gadA CDS complement(18979..20112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 note possible pseudo, frameshifted CDS complement(20124..20246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(20496..21899) product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I341 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene gadA CDS complement(21939..23369) product glutamate:gamma-aminobutyrate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989972.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(23629..24309) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066452.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 24691..27363 product aldehyde-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q184F6 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene adhE1 CDS complement(27457..29223) product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948658.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene dhaK CDS complement(29236..30363) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948659.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene gldA CDS complement(30556..31590) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382271.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 31693..32187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048323.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 32726..34162 product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948044.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(34211..34522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(34647..42728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 42898..46332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(46384..47310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861485.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(47359..47859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861486.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(48001..49443) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903314.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(49549..50721) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861662.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(51016..53607) product phosphatidylglycerol lysyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6I9 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene mprF CDS complement(53886..54098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461873.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(54137..56635) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861457.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(56929..58845) product carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860935.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene cooS CDS 59055..59942 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945976.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(60009..61139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(61325..62107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(62242..64302) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861661.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(64420..64920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(65114..67093) product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860952.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 67270..67806 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704720.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(67834..68760) product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37599 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene cheV CDS complement(68876..69751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 69942..70790 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965720.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(70831..72912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 sequence015 source 1..60869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 394..693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 870..1277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 1508..4102 product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187Y8 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene clpB CDS 4281..5426 product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436749.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 5446..5589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 5732..6841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(6915..7457) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889535.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 7626..7802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 7921..8748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966202.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 9102..10214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 note possible pseudo, internal stop codon, frameshifted CDS 10262..11662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 note possible pseudo, internal stop codon, frameshifted CDS 11663..13099 product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186L4 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene gcvPB CDS 13228..14460 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571591.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene gltS CDS 14571..15035 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965770.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 15223..15501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 15687..20009 product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861332.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(20078..20800) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948676.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 20982..22754 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949077.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 22827..24029 product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81DR1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene sbcD CDS 24029..27154 product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6N9 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene sbcC CDS 27296..28696 product alginate regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 28705..29043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 29056..30120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 30223..31917 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(32005..33219) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 33423..34421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435128.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(34502..35419) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949049.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 tRNA 35564..35639 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 35718..36374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964101.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 36412..36669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 36851..38350 product alveolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576704.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(38400..38933) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493254.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(38933..39409) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393698.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(39600..40973) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861659.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 41167..43044 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436553.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 43190..45337 product phage infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948673.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 45356..47494 product phage infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948674.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 47639..48826 product cytochrome c biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903396.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 49168..49866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 49880..51622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 51622..52569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 52573..53328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 53369..55939 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 55939..56433 product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582993.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 56442..57440 product CRISPR-associated endonuclease Cas1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL10 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene cas1-2 CDS 57442..57732 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817554.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 repeat_region 57908..60840 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gattaacattaacataagatgtatttaaac sequence016 source 1..58836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(358..804) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437841.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene rpiB2 CDS complement(928..1971) product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180X9 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(1997..2674) product zinc permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425887.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(2811..3875) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Y2 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene prfA CDS complement(3919..4770) product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Y4 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene hemK CDS complement(4785..5681) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(5770..6345) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F65 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene tdk CDS complement(6403..6612) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Y7 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene rpmE CDS complement(6717..8180) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Y6 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene rho CDS complement(8361..9359) product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97K33 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene glpX CDS complement(9517..10164) product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97JD9 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene tal CDS complement(10330..12231) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861980.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(12661..15027) product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898719.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene spoIIE CDS complement(15119..16039) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894028.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(16096..16395) product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437861.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(16407..16901) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425904.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(16901..17155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421411.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(17220..17462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421412.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(17525..17803) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421415.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene hbs CDS complement(17893..19341) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894031.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(19421..21046) product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene spoVB CDS complement(21166..21705) product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892063.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene spoVT CDS complement(21810..22757) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Z8 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene prsA1 CDS complement(22820..26215) product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181A0 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene mfd CDS complement(26236..26796) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181A2 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene pth CDS complement(26847..27422) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861981.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(27497..28558) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861983.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(28744..29694) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181B3 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene prs CDS complement(29789..31156) product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181B4 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene glmU CDS complement(31366..31644) product putative septation protein SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181B5 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene spoVG CDS complement(31821..32705) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425934.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene purR CDS 32930..34282 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181B7 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene murC CDS complement(34310..35104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425938.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(35210..36109) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(36294..37409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861987.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(37503..38615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(38686..39555) product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181C1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene rsmA CDS complement(39583..40113) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181C4 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene rnmV CDS complement(40258..41028) product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(41041..42975) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181D9 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene metG CDS complement(43521..44243) product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(44259..44978) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888558.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(44995..45804) product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(46405..46929) product spore maturation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898747.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene spmB CDS complement(46929..47507) product spore maturation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427659.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene spmA CDS 47637..49067 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181E1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 49098..49526 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421494.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(49556..50251) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454801.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(50431..51621) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4H3 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene aspC CDS complement(51846..52544) product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861996.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(52562..53395) product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181E6 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene rsmI CDS complement(53396..54148) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(54426..55310) product stage 0 sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427637.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(55307..56242) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(56245..56934) product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181E7 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene tmk CDS complement(57011..58426) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861997.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 sequence017 source 1..58317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 499..948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943155.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 1315..1860 product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889371.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 2021..2566 product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889371.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 2919..3470 product glycerol uptake operon antiterminator regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016313.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 3683..4453 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705540.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene glpF CDS 4500..6035 product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BQ0 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene glpK2 CDS 6128..6898 product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263776.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene glpQ CDS 7061..8521 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957284.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 8511..9755 product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 9758..10159 product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964634.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 10750..11490 product cobalt transport protein CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18D63 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene cbiM CDS 11462..11761 product cobalt transport protein CbiN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18D62 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene cbiN CDS 11755..12435 product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434199.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene cbiQ CDS 12445..13266 product cobalt ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434196.