>Feature sequence01 436 1068 gene locus_tag LOCUS_00010 gene lexA 436 1068 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCZ5 protein_id gnl|my_center|LOCUS_00010 2070 1126 gene locus_tag LOCUS_00020 gene dapE 2070 1126 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2G4 protein_id gnl|my_center|LOCUS_00020 1996 2223 gene locus_tag LOCUS_00030 1996 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3029 2205 gene locus_tag LOCUS_00040 gene dapD 3029 2205 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_00040 4264 3152 gene locus_tag LOCUS_00050 4264 3152 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_00050 5613 4261 gene locus_tag LOCUS_00060 gene hflX 5613 4261 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33230 protein_id gnl|my_center|LOCUS_00060 6442 5606 gene locus_tag LOCUS_00070 gene dapF 6442 5606 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZX7 protein_id gnl|my_center|LOCUS_00070 7307 6450 gene locus_tag LOCUS_00080 gene miaA 7307 6450 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EDG9 protein_id gnl|my_center|LOCUS_00080 8845 7382 gene locus_tag LOCUS_00090 gene miaB 8845 7382 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69963 protein_id gnl|my_center|LOCUS_00090 10022 8931 gene locus_tag LOCUS_00100 gene recA 10022 8931 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9REV6 protein_id gnl|my_center|LOCUS_00100 10327 10737 gene locus_tag LOCUS_00110 gene msrB 10327 10737 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B11 protein_id gnl|my_center|LOCUS_00110 11986 10751 gene locus_tag LOCUS_00120 11986 10751 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYM0 protein_id gnl|my_center|LOCUS_00120 13197 11983 gene locus_tag LOCUS_00130 13197 11983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887916.1 protein_id gnl|my_center|LOCUS_00130 13796 13218 gene locus_tag LOCUS_00140 13796 13218 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_00140 15061 13793 gene locus_tag LOCUS_00150 gene rimO 15061 13793 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJK1 protein_id gnl|my_center|LOCUS_00150 17540 15078 gene locus_tag LOCUS_00160 gene ftsK 17540 15078 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05560 protein_id gnl|my_center|LOCUS_00160 17700 18950 gene locus_tag LOCUS_00170 17700 18950 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531653.1 protein_id gnl|my_center|LOCUS_00170 20196 19129 gene locus_tag LOCUS_00180 gene bioB 20196 19129 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QX70 protein_id gnl|my_center|LOCUS_00180 21994 20240 gene locus_tag LOCUS_00190 gene rnj 21994 20240 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748A2 protein_id gnl|my_center|LOCUS_00190 22872 21991 gene locus_tag LOCUS_00200 gene dapA 22872 21991 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJK7 protein_id gnl|my_center|LOCUS_00200 24057 22939 gene locus_tag LOCUS_00210 24057 22939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_00210 24703 24071 gene locus_tag LOCUS_00220 24703 24071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25560 24742 gene locus_tag LOCUS_00230 25560 24742 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ39 protein_id gnl|my_center|LOCUS_00230 27252 25624 gene locus_tag LOCUS_00240 27252 25624 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730481.1 protein_id gnl|my_center|LOCUS_00240 27326 28048 gene locus_tag LOCUS_00250 27326 28048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28849 28061 gene locus_tag LOCUS_00260 gene dapB 28849 28061 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAK6 protein_id gnl|my_center|LOCUS_00260 30178 28859 gene locus_tag LOCUS_00270 30178 28859 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728508.1 protein_id gnl|my_center|LOCUS_00270 32555 30147 gene locus_tag LOCUS_00280 gene pnp 32555 30147 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WI57 protein_id gnl|my_center|LOCUS_00280 33025 32747 gene locus_tag LOCUS_00290 gene rpsO 33025 32747 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT0 protein_id gnl|my_center|LOCUS_00290 33276 34553 gene locus_tag LOCUS_00300 33276 34553 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_00300 35522 34575 gene locus_tag LOCUS_00310 35522 34575 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD65 protein_id gnl|my_center|LOCUS_00310 36435 35536 gene locus_tag LOCUS_00320 gene truB 36435 35536 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z528 protein_id gnl|my_center|LOCUS_00320 36824 36432 gene locus_tag LOCUS_00330 gene rbfA 36824 36432 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_00330 39757 36881 gene locus_tag LOCUS_00340 39757 36881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41120 39888 gene locus_tag LOCUS_00350 41120 39888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 41698 41117 gene locus_tag LOCUS_00360 41698 41117 CDS product ribosome maturation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_00360 43354 41942 gene locus_tag LOCUS_00370 gene proS 43354 41942 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z5I7 protein_id gnl|my_center|LOCUS_00370 44636 43407 gene locus_tag LOCUS_00380 gene ispG 44636 43407 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NP12 protein_id gnl|my_center|LOCUS_00380 46185 44653 gene locus_tag LOCUS_00390 gene rip1 46185 44653 CDS product zinc metalloprotease Rip1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHS3 protein_id gnl|my_center|LOCUS_00390 47381 46185 gene locus_tag LOCUS_00400 gene dxr 47381 46185 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV9 protein_id gnl|my_center|LOCUS_00400 48885 47425 gene locus_tag LOCUS_00410 48885 47425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 49454 48885 gene locus_tag LOCUS_00420 gene frr 49454 48885 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDE3 protein_id gnl|my_center|LOCUS_00420 50238 49507 gene locus_tag LOCUS_00430 gene pyrH 50238 49507 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q831V1 protein_id gnl|my_center|LOCUS_00430 51032 50238 gene locus_tag LOCUS_00440 gene tsf 51032 50238 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYT7 protein_id gnl|my_center|LOCUS_00440 51941 51039 gene locus_tag LOCUS_00450 gene rpsB 51941 51039 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDF2 protein_id gnl|my_center|LOCUS_00450 53635 52139 gene locus_tag LOCUS_00460 53635 52139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54855 53890 gene locus_tag LOCUS_00470 54855 53890 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460421.1 protein_id gnl|my_center|LOCUS_00470 55805 54852 gene locus_tag LOCUS_00480 55805 54852 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190020.1 protein_id gnl|my_center|LOCUS_00480 57497 55983 gene locus_tag LOCUS_00490 57497 55983 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_00490 57967 57614 gene locus_tag LOCUS_00500 57967 57614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 58218 58403 gene locus_tag LOCUS_00510 58218 58403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 58394 59071 gene locus_tag LOCUS_00520 58394 59071 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903437.1 protein_id gnl|my_center|LOCUS_00520 59865 59083 gene locus_tag LOCUS_00530 59865 59083 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887469.1 protein_id gnl|my_center|LOCUS_00530 61574 59934 gene locus_tag LOCUS_00540 gene pgi2 61574 59934 CDS product glucose-6-phosphate isomerase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z523 protein_id gnl|my_center|LOCUS_00540 62530 61589 gene locus_tag LOCUS_00550 62530 61589 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727141.1 protein_id gnl|my_center|LOCUS_00550 63548 62520 gene locus_tag LOCUS_00560 63548 62520 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_00560 63822 66014 gene locus_tag LOCUS_00570 63822 66014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 66110 67570 gene locus_tag LOCUS_00580 66110 67570 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726834.1 protein_id gnl|my_center|LOCUS_00580 69025 67664 gene locus_tag LOCUS_00590 69025 67664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 69995 68976 gene locus_tag LOCUS_00600 69995 68976 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730974.1 protein_id gnl|my_center|LOCUS_00600 71180 70002 gene locus_tag LOCUS_00610 71180 70002 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_00610 71426 71262 gene locus_tag LOCUS_00620 71426 71262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 71377 72621 gene locus_tag LOCUS_00630 71377 72621 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_00630 72669 73187 gene locus_tag LOCUS_00640 72669 73187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 73184 74011 gene locus_tag LOCUS_00650 73184 74011 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_00650 74671 74015 gene locus_tag LOCUS_00660 74671 74015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 75185 74790 gene locus_tag LOCUS_00670 gene atpC 75185 74790 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2Z6 protein_id gnl|my_center|LOCUS_00670 76621 75185 gene locus_tag LOCUS_00680 gene atpD 76621 75185 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42464 protein_id gnl|my_center|LOCUS_00680 77653 76676 gene locus_tag LOCUS_00690 gene atpG 77653 76676 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4D4 protein_id gnl|my_center|LOCUS_00690 79204 77657 gene locus_tag LOCUS_00700 gene atpA 79204 77657 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MLW0 protein_id gnl|my_center|LOCUS_00700 79746 79222 gene locus_tag LOCUS_00710 79746 79222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 80270 79743 gene locus_tag LOCUS_00720 gene atpF 80270 79743 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2Z0 protein_id gnl|my_center|LOCUS_00720 80864 80283 gene locus_tag LOCUS_00730 80864 80283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 81314 81030 gene locus_tag LOCUS_00740 81314 81030 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6C1 protein_id gnl|my_center|LOCUS_00740 82194 81412 gene locus_tag LOCUS_00750 gene atpB 82194 81412 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NR51 protein_id gnl|my_center|LOCUS_00750 82652 82191 gene locus_tag LOCUS_00760 82652 82191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 82885 82637 gene locus_tag LOCUS_00770 82885 82637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 84220 82985 gene locus_tag LOCUS_00780 84220 82985 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775946.1 protein_id gnl|my_center|LOCUS_00780 85482 84241 gene locus_tag LOCUS_00790 85482 84241 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_00790 85566 87092 gene locus_tag LOCUS_00800 85566 87092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704555.1 protein_id gnl|my_center|LOCUS_00800 87537 87106 gene locus_tag LOCUS_00810 87537 87106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 87620 88522 gene locus_tag LOCUS_00820 gene menB 87620 88522 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHD8 protein_id gnl|my_center|LOCUS_00820 89410 88577 gene locus_tag LOCUS_00830 89410 88577 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027715.1 protein_id gnl|my_center|LOCUS_00830 90293 89412 gene locus_tag LOCUS_00840 gene prmC 90293 89412 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC99 protein_id gnl|my_center|LOCUS_00840 91357 90290 gene locus_tag LOCUS_00850 gene prfA 91357 90290 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F68 protein_id gnl|my_center|LOCUS_00850 92376 91360 gene locus_tag LOCUS_00860 92376 91360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 92620 92414 gene locus_tag LOCUS_00870 gene rpmE 92620 92414 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R215 protein_id gnl|my_center|LOCUS_00870 94302 92713 gene locus_tag LOCUS_00880 94302 92713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 95646 94501 gene locus_tag LOCUS_00890 95646 94501 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_00890 97102 95693 gene locus_tag LOCUS_00900 gene thrC 97102 95693 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29363 protein_id gnl|my_center|LOCUS_00900 98424 97102 gene locus_tag LOCUS_00910 98424 97102 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIW9 protein_id gnl|my_center|LOCUS_00910 99217 98486 gene locus_tag LOCUS_00920 99217 98486 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X8E6 protein_id gnl|my_center|LOCUS_00920 100497 99226 gene locus_tag LOCUS_00930 gene lysA 100497 99226 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIR2 protein_id gnl|my_center|LOCUS_00930 102112 100505 gene locus_tag LOCUS_00940 gene argS 102112 100505 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y493 protein_id gnl|my_center|LOCUS_00940 102282 103613 gene locus_tag LOCUS_00950 gene murA 102282 103613 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1U5 protein_id gnl|my_center|LOCUS_00950 103743 104084 gene locus_tag LOCUS_00960 103743 104084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787945.1 protein_id gnl|my_center|LOCUS_00960 104084 104737 gene locus_tag LOCUS_00970 104084 104737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225444.1 protein_id gnl|my_center|LOCUS_00970 104799 104871 gene locus_tag LOCUS_t00010 104799 104871 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 106497 104956 gene locus_tag LOCUS_00980 106497 104956 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729267.1 protein_id gnl|my_center|LOCUS_00980 108128 106494 gene locus_tag LOCUS_00990 108128 106494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 109423 108182 gene locus_tag LOCUS_01000 gene fadE17 109423 108182 CDS product putative acyl-CoA dehydrogenase FadE17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95280 protein_id gnl|my_center|LOCUS_01000 109513 110685 gene locus_tag LOCUS_01010 109513 110685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 111144 110698 gene locus_tag LOCUS_01020 111144 110698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 111302 111949 gene locus_tag LOCUS_01030 111302 111949 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600286.1 protein_id gnl|my_center|LOCUS_01030 111946 112464 gene locus_tag LOCUS_01040 111946 112464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_01040 112446 113174 gene locus_tag LOCUS_01050 112446 113174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014087.1 protein_id gnl|my_center|LOCUS_01050 114232 113264 gene locus_tag LOCUS_01060 114232 113264 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_01060 115027 114245 gene locus_tag LOCUS_01070 gene fixA 115027 114245 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_01070 115138 116067 gene locus_tag LOCUS_01080 115138 116067 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_01080 116722 116054 gene locus_tag LOCUS_01090 gene glpQ 116722 116054 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_01090 116978 117337 gene locus_tag LOCUS_01100 116978 117337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 118901 117429 gene locus_tag LOCUS_01110 118901 117429 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728009.1 protein_id gnl|my_center|LOCUS_01110 119156 118920 gene locus_tag LOCUS_01120 gene TB9.4 119156 118920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416863.1 protein_id gnl|my_center|LOCUS_01120 120368 119223 gene locus_tag LOCUS_01130 120368 119223 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NRC9 protein_id gnl|my_center|LOCUS_01130 120428 121147 gene locus_tag LOCUS_01140 120428 121147 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226228.1 protein_id gnl|my_center|LOCUS_01140 121123 122319 gene locus_tag LOCUS_01150 121123 122319 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_01150 122382 122843 gene locus_tag LOCUS_01160 122382 122843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 123743 122850 gene locus_tag LOCUS_01170 123743 122850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 124273 123740 gene locus_tag LOCUS_01180 124273 123740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 124863 124270 gene locus_tag LOCUS_01190 124863 124270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 126833 124860 gene locus_tag LOCUS_01200 126833 124860 CDS product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_01200 127357 126830 gene locus_tag LOCUS_01210 127357 126830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 127512 127348 gene locus_tag LOCUS_01220 127512 127348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 128270 127509 gene locus_tag LOCUS_01230 128270 127509 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_01230 128941 128267 gene locus_tag LOCUS_01240 128941 128267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 129629 128925 gene locus_tag LOCUS_01250 129629 128925 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895205.1 protein_id gnl|my_center|LOCUS_01250 129740 130138 gene locus_tag LOCUS_01260 129740 130138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01260 130142 130684 gene locus_tag LOCUS_01270 130142 130684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 130687 131289 gene locus_tag LOCUS_01280 130687 131289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 131368 131757 gene locus_tag LOCUS_01290 131368 131757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 132957 131776 gene locus_tag LOCUS_01300 132957 131776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223432.1 protein_id gnl|my_center|LOCUS_01300 132994 134079 gene locus_tag LOCUS_01310 132994 134079 