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene cbiO CDS 13476..15698 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18D66 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene pcrA CDS 15725..17023 product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18D72 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 17130..17879 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434193.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 17979..18575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 18675..19199 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18D70 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene ppiB CDS 19534..20607 product methylcobamide:CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254010.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(20796..21743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 21852..22454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 22688..25318 product aldehyde-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818A4 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(25428..25766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860735.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(25989..26237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417301.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 26325..27053 product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860741.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 27064..27969 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860742.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 28028..28822 product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417310.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 28927..29619 product ser/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427805.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 29692..30483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860743.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 30728..31288 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888208.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 31312..31797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427789.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 31946..32275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895429.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 32291..33013 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q188I9 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene rluA CDS 33037..34395 product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860779.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(34452..35315) product fructose-1,6-bisphosphate aldolase, class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 35609..36445 product transcription antiterminator BglG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987107.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 36695..38353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 38523..39878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(39914..41185) product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene sleC CDS 41309..42028 product protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q188Z4 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene prsW CDS 42043..42873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 42857..43390 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q188Z8 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene sip2A CDS 43400..44143 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860855.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 44198..45853 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436982.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 45949..46866 product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189A6 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene glsA CDS 46947..47510 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417965.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 47586..48425 product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189A4 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene nfo CDS 48544..49539 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895580.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(49566..49970) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895581.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 50036..50929 product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438992.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 51029..53242 product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438993.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 53466..54119 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189B2 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene nth CDS 54122..55489 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896350.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 55594..56064 product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189B1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 56280..57308 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357021.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 sequence018 source 1..51704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 342..497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 699..1214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(1371..2321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 2667..2990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 3186..3611 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015980.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 3632..4192 product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391917.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(4283..4783) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142381.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(4912..5055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(5061..5423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 5665..5976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 6147..6398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 6704..6874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 6977..7300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(7467..8072) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837485.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(8287..8502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(8842..9369) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 10208..11776 product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113321.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(11901..12722) product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AU0 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene zupT CDS 12984..13676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 13787..13987 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423148.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene cspD CDS complement(14245..14631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 14785..15243 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762311.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(15314..15550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(15638..16282) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 16497..17051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 17114..17278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 17601..18515 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254705.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 18923..19261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 19407..20024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268071.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(20133..20405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(20389..21048) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861420.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 21274..21555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253261.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 21653..21841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(21938..22594) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434300.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(22654..22884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 23093..23605 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775452.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(23816..24133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(24321..24554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(25055..25909) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948667.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(26015..26269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(26621..26998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(27001..27807) product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005717330.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(28786..29475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(29542..31149) product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964866.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(31371..31823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(31838..32455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(32455..33657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(33778..35130) product Cys-rich peptide radical SAM maturase CcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860654.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(35181..35318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(35341..35469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(35651..35791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(35793..36380) product accessory gene regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454130.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene agrB CDS complement(36458..37777) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860860.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(37771..38481) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene rgbR CDS complement(38641..38763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(38954..39133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(39149..40426) product putative bacteriocin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001256140.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(40525..40659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(40756..41886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(41960..43141) product TldD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001256142.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(43151..43792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(43793..44488) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963642.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 45196..45726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 45807..46442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 46590..46982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(47004..47318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(47428..48690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(48790..49308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(49583..49942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(50143..50535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 sequence019 source 1..50483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 76..151 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 176..250 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 257..332 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 507..1223 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene rgbR CDS 1235..2596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008691078.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 2705..5269 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860737.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 5262..5957 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860736.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(6002..6997) product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene dnaC CDS complement(7023..8081) product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429260.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene dnaD CDS 8180..9643 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862025.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 9730..10524 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435698.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 10540..11019 product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181Q1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene rlmH CDS 11156..11824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 11818..12246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 12329..12571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 12607..12777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 12786..13283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 13469..13942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 14378..14995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 15327..16475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 16503..17651 product tellurium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 17788..18537 product N-acyl homoserine lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216585.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 18614..19267 product putative NAD(P)H nitroreductase YfkO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34475 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene yfkO CDS 19477..19923 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133920.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene ohrR CDS 19973..20731 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(20913..21803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 22088..22663 product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948694.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 22665..23120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 23644..24495 product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948612.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 24670..25371 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948485.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 25398..26321 product bacitracin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948486.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 26315..27112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 27139..28050 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948489.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 28488..29240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 29902..31434 product zinc metalloproteinase aureolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001821522.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene aur CDS 31981..32547 product tryptophan transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435247.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(32617..33858) product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016669.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 34448..35782 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110271.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 36013..36369 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965256.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 36527..36967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 36984..38345 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987111.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(38484..39158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 39498..40490 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene potD CDS 40674..41081 product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943560.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 41212..42042 product glyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965260.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(42156..43583) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890815.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 43925..45217 product branched-chain amino acid transport system carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BC4 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene brnQ-2 CDS 45497..46675 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 46688..47659 product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395562.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene kdgT CDS 47846..49432 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948042.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 49434..50015 product transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYE2 transl_table 11 codon_start 1 locus_tag LOCUS_26660 sequence020 source 1..50335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(138..1355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(1443..2063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(2063..3472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 3592..3951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 3964..5766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 5805..5960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 5966..6262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(6302..6952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(7006..7410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(7563..8354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(8562..9848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(10155..10655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(10668..10853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(10854..11006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(11042..12268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(12350..12877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(12879..13373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(13445..13843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(13923..14975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(14994..15398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(15398..15649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(15662..15814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(15869..17455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(17502..18260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(18363..20552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(20568..21236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(21440..22240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(22301..22798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(22969..24114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(24203..26071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(26181..27101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(27204..27485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(27537..29993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(30102..30656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(30653..31075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(31044..31472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(31486..31737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 31849..32679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(32725..33084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(33084..33287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(33356..35026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(35168..37303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 37665..37991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 38032..38568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 38619..40934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(41016..43145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 43354..43809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 43958..44749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 44792..46951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 47001..47198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 47195..47431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 47431..48021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 48018..48353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 48353..48805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 48820..48987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 49055..50212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 sequence021 source 1..49888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(844..2232) product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181G3 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene tilS CDS 2498..3196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(3227..3649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892126.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(3709..4518) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181G1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene murI CDS complement(4536..5603) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F58 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene ddl CDS complement(5732..6259) product spore cortex-lytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434944.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(6288..6950) product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene spoIIR CDS complement(7069..7752) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862000.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(7745..8626) product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181G8 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene ispE CDS complement(8741..10291) product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898760.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(10386..10652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892135.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(10818..11720) product peptidase U57 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422239.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 11940..13028 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 13030..13947 product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I109 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene psuG CDS complement(13973..14134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426006.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(14144..14650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434936.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(14706..15410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434933.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(15413..16084) product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(16084..16956) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 17124..17636 product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2Q6 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene ftnA CDS complement(17680..18876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(19048..22254) product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181J0 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene carB1 CDS complement(22294..23340) product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181J1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene carA CDS complement(23354..24070) product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181J5 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene pyrF CDS complement(24463..25188) product accessory gene regulator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CNM5 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene agrA CDS complement(25201..26472) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963407.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene agrC CDS complement(26547..27341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862006.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 27662..28891 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(28940..29893) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986321.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 30241..30966 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(31015..31641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(31663..32901) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429753.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(32904..33584) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436744.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(33577..34626) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355284.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 34908..35132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(35145..36629) product dehydrosqualene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102097.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene crtN CDS 36819..37466 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186I6 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene sodA CDS complement(37485..38141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 38396..39607 product 2-amino-3-ketobutyrate CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095906.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene bioF CDS 39636..40610 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433612.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(40683..41189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903837.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(41225..41887) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439746.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(41905..42624) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434038.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(42834..43175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435770.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(43334..44107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390209.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(44192..45154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248640.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(45192..45875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(45990..47795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(47841..48530) product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(48550..49236) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 sequence022 source 1..45710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(309..1412) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888643.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(1686..2390) product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948062.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 2464..3078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453592.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 3112..4455 product permease IIC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYM1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(4487..5110) product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949142.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(5212..5532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812124.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 5935..7443 product UPF0371 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18A92 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 7517..8602 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18A91 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene dinB CDS 8740..10137 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 10247..10960 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 11080..12291 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453528.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene rpsA CDS 12646..12840 product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430174.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene thiS CDS 12842..13645 product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454457.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene thiF CDS 13659..14435 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186R1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene thiG CDS 14438..15553 product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896847.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene thiH CDS 15541..16128 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889638.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene thiE2 CDS 16295..17608 product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459325.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 17662..18114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 18251..19642 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 19855..21849 product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AK0 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 22061..22615 product UPF0397 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q832R4 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 22628..24334 product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q832R5 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 24331..25161 product cobalt ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356939.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(25259..26437) product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 26613..26984 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890791.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 27040..27519 product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AK3 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 27548..28162 product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C13 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(28235..29155) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 29509..30348 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437062.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene fumA CDS 30361..30891 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437060.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene fumB CDS 30923..32101 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861063.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 32283..32987 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426754.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 33251..34606 product permease IIC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183W6 transl_table 11 codon_start 1 locus_tag LOCUS_28050 gene celB CDS 34630..35940 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861728.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene celF CDS 36069..36446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(36479..37321) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888767.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 37523..38257 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437044.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 38269..39402 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AL1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene nagA CDS 39421..40170 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AL0 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene nagB CDS 40478..41017 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 41036..42079 product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AM3 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene potA CDS 42083..42922 product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene potB CDS 42982..43695 product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861072.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene potC CDS 43698..44744 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene potD CDS 44845..45495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 sequence023 source 1..42382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 692..1024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 1533..2345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 2329..2526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 2906..3166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(3227..3604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 3881..4249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 4544..4759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 4794..5270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986646.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 5290..5778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986646.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 5788..6009 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(6318..7424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(8249..8458) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358328.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(8552..8695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 9305..9523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 9639..10394 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434049.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 10351..11814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 11860..12753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 12750..13034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 13027..13599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 13641..14273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(14328..14681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(14754..15602) product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene parA CDS complement(15782..15958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(16151..16477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(16714..17274) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861306.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 17789..18475 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene rgaR CDS 18469..19011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 19165..19329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 20087..20914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978134.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 21402..21521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(22062..22367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(23081..23779) product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963524.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(24577..25089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(25304..26026) product SrtB family sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903304.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(26048..27412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(27806..28360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(28541..29533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 30035..30190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 30505..31125 product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(31168..31461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 31696..32922 product voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387108.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 33289..33807 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386773.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(33905..34168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(34369..34851) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966687.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 35023..35553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 35725..36288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 36562..38529 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252880.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 38774..39637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862012.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 39945..40214 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966911.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene spoVT CDS 40570..41028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 note possible pseudo, internal stop codon, frameshifted CDS 41157..41954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 note possible pseudo, internal stop codon, frameshifted sequence024 source 1..38626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1367..2062 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860731.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 2065..2988 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888178.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 3169..4092 product bacitracin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860730.