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325333.1 protein_id gnl|my_center|LOCUS_01310 134076 134348 gene locus_tag LOCUS_01320 134076 134348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 134949 134356 gene locus_tag LOCUS_01330 134949 134356 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223021.1 protein_id gnl|my_center|LOCUS_01330 136187 134976 gene locus_tag LOCUS_01340 gene ltp1 136187 134976 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_01340 136591 136199 gene locus_tag LOCUS_01350 136591 136199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 137625 136687 gene locus_tag LOCUS_01360 137625 136687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 137705 138763 gene locus_tag LOCUS_01370 137705 138763 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 protein_id gnl|my_center|LOCUS_01370 138808 140085 gene locus_tag LOCUS_01380 138808 140085 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_01380 140362 142191 gene locus_tag LOCUS_01390 140362 142191 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900811.1 protein_id gnl|my_center|LOCUS_01390 142285 143244 gene locus_tag LOCUS_01400 142285 143244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 144605 143307 gene locus_tag LOCUS_01410 gene mtrB 144605 143307 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_01410 144739 145452 gene locus_tag LOCUS_01420 gene afsQ1 144739 145452 CDS product transcriptional regulatory protein AfsQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04942 protein_id gnl|my_center|LOCUS_01420 145864 146133 gene locus_tag LOCUS_01430 145864 146133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 146120 146614 gene locus_tag LOCUS_01440 146120 146614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 147415 146660 gene locus_tag LOCUS_01450 147415 146660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 148350 147415 gene locus_tag LOCUS_01460 148350 147415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01460 148839 148474 gene locus_tag LOCUS_01470 148839 148474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01470 150264 149047 gene locus_tag LOCUS_01480 150264 149047 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_01480 151641 150325 gene locus_tag LOCUS_01490 151641 150325 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055994.1 protein_id gnl|my_center|LOCUS_01490 153023 151641 gene locus_tag LOCUS_01500 gene cysS 153023 151641 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A2 protein_id gnl|my_center|LOCUS_01500 153083 155716 gene locus_tag LOCUS_01510 gene valS 153083 155716 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1M5 protein_id gnl|my_center|LOCUS_01510 156787 155645 gene locus_tag LOCUS_01520 156787 155645 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978023.1 protein_id gnl|my_center|LOCUS_01520 157438 156857 gene locus_tag LOCUS_01530 gene sodB 157438 156857 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2F5 protein_id gnl|my_center|LOCUS_01530 158094 157546 gene locus_tag LOCUS_01540 158094 157546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 159022 158366 gene locus_tag LOCUS_01550 gene msrA1 159022 158366 CDS product peptide methionine sulfoxide reductase MsrA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9I6 protein_id gnl|my_center|LOCUS_01550 159070 160203 gene locus_tag LOCUS_01560 gene menC 159070 160203 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2S6 protein_id gnl|my_center|LOCUS_01560 160220 161020 gene locus_tag LOCUS_01570 gene hdhA 160220 161020 CDS product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224179.1 protein_id gnl|my_center|LOCUS_01570 162754 161036 gene locus_tag LOCUS_01580 162754 161036 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_01580 163861 162869 gene locus_tag LOCUS_01590 163861 162869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 164040 164879 gene locus_tag LOCUS_01600 164040 164879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 164876 165733 gene locus_tag LOCUS_01610 164876 165733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 165812 167515 gene locus_tag LOCUS_01620 165812 167515 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_01620 168824 167634 gene locus_tag LOCUS_01630 168824 167634 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_01630 169683 168835 gene locus_tag LOCUS_01640 gene paaX 169683 168835 CDS product PaaX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226874.1 protein_id gnl|my_center|LOCUS_01640 171065 169683 gene locus_tag LOCUS_01650 171065 169683 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730666.1 protein_id gnl|my_center|LOCUS_01650 171709 171107 gene locus_tag LOCUS_01660 171709 171107 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600671.1 protein_id gnl|my_center|LOCUS_01660 172808 171702 gene locus_tag LOCUS_01670 gene paaG 172808 171702 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228967.1 protein_id gnl|my_center|LOCUS_01670 174163 172778 gene locus_tag LOCUS_01680 174163 172778 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228965.1 protein_id gnl|my_center|LOCUS_01680 175236 174166 gene locus_tag LOCUS_01690 175236 174166 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726790.1 protein_id gnl|my_center|LOCUS_01690 176019 175240 gene locus_tag LOCUS_01700 gene paaG 176019 175240 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222473.1 protein_id gnl|my_center|LOCUS_01700 177134 176034 gene locus_tag LOCUS_01710 177134 176034 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728649.1 protein_id gnl|my_center|LOCUS_01710 178649 177168 gene locus_tag LOCUS_01720 178649 177168 CDS product AMP-dependent ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730162.1 protein_id gnl|my_center|LOCUS_01720 178988 178665 gene locus_tag LOCUS_01730 178988 178665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228958.1 protein_id gnl|my_center|LOCUS_01730 179122 179889 gene locus_tag LOCUS_01740 179122 179889 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729763.1 protein_id gnl|my_center|LOCUS_01740 179997 181184 gene locus_tag LOCUS_01750 179997 181184 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730892.1 protein_id gnl|my_center|LOCUS_01750 181181 181714 gene locus_tag LOCUS_01760 181181 181714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 182390 181737 gene locus_tag LOCUS_01770 182390 181737 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975712.1 protein_id gnl|my_center|LOCUS_01770 183145 182396 gene locus_tag LOCUS_01780 183145 182396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731508.1 protein_id gnl|my_center|LOCUS_01780 183280 183765 gene locus_tag LOCUS_01790 183280 183765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704026.1 protein_id gnl|my_center|LOCUS_01790 185076 183775 gene locus_tag LOCUS_01800 185076 183775 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_01800 186335 185145 gene locus_tag LOCUS_01810 gene yjiB 186335 185145 CDS product putative cytochrome P450 YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34374 protein_id gnl|my_center|LOCUS_01810 186449 186829 gene locus_tag LOCUS_01820 186449 186829 CDS product limonene-1,2-epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230664.1 protein_id gnl|my_center|LOCUS_01820 187636 186842 gene locus_tag LOCUS_01830 187636 186842 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030552.1 protein_id gnl|my_center|LOCUS_01830 188444 187638 gene locus_tag LOCUS_01840 188444 187638 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_01840 188521 189303 gene locus_tag LOCUS_01850 188521 189303 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM3 protein_id gnl|my_center|LOCUS_01850 191034 189319 gene locus_tag LOCUS_01860 191034 189319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702605.1 protein_id gnl|my_center|LOCUS_01860 191730 191170 gene locus_tag LOCUS_01870 191730 191170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 191881 192681 gene locus_tag LOCUS_01880 191881 192681 CDS product 3-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_01880 192678 193340 gene locus_tag LOCUS_01890 192678 193340 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728638.1 protein_id gnl|my_center|LOCUS_01890 193340 193750 gene locus_tag LOCUS_01900 193340 193750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_01900 194055 193759 gene locus_tag LOCUS_01910 194055 193759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 195696 194113 gene locus_tag LOCUS_01920 195696 194113 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031209.1 protein_id gnl|my_center|LOCUS_01920 196175 195741 gene locus_tag LOCUS_01930 196175 195741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 196415 197938 gene locus_tag LOCUS_01940 196415 197938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 198792 197929 gene locus_tag LOCUS_01950 198792 197929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223235.1 protein_id gnl|my_center|LOCUS_01950 199930 198872 gene locus_tag LOCUS_01960 199930 198872 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_01960 201063 199927 gene locus_tag LOCUS_01970 201063 199927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_01970 202540 201275 gene locus_tag LOCUS_01980 202540 201275 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_01980 203473 202787 gene locus_tag LOCUS_01990 203473 202787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 203569 204651 gene locus_tag LOCUS_02000 203569 204651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_02000 204648 205274 gene locus_tag LOCUS_02010 204648 205274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 205362 206276 gene locus_tag LOCUS_02020 gene dhmA 205362 206276 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A919 protein_id gnl|my_center|LOCUS_02020 206320 206958 gene locus_tag LOCUS_02030 206320 206958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411033.1 protein_id gnl|my_center|LOCUS_02030 206971 207918 gene locus_tag LOCUS_02040 206971 207918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 208492 207884 gene locus_tag LOCUS_02050 208492 207884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 208581 209384 gene locus_tag LOCUS_02060 gene paaG 208581 209384 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_02060 209398 210522 gene locus_tag LOCUS_02070 209398 210522 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731378.1 protein_id gnl|my_center|LOCUS_02070 210632 211657 gene locus_tag LOCUS_02080 210632 211657 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015397.1 protein_id gnl|my_center|LOCUS_02080 211660 212481 gene locus_tag LOCUS_02090 211660 212481 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878366.1 protein_id gnl|my_center|LOCUS_02090 213226 212438 gene locus_tag LOCUS_02100 213226 212438 CDS product 3-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_02100 214226 213213 gene locus_tag LOCUS_02110 214226 213213 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_02110 215162 214290 gene locus_tag LOCUS_02120 215162 214290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 215622 215155 gene locus_tag LOCUS_02130 215622 215155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702665.1 protein_id gnl|my_center|LOCUS_02130 217088 215619 gene locus_tag LOCUS_02140 gene hapE 217088 215619 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206172.1 protein_id gnl|my_center|LOCUS_02140 217182 218252 gene locus_tag LOCUS_02150 gene adh 217182 218252 CDS product putative alcohol dehydrogenase adh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQC3 protein_id gnl|my_center|LOCUS_02150 219664 218489 gene locus_tag LOCUS_02160 219664 218489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 219872 220753 gene locus_tag LOCUS_02170 219872 220753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 222491 220743 gene locus_tag LOCUS_02180 222491 220743 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727566.1 protein_id gnl|my_center|LOCUS_02180 223914 222988 gene locus_tag LOCUS_02190 223914 222988 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014292.1 protein_id gnl|my_center|LOCUS_02190 224823 224062 gene locus_tag LOCUS_02200 224823 224062 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404948.1 protein_id gnl|my_center|LOCUS_02200 226261 224876 gene locus_tag LOCUS_02210 226261 224876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 226728 228461 gene locus_tag LOCUS_02220 226728 228461 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_02220 228916 230451 gene locus_tag LOCUS_02230 228916 230451 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031024.1 protein_id gnl|my_center|LOCUS_02230 230654 231949 gene locus_tag LOCUS_02240 230654 231949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 233421 232516 gene locus_tag LOCUS_02250 233421 232516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 234384 234692 gene locus_tag LOCUS_02260 234384 234692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 234941 236281 gene locus_tag LOCUS_02270 234941 236281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 236321 236509 gene locus_tag LOCUS_02280 236321 236509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence02 374 1162 gene locus_tag LOCUS_02290 374 1162 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390253.1 protein_id gnl|my_center|LOCUS_02290 1163 1852 gene locus_tag LOCUS_02300 1163 1852 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704421.1 protein_id gnl|my_center|LOCUS_02300 3277 1853 gene locus_tag LOCUS_02310 3277 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 5970 3328 gene locus_tag LOCUS_02320 gene glnE 5970 3328 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWL3 protein_id gnl|my_center|LOCUS_02320 5896 6090 gene locus_tag LOCUS_02330 5896 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 6100 7806 gene locus_tag LOCUS_02340 6100 7806 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039823.1 protein_id gnl|my_center|LOCUS_02340 7837 8385 gene locus_tag LOCUS_02350 7837 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 8506 9441 gene locus_tag LOCUS_02360 gene sigA 8506 9441 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGV1 protein_id gnl|my_center|LOCUS_02360 9466 10086 gene locus_tag LOCUS_02370 9466 10086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 11017 10217 gene locus_tag LOCUS_02380 11017 10217 CDS product morphological differentiation-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975378.1 protein_id gnl|my_center|LOCUS_02380 11158 11826 gene locus_tag LOCUS_02390 11158 11826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 11816 12997 gene locus_tag LOCUS_02400 11816 12997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 12994 13755 gene locus_tag LOCUS_02410 12994 13755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 13752 14291 gene locus_tag LOCUS_02420 13752 14291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 14338 14586 gene locus_tag LOCUS_02430 14338 14586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 14583 14984 gene locus_tag LOCUS_02440 14583 14984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 17246 14961 gene locus_tag LOCUS_02450 17246 14961 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029077.1 protein_id gnl|my_center|LOCUS_02450 17300 17650 gene locus_tag LOCUS_02460 17300 17650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 17794 20181 gene locus_tag LOCUS_02470 17794 20181 CDS product putative cation antiporter NADH dehydrogenase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701388.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02470 20178 20672 gene locus_tag LOCUS_02480 20178 20672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 20669 21043 gene locus_tag LOCUS_02490 20669 21043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 21040 22518 gene locus_tag LOCUS_02500 21040 22518 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776504.1 protein_id gnl|my_center|LOCUS_02500 22515 23054 gene locus_tag LOCUS_02510 22515 23054 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727234.1 protein_id gnl|my_center|LOCUS_02510 23051 23311 gene locus_tag LOCUS_02520 23051 23311 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080106.1 protein_id gnl|my_center|LOCUS_02520 23550 23359 gene locus_tag LOCUS_02530 23550 23359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 24908 23652 gene locus_tag LOCUS_02540 gene acd 24908 23652 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_02540 25318 24908 gene locus_tag LOCUS_02550 25318 24908 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943000.1 protein_id gnl|my_center|LOCUS_02550 25411 28299 gene locus_tag LOCUS_02560 gene topA 25411 28299 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJV1 protein_id gnl|my_center|LOCUS_02560 28353 30032 gene locus_tag LOCUS_02570 28353 30032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 30029 30640 gene locus_tag LOCUS_02580 30029 30640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 30637 31728 gene locus_tag LOCUS_02590 gene holB 30637 31728 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230507.1 protein_id gnl|my_center|LOCUS_02590 31805 31878 gene locus_tag LOCUS_t00020 31805 31878 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31881 32459 gene locus_tag LOCUS_02600 gene sigR 31881 32459 CDS product ECF RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKG9 protein_id gnl|my_center|LOCUS_02600 32468 32800 gene locus_tag LOCUS_02610 32468 32800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 32811 32945 gene locus_tag LOCUS_02620 32811 32945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 32951 34024 gene locus_tag LOCUS_02630 32951 34024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_02630 34143 34934 gene locus_tag LOCUS_02640 gene tilS 34143 34934 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGT6 protein_id gnl|my_center|LOCUS_02640 34956 35537 gene locus_tag LOCUS_02650 34956 35537 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804893.1 protein_id gnl|my_center|LOCUS_02650 35617 36189 gene locus_tag LOCUS_02660 gene folE 35617 36189 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64208 protein_id gnl|my_center|LOCUS_02660 36192 37013 gene locus_tag LOCUS_02670 36192 37013 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3I0 protein_id gnl|my_center|LOCUS_02670 37010 37531 gene locus_tag LOCUS_02680 37010 37531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 37548 37913 gene locus_tag LOCUS_02690 37548 37913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02690 37914 38378 gene locus_tag LOCUS_02700 37914 38378 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391686.1 protein_id gnl|my_center|LOCUS_02700 38375 39160 gene locus_tag LOCUS_02710 38375 39160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701293.1 protein_id gnl|my_center|LOCUS_02710 39160 40014 gene locus_tag LOCUS_02720 gene panC 39160 40014 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UB63 protein_id gnl|my_center|LOCUS_02720 40068 40466 gene locus_tag LOCUS_02730 gene panD 40068 40466 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D9Q6 protein_id gnl|my_center|LOCUS_02730 40495 42057 gene locus_tag LOCUS_02740 gene nadB 40495 42057 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8N8 protein_id gnl|my_center|LOCUS_02740 42099 42959 gene locus_tag LOCUS_02750 gene nadC 42099 42959 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973559.1 protein_id gnl|my_center|LOCUS_02750 42974 43768 gene locus_tag LOCUS_02760 gene coaX 42974 43768 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8N6 protein_id gnl|my_center|LOCUS_02760 44795 43770 gene locus_tag LOCUS_02770 44795 43770 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_02770 44859 47477 gene locus_tag LOCUS_02780 44859 47477 CDS product ATP-dependent Clp protease ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_02780 47610 48350 gene locus_tag LOCUS_02790 47610 48350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 48476 48895 gene locus_tag LOCUS_02800 48476 48895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 49005 48868 gene locus_tag LOCUS_02810 49005 48868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 49099 50475 gene locus_tag LOCUS_02820 gene radA 49099 50475 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8L5 protein_id gnl|my_center|LOCUS_02820 50525 51571 gene locus_tag LOCUS_02830 gene disA 50525 51571 CDS product DNA integrity scanning protein DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8L6 protein_id gnl|my_center|LOCUS_02830 51588 52247 gene locus_tag LOCUS_02840 51588 52247 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228766.1 protein_id gnl|my_center|LOCUS_02840 53521 52253 gene locus_tag LOCUS_02850 53521 52253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 53692 54717 gene locus_tag LOCUS_02860 53692 54717 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893406.1 protein_id gnl|my_center|LOCUS_02860 54717 55565 gene locus_tag LOCUS_02870 54717 55565 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700858.1 protein_id gnl|my_center|LOCUS_02870 55562 56488 gene locus_tag LOCUS_02880 55562 56488 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889219.1 protein_id gnl|my_center|LOCUS_02880 57150 56491 gene locus_tag LOCUS_02890 57150 56491 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727023.1 protein_id gnl|my_center|LOCUS_02890 57300 57965 gene locus_tag LOCUS_02900 gene ispD 57300 57965 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R560 protein_id gnl|my_center|LOCUS_02900 57975 58448 gene locus_tag LOCUS_02910 gene ispF 57975 58448 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC4 protein_id gnl|my_center|LOCUS_02910 58445 59599 gene locus_tag LOCUS_02920 58445 59599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 61891 59636 gene locus_tag LOCUS_02930 gene cutL 61891 59636 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_02930 61999 63693 gene locus_tag LOCUS_02940 61999 63693 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_02940 63798 63871 gene locus_tag LOCUS_t00030 63798 63871 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 65020 63872 gene locus_tag LOCUS_02950 65020 63872 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926116.1 protein_id gnl|my_center|LOCUS_02950 65156 65422 gene locus_tag LOCUS_02960 65156 65422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 65425 65934 gene locus_tag LOCUS_02970 65425 65934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 65981 66973 gene locus_tag LOCUS_02980 gene glxK 65981 66973 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223742.1 protein_id gnl|my_center|LOCUS_02980 67836 66985 gene locus_tag LOCUS_02990 67836 66985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701119.1 protein_id gnl|my_center|LOCUS_02990 68787 67879 gene locus_tag LOCUS_03000 68787 67879 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_03000 68913 69191 gene locus_tag LOCUS_03010 68913 69191 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_03010 69375 70991 gene locus_tag LOCUS_03020 gene groL2 69375 70991 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXU5 protein_id gnl|my_center|LOCUS_03020 71066 71878 gene locus_tag LOCUS_03030 gene fdhD 71066 71878 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMW5 protein_id gnl|my_center|LOCUS_03030 71878 74112 gene locus_tag LOCUS_03040 71878 74112 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256094.1 protein_id gnl|my_center|LOCUS_03040 74155 74838 gene locus_tag LOCUS_03050 74155 74838 CDS product putative heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTQ2 protein_id gnl|my_center|LOCUS_03050 74846 75670 gene locus_tag LOCUS_03060 74846 75670 CDS product adenine nucleotide alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_03060 75667 76161 gene locus_tag LOCUS_03070 75667 76161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 76296 77567 gene locus_tag LOCUS_03080 gene amtB 76296 77567 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0Q9 protein_id gnl|my_center|LOCUS_03080 77637 77984 gene locus_tag LOCUS_03090 gene glnB 77637 77984 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 protein_id gnl|my_center|LOCUS_03090 78012 80318 gene locus_tag LOCUS_03100 gene glnD 78012 80318 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2P5 protein_id gnl|my_center|LOCUS_03100 80341 81045 gene locus_tag LOCUS_03110 80341 81045 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216917.1 protein_id gnl|my_center|LOCUS_03110 81918 81049 gene locus_tag LOCUS_03120 81918 81049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_03120 81952 82434 gene locus_tag LOCUS_03130 81952 82434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 83296 82457 gene locus_tag LOCUS_03140 83296 82457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 83486 83713 gene locus_tag LOCUS_03150 83486 83713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 84189 83740 gene locus_tag LOCUS_03160 84189 83740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703277.1 protein_id gnl|my_center|LOCUS_03160 85072 84191 gene locus_tag LOCUS_03170 85072 84191 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 protein_id gnl|my_center|LOCUS_03170 85215 85841 gene locus_tag LOCUS_03180 85215 85841 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531693.1 protein_id gnl|my_center|LOCUS_03180 85848 86282 gene locus_tag LOCUS_03190 85848 86282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 86564 86764 gene locus_tag LOCUS_03200 86564 86764 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391793.1 protein_id gnl|my_center|LOCUS_03200 86761 86979 gene locus_tag LOCUS_03210 86761 86979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391794.1 protein_id gnl|my_center|LOCUS_03210 87429 87010 gene locus_tag LOCUS_03220 gene ypeA 87429 87010 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804508.1 protein_id gnl|my_center|LOCUS_03220 87640 87912 gene locus_tag LOCUS_03230 gene relb 87640 87912 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P3B8 protein_id gnl|my_center|LOCUS_03230 87909 88184 gene locus_tag LOCUS_03240 87909 88184 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898789.1 protein_id gnl|my_center|LOCUS_03240 88635 88219 gene locus_tag LOCUS_03250 88635 88219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728622.1 protein_id gnl|my_center|LOCUS_03250 88692 89117 gene locus_tag LOCUS_03260 88692 89117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 89294 91060 gene locus_tag LOCUS_03270 89294 91060 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_03270 92341 91070 gene locus_tag LOCUS_03280 92341 91070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 92462 92800 gene locus_tag LOCUS_03290 92462 92800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 93465 92887 gene locus_tag LOCUS_03300 93465 92887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 93523 94845 gene locus_tag LOCUS_03310 93523 94845 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727117.1 protein_id gnl|my_center|LOCUS_03310 94960 96096 gene locus_tag LOCUS_03320 94960 96096 CDS product putative drug antiporter protein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702149.1 protein_id gnl|my_center|LOCUS_03320 96252 96085 gene locus_tag LOCUS_03330 96252 96085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 96693 96307 gene locus_tag LOCUS_03340 gene doc 96693 96307 CDS product toxin Doc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QRY0 protein_id gnl|my_center|LOCUS_03340 96887 96690 gene locus_tag LOCUS_03350 96887 96690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 97628 97002 gene locus_tag LOCUS_03360 97628 97002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228658.1 protein_id gnl|my_center|LOCUS_03360 97727 99193 gene locus_tag LOCUS_03370 97727 99193 CDS product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973306.1 protein_id gnl|my_center|LOCUS_03370 99991 99194 gene locus_tag LOCUS_03380 gene aldC 99991 99194 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958007.1 protein_id gnl|my_center|LOCUS_03380 100101 100922 gene locus_tag LOCUS_03390 gene rnz 100101 100922 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TYN1 protein_id gnl|my_center|LOCUS_03390 100959 101678 gene locus_tag LOCUS_03400 100959 101678 CDS product putative carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAL4 protein_id gnl|my_center|LOCUS_03400 103346 101907 gene locus_tag LOCUS_03410 103346 101907 CDS product inosine 5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027797.1 protein_id gnl|my_center|LOCUS_03410 103655 103368 gene locus_tag LOCUS_03420 103655 103368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 106882 103652 gene locus_tag LOCUS_03430 gene helZ 106882 103652 CDS product helicase HelZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950658.1 protein_id gnl|my_center|LOCUS_03430 108255 107191 gene locus_tag LOCUS_03440 108255 107191 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_03440 109091 108252 gene locus_tag LOCUS_03450 109091 108252 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_03450 109669 109088 gene locus_tag LOCUS_03460 gene modA 109669 109088 CDS product molybdate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_03460 109966 110475 gene locus_tag LOCUS_03470 109966 110475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 110472 111791 gene locus_tag LOCUS_03480 110472 111791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701628.1 protein_id gnl|my_center|LOCUS_03480 111830 112441 gene locus_tag LOCUS_03490 111830 112441 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_03490 112478 113524 gene locus_tag LOCUS_03500 112478 113524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 113596 114102 gene locus_tag LOCUS_03510 113596 114102 CDS product putative CarD-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701320.1 protein_id gnl|my_center|LOCUS_03510 115680 114106 gene locus_tag LOCUS_03520 115680 114106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 117144 115714 gene locus_tag LOCUS_03530 117144 115714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 117274 118785 gene locus_tag LOCUS_03540 117274 118785 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_03540 118792 119403 gene locus_tag LOCUS_03550 gene alkB 118792 119403 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035874.1 protein_id gnl|my_center|LOCUS_03550 119511 121298 gene locus_tag LOCUS_03560 119511 121298 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_03560 121696 121295 gene locus_tag LOCUS_03570 121696 121295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 122217 121693 gene locus_tag LOCUS_03580 122217 121693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 122953 122399 gene locus_tag LOCUS_03590 122953 122399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 123798 123058 gene locus_tag LOCUS_03600 123798 123058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229255.1 protein_id gnl|my_center|LOCUS_03600 124397 123795 gene locus_tag LOCUS_03610 gene rpoE 124397 123795 CDS product RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229256.1 protein_id gnl|my_center|LOCUS_03610 124645 125814 gene locus_tag LOCUS_03620 124645 125814 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725028.1 protein_id gnl|my_center|LOCUS_03620 125816 126805 gene locus_tag LOCUS_03630 125816 126805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 126832 127170 gene locus_tag LOCUS_03640 126832 127170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 127167 128378 gene locus_tag LOCUS_03650 127167 128378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 128436 130064 gene locus_tag LOCUS_03660 128436 130064 CDS product putative (cyclohexanone) monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700828.1 protein_id gnl|my_center|LOCUS_03660 130166 130594 gene locus_tag LOCUS_03670 130166 130594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 130787 130703 gene locus_tag LOCUS_t00040 130787 130703 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 130798 131574 gene locus_tag LOCUS_03680 130798 131574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257858.1 protein_id gnl|my_center|LOCUS_03680 131577 132053 gene locus_tag LOCUS_03690 131577 132053 CDS product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003079002.1 protein_id gnl|my_center|LOCUS_03690 132050 133273 gene locus_tag LOCUS_03700 132050 133273 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222007.1 protein_id gnl|my_center|LOCUS_03700 133278 134582 gene locus_tag LOCUS_03710 133278 134582 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726618.1 protein_id gnl|my_center|LOCUS_03710 134579 136060 gene locus_tag LOCUS_03720 gene pbpA 134579 136060 CDS product penicillin-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNG3 protein_id gnl|my_center|LOCUS_03720 136124 137917 gene locus_tag LOCUS_03730 136124 137917 CDS product putative serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XA16 protein_id gnl|my_center|LOCUS_03730 138544 137963 gene locus_tag LOCUS_03740 gene trpG 138544 137963 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140885.1 protein_id gnl|my_center|LOCUS_03740 138531 138941 gene locus_tag LOCUS_03750 138531 138941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 139397 139035 gene locus_tag LOCUS_03760 139397 139035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 140597 139407 gene locus_tag LOCUS_03770 140597 139407 CDS product putative acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704185.1 protein_id gnl|my_center|LOCUS_03770 142103 140643 gene locus_tag LOCUS_03780 142103 140643 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772424.1 protein_id gnl|my_center|LOCUS_03780 142810 142196 gene locus_tag LOCUS_03790 gene gpm 142810 142196 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229706.1 protein_id gnl|my_center|LOCUS_03790 144192 142774 gene locus_tag LOCUS_03800 gene zwf 144192 142774 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CH73 protein_id gnl|my_center|LOCUS_03800 144420 145091 gene locus_tag LOCUS_03810 gene trkA 144420 145091 CDS product Trk system potassium uptake protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53949 protein_id gnl|my_center|LOCUS_03810 145091 145759 gene locus_tag LOCUS_03820 145091 145759 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_03820 146162 146001 gene locus_tag LOCUS_03830 146162 146001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 146208 148814 gene locus_tag LOCUS_03840 146208 148814 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022472.1 protein_id gnl|my_center|LOCUS_03840 148807 149202 gene locus_tag LOCUS_03850 148807 149202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 149948 149220 gene locus_tag LOCUS_03860 149948 149220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027556.1 protein_id gnl|my_center|LOCUS_03860 151307 149958 gene locus_tag LOCUS_03870 151307 149958 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 protein_id gnl|my_center|LOCUS_03870 151507 152568 gene locus_tag LOCUS_03880 151507 152568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 