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 4085..4825 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895383.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 4829..5563 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860729.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 6323..7495 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861801.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(7592..8401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 9374..10789 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903314.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 10847..11113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861663.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(11371..11568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 11896..12321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 12514..13122 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 13488..14048 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402394.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(14170..14793) product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398264.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 gene cat CDS complement(15001..15264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(15439..15783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 16004..16312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(16638..16892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 17228..17638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440086.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 17639..17851 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861845.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(17984..18379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(18390..19139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(19133..19936) product bacitracin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948486.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 20188..20382 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934223.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 20385..20843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 21183..21527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(21631..22947) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182I5 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene argH CDS complement(23085..24281) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186Z6 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene argG CDS 25326..25775 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436793.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(25812..26450) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454888.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(26483..28201) product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CVD0 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene urdA CDS 28353..28595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(28682..29029) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963402.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(29384..29575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(29739..29981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(30335..31483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(32244..33380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 33750..33971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(34110..34580) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861860.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(35233..35550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(35750..36268) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(36466..36672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 note possible pseudo, internal stop codon CDS complement(36697..36969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(37067..37417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 37594..37842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 misc_feature complement(38041..>38626) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262027.1:flavocytochrome c locus_tag LOCUS_29140 sequence025 source 1..36921 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..970) product RNA polymerase sigma-B factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420464.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene sigB CDS complement(970..1377) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892343.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene rsbW CDS complement(1381..1692) product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C94 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene rsbV CDS complement(1708..1965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420469.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(1965..2246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420471.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(2322..4745) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C90 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene gyrA CDS complement(4764..6665) product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C89 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene gyrB CDS complement(6666..7784) product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C86 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene recF CDS complement(7799..8005) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420479.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(8131..9240) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C88 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene dnaN CDS complement(9481..10809) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C85 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene dnaA CDS 11207..11455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 11597..11944 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181T2 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene rnpA CDS 11965..12216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 12262..12969 product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429300.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene oxaA1 CDS 12941..13657 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434235.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 13975..15354 product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181S7 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene mnmE CDS 15406..17301 product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181S8 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene mnmG CDS 17294..18013 product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97CW4 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene rsmG CDS 18174..18965 product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 19021..19794 product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene soj CDS 19796..20674 product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429290.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene spo0J CDS 20690..21838 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 22005..23297 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894114.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 23375..24403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 24514..25104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892314.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 25193..25456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434250.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 25468..25653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420516.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 25716..26918 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 27215..27493 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181R5 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene rpsF CDS 27534..27989 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181R6 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene ssb1 CDS 28007..28234 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181R4 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene rpsR CDS 28329..28649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420530.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 28657..29616 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434254.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 29626..31626 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 31626..32075 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181R0 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene rplI CDS 32099..33427 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181Q8 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene dnaC CDS 33627..33917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862026.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 34001..35284 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181Q7 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene purA CDS complement(35356..36258) product acetamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285679.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 tRNA 36552..36627 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 36640..36714 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 36721..36796 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 36804..36880 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 sequence026 source 1..25658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 162..236 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 rRNA 253..358 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 CDS 755..1801 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180T6 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene cobT CDS 1814..2374 product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891982.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene cobU CDS 2379..3149 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180T5 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene cobS CDS 3161..3766 product histidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861969.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene cobC CDS 4083..5594 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180T4 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene cobQ CDS 5603..6958 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180T2 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene cobB CDS 6951..7907 product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180T1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene cbiB CDS 7925..8995 product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861966.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene cobD CDS 8997..9869 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861965.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 9872..10504 product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437747.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene cbiC CDS 10515..11642 product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180S8 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene cbiD CDS 11635..12243 product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437741.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene cbiE CDS 12233..12790 product cobalt-precorrin-6Y C(15)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898664.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene cbiT CDS 12795..13547 product cobalt-precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891957.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene cbiF CDS 13531..14598 product cobalamin biosynthesis protein CbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437735.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene cbiG CDS 14595..15317 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903755.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene cbiH CDS 15314..16069 product precorrin-6x reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437730.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene cbiJ CDS 16072..16866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 note possible pseudo, internal stop codon, frameshifted CDS 16868..17578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 note possible pseudo, internal stop codon, frameshifted CDS 17593..18828 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16618 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene hemA CDS 18854..19759 product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180R9 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene hemC CDS 19749..21251 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898657.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene cobA/hemD CDS 21272..22237 product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180R7 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene hemB CDS 22243..23541 product glutamate-1-semialdehyde 2,1-aminomutase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HD65 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene hemL2 CDS 23785..24138 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2U7 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 24273..24722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 24763..25341 product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898654.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene sirC sequence027 source 1..25158 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 286..756 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948450.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(809..1519) product putative glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1E3 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene glpF CDS complement(1545..2702) product 1,3-propanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644879.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene dhaT CDS complement(2751..3176) product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388668.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(3210..3569) product propanediol dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444015.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(3559..5406) product diol dehydratase reactivase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931948.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(5435..5857) product propanediol dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732740.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(5878..6453) product propanediol dehydratase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989693.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(6470..8134) product propanediol dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008947521.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(8433..9167) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016216.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(9179..10417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(10694..11035) product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252977.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene hypA CDS 11253..12176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252978.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(12214..12546) product transcriptional regulator, HxlR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431984.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(12651..13154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948991.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(13165..15084) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948990.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(15071..15835) product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948989.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(16169..17713) product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183L8 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene mviN CDS complement(17894..18562) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475802.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(18710..19006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(19138..19722) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943659.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(19855..20685) product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(20825..21925) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426142.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(22106..23464) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986557.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 sequence028 source 1..23979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 671..1384 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916629.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(2364..3083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 3214..3849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 3981..6743 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331330.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 6866..7465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 7456..9000 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028663.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 9016..10137 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476039.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene hsdS CDS 10222..10980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 10985..11863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861925.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 12136..12741 product DNA recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023352.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene res CDS 13226..14455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 14545..14862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 14950..15204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 15906..16127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 16383..17246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(17472..18224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(18637..18846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 19057..19269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 19429..21648 product bacteriocin cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 21638..23077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(23522..23677) product YvrJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890850.