152640 153893 gene locus_tag LOCUS_03890 152640 153893 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_03890 153893 154357 gene locus_tag LOCUS_03900 153893 154357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 154501 155421 gene locus_tag LOCUS_03910 154501 155421 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_03910 156629 155559 gene locus_tag LOCUS_03920 156629 155559 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_03920 156720 157904 gene locus_tag LOCUS_03930 156720 157904 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896175.1 protein_id gnl|my_center|LOCUS_03930 157945 159057 gene locus_tag LOCUS_03940 157945 159057 CDS product putative zinc-type alcohol dehydrogenase AdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702819.1 protein_id gnl|my_center|LOCUS_03940 161441 159054 gene locus_tag LOCUS_03950 161441 159054 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_03950 161635 161559 gene locus_tag LOCUS_t00050 161635 161559 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 161973 161740 gene locus_tag LOCUS_03960 161973 161740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 163607 161931 gene locus_tag LOCUS_03970 gene fumC 163607 161931 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021037.1 protein_id gnl|my_center|LOCUS_03970 163766 164695 gene locus_tag LOCUS_03980 163766 164695 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 protein_id gnl|my_center|LOCUS_03980 165671 164706 gene locus_tag LOCUS_03990 gene fkbP1 165671 164706 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068443.1 protein_id gnl|my_center|LOCUS_03990 165845 166531 gene locus_tag LOCUS_04000 gene mprA 165845 166531 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225546.1 protein_id gnl|my_center|LOCUS_04000 166528 167880 gene locus_tag LOCUS_04010 gene mprB 166528 167880 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225545.1 protein_id gnl|my_center|LOCUS_04010 168302 167961 gene locus_tag LOCUS_04020 gene glnB 168302 167961 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN31 protein_id gnl|my_center|LOCUS_04020 169735 168305 gene locus_tag LOCUS_04030 169735 168305 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH4 protein_id gnl|my_center|LOCUS_04030 172411 169979 gene locus_tag LOCUS_04040 gene ppa 172411 169979 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DII8 protein_id gnl|my_center|LOCUS_04040 174293 172758 gene locus_tag LOCUS_04050 174293 172758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 175918 174332 gene locus_tag LOCUS_04060 gene prfC 175918 174332 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QS18 protein_id gnl|my_center|LOCUS_04060 176394 175936 gene locus_tag LOCUS_04070 176394 175936 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733104.1 protein_id gnl|my_center|LOCUS_04070 176460 177386 gene locus_tag LOCUS_04080 176460 177386 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_04080 177539 178033 gene locus_tag LOCUS_04090 177539 178033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 179111 178044 gene locus_tag LOCUS_04100 179111 178044 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_04100 179350 179108 gene locus_tag LOCUS_04110 179350 179108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 180591 179359 gene locus_tag LOCUS_04120 gene xseA 180591 179359 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_04120 180881 180627 gene locus_tag LOCUS_04130 180881 180627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 180880 181170 gene locus_tag LOCUS_04140 180880 181170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 181653 181174 gene locus_tag LOCUS_04150 181653 181174 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_04150 183057 181678 gene locus_tag LOCUS_04160 183057 181678 CDS product crotonyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972505.1 protein_id gnl|my_center|LOCUS_04160 183194 184375 gene locus_tag LOCUS_04170 gene atoB 183194 184375 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_04170 184979 184377 gene locus_tag LOCUS_04180 gene recR 184979 184377 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI4 protein_id gnl|my_center|LOCUS_04180 185389 184976 gene locus_tag LOCUS_04190 185389 184976 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNR9 protein_id gnl|my_center|LOCUS_04190 187314 185422 gene locus_tag LOCUS_04200 187314 185422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 187577 187664 gene locus_tag LOCUS_t00060 187577 187664 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 187683 188171 gene locus_tag LOCUS_04210 gene tadA 187683 188171 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2VEQ5 protein_id gnl|my_center|LOCUS_04210 188234 188323 gene locus_tag LOCUS_t00070 188234 188323 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 188410 190263 gene locus_tag LOCUS_04220 188410 190263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_04220 191236 190268 gene locus_tag LOCUS_04230 191236 190268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 191299 191826 gene locus_tag LOCUS_04240 191299 191826 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225670.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence03 399 2075 gene locus_tag LOCUS_04250 399 2075 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_04250 2072 2449 gene locus_tag LOCUS_04260 2072 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2494 3249 gene locus_tag LOCUS_04270 2494 3249 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_04270 3296 4936 gene locus_tag LOCUS_04280 3296 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703128.1 protein_id gnl|my_center|LOCUS_04280 4963 5622 gene locus_tag LOCUS_04290 gene nucS 4963 5622 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4C3 protein_id gnl|my_center|LOCUS_04290 6488 5640 gene locus_tag LOCUS_04300 6488 5640 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950882.1 protein_id gnl|my_center|LOCUS_04300 7375 6497 gene locus_tag LOCUS_04310 7375 6497 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_04310 7584 8777 gene locus_tag LOCUS_04320 7584 8777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_04320 8835 9977 gene locus_tag LOCUS_04330 8835 9977 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865348.1 protein_id gnl|my_center|LOCUS_04330 10928 9990 gene locus_tag LOCUS_04340 10928 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 12181 10928 gene locus_tag LOCUS_04350 12181 10928 CDS product linalool 8-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_04350 13123 12209 gene locus_tag LOCUS_04360 13123 12209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 14431 13166 gene locus_tag LOCUS_04370 14431 13166 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 protein_id gnl|my_center|LOCUS_04370 15256 14435 gene locus_tag LOCUS_04380 15256 14435 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_04380 15513 16544 gene locus_tag LOCUS_04390 15513 16544 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_04390 16555 17457 gene locus_tag LOCUS_04400 16555 17457 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400489.1 protein_id gnl|my_center|LOCUS_04400 17496 18398 gene locus_tag LOCUS_04410 17496 18398 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727261.1 protein_id gnl|my_center|LOCUS_04410 18868 18407 gene locus_tag LOCUS_04420 18868 18407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 20362 18896 gene locus_tag LOCUS_04430 20362 18896 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_04430 20350 21117 gene locus_tag LOCUS_04440 20350 21117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 21117 21665 gene locus_tag LOCUS_04450 21117 21665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090877.1 protein_id gnl|my_center|LOCUS_04450 22745 21669 gene locus_tag LOCUS_04460 22745 21669 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229260.1 protein_id gnl|my_center|LOCUS_04460 23899 22793 gene locus_tag LOCUS_04470 23899 22793 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027659.1 protein_id gnl|my_center|LOCUS_04470 24032 24814 gene locus_tag LOCUS_04480 24032 24814 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701013.1 protein_id gnl|my_center|LOCUS_04480 24879 25361 gene locus_tag LOCUS_04490 24879 25361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 26109 25396 gene locus_tag LOCUS_04500 26109 25396 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_04500 26224 27426 gene locus_tag LOCUS_04510 26224 27426 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_04510 28361 27429 gene locus_tag LOCUS_04520 28361 27429 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031608.1 protein_id gnl|my_center|LOCUS_04520 29272 28481 gene locus_tag LOCUS_04530 29272 28481 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727864.1 protein_id gnl|my_center|LOCUS_04530 30456 29269 gene locus_tag LOCUS_04540 30456 29269 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_04540 30756 30595 gene locus_tag LOCUS_04550 30756 30595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 30703 32112 gene locus_tag LOCUS_04560 gene cydA 30703 32112 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_04560 32109 33134 gene locus_tag LOCUS_04570 gene cydB 32109 33134 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933479.1 protein_id gnl|my_center|LOCUS_04570 33170 34813 gene locus_tag LOCUS_04580 gene cydD 33170 34813 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941872.1 protein_id gnl|my_center|LOCUS_04580 34810 36480 gene locus_tag LOCUS_04590 gene cydC 34810 36480 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933482.1 protein_id gnl|my_center|LOCUS_04590 37837 36554 gene locus_tag LOCUS_04600 37837 36554 CDS product putative saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704055.1 protein_id gnl|my_center|LOCUS_04600 39947 38001 gene locus_tag LOCUS_04610 39947 38001 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_04610 40049 40249 gene locus_tag LOCUS_04620 40049 40249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 40303 41100 gene locus_tag LOCUS_04630 40303 41100 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776151.1 protein_id gnl|my_center|LOCUS_04630 41911 41171 gene locus_tag LOCUS_04640 41911 41171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028179.1 protein_id gnl|my_center|LOCUS_04640 42771 41965 gene locus_tag LOCUS_04650 42771 41965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 42880 43623 gene locus_tag LOCUS_04660 42880 43623 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727098.1 protein_id gnl|my_center|LOCUS_04660 44329 43643 gene locus_tag LOCUS_04670 44329 43643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 45556 44492 gene locus_tag LOCUS_04680 45556 44492 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266739.1 protein_id gnl|my_center|LOCUS_04680 46557 45721 gene locus_tag LOCUS_04690 46557 45721 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 protein_id gnl|my_center|LOCUS_04690 47843 46554 gene locus_tag LOCUS_04700 47843 46554 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_04700 48829 47840 gene locus_tag LOCUS_04710 48829 47840 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140297.1 protein_id gnl|my_center|LOCUS_04710 49370 49092 gene locus_tag LOCUS_04720 49370 49092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 49342 49683 gene locus_tag LOCUS_04730 49342 49683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 49740 50528 gene locus_tag LOCUS_04740 49740 50528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 50688 51107 gene locus_tag LOCUS_04750 50688 51107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 51153 52388 gene locus_tag LOCUS_04760 51153 52388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 52398 52610 gene locus_tag LOCUS_04770 52398 52610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 52893 53366 gene locus_tag LOCUS_04780 52893 53366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 53961 54626 gene locus_tag LOCUS_04790 53961 54626 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722934.1 protein_id gnl|my_center|LOCUS_04790 54826 54695 gene locus_tag LOCUS_04800 54826 54695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 55475 57367 gene locus_tag LOCUS_04810 55475 57367 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459981.1 protein_id gnl|my_center|LOCUS_04810 57461 58675 gene locus_tag LOCUS_04820 57461 58675 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022606.1 protein_id gnl|my_center|LOCUS_04820 58876 60345 gene locus_tag LOCUS_04830 58876 60345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967310.1 protein_id gnl|my_center|LOCUS_04830 60418 62217 gene locus_tag LOCUS_04840 60418 62217 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931031.1 protein_id gnl|my_center|LOCUS_04840 63126 62806 gene locus_tag LOCUS_04850 63126 62806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 63019 64137 gene locus_tag LOCUS_04860 63019 64137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 64261 64185 gene locus_tag LOCUS_t00080 64261 64185 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 65146 64376 gene locus_tag LOCUS_04870 65146 64376 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYP6 protein_id gnl|my_center|LOCUS_04870 65940 65311 gene locus_tag LOCUS_04880 65940 65311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 67455 66181 gene locus_tag LOCUS_04890 67455 66181 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_04890 67480 68262 gene locus_tag LOCUS_04900 gene ditI 67480 68262 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973229.1 protein_id gnl|my_center|LOCUS_04900 69447 68266 gene locus_tag LOCUS_04910 69447 68266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 70234 69461 gene locus_tag LOCUS_04920 gene fabG 70234 69461 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_04920 70299 71993 gene locus_tag LOCUS_04930 70299 71993 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_04930 72902 71997 gene locus_tag LOCUS_04940 72902 71997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 73015 75444 gene locus_tag LOCUS_04950 73015 75444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 75441 75848 gene locus_tag LOCUS_04960 75441 75848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 75845 76981 gene locus_tag LOCUS_04970 75845 76981 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730955.1 protein_id gnl|my_center|LOCUS_04970 76997 78103 gene locus_tag LOCUS_04980 76997 78103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 78100 78690 gene locus_tag LOCUS_04990 78100 78690 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727647.1 protein_id gnl|my_center|LOCUS_04990 81755 78699 gene locus_tag LOCUS_05000 81755 78699 CDS product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FCI4 protein_id gnl|my_center|LOCUS_05000 83659 81803 gene locus_tag LOCUS_05010 83659 81803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 84730 83711 gene locus_tag LOCUS_05020 84730 83711 CDS product signal protein PDZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907855.1 protein_id gnl|my_center|LOCUS_05020 84945 85136 gene locus_tag LOCUS_05030 84945 85136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 85139 85774 gene locus_tag LOCUS_05040 85139 85774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 86759 85764 gene locus_tag LOCUS_05050 86759 85764 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_05050 86979 86761 gene locus_tag LOCUS_05060 86979 86761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 87458 86976 gene locus_tag LOCUS_05070 87458 86976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 87677 88699 gene locus_tag LOCUS_05080 87677 88699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 89738 88683 gene locus_tag LOCUS_05090 89738 88683 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_05090 89839 91071 gene locus_tag LOCUS_05100 89839 91071 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731046.1 protein_id gnl|my_center|LOCUS_05100 92742 91072 gene locus_tag LOCUS_05110 92742 91072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 93501 92785 gene locus_tag LOCUS_05120 gene regX3 93501 92785 CDS product sensory transduction protein regX3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07130 protein_id gnl|my_center|LOCUS_05120 94780 93506 gene locus_tag LOCUS_05130 94780 93506 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_05130 95523 94777 gene locus_tag LOCUS_05140 95523 94777 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJU3 protein_id gnl|my_center|LOCUS_05140 96213 95557 gene locus_tag LOCUS_05150 gene phoU 96213 95557 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKD9 protein_id gnl|my_center|LOCUS_05150 97111 96224 gene locus_tag LOCUS_05160 gene pstB 97111 96224 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCU7 protein_id gnl|my_center|LOCUS_05160 98029 97130 gene locus_tag LOCUS_05170 98029 97130 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMD3 protein_id gnl|my_center|LOCUS_05170 99023 98031 gene locus_tag LOCUS_05180 99023 98031 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRT5 protein_id gnl|my_center|LOCUS_05180 100112 99033 gene locus_tag LOCUS_05190 100112 99033 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYZ6 protein_id gnl|my_center|LOCUS_05190 100605 100252 gene locus_tag LOCUS_05200 100605 100252 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031200.1 protein_id gnl|my_center|LOCUS_05200 100758 101219 gene locus_tag LOCUS_05210 100758 101219 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031198.1 protein_id