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 sequence029 source 1..22105 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 632..943 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CF6 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene rpsJ CDS 1035..1664 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG0 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene rplC CDS 1693..2316 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CF9 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene rplD CDS 2316..2606 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CF8 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene rplW CDS 2638..3468 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG3 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene rplB CDS 3502..3783 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG2 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene rpsS CDS 3817..4152 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene rplV CDS 4174..4974 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG5 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene rpsC CDS 5008..5439 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG4 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene rplP CDS 5441..5644 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG9 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene rpmC CDS 5668..5922 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG8 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene rpsQ CDS 5948..6316 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG7 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene rplN CDS 6336..6644 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG6 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene rplX CDS 6669..7211 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH2 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene rplE CDS 7229..7414 product 30S ribosomal protein S14 type Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene rpsZ CDS 7447..7845 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH0 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene rpsH CDS 7876..8418 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH5 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene rplF CDS 8453..8821 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH4 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene rplR CDS 8840..9349 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH3 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene rpsE CDS 9365..9550 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH8 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene rpmD CDS 9584..10027 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH7 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene rplO CDS 10072..11340 product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH6 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene SecY CDS 11355..12005 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH9 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene adk CDS 12005..12751 product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CI4 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene map1 CDS 12773..13048 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895197.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 13076..13294 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CI2 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene infA CDS 13236..13442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 13609..13980 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CI0 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene rpsM CDS 14005..14403 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CI7 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene rpsK CDS 14421..15044 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CI6 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene rpsD CDS 15122..16069 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CI5 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene rpoA CDS 16089..16430 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CI8 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene rplQ CDS 16773..17612 product energy-coupling factor transporter ATP-binding protein EcfA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CJ0 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene ecfA1 CDS 17600..18466 product energy-coupling factor transporter ATP-binding protein EcfA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CI9 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene ecfA2 CDS 18460..19257 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CJ3 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene cbiQ CDS 19269..20000 product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CJ2 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene truA1 CDS 20120..20551 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CJ1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene rplM CDS 20580..20972 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CJ5 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene rpsI CDS 21045..21761 product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene cwlD sequence030 source 1..19711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..1638) product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254890.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(1659..2105) product metallopeptidase ImmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96630 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene immA CDS complement(2148..2555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 2725..2943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 2961..3773 product putative antirepressor - phage associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269164.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 3846..4004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(4090..4356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(4541..4786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 5179..6138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110243.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 6020..6808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254802.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(7111..8337) product PLP-dependent lyase/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047950.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene dpaL CDS 8508..9404 product putative HTH-type transcriptional regulator YdeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96660 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene ydeC CDS 9699..10304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963496.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(10533..11399) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770800.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(11401..12987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267608.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 13395..14186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 14341..16119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 16421..16861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 18225..18875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(19045..19200) product YvrJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890850.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(19275..19508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 sequence031 source 1..19554 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 284..1156 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861970.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(1232..2353) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437815.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 2516..3079 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180V5 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(3124..5505) product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(5708..6133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894025.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(6252..7187) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(7180..8007) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421354.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(8172..8537) product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180V9 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene EndoA CDS complement(8527..8811) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421359.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(8845..10008) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180W0 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene alr2 CDS complement(10023..10613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892025.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(10636..11097) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421362.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(11102..11482) product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180W4 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene acpS CDS complement(11702..11962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425849.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene atpC CDS complement(11965..13359) product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180W5 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene atpD CDS complement(13376..14239) product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180W7 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene atpG CDS complement(14268..15770) product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180W8 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene atpA CDS complement(15786..16328) product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180W9 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene atpH CDS complement(16325..16825) product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180X1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene atpF CDS complement(16911..17165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(17225..17926) product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180X2 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene atpA2 CDS complement(17929..18318) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437838.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene atpI CDS complement(18323..18553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421373.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene atpZ sequence032 source 1..19156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 17..121 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS 442..2376 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887791.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene fusA1 CDS 2506..4806 product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 5012..6391 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CB3 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene radA CDS 6393..7463 product DNA integrity scanning protein DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CB2 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene disA CDS 7562..8650 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860623.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 8785..9465 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CD1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene ispD CDS 9482..9961 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CD3 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene ispF CDS 10382..12097 product proline--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CD2 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene proS1 CDS 12318..13799 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CD6 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene gltX CDS 13953..14126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 14240..15637 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CD5 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene cysS CDS 15640..16035 product mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CD4 transl_table 11 codon_start 1 locus_tag LOCUS_31220 gene mrnC CDS 16170..16928 product flavin-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CE1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene thyX CDS 16941..17675 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425498.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 17680..18207 product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421194.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 18268..18915 product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421193.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene sigH sequence033 source 1..19085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 22..98 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 108..182 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 192..268 product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 411..1259 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 1256..2446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432439.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 2583..3488 product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420701.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene ptb CDS 3511..4614 product putative butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CK3 transl_table 11 codon_start 1 locus_tag LOCUS_31300 gene buk CDS 4626..5303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 5345..5560 product 2-oxoacid:acceptor oxidoreductase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 5585..6667 product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 6667..7419 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 7421..7981 product 2-oxoglutarate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 8158..9504 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CL0 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene glmM CDS 9747..11573 product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CK9 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene glmS CDS 12109..12855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432450.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 12874..14127 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CL1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene murA CDS 14202..15242 product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432452.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene spoIIC CDS 15463..16143 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432453.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 16241..16507 product stage III sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene spoIIID CDS 16614..17657 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene mreB1 CDS 17662..18090 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CL9 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene fabZ CDS complement(18147..18656) product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421842.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 sequence034 source 1..17269 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 406..2478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(2541..3197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54525 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene yqiI CDS complement(3520..4668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 4986..5264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 5483..5740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 5892..6968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(7284..7544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 7672..7860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 8034..9392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 9508..9894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 10488..12509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 12511..13797 product restriction modification system DNA specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 13810..16809 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene hsdR2 CDS complement(16967..17266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 sequence035 source 1..15955 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 148..636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS complement(692..958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(1055..1288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(1470..1715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 2124..2927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254802.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 3308..4963 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I1D0 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene rnj CDS complement(5025..6488) product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229528.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene sulP CDS complement(6888..7100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 7647..8429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248630.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 note possible pseudo, internal stop codon CDS 8763..9035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 9040..10314 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861541.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(10693..11736) product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680822.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 gene arcB CDS 12029..12253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 note possible pseudo, internal stop codon, frameshifted CDS complement(12292..12588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 12628..12834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS 13586..14296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 14460..14834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 14839..15042 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423163.