gnl|my_center|LOCUS_05210 101219 101923 gene locus_tag LOCUS_05220 101219 101923 CDS product glycerol uptake transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888242.1 protein_id gnl|my_center|LOCUS_05220 101920 102330 gene locus_tag LOCUS_05230 101920 102330 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_05230 102782 102342 gene locus_tag LOCUS_05240 102782 102342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 104885 102789 gene locus_tag LOCUS_05250 gene ppk 104885 102789 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUZ3 protein_id gnl|my_center|LOCUS_05250 105154 104888 gene locus_tag LOCUS_05260 105154 104888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 105330 105581 gene locus_tag LOCUS_05270 105330 105581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 105808 105578 gene locus_tag LOCUS_05280 105808 105578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 105698 106495 gene locus_tag LOCUS_05290 105698 106495 CDS product glutamate formiminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_05290 106824 106498 gene locus_tag LOCUS_05300 106824 106498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 108991 106976 gene locus_tag LOCUS_05310 108991 106976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_05310 109021 110229 gene locus_tag LOCUS_05320 109021 110229 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_05320 110247 110942 gene locus_tag LOCUS_05330 gene rpiA 110247 110942 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJF2 protein_id gnl|my_center|LOCUS_05330 112363 110957 gene locus_tag LOCUS_05340 112363 110957 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730585.1 protein_id gnl|my_center|LOCUS_05340 112497 113342 gene locus_tag LOCUS_05350 gene sdhC 112497 113342 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225081.1 protein_id gnl|my_center|LOCUS_05350 113354 115279 gene locus_tag LOCUS_05360 gene sdhA 113354 115279 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_05360 115292 116053 gene locus_tag LOCUS_05370 115292 116053 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 protein_id gnl|my_center|LOCUS_05370 117205 116264 gene locus_tag LOCUS_05380 117205 116264 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246890.1 protein_id gnl|my_center|LOCUS_05380 117313 117684 gene locus_tag LOCUS_05390 117313 117684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 118734 117748 gene locus_tag LOCUS_05400 gene mdh 118734 117748 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3J3 protein_id gnl|my_center|LOCUS_05400 119617 118811 gene locus_tag LOCUS_05410 119617 118811 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_05410 120485 119658 gene locus_tag LOCUS_05420 120485 119658 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086235.1 protein_id gnl|my_center|LOCUS_05420 120638 121531 gene locus_tag LOCUS_05430 120638 121531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 121750 121941 gene locus_tag LOCUS_05440 121750 121941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 121889 122341 gene locus_tag LOCUS_05450 121889 122341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_05450 123202 122345 gene locus_tag LOCUS_05460 123202 122345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 125231 123291 gene locus_tag LOCUS_05470 125231 123291 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_05470 127051 125228 gene locus_tag LOCUS_05480 127051 125228 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 protein_id gnl|my_center|LOCUS_05480 127939 127058 gene locus_tag LOCUS_05490 gene metF 127939 127058 CDS product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67422 protein_id gnl|my_center|LOCUS_05490 128805 127942 gene locus_tag LOCUS_05500 gene folD 128805 127942 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3J6 protein_id gnl|my_center|LOCUS_05500 128844 129980 gene locus_tag LOCUS_05510 128844 129980 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKF6 protein_id gnl|my_center|LOCUS_05510 129991 130578 gene locus_tag LOCUS_05520 129991 130578 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A46 protein_id gnl|my_center|LOCUS_05520 130946 130575 gene locus_tag LOCUS_05530 130946 130575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 132369 131005 gene locus_tag LOCUS_05540 132369 131005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 133046 132390 gene locus_tag LOCUS_05550 133046 132390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 134598 133075 gene locus_tag LOCUS_05560 gene purH 134598 133075 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU9 protein_id gnl|my_center|LOCUS_05560 135158 134595 gene locus_tag LOCUS_05570 gene purN 135158 134595 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R3L5 protein_id gnl|my_center|LOCUS_05570 136865 135174 gene locus_tag LOCUS_05580 136865 135174 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_05580 137375 136908 gene locus_tag LOCUS_05590 137375 136908 CDS product mini-circle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030051.1 protein_id gnl|my_center|LOCUS_05590 138355 137462 gene locus_tag LOCUS_05600 138355 137462 CDS product succinyl-CoA synthetase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879674.1 protein_id gnl|my_center|LOCUS_05600 139505 138363 gene locus_tag LOCUS_05610 gene sucC 139505 138363 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJJ0 protein_id gnl|my_center|LOCUS_05610 139619 140128 gene locus_tag LOCUS_05620 139619 140128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 140983 140129 gene locus_tag LOCUS_05630 140983 140129 CDS product spermidine/putrescine ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020477356.1 protein_id gnl|my_center|LOCUS_05630 142548 140980 gene locus_tag LOCUS_05640 142548 140980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729220.1 protein_id gnl|my_center|LOCUS_05640 143648 142551 gene locus_tag LOCUS_05650 143648 142551 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_05650 146058 143737 gene locus_tag LOCUS_05660 146058 143737 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KY67 protein_id gnl|my_center|LOCUS_05660 146171 147811 gene locus_tag LOCUS_05670 146171 147811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 148575 147766 gene locus_tag LOCUS_05680 148575 147766 CDS product putative dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704240.1 protein_id gnl|my_center|LOCUS_05680 148655 149482 gene locus_tag LOCUS_05690 gene fabG 148655 149482 CDS product NAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403468.1 protein_id gnl|my_center|LOCUS_05690 149495 150466 gene locus_tag LOCUS_05700 149495 150466 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414686.1 protein_id gnl|my_center|LOCUS_05700 152031 150484 gene locus_tag LOCUS_05710 gene guaA 152031 150484 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGP2 protein_id gnl|my_center|LOCUS_05710 153197 152034 gene locus_tag LOCUS_05720 153197 152034 CDS product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_05720 153994 153293 gene locus_tag LOCUS_05730 153994 153293 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943986.1 protein_id gnl|my_center|LOCUS_05730 154209 154036 gene locus_tag LOCUS_05740 154209 154036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 155981 154335 gene locus_tag LOCUS_05750 gene groL2 155981 154335 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXU5 protein_id gnl|my_center|LOCUS_05750 156286 155996 gene locus_tag LOCUS_05760 gene groS 156286 155996 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSS3 protein_id gnl|my_center|LOCUS_05760 157449 156439 gene locus_tag LOCUS_05770 gene tsaD 157449 156439 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGJ3 protein_id gnl|my_center|LOCUS_05770 157970 157446 gene locus_tag LOCUS_05780 157970 157446 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FA0 protein_id gnl|my_center|LOCUS_05780 158692 157994 gene locus_tag LOCUS_05790 158692 157994 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_05790 159219 158692 gene locus_tag LOCUS_05800 159219 158692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 160337 159216 gene locus_tag LOCUS_05810 160337 159216 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NER0 protein_id gnl|my_center|LOCUS_05810 160824 160342 gene locus_tag LOCUS_05820 160824 160342 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876282.1 protein_id gnl|my_center|LOCUS_05820 162658 160847 gene locus_tag LOCUS_05830 162658 160847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 166128 162655 gene locus_tag LOCUS_05840 166128 162655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 167457 166141 gene locus_tag LOCUS_05850 gene glmM 167457 166141 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGA6 protein_id gnl|my_center|LOCUS_05850 167896 167504 gene locus_tag LOCUS_05860 gene rpsI 167896 167504 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EL3 protein_id gnl|my_center|LOCUS_05860 168360 167914 gene locus_tag LOCUS_05870 gene rplM 168360 167914 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZ33 protein_id gnl|my_center|LOCUS_05870 169380 168514 gene locus_tag LOCUS_05880 gene truA 169380 168514 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFT1 protein_id gnl|my_center|LOCUS_05880 169761 169408 gene locus_tag LOCUS_05890 169761 169408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 170706 169768 gene locus_tag LOCUS_05900 gene rpoA 170706 169768 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MG99 protein_id gnl|my_center|LOCUS_05900 171406 170789 gene locus_tag LOCUS_05910 gene rpsD 171406 170789 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45811 protein_id gnl|my_center|LOCUS_05910 171807 171409 gene locus_tag LOCUS_05920 gene rpsK 171807 171409 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72403 protein_id gnl|my_center|LOCUS_05920 172184 171807 gene locus_tag LOCUS_05930 gene rpsM 172184 171807 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X7A1 protein_id gnl|my_center|LOCUS_05930 172644 172486 gene locus_tag LOCUS_05940 172644 172486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 173607 172864 gene locus_tag LOCUS_05950 173607 172864 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_05950 174276 173629 gene locus_tag LOCUS_05960 gene adk 174276 173629 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHP1 protein_id gnl|my_center|LOCUS_05960 175583 174276 gene locus_tag LOCUS_05970 gene secY 175583 174276 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46785 protein_id gnl|my_center|LOCUS_05970 176112 175624 gene locus_tag LOCUS_05980 gene rplO 176112 175624 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46787 protein_id gnl|my_center|LOCUS_05980 176323 176120 gene locus_tag LOCUS_05990 gene rpmD 176323 176120 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46789 protein_id gnl|my_center|LOCUS_05990 176883 176320 gene locus_tag LOCUS_06000 gene rpsE 176883 176320 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG6 protein_id gnl|my_center|LOCUS_06000 177248 176883 gene locus_tag LOCUS_06010 gene rplR 177248 176883 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEG8 protein_id gnl|my_center|LOCUS_06010 177790 177251 gene locus_tag LOCUS_06020 gene rplF 177790 177251 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CV34 protein_id gnl|my_center|LOCUS_06020 178204 177800 gene locus_tag LOCUS_06030 gene rpsH 178204 177800 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WH27 protein_id gnl|my_center|LOCUS_06030 178403 178218 gene locus_tag LOCUS_06040 gene rpsZ 178403 178218 CDS product 30S ribosomal protein S14 type Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32996 protein_id gnl|my_center|LOCUS_06040 178975 178403 gene locus_tag LOCUS_06050 gene rplE 178975 178403 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0C8 protein_id gnl|my_center|LOCUS_06050 179283 178972 gene locus_tag LOCUS_06060 gene rplX 179283 178972 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38513 protein_id gnl|my_center|LOCUS_06060 179651 179283 gene locus_tag LOCUS_06070 gene rplN 179651 179283 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CV29 protein_id gnl|my_center|LOCUS_06070 179926 179648 gene locus_tag LOCUS_06080 gene rpsQ 179926 179648 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYY9 protein_id gnl|my_center|LOCUS_06080 180159 179926 gene locus_tag LOCUS_06090 gene rpmC 180159 179926 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSD9 protein_id gnl|my_center|LOCUS_06090 180575 180159 gene locus_tag LOCUS_06100 gene rplP 180575 180159 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSD8 protein_id gnl|my_center|LOCUS_06100 181480 180578 gene locus_tag LOCUS_06110 gene rpsC 181480 180578 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSD7 protein_id gnl|my_center|LOCUS_06110 182106 181480 gene locus_tag LOCUS_06120 182106 181480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 182384 182106 gene locus_tag LOCUS_06130 gene rpsS 182384 182106 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYY4 protein_id gnl|my_center|LOCUS_06130 183232 182396 gene locus_tag LOCUS_06140 gene rplB 183232 182396 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSD4 protein_id gnl|my_center|LOCUS_06140 183544 183239 gene locus_tag LOCUS_06150 183544 183239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 184164 183541 gene locus_tag LOCUS_06160 gene rplD 184164 183541 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSD2 protein_id gnl|my_center|LOCUS_06160 184877 184161 gene locus_tag LOCUS_06170 gene rplC 184877 184161 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0E0 protein_id gnl|my_center|LOCUS_06170 185405 185872 gene locus_tag LOCUS_06180 185405 185872 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_06180 186705 185923 gene locus_tag LOCUS_06190 gene yxbG 186705 185923 CDS product putative oxidoreductase YxbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46331 protein_id gnl|my_center|LOCUS_06190 187162 186842 gene locus_tag LOCUS_06200 gene rpsJ 187162 186842 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66337 protein_id gnl|my_center|LOCUS_06200 >Feature sequence04 1553 129 gene locus_tag LOCUS_06210 gene glnA 1553 129 CDS product glutamine synthetase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R079 protein_id gnl|my_center|LOCUS_06210 1768 3102 gene locus_tag LOCUS_06220 gene glnA2 1768 3102 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223124.1 protein_id gnl|my_center|LOCUS_06220 3108 3788 gene locus_tag LOCUS_06230 3108 3788 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897204.1 protein_id gnl|my_center|LOCUS_06230 4114 3914 gene locus_tag LOCUS_06240 4114 3914 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_06240 4434 4267 gene locus_tag LOCUS_06250 4434 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 4801 4445 gene locus_tag LOCUS_06260 4801 4445 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_06260 6449 4806 gene locus_tag LOCUS_06270 6449 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 6857 6537 gene locus_tag LOCUS_06280 gene erpA 6857 6537 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGX6 protein_id gnl|my_center|LOCUS_06280 6965 8137 gene locus_tag LOCUS_06290 gene mrp 6965 8137 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX37 protein_id gnl|my_center|LOCUS_06290 8999 8154 gene locus_tag LOCUS_06300 8999 8154 CDS product acyl-ACP thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908915.1 protein_id gnl|my_center|LOCUS_06300 9441 9785 gene locus_tag LOCUS_06310 9441 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 9951 10565 gene locus_tag LOCUS_06320 9951 10565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 10567 11427 gene locus_tag LOCUS_06330 10567 11427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705002.1 protein_id gnl|my_center|LOCUS_06330 11437 12369 gene locus_tag LOCUS_06340 11437 12369 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727131.1 protein_id gnl|my_center|LOCUS_06340 13035 12382 gene locus_tag LOCUS_06350 gene pdxH 13035 12382 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WN7 protein_id gnl|my_center|LOCUS_06350 13450 13082 gene locus_tag LOCUS_06360 gene crcB 13450 13082 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q035E5 protein_id gnl|my_center|LOCUS_06360 13848 13447 gene locus_tag LOCUS_06370 gene crcB1 13848 13447 CDS product putative fluoride ion transporter CrcB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FC39 protein_id gnl|my_center|LOCUS_06370 15148 13856 gene locus_tag LOCUS_06380 gene serS 15148 13856 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN0 protein_id gnl|my_center|LOCUS_06380 15188 16159 gene locus_tag LOCUS_06390 15188 16159 CDS product spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407477.1 protein_id gnl|my_center|LOCUS_06390 16156 16884 gene locus_tag LOCUS_06400 16156 16884 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAC7 protein_id gnl|my_center|LOCUS_06400 17733 16885 gene locus_tag LOCUS_06410 gene ctaG 17733 16885 CDS product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069017.1 protein_id gnl|my_center|LOCUS_06410 18192 17851 gene locus_tag LOCUS_06420 18192 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 18842 18207 gene locus_tag LOCUS_06430 gene cyoC 18842 18207 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976136.1 protein_id gnl|my_center|LOCUS_06430 20850 18835 gene locus_tag LOCUS_06440 20850 18835 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819N3 protein_id gnl|my_center|LOCUS_06440 22113 20893 gene locus_tag