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(15217..15372) product YvrJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890850.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(15477..15710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 sequence036 source 1..15762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 689..3238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 3274..4194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(4241..4618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(4618..5343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(5433..7160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 misc_feature complement(7223..>15762) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000726077.1:peptidase M24 locus_tag LOCUS_31850 sequence037 source 1..15728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1845..1917) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(1929..2016) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(2070..2141) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(2300..2371) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(2628..2708) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(2868..2942) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(2947..3019) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 3526..3798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 3985..4980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 5185..5370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 5626..5865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 tRNA 6793..6865 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 6935..7018 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 7262..7334 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 7675..7750 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 7961..8033 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 8546..8618 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 8620..8693 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 8850..9371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31900 note possible pseudo, internal stop codon CDS 10302..10526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 rRNA 10905..12356 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 CDS 12776..13027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 13059..13451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 13468..13950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 tRNA 14124..14208 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 14305..14376 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 15011..15274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 note possible pseudo, internal stop codon tRNA 15345..15416 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 sequence038 source 1..14924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 358..507 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CE3 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene rpmG CDS 533..754 product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CE2 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene secE CDS 770..1315 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CE6 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene nusG CDS 1345..1770 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CE5 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene rplK CDS 1847..2545 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CE9 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene rplA CDS 2763..3266 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CE8 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene rplJ CDS 3344..3706 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CE7 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene rplL CDS 3972..7670 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CF1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene rpoB CDS 7714..11202 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CF3 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene rpoC CDS 11512..11934 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CF2 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene rpsL CDS 12055..12525 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CF5 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene rpsG CDS 12583..14649 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CF4 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene fusA sequence039 source 1..14669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 628..843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 932..2239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 2257..3273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 3440..4591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 4618..5694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 5759..6850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 6853..8082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(8115..9320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(9387..10463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(10463..10762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(10774..11505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(11523..11933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(11939..12166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(12163..12567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(12673..13479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(13574..14509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 sequence040 source 1..13187 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1083..1460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 2061..2423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 note possible pseudo, internal stop codon CDS 3190..3435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 4318..4554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 note possible pseudo, internal stop codon CDS 4618..4902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 note possible pseudo, internal stop codon tRNA 5115..5187 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 5339..5695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 note possible pseudo, internal stop codon CDS 5774..6073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 note possible pseudo, internal stop codon CDS 6134..6856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 note possible pseudo, internal stop codon CDS complement(7410..8009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(8192..8566) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU40 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene nuoA CDS complement(8567..9259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 note possible pseudo, internal stop codon CDS complement(9560..10276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 note possible pseudo, internal stop codon tRNA complement(10279..10352) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(10642..10848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 10796..11053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(11218..11415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(11963..12268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 note possible pseudo, internal stop codon CDS complement(12691..13041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 sequence041 source 1..12042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1788..3599) product lantibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888006.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(3714..3914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(3978..5534) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963977.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(5589..6824) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811490.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(6826..7713) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459749.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(7860..8927) product vancomycin resistance histidine kinase VanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510927.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(8920..9618) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461303.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 10051..11505 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699969.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene nisP sequence042 source 1..11070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(568..795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(1002..2390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(2496..4640) product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701298.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene clyB CDS complement(4612..5373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033170.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(5458..5691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(5783..5977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(6038..9031) product type 2 lantibiotic biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370929.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene cylM CDS complement(9954..10514) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837300.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(10792..10947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32580 sequence043 source 1..9857 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 666..953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 1378..1935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 1919..2896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 2968..3399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS 3689..4642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 5196..5615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 5970..6878 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 6884..7567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 7950..8210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 sequence044 source 1..9765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1355..2116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 note possible pseudo, internal stop codon CDS 2150..2971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 note possible pseudo, internal stop codon CDS complement(3144..3455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(3717..4514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(4507..4722) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836709.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(4969..7233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(7444..8760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 sequence045 source 1..9545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(269..499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 684..1889 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426064.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(1947..2174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421616.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(2328..2927) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CA2 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene recR CDS complement(2939..3280) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CA3 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(3346..4995) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene dnaX tRNA complement(5429..5521) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(5522..5977) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CA0 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene tadA CDS complement(6196..7479) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C97 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene serS1 CDS complement(7915..8781) product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860622.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(8942..9163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 rRNA complement(9419..9523) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 sequence046 source 1..8500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 1695..1768 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(2028..2231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 2200..2376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32860 note possible pseudo, internal stop codon CDS complement(2478..2687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 3076..3243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32880 note possible pseudo, internal stop codon CDS 3824..4132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 4271..4432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 4898..5131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS 5162..5404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS 5423..5611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS 5666..5935 product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3W1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene nuoK CDS 5935..6126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 6478..6630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 6853..7902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32970 note possible pseudo, internal stop codon CDS 8030..8239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 sequence047 source 1..8349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(74..358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(375..1475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888008.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(1487..2887) product Cys-rich peptide radical SAM maturase CcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860654.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(3012..3188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(3236..4966) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 5141..6187 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03CR5 transl_table 11 codon_start 1 locus_tag LOCUS_33040 gene ddl CDS 6258..6407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 6379..7716 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462056.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS 7700..8179 product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FB5 transl_table 11 codon_start 1 locus_tag LOCUS_33070 sequence048 source 1..8125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 461..955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 1046..1630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS 1866..3035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 note possible pseudo, frameshifted CDS 3172..3717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 4179..4454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 4488..4700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33130 note possible pseudo, internal stop codon CDS 4813..5337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 5624..5878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(6157..6312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(6305..6538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(6613..6753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(6881..7036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(7113..7271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS 7442..8062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 sequence049 source 1..7963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 247..714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(1151..2428) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775654.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(2923..4239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(4289..4690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(5014..5136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(5139..6176) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023456.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(6891..7067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(7153..7395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 sequence050 source 1..7476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(982..1461) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F4 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene greA CDS complement(1563..2531) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F5 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene dusB CDS complement(2633..3403) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F7 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene coaX CDS complement(3421..4017) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892118.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS complement(4173..5132) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(5125..6102) product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F8 transl_table 11 codon_start 1 locus_tag LOCUS_33350 gene birA misc_feature complement(6168..>7476) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q181G0:ATP-dependent zinc metalloprotease FtsH locus_tag LOCUS_33360 sequence051 source 1..7378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 25..156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 317..1129 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622595.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(1740..3527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(3756..5492) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948347.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 5765..6181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(6218..6742) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454764.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 sequence052 source 1..7003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1139..1807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 2110..2652 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434528.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 gene tcdR CDS 2721..3236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS 3289..5616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 6011..6817 product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005717330.