LOCUS_06450 22113 20893 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLI2 protein_id gnl|my_center|LOCUS_06450 23159 22299 gene locus_tag LOCUS_06460 23159 22299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 23756 23166 gene locus_tag LOCUS_06470 23756 23166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 25321 23759 gene locus_tag LOCUS_06480 gene qoxB 25321 23759 CDS product quinol oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34956 protein_id gnl|my_center|LOCUS_06480 26395 25499 gene locus_tag LOCUS_06490 gene ctaB 26395 25499 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MCQ0 protein_id gnl|my_center|LOCUS_06490 26519 27433 gene locus_tag LOCUS_06500 26519 27433 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028049.1 protein_id gnl|my_center|LOCUS_06500 27430 27735 gene locus_tag LOCUS_06510 gene clpS 27430 27735 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DET2 protein_id gnl|my_center|LOCUS_06510 27737 28225 gene locus_tag LOCUS_06520 27737 28225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 28298 28371 gene locus_tag LOCUS_t00090 28298 28371 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 28384 28461 gene locus_tag LOCUS_t00100 28384 28461 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 28512 28585 gene locus_tag LOCUS_t00110 28512 28585 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 29564 28644 gene locus_tag LOCUS_06530 29564 28644 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_06530 30375 29650 gene locus_tag LOCUS_06540 30375 29650 CDS product 2-haloalkanoic acid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173565.1 protein_id gnl|my_center|LOCUS_06540 31787 30381 gene locus_tag LOCUS_06550 31787 30381 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404528.1 protein_id gnl|my_center|LOCUS_06550 32426 31869 gene locus_tag LOCUS_06560 gene pyrE 32426 31869 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NM11 protein_id gnl|my_center|LOCUS_06560 33527 32478 gene locus_tag LOCUS_06570 gene purM 33527 32478 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU7 protein_id gnl|my_center|LOCUS_06570 35076 33520 gene locus_tag LOCUS_06580 gene purF 35076 33520 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKK3 protein_id gnl|my_center|LOCUS_06580 37317 35080 gene locus_tag LOCUS_06590 gene purL 37317 35080 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU5 protein_id gnl|my_center|LOCUS_06590 37395 37856 gene locus_tag LOCUS_06600 37395 37856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 38554 37895 gene locus_tag LOCUS_06610 gene purQ 38554 37895 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPA5 protein_id gnl|my_center|LOCUS_06610 38814 38551 gene locus_tag LOCUS_06620 gene purS 38814 38551 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 protein_id gnl|my_center|LOCUS_06620 39748 38873 gene locus_tag LOCUS_06630 gene purC 39748 38873 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF0 protein_id gnl|my_center|LOCUS_06630 41217 39787 gene locus_tag LOCUS_06640 gene purB 41217 39787 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJA2 protein_id gnl|my_center|LOCUS_06640 42552 41296 gene locus_tag LOCUS_06650 gene purD 42552 41296 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP5 protein_id gnl|my_center|LOCUS_06650 43832 42552 gene locus_tag LOCUS_06660 gene purA 43832 42552 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8P6 protein_id gnl|my_center|LOCUS_06660 45896 43908 gene locus_tag LOCUS_06670 45896 43908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 48472 45992 gene locus_tag LOCUS_06680 gene clpB 48472 45992 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF1 protein_id gnl|my_center|LOCUS_06680 49055 48639 gene locus_tag LOCUS_06690 49055 48639 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230871.1 protein_id gnl|my_center|LOCUS_06690 50200 49058 gene locus_tag LOCUS_06700 gene dnaJ1 50200 49058 CDS product chaperone protein DnaJ 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNV9 protein_id gnl|my_center|LOCUS_06700 50737 50204 gene locus_tag LOCUS_06710 50737 50204 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_06710 52566 50734 gene locus_tag LOCUS_06720 gene dnaK 52566 50734 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJ41 protein_id gnl|my_center|LOCUS_06720 52801 53559 gene locus_tag LOCUS_06730 gene gpm 52801 53559 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVH8 protein_id gnl|my_center|LOCUS_06730 54065 53547 gene locus_tag LOCUS_06740 54065 53547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 54121 54570 gene locus_tag LOCUS_06750 54121 54570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 54643 56838 gene locus_tag LOCUS_06760 54643 56838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_06760 56904 57389 gene locus_tag LOCUS_06770 56904 57389 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887791.1 protein_id gnl|my_center|LOCUS_06770 57434 58579 gene locus_tag LOCUS_06780 57434 58579 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973241.1 protein_id gnl|my_center|LOCUS_06780 59160 58597 gene locus_tag LOCUS_06790 gene dcd 59160 58597 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJL3 protein_id gnl|my_center|LOCUS_06790 60796 59183 gene locus_tag LOCUS_06800 60796 59183 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030563.1 protein_id gnl|my_center|LOCUS_06800 61327 60869 gene locus_tag LOCUS_06810 61327 60869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65054 protein_id gnl|my_center|LOCUS_06810 62157 61360 gene locus_tag LOCUS_06820 62157 61360 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031153.1 protein_id gnl|my_center|LOCUS_06820 62294 62365 gene locus_tag LOCUS_t00120 62294 62365 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 63612 62632 gene locus_tag LOCUS_06830 63612 62632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205700.1 protein_id gnl|my_center|LOCUS_06830 63794 64021 gene locus_tag LOCUS_06840 63794 64021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 64096 64578 gene locus_tag LOCUS_06850 64096 64578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 64673 64957 gene locus_tag LOCUS_06860 64673 64957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 65950 64970 gene locus_tag LOCUS_06870 65950 64970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 66184 66381 gene locus_tag LOCUS_06880 66184 66381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 66406 67104 gene locus_tag LOCUS_06890 66406 67104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 67002 67574 gene locus_tag LOCUS_06900 67002 67574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 68481 67624 gene locus_tag LOCUS_06910 gene purU 68481 67624 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBG2 protein_id gnl|my_center|LOCUS_06910 68691 68488 gene locus_tag LOCUS_06920 68691 68488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 69655 68774 gene locus_tag LOCUS_06930 gene oxyR 69655 68774 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_06930 69787 71031 gene locus_tag LOCUS_06940 69787 71031 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_06940 71197 71760 gene locus_tag LOCUS_06950 71197 71760 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730621.1 protein_id gnl|my_center|LOCUS_06950 72130 71930 gene locus_tag LOCUS_06960 gene cspLB 72130 71930 CDS product cold shock-like protein CspLB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A357 protein_id gnl|my_center|LOCUS_06960 72796 72365 gene locus_tag LOCUS_06970 72796 72365 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224891.1 protein_id gnl|my_center|LOCUS_06970 73222 72842 gene locus_tag LOCUS_06980 73222 72842 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06800 protein_id gnl|my_center|LOCUS_06980 73523 73254 gene locus_tag LOCUS_06990 73523 73254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599308.1 protein_id gnl|my_center|LOCUS_06990 73856 75565 gene locus_tag LOCUS_07000 73856 75565 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_07000 75567 76433 gene locus_tag LOCUS_07010 75567 76433 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEN7 protein_id gnl|my_center|LOCUS_07010 76607 78775 gene locus_tag LOCUS_07020 76607 78775 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031731.1 protein_id gnl|my_center|LOCUS_07020 78806 79036 gene locus_tag LOCUS_07030 78806 79036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 79513 79040 gene locus_tag LOCUS_07040 79513 79040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704682.1 protein_id gnl|my_center|LOCUS_07040 79788 80801 gene locus_tag LOCUS_07050 79788 80801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 82201 80834 gene locus_tag LOCUS_07060 82201 80834 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8U7 protein_id gnl|my_center|LOCUS_07060 82950 82504 gene locus_tag LOCUS_07070 82950 82504 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_07070 83408 82947 gene locus_tag LOCUS_07080 83408 82947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 83875 83408 gene locus_tag LOCUS_07090 gene ssb 83875 83408 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGD5 protein_id gnl|my_center|LOCUS_07090 84233 83892 gene locus_tag LOCUS_07100 gene rpsF 84233 83892 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8U2 protein_id gnl|my_center|LOCUS_07100 84908 84366 gene locus_tag LOCUS_07110 84908 84366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 85775 84912 gene locus_tag LOCUS_07120 gene panB2 85775 84912 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AMS0 protein_id gnl|my_center|LOCUS_07120 88101 85876 gene locus_tag LOCUS_07130 88101 85876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 88566 88114 gene locus_tag LOCUS_07140 88566 88114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909035.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07140 88619 89317 gene locus_tag LOCUS_07150 88619 89317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 90716 89334 gene locus_tag LOCUS_07160 90716 89334 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_07160 90845 91567 gene locus_tag LOCUS_07170 90845 91567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 91567 93555 gene locus_tag LOCUS_07180 91567 93555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 93592 94431 gene locus_tag LOCUS_07190 93592 94431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_07190 94565 95956 gene locus_tag LOCUS_07200 94565 95956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 95987 96403 gene locus_tag LOCUS_07210 95987 96403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 96477 97436 gene locus_tag LOCUS_07220 gene trxB 96477 97436 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52215 protein_id gnl|my_center|LOCUS_07220 97637 97963 gene locus_tag LOCUS_07230 gene trxA 97637 97963 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A617 protein_id gnl|my_center|LOCUS_07230 99050 98151 gene locus_tag LOCUS_07240 gene parB 99050 98151 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_07240 99921 99025 gene locus_tag LOCUS_07250 gene soj 99921 99025 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37522 protein_id gnl|my_center|LOCUS_07250 100825 100175 gene locus_tag LOCUS_07260 gene rsmG 100825 100175 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFJ0 protein_id gnl|my_center|LOCUS_07260 101761 100910 gene locus_tag LOCUS_07270 101761 100910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 102958 101768 gene locus_tag LOCUS_07280 102958 101768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 104145 103906 gene locus_tag LOCUS_07290 104145 103906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 104063 105475 gene locus_tag LOCUS_07300 gene dnaA 104063 105475 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46388 protein_id gnl|my_center|LOCUS_07300 105795 106895 gene locus_tag LOCUS_07310 105795 106895 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03D54 protein_id gnl|my_center|LOCUS_07310 106897 107976 gene locus_tag LOCUS_07320 gene recF 106897 107976 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P36176 protein_id gnl|my_center|LOCUS_07320 108014 108373 gene locus_tag LOCUS_07330 108014 108373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 108557 110494 gene locus_tag LOCUS_07340 gene gyrB 108557 110494 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEZ7 protein_id gnl|my_center|LOCUS_07340 110530 113028 gene locus_tag LOCUS_07350 gene gyrA 110530 113028 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48354 protein_id gnl|my_center|LOCUS_07350 113233 113499 gene locus_tag LOCUS_07360 113233 113499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 113493 114026 gene locus_tag LOCUS_07370 113493 114026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 114080 114154 gene locus_tag LOCUS_t00130 114080 114154 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 114295 115287 gene locus_tag LOCUS_07380 114295 115287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 115485 116276 gene locus_tag LOCUS_07390 115485 116276 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0T4 protein_id gnl|my_center|LOCUS_07390 117052 116363 gene locus_tag LOCUS_07400 117052 116363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 118723 117065 gene locus_tag LOCUS_07410 118723 117065 CDS product copper resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529536.1 protein_id gnl|my_center|LOCUS_07410 118832 119650 gene locus_tag LOCUS_07420 gene sitB 118832 119650 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083163.1 protein_id gnl|my_center|LOCUS_07420 120441 119647 gene locus_tag LOCUS_07430 120441 119647 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118358.1 protein_id gnl|my_center|LOCUS_07430 121119 120484 gene locus_tag LOCUS_07440 121119 120484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 121714 121121 gene locus_tag LOCUS_07450 121714 121121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 122321 121725 gene locus_tag LOCUS_07460 122321 121725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 122509 123783 gene locus_tag LOCUS_07470 122509 123783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 123822 124082 gene locus_tag LOCUS_07480 123822 124082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 124169 125707 gene locus_tag LOCUS_07490 124169 125707 CDS product putative acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704165.1 protein_id gnl|my_center|LOCUS_07490 125704 126540 gene locus_tag LOCUS_07500 gene prmA 125704 126540 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WD89 protein_id gnl|my_center|LOCUS_07500 126594 126968 gene locus_tag LOCUS_07510 126594 126968 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVD8 protein_id gnl|my_center|LOCUS_07510 128425 126977 gene locus_tag LOCUS_07520 128425 126977 CDS product mycofactocin system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727662.1 protein_id gnl|my_center|LOCUS_07520 129105 128422 gene locus_tag LOCUS_07530 129105 128422 CDS product mycofactocin system creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727661.1 protein_id gnl|my_center|LOCUS_07530 130066 129146 gene locus_tag LOCUS_07540 130066 129146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 131034 130129 gene locus_tag LOCUS_07550 gene moxR 131034 130129 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223047.1 protein_id gnl|my_center|LOCUS_07550 131840 131031 gene locus_tag LOCUS_07560 131840 131031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 131875 132354 gene locus_tag LOCUS_07570 131875 132354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 132746 132345 gene locus_tag LOCUS_07580 132746 132345 CDS product VapC ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64880 protein_id gnl|my_center|LOCUS_07580 132961 132737 gene locus_tag LOCUS_07590 132961 132737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64878 protein_id gnl|my_center|LOCUS_07590 133524 133024 gene locus_tag LOCUS_07600 133524 133024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 133638 134756 gene locus_tag LOCUS_07610 133638 134756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900087.1 protein_id gnl|my_center|LOCUS_07610 135317 134757 gene locus_tag LOCUS_07620 135317 134757 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 protein_id gnl|my_center|LOCUS_07620 136447 135335 gene locus_tag LOCUS_07630 136447 135335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 136546 137514 gene locus_tag LOCUS_07640 136546 137514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 137583 138758 gene locus_tag LOCUS_07650 137583 138758 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727660.1 protein_id gnl|my_center|LOCUS_07650 139913 138780 gene locus_tag LOCUS_07660 139913 138780 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727659.1 protein_id gnl|my_center|LOCUS_07660 140209 139925 gene locus_tag LOCUS_07670 140209 139925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704564.1 protein_id gnl|my_center|LOCUS_07670 140902 140438 gene locus_tag LOCUS_07680 140902 140438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 141837 140911 gene locus_tag LOCUS_07690 141837 140911 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYG3 protein_id gnl|my_center|LOCUS_07690 141956 142825 gene locus_tag LOCUS_07700 141956 142825 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893604.1 protein_id gnl|my_center|LOCUS_07700 142825 143544 gene locus_tag LOCUS_07710 gene fabG 142825 143544 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225006.1 protein_id gnl|my_center|LOCUS_07710 143544 144398 gene locus_tag LOCUS_07720 143544 144398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 144413 145576 gene locus_tag LOCUS_07730 144413 145576 CDS product microsomal epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_07730 145573 147207 gene locus_tag LOCUS_07740 145573 147207 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777012.1 protein_id gnl|my_center|LOCUS_07740 147224 147985 gene locus_tag LOCUS_07750 147224 147985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07750 148654 148238 gene locus_tag LOCUS_07760 148654 148238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 149037 148699 gene locus_tag LOCUS_07770 149037 148699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 149291 150451 gene locus_tag LOCUS_07780 gene sbcD 149291 150451 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93IW9 protein_id gnl|my_center|LOCUS_07780 150448 153465 gene locus_tag LOCUS_07790 gene sbcC 150448 153465 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DI18 protein_id gnl|my_center|LOCUS_07790 153903 153469 gene locus_tag LOCUS_07800 153903 153469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 154066 154635 gene locus_tag LOCUS_07810 154066 154635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 154638 155732 gene locus_tag LOCUS_07820 154638 155732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 155737 155952 gene locus_tag LOCUS_07830 155737 155952 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420479.1 protein_id gnl|my_center|LOCUS_07830 157082 155964 gene locus_tag LOCUS_07840 157082 155964 CDS product putative phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705205.1 protein_id gnl|my_center|LOCUS_07840 157195 158028 gene locus_tag LOCUS_07850 157195 158028 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702148.1 protein_id gnl|my_center|LOCUS_07850 159037 158231 gene locus_tag LOCUS_07860 159037 158231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 160625 159129 gene locus_tag LOCUS_07870 160625 159129 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063657.1 protein_id gnl|my_center|LOCUS_07870 162486 160615 gene locus_tag LOCUS_07880 162486 160615 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_07880 164213 162483 gene locus_tag LOCUS_07890 164213 162483 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_07890 164504 165124 gene locus_tag LOCUS_07900 164504 165124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence05 552 1046 gene locus_tag LOCUS_07910 552 1046 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 protein_id gnl|my_center|LOCUS_07910 2010 1051 gene locus_tag LOCUS_07920 2010 1051 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_07920 3140 2013 gene locus_tag LOCUS_07930 3140 2013 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_07930 4705 3140 gene locus_tag LOCUS_07940 4705 3140 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_07940 5909 4728 gene locus_tag LOCUS_07950 5909 4728 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393451.1 protein_id gnl|my_center|LOCUS_07950 6082 7347 gene locus_tag LOCUS_07960 6082 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 7727 7293 gene locus_tag LOCUS_07970 7727 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 7792 9429 gene locus_tag LOCUS_07980 7792 9429 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN4 protein_id gnl|my_center|LOCUS_07980 11077 9506 gene locus_tag LOCUS_07990 11077 9506 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_07990 11173 12222 gene locus_tag LOCUS_08000 11173 12222 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_08000 12618 12235 gene locus_tag LOCUS_08010 12618 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 13031 12843 gene locus_tag LOCUS_08020 13031 12843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 14431 13265 gene locus_tag LOCUS_08030 14431 13265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225718.1 protein_id gnl|my_center|LOCUS_08030 14508 15404 gene locus_tag LOCUS_08040 14508 15404 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931162.1 protein_id gnl|my_center|LOCUS_08040 15886 15425 gene locus_tag LOCUS_08050 15886 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 17682 15931 gene locus_tag LOCUS_08060 17682 15931 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_08060 19037 17832 gene locus_tag LOCUS_08070 19037 17832 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_08070 19159 20040 gene locus_tag LOCUS_08080 19159 20040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704001.1 protein_id gnl|my_center|LOCUS_08080 20053 20994 gene locus_tag LOCUS_08090 20053 20994 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_08090 22225 21038 gene locus_tag LOCUS_08100 22225 21038 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229035.1 protein_id gnl|my_center|LOCUS_08100 23065 22247 gene locus_tag LOCUS_08110 23065 22247 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADK3 protein_id gnl|my_center|LOCUS_08110 24018 23065 gene locus_tag LOCUS_08120 24018 23065 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_08120 24512 24087 gene locus_tag LOCUS_08130 24512 24087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 24607 25602 gene locus_tag LOCUS_08140 24607 25602 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729074.1 protein_id gnl|my_center|LOCUS_08140 25667 27652 gene locus_tag LOCUS_08150 25667 27652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 28455 27643 gene locus_tag LOCUS_08160 28455 27643 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031500.1 protein_id gnl|my_center|LOCUS_08160 30073 28442 gene locus_tag LOCUS_08170 30073 28442 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919668.1 protein_id gnl|my_center|LOCUS_08170 30247 30987 gene locus_tag LOCUS_08180 30247 30987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 31025 32212 gene locus_tag LOCUS_08190 31025 32212 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701349.1 protein_id gnl|my_center|LOCUS_08190 32215 33189 gene locus_tag LOCUS_08200 32215 33189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 34487 33297 gene locus_tag LOCUS_08210 34487 33297 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_08210 34577 35635 gene locus_tag LOCUS_08220 34577 35635 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728110.1 protein_id gnl|my_center|LOCUS_08220 35841 37706 gene locus_tag LOCUS_08230 35841 37706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 37703 42130 gene locus_tag LOCUS_08240 37703 42130 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950366.1 protein_id gnl|my_center|LOCUS_08240 43090 43431 gene locus_tag LOCUS_08250 43090 43431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 43594 45030 gene locus_tag LOCUS_08260 43594 45030 CDS product 4-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846143.1 protein_id gnl|my_center|LOCUS_08260 45959 45039 gene locus_tag LOCUS_08270 45959 45039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 47338 45956 gene locus_tag LOCUS_08280 47338 45956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 48192 47335 gene locus_tag LOCUS_08290 48192 47335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 48296 50251 gene locus_tag LOCUS_08300 48296 50251 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900811.1 protein_id gnl|my_center|LOCUS_08300 50351 52453 gene locus_tag LOCUS_08310 50351 52453 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730604.1 protein_id gnl|my_center|LOCUS_08310 52995 52525 gene locus_tag LOCUS_08320 52995 52525 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_08320 53123 54343 gene locus_tag LOCUS_08330 53123 54343 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_08330 54353 54784 gene locus_tag LOCUS_08340 54353 54784 CDS product acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_08340 55590 54787 gene locus_tag LOCUS_08350 55590 54787 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703470.1 protein_id gnl|my_center|LOCUS_08350 55835 56113 gene locus_tag LOCUS_08360 55835 56113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 57050 56115 gene locus_tag LOCUS_08370 57050 56115 CDS product putative 2-nitropropane dioxygenase, NPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704729.1 protein_id gnl|my_center|LOCUS_08370 57568 57143 gene locus_tag LOCUS_08380 57568 57143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 57704 59416 gene locus_tag LOCUS_08390 gene cshA 57704 59416 CDS product DEAD-box ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHF7 protein_id gnl|my_center|LOCUS_08390 59450 60490 gene locus_tag LOCUS_08400 59450 60490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_08400 60542 61735 gene locus_tag LOCUS_08410 60542 61735 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730892.1 protein_id gnl|my_center|LOCUS_08410 61739 62179 gene locus_tag LOCUS_08420 61739 62179 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897886.1 protein_id gnl|my_center|LOCUS_08420 62425 62183 gene locus_tag LOCUS_08430 62425 62183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 64914 62920 gene locus_tag LOCUS_08440 64914 62920 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_08440 65667 64924 gene locus_tag LOCUS_08450 65667 64924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 65751 66461 gene locus_tag LOCUS_08460 65751 66461 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225354.1 protein_id gnl|my_center|LOCUS_08460 66455 66886 gene locus_tag LOCUS_08470 66455 66886 CDS product bile-acid 7-alpha-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893617.1 protein_id gnl|my_center|LOCUS_08470 68084 66909 gene locus_tag LOCUS_08480 68084 66909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 69524 68313 gene locus_tag LOCUS_08490 gene cyp142 69524 68313 CDS product putative cytochrome P450 142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPL5 protein_id gnl|my_center|LOCUS_08490 70874 69678 gene locus_tag LOCUS_08500 70874 69678 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227670.1 protein_id gnl|my_center|LOCUS_08500 71093 71956 gene locus_tag LOCUS_08510 71093 71956 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_08510 72880 72035 gene locus_tag LOCUS_08520 72880 72035 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142351.1 protein_id gnl|my_center|LOCUS_08520 73033 73662 gene locus_tag LOCUS_08530 73033 73662 CDS product GCN5-like N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_08530 73742 75733 gene locus_tag LOCUS_08540 73742 75733 CDS product molybdopterin-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230850.1 protein_id gnl|my_center|LOCUS_08540 77026 75737 gene locus_tag LOCUS_08550 77026 75737 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 protein_id gnl|my_center|LOCUS_08550 77582 77172 gene locus_tag LOCUS_08560 gene gloA 77582 77172 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44638 protein_id gnl|my_center|LOCUS_08560 77768 78157 gene locus_tag LOCUS_08570 gene pcaC 77768 78157 CDS product gamma-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088415.1 protein_id gnl|my_center|LOCUS_08570 78154 78996 gene locus_tag LOCUS_08580 78154 78996 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNY3 protein_id gnl|my_center|LOCUS_08580 79023 79862 gene locus_tag LOCUS_08590 gene tauD 79023 79862 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004074.1 protein_id gnl|my_center|LOCUS_08590 79925 80794 gene locus_tag LOCUS_08600 79925 80794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 80801 81367 gene locus_tag LOCUS_08610 80801 81367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 82144 81380 gene locus_tag LOCUS_08620 82144 81380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 82224 82952 gene locus_tag LOCUS_08630 82224 82952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701950.1 protein_id gnl|my_center|LOCUS_08630 83756 82953 gene locus_tag LOCUS_08640 83756 82953 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_08640 85501 83768 gene locus_tag LOCUS_08650 85501 83768 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_08650 85605 87233 gene locus_tag LOCUS_08660 85605 87233 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730149.1 protein_id gnl|my_center|LOCUS_08660 88164 87238 gene locus_tag LOCUS_08670 88164 87238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 88658 88197 gene locus_tag LOCUS_08680 88658 88197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 88856 90733 gene locus_tag LOCUS_08690 88856 90733 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_08690 92731 90776 gene locus_tag LOCUS_08700 92731 90776 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_08700 92853 94598 gene locus_tag LOCUS_08710 92853 94598 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_08710 94768 94682 gene locus_tag LOCUS_t00140 94768 94682 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 94936 96387 gene locus_tag LOCUS_08720 94936 96387 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728442.1 protein_id gnl|my_center|LOCUS_08720 98197 96392 gene locus_tag LOCUS_08730 gene pepF 98197 96392 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_08730 98644 98219 gene locus_tag LOCUS_08740 98644 98219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 99397 98672 gene locus_tag LOCUS_08750 99397 98672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 101000 99399 gene locus_tag LOCUS_08760 101000 99399 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030361.1 protein_id gnl|my_center|LOCUS_08760 101932 101069 gene locus_tag LOCUS_08770 101932 101069 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030360.1 protein_id gnl|my_center|LOCUS_08770 102896 102219 gene locus_tag LOCUS_08780 102896 102219 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583622.1 protein_id gnl|my_center|LOCUS_08780 103123 104271 gene locus_tag LOCUS_08790 103123 104271 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703772.1 protein_id gnl|my_center|LOCUS_08790 105579 104437 gene locus_tag LOCUS_08800 105579 104437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 105735 107063 gene locus_tag LOCUS_08810 105735 107063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 107118 108935 gene locus_tag LOCUS_08820 107118 108935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 109012 110619 gene locus_tag LOCUS_08830 109012 110619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813299.1 protein_id gnl|my_center|LOCUS_08830 111738 110623 gene locus_tag LOCUS_08840 gene prfB 111738 110623 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QU58 protein_id gnl|my_center|LOCUS_08840 114458 111735 gene locus_tag LOCUS_08850 gene secA1 114458 111735 CDS product protein translocase subunit SecA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71533 protein_id gnl|my_center|LOCUS_08850 115093 114545 gene locus_tag LOCUS_08860 115093 114545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 116098 115283 gene locus_tag LOCUS_08870 116098 115283 CDS product short-chain type dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_08870 117647 116175 gene locus_tag LOCUS_08880 gene ahcY 117647 116175 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZM1 protein_id gnl|my_center|LOCUS_08880 118857 117820 gene locus_tag LOCUS_08890 118857 117820 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392147.1 protein_id gnl|my_center|LOCUS_08890 119094 118858 gene locus_tag LOCUS_08900 119094 118858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895208.1 protein_id gnl|my_center|LOCUS_08900 120513 119113 gene locus_tag LOCUS_08910 gene manB 120513 119113 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_08910 121328 120537 gene locus_tag LOCUS_08920 121328 120537 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_08920 124021 121460 gene locus_tag LOCUS_08930 124021 121460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 125089 124070 gene locus_tag LOCUS_08940 125089 124070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 125227 125382 gene locus_tag LOCUS_08950 125227 125382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 125451 127415 gene locus_tag LOCUS_08960 gene ftsH 125451 127415 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CK5 protein_id gnl|my_center|LOCUS_08960 127872 127417 gene locus_tag LOCUS_08970 127872 127417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 129523 127877 gene locus_tag LOCUS_08980 129523 127877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 133077 129520 gene locus_tag LOCUS_08990 133077 129520 CDS product integral membrane regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 protein_id gnl|my_center|LOCUS_08990 133220 133441 gene locus_tag LOCUS_09000 133220 133441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 133443 134567 gene locus_tag LOCUS_09010 133443 134567 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222919.1 protein_id gnl|my_center|LOCUS_09010 134577 135485 gene locus_tag LOCUS_09020 134577 135485 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_09020 135580 136560 gene locus_tag LOCUS_09030 gene gmd 135580 136560 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ72 protein_id gnl|my_center|LOCUS_09030 136566 137534 gene locus_tag LOCUS_09040 136566 137534 CDS product LPPG--FO 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_09040 137531 138247 gene locus_tag LOCUS_09050 137531 138247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 138417 139388 gene locus_tag LOCUS_09060 138417 139388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 140336 139392 gene locus_tag LOCUS_09070 gene galE1 140336 139392 