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 sequence053 source 1..6443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(189..2612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964266.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(2609..5215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 misc_feature complement(5585..>6443) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460042.1:transporter locus_tag LOCUS_33500 sequence054 source 1..6406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 120..290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 287..895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 930..1412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 1409..2080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 2037..5495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 5492..5641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 5713..6036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 sequence055 source 1..6099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(549..1088) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CJ8 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene nrdG CDS complement(1125..3476) product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436320.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene nrdD CDS 3833..5011 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CJ7 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene aspC CDS complement(5199..5720) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902046.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 sequence056 source 1..6035 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..874 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P45867:acyl-CoA dehydrogenase locus_tag LOCUS_33620 CDS 907..1665 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 1676..2662 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52039 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene etfA CDS 2695..4317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS 4572..5258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 sequence057 source 1..5644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 420..992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(1134..1991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 2162..2719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(2821..4962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 sequence058 source 1..5386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(318..890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS 1076..1555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(1722..1943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(2391..2594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(3316..3792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(3884..4204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 4408..4968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 sequence059 source 1..5217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(674..2659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(2682..3506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(3657..4514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(4547..4819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS complement(4761..5114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33820 sequence060 source 1..5178 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(799..1434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986295.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(1632..1817) product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964076.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(1840..2028) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422320.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(2149..3825) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7H3 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene hcp misc_feature complement(4013..>5178) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5I5M8:hydroxylamine reductase locus_tag LOCUS_33870 sequence061 source 1..5106 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(319..2169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(2433..3491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272581.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(3507..4001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(4190..4369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(4440..5006) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461583.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 sequence062 source 1..4849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(293..427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(467..1393) product putative HTH-type transcriptional regulator YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96662 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene ydeE CDS complement(1570..1962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(2200..2499) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305011.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(2829..3941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459994.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS complement(4010..4333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 sequence063 source 1..4623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(68..141) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(918..1442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(1463..2305) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458816.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 2817..4028 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458812.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(4359..4574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34020 sequence064 source 1..4601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 293..1096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 1135..1431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS 1464..2336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 2342..2521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 2575..2835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 2868..3299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 3507..3737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 sequence065 source 1..4437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(542..862) product phosphoribosyl-ATP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966108.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS complement(831..1862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS 2328..2837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 2851..3492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(3787..4227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 note possible pseudo, internal stop codon sequence066 source 1..4376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(401..1171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 1712..2071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(2488..2742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(2847..3137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 3545..4075 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434528.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene tcdR sequence067 source 1..4346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(865..1437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(1460..2146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(2151..3464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 sequence068 source 1..4215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1306..1749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 2124..2684 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355429.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 2686..3657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34260 sequence069 source 1..4019 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 973..1890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS 1954..2397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 2861..3283 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804885.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 3280..3510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857133.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 3720..3860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34310 sequence070 source 1..4007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(637..1449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986597.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(1497..2645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(3221..3538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(3565..3720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34350 sequence071 source 1..3933 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(401..610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(624..872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(1125..1481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 1951..2154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 2387..2599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 2596..2850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(3335..3667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34420 sequence072 source 1..3678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 88..1563 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068635.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 1639..2535 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567523.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 2535..3389 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 sequence073 source 1..3659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 308..1285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 1473..2297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(2628..3278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS complement(3307..3657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34490 sequence074 source 1..3566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 278..958 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 951..3470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 sequence075 source 1..3541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(174..383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(627..1067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS complement(1169..1420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS complement(1432..1995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS 2438..2596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 sequence076 source 1..3424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 510..1487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS 1475..2587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS 2568..3257 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948608.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 sequence077 source 1..3420 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(128..625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(1117..1287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS complement(1530..1652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(1785..2486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34630 sequence078 source 1..3377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1469..1972 product zeta toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226648.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 2499..2699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 2689..2883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 2855..3043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34670 sequence079 source 1..3372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 877..1590 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 1580..2911 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948726.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 sequence080 source 1..3306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 961..1176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 1413..2057 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223578.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 2245..2364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 2548..2991 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816014.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 sequence081 source 1..3172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1079..1849) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(1993..3078) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 sequence082 source 1..3121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1152..2072) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986545.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS complement(2127..2543) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438356.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 sequence083 source 1..2874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence084 source 1..2855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 995..1939 product adenosine deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681076.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(1970..2437) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_604004.2 transl_table 11 codon_start 1 locus_tag LOCUS_34790 sequence085 source 1..2787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(803..1975) product putative metal chaperone YciC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94400 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene yciC CDS complement(2020..2448) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812063.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 sequence086 source 1..2783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 518..1774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34820 sequence087 source 1..2728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(601..1047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 1241..1567 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948550.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS 1752..2228 product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948549.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 sequence088 source 1..2547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(267..1328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(1367..1684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(1978..2301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34880 sequence089 source 1..2530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(51..383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(728..1189) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905253.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene ycgF CDS complement(1311..1655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(1742..2278) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816041.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 sequence090 source 1..2410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 172..1041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 1200..1430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 1796..2062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34950 sequence091 source 1..2388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..596 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000458116.1:choline-binding protein A locus_tag LOCUS_34960 CDS 673..1329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296481.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(1404..1583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34980 tRNA complement(1882..1957) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(1962..2035) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(2119..2358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 sequence092 source 1..2301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 752..1600 product transcription antiterminator BglG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289586.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene bglG2 sequence093 source 1..2261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(601..1800) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084954.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 sequence094 source 1..2199 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(22..936) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101315.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene cps3A CDS complement(957..1865) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(1897..2169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35060 sequence095 source 1..2180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(261..509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(976..1095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35080 sequence096 source 1..2104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(170..325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(555..1664) product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 sequence097 source 1..2082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 534..1103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 sequence098 source 1..2072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(210..857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 sequence099 source 1..2061 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 165..551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 588..785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 793..1026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 1069..1347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 1434..1856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 sequence100 source 1..2049 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 987..1205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(1301..1495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(1544..1774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35200 note possible pseudo, internal stop codon sequence101 source 1..2049 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 485..790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 969..1097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 1131..1670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902203.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 1744..1986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35240 sequence102 source 1..2036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 34..216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(314..1114) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286866.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(1156..1725) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303222.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 sequence103 source 1..2012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 416..691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(771..1316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(1328..1612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 sequence104 source 1..2004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(182..802) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435768.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 misc_feature complement(803..>2004) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011862013.1:ABC transporter permease locus_tag LOCUS_35320 sequence105 source 1..1984 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 456..812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(973..1389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35350 note possible pseudo, frameshifted CDS complement(1585..1722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 sequence106 source 1..1951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1144..1896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180345.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 sequence107 source 1..1947 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 374..772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 762..1238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415780.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 sequence108 source 1..1870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence109 source 1..1858 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1169..1468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35400 sequence110 source 1..1848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 483..1301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35410 sequence111 source 1..1847 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..712 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986544.1:GntR family transcriptional regulator locus_tag LOCUS_35420 CDS complement(761..1717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 sequence112 source 1..1845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 26..102 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 126..202 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 211..287 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 296..371 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 393..466 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 474..550 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA 564..639 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS 822..1073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 1100..1513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895151.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 sequence113 source 1..1830 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(283..786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(803..1072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 misc_feature complement(1280..>1830) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000551899.1:IS110 family transposase locus_tag LOCUS_35480 sequence114 source 1..1828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 149..856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 1027..1827 product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460668.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 sequence115 source 1..1776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(26..649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS complement(640..1497) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 sequence116 source 1..1756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 973..1155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 1152..1331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 1347..1544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35550 sequence117 source 1..1747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 207..401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(451..1260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35570 sequence118 source 1..1744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(527..955) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764905.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS complement(1040..1357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS complement(1246..1536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35600 sequence119 source 1..1735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 153..614 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445792.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS 611..967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 977..1564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35630 sequence120 source 1..1694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 243..719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861759.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 772..1551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674335.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 sequence121 source 1..1685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(410..616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(594..1442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35670 sequence122 source 1..1684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence123 source 1..1676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(379..540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(549..1220) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023861.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 sequence124 source 1..1657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 288..572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(657..1175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35710 sequence125 source 1..1635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence126 source 1..1613 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 14..967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35720 sequence127 source 1..1611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(9..788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(785..1270) product RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306931.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 sequence128 source 1..1605 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 392..730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35750 sequence129 source 1..1592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(85..246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35760 misc_feature complement(324..>1592) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860860.1:sensor histidine kinase locus_tag LOCUS_35770 sequence130 source 1..1559 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 215..1408 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966748.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 sequence131 source 1..1557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(306..1061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35790 sequence132 source 1..1553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(208..1194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35800 sequence133 source 1..1552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 29..754 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021134.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 sequence134 source 1..1545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 426..824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 818..1102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 1083..1286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 sequence135 source 1..1468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(11..382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS 586..1308 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene rgaR sequence136 source 1..1458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence137 source 1..1452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence138 source 1..1446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 287..511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS 822..1130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35880 tRNA complement(1343..1415) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 sequence139 source 1..1424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(479..>1424) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583044.1:multidrug ABC transporter ATP-binding protein locus_tag LOCUS_35890 sequence140 source 1..1410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(71..292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(539..961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35910 sequence141 source 1..1401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(271..474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35920 misc_feature complement(700..>1401) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q181F2:lysine--tRNA ligase locus_tag LOCUS_35930 sequence142 source 1..1395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(42..446) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS complement(516..1157) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948953.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 sequence143 source 1..1392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(164..325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(756..977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35970 sequence144 source 1..1374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1032 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459160.1:ABC transporter permease locus_tag LOCUS_35980 sequence145 source 1..1358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 381..959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS 953..1339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36000 sequence146 source 1..1347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(809..1033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS complement(1093..1221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36020 sequence147 source 1..1341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence148 source 1..1340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence149 source 1..1337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(824..1000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 sequence150 source 1..1334 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence151 source 1..1330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(328..1305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36050 sequence152 source 1..1313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence153 source 1..1301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 49..891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36060 sequence154 source 1..1299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 263..715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS 702..1148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 sequence155 source 1..1295 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 264..608 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184004.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS 595..1197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459652.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 sequence156 source 1..1295 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 152..225 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 rRNA 244..349 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS 660..779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(801..989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421310.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 1083..1214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36140 sequence157 source 1..1293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(928..1146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36150 sequence158 source 1..1275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(223..1017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36160 sequence159 source 1..1261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence160 source 1..1258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 392..634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(627..938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36190 sequence161 source 1..1231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1076..1231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36200 sequence162 source 1..1228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence163 source 1..1214 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1044 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680887.1:ABC transporter ATP-binding protein locus_tag LOCUS_36210 sequence164 source 1..1213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence165 source 1..1210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(76..207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36220 sequence166 source 1..1204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 146..916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36230 sequence167 source 1..1192 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS 319..1041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36250 sequence168 source 1..1188 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 595..939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 915..1058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36280 sequence169 source 1..1186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 250..519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS 645..812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS 820..945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 sequence170 source 1..1176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(914..1051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36320 sequence171 source 1..1169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(498..1136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679175.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene ubiE sequence172 source 1..1168 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 8..484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 487..1056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36350 sequence173 source 1..1163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 359..799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36360 sequence174 source 1..1162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence175 source 1..1146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 89..223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 315..767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36380 sequence176 source 1..1133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 166..1131 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 sequence177 source 1..1108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 52..125 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 128..201 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA 207..279 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA 315..389 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA 418..493 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA 560..634 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA 656..743 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA 768..843 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA 1029..1104 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 sequence178 source 1..1091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 341..829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 sequence179 source 1..1081 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 289..816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429178.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 sequence180 source 1..1065 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 619..747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36420 sequence181 source 1..1048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence182 source 1..1046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence183 source 1..1039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(895..1000) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 sequence184 source 1..1031 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence185 source 1..1020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 679..885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36430 sequence186 source 1..1013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 86..460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 567..695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 sequence187 source 1..1013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 290..640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 693..995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 sequence188 source 1..1013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 202..633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 741..989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36490 sequence189 source 1..1012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 146..679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36500 sequence190 source 1..1001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 466..708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36510 sequence191 source 1..1000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(31..831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36520