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN67 protein_id gnl|my_center|LOCUS_09070 141340 140339 gene locus_tag LOCUS_09080 141340 140339 CDS product GDP-mannose pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_09080 141654 141337 gene locus_tag LOCUS_09090 141654 141337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 142975 141704 gene locus_tag LOCUS_09100 142975 141704 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265553.1 protein_id gnl|my_center|LOCUS_09100 144117 142972 gene locus_tag LOCUS_09110 144117 142972 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257269.1 protein_id gnl|my_center|LOCUS_09110 144944 144114 gene locus_tag LOCUS_09120 144944 144114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 145077 145271 gene locus_tag LOCUS_09130 145077 145271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 145313 146290 gene locus_tag LOCUS_09140 gene fcl 145313 146290 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF18 protein_id gnl|my_center|LOCUS_09140 147473 146295 gene locus_tag LOCUS_09150 147473 146295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 147556 148593 gene locus_tag LOCUS_09160 147556 148593 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_09160 148590 149405 gene locus_tag LOCUS_09170 148590 149405 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence06 77 808 gene locus_tag LOCUS_09180 77 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392092.1 protein_id gnl|my_center|LOCUS_09180 824 2839 gene locus_tag LOCUS_09190 824 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 2909 3214 gene locus_tag LOCUS_09200 gene rplU 2909 3214 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NN50 protein_id gnl|my_center|LOCUS_09200 3218 3469 gene locus_tag LOCUS_09210 gene rpmA 3218 3469 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMY4 protein_id gnl|my_center|LOCUS_09210 4599 3526 gene locus_tag LOCUS_09220 4599 3526 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKT7 protein_id gnl|my_center|LOCUS_09220 4799 5029 gene locus_tag LOCUS_09230 4799 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 5002 6060 gene locus_tag LOCUS_09240 gene obg 5002 6060 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ8 protein_id gnl|my_center|LOCUS_09240 6060 7154 gene locus_tag LOCUS_09250 gene proB 6060 7154 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DFK4 protein_id gnl|my_center|LOCUS_09250 8740 7151 gene locus_tag LOCUS_09260 gene mviN 8740 7151 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224759.1 protein_id gnl|my_center|LOCUS_09260 8823 10082 gene locus_tag LOCUS_09270 gene proA 8823 10082 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ6 protein_id gnl|my_center|LOCUS_09270 10155 11057 gene locus_tag LOCUS_09280 10155 11057 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_09280 11077 12540 gene locus_tag LOCUS_09290 11077 12540 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729941.1 protein_id gnl|my_center|LOCUS_09290 13244 12552 gene locus_tag LOCUS_09300 gene cysH 13244 12552 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0W2 protein_id gnl|my_center|LOCUS_09300 15019 13232 gene locus_tag LOCUS_09310 15019 13232 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389684.1 protein_id gnl|my_center|LOCUS_09310 16458 15106 gene locus_tag LOCUS_09320 16458 15106 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NQ6 protein_id gnl|my_center|LOCUS_09320 17343 16513 gene locus_tag LOCUS_09330 17343 16513 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEI7 protein_id gnl|my_center|LOCUS_09330 17549 18151 gene locus_tag LOCUS_09340 gene nadD 17549 18151 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCI6 protein_id gnl|my_center|LOCUS_09340 18148 19599 gene locus_tag LOCUS_09350 18148 19599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 19596 19961 gene locus_tag LOCUS_09360 gene rsfS 19596 19961 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182L0 protein_id gnl|my_center|LOCUS_09360 20149 21501 gene locus_tag LOCUS_09370 20149 21501 CDS product potassium transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_09370 21494 22171 gene locus_tag LOCUS_09380 21494 22171 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_09380 22311 22238 gene locus_tag LOCUS_t00150 22311 22238 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 22418 24916 gene locus_tag LOCUS_09390 gene leuS 22418 24916 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2J3 protein_id gnl|my_center|LOCUS_09390 25785 24931 gene locus_tag LOCUS_09400 25785 24931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_09400 26830 25778 gene locus_tag LOCUS_09410 26830 25778 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_09410 26891 27625 gene locus_tag LOCUS_09420 26891 27625 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_09420 27939 28508 gene locus_tag LOCUS_09430 27939 28508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 28656 29948 gene locus_tag LOCUS_09440 28656 29948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 29958 30788 gene locus_tag LOCUS_09450 29958 30788 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MH13 protein_id gnl|my_center|LOCUS_09450 30785 31846 gene locus_tag LOCUS_09460 30785 31846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 32201 31938 gene locus_tag LOCUS_09470 gene rpsT 32201 31938 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDA3 protein_id gnl|my_center|LOCUS_09470 32597 32349 gene locus_tag LOCUS_09480 32597 32349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 32496 34166 gene locus_tag LOCUS_09490 gene lepA 32496 34166 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65270 protein_id gnl|my_center|LOCUS_09490 34275 35288 gene locus_tag LOCUS_09500 gene hrcA 34275 35288 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDD6 protein_id gnl|my_center|LOCUS_09500 35292 36404 gene locus_tag LOCUS_09510 gene dnaJ2 35292 36404 CDS product chaperone protein DnaJ 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDD7 protein_id gnl|my_center|LOCUS_09510 36409 37113 gene locus_tag LOCUS_09520 36409 37113 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDD9 protein_id gnl|my_center|LOCUS_09520 37110 38180 gene locus_tag LOCUS_09530 gene hemN 37110 38180 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228429.1 protein_id gnl|my_center|LOCUS_09530 38184 38828 gene locus_tag LOCUS_09540 38184 38828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 38918 39754 gene locus_tag LOCUS_09550 38918 39754 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090003.1 protein_id gnl|my_center|LOCUS_09550 40012 40569 gene locus_tag LOCUS_09560 40012 40569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 40566 41609 gene locus_tag LOCUS_09570 40566 41609 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876331.1 protein_id gnl|my_center|LOCUS_09570 42107 42031 gene locus_tag LOCUS_t00160 42107 42031 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 42242 43360 gene locus_tag LOCUS_09580 42242 43360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_09580 44367 43384 gene locus_tag LOCUS_09590 gene trpS 44367 43384 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSZ6 protein_id gnl|my_center|LOCUS_09590 44366 45229 gene locus_tag LOCUS_09600 44366 45229 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027965.1 protein_id gnl|my_center|LOCUS_09600 45239 45901 gene locus_tag LOCUS_09610 45239 45901 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S231 protein_id gnl|my_center|LOCUS_09610 45898 46647 gene locus_tag LOCUS_09620 45898 46647 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_09620 46671 47039 gene locus_tag LOCUS_09630 46671 47039 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_09630 47045 48142 gene locus_tag LOCUS_09640 47045 48142 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_09640 48142 49437 gene locus_tag LOCUS_09650 gene aroA 48142 49437 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z0 protein_id gnl|my_center|LOCUS_09650 49434 50081 gene locus_tag LOCUS_09660 gene cmk 49434 50081 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D9R5 protein_id gnl|my_center|LOCUS_09660 50078 50791 gene locus_tag LOCUS_09670 50078 50791 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_09670 51359 50805 gene locus_tag LOCUS_09680 51359 50805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090877.1 protein_id gnl|my_center|LOCUS_09680 51813 51400 gene locus_tag LOCUS_09690 51813 51400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 52900 51827 gene locus_tag LOCUS_09700 gene ispH 52900 51827 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULU1 protein_id gnl|my_center|LOCUS_09700 53032 54294 gene locus_tag LOCUS_09710 53032 54294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_09710 54291 55610 gene locus_tag LOCUS_09720 gene engA 54291 55610 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYP9 protein_id gnl|my_center|LOCUS_09720 55832 57334 gene locus_tag LOCUS_09730 55832 57334 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229439.1 protein_id gnl|my_center|LOCUS_09730 57348 57425 gene locus_tag LOCUS_t00170 57348 57425 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 57489 59072 gene locus_tag LOCUS_09740 gene lysS 57489 59072 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA9 protein_id gnl|my_center|LOCUS_09740 59209 59940 gene locus_tag LOCUS_09750 59209 59940 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_09750 60289 59945 gene locus_tag LOCUS_09760 60289 59945 CDS product putative HIT-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WML3 protein_id gnl|my_center|LOCUS_09760 60179 60385 gene locus_tag LOCUS_09770 60179 60385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 60382 60987 gene locus_tag LOCUS_09780 60382 60987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 61051 61434 gene locus_tag LOCUS_09790 gene gcvH 61051 61434 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D905 protein_id gnl|my_center|LOCUS_09790 61434 61928 gene locus_tag LOCUS_09800 61434 61928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 61925 62866 gene locus_tag LOCUS_09810 61925 62866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 62909 63403 gene locus_tag LOCUS_09820 62909 63403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_09820 63556 64068 gene locus_tag LOCUS_09830 63556 64068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 64126 65208 gene locus_tag LOCUS_09840 gene gcvT 64126 65208 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFJ5 protein_id gnl|my_center|LOCUS_09840 68106 65209 gene locus_tag LOCUS_09850 gene gcvP 68106 65209 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DB35 protein_id gnl|my_center|LOCUS_09850 69230 68424 gene locus_tag LOCUS_09860 69230 68424 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_09860 69585 70709 gene locus_tag LOCUS_09870 69585 70709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 70967 71209 gene locus_tag LOCUS_09880 70967 71209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 71853 71329 gene locus_tag LOCUS_09890 71853 71329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 72107 73546 gene locus_tag LOCUS_09900 72107 73546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 74129 73548 gene locus_tag LOCUS_09910 74129 73548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 74196 74972 gene locus_tag LOCUS_09920 74196 74972 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064991.1 protein_id gnl|my_center|LOCUS_09920 75455 74988 gene locus_tag LOCUS_09930 75455 74988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 75961 75458 gene locus_tag LOCUS_09940 75961 75458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 76655 75963 gene locus_tag LOCUS_09950 76655 75963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 78391 76784 gene locus_tag LOCUS_09960 78391 76784 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_09960 79628 78450 gene locus_tag LOCUS_09970 79628 78450 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228841.1 protein_id gnl|my_center|LOCUS_09970 80275 79667 gene locus_tag LOCUS_09980 80275 79667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 82920 80272 gene locus_tag LOCUS_09990 82920 80272 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_09990 83716 82910 gene locus_tag LOCUS_10000 gene tatC 83716 82910 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MAJ8 protein_id gnl|my_center|LOCUS_10000 84065 83724 gene locus_tag LOCUS_10010 84065 83724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 84147 84872 gene locus_tag LOCUS_10020 84147 84872 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763000.1 protein_id gnl|my_center|LOCUS_10020 85533 84907 gene locus_tag LOCUS_10030 85533 84907 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV2 protein_id gnl|my_center|LOCUS_10030 86535 85585 gene locus_tag LOCUS_10040 86535 85585 CDS product protein pafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_10040 87505 86528 gene locus_tag LOCUS_10050 87505 86528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 88898 87540 gene locus_tag LOCUS_10060 gene pafA 88898 87540 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ61 protein_id gnl|my_center|LOCUS_10060 89630 88947 gene locus_tag LOCUS_10070 gene psmA 89630 88947 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAT2 protein_id gnl|my_center|LOCUS_10070 90469 89627 gene locus_tag LOCUS_10080 90469 89627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 90706 90512 gene locus_tag LOCUS_10090 90706 90512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 92272 90761 gene locus_tag LOCUS_10100 92272 90761 CDS product proteasome accessory factor PafA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_10100 94062 92305 gene locus_tag LOCUS_10110 gene arc 94062 92305 CDS product proteasome-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ58 protein_id gnl|my_center|LOCUS_10110 94240 94476 gene locus_tag LOCUS_10120 94240 94476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 95757 94588 gene locus_tag LOCUS_10130 95757 94588 CDS product acid resistance periplasmic serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731101.1 protein_id gnl|my_center|LOCUS_10130 96567 95794 gene locus_tag LOCUS_10140 96567 95794 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_10140 97412 96564 gene locus_tag LOCUS_10150 97412 96564 CDS product tRNA(Ile)-lysidine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584019.1 protein_id gnl|my_center|LOCUS_10150 97508 97807 gene locus_tag LOCUS_10160 97508 97807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 98256 98047 gene locus_tag LOCUS_10170 98256 98047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 98600 98253 gene locus_tag LOCUS_10180 98600 98253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 99343 98723 gene locus_tag LOCUS_10190 99343 98723 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402203.1 protein_id gnl|my_center|LOCUS_10190 100791 99379 gene locus_tag LOCUS_10200 100791 99379 CDS product peptidase S13 (D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701272.1 protein_id gnl|my_center|LOCUS_10200 102275 100791 gene locus_tag LOCUS_10210 102275 100791 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867767.1 protein_id gnl|my_center|LOCUS_10210 102934 102272 gene locus_tag LOCUS_10220 102934 102272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 103542 102931 gene locus_tag LOCUS_10230 103542 102931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 103602 103988 gene locus_tag LOCUS_10240 103602 103988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 103988 105106 gene locus_tag LOCUS_10250 103988 105106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_10250 105116 107074 gene locus_tag LOCUS_10260 gene tkt 105116 107074 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_10260 107089 108180 gene locus_tag LOCUS_10270 gene talA 107089 108180 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4Z8 protein_id gnl|my_center|LOCUS_10270 108177 108860 gene locus_tag LOCUS_10280 gene pgl 108177 108860 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403626.1 protein_id gnl|my_center|LOCUS_10280 108871 111210 gene locus_tag LOCUS_10290 108871 111210 CDS product putative 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702061.1 protein_id gnl|my_center|LOCUS_10290 111415 111212 gene locus_tag LOCUS_10300 111415 111212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 111502 112257 gene locus_tag LOCUS_10310 111502 112257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8H2 protein_id gnl|my_center|LOCUS_10310 114093 112261 gene locus_tag LOCUS_10320 114093 112261 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887841.1 protein_id gnl|my_center|LOCUS_10320 114332 114138 gene locus_tag LOCUS_10330 114332 114138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 115581 114415 gene locus_tag LOCUS_10340 gene rnd 115581 114415 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 protein_id gnl|my_center|LOCUS_10340 115917 115591 gene locus_tag LOCUS_10350 115917 115591 CDS product rhodanese-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700875.1 protein_id gnl|my_center|LOCUS_10350 116537 115944 gene locus_tag LOCUS_10360 gene mobA 116537 115944 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q835J2 protein_id gnl|my_center|LOCUS_10360 116987 116541 gene locus_tag LOCUS_10370 116987 116541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029140.1 protein_id gnl|my_center|LOCUS_10370 119217 117784 gene locus_tag LOCUS_10380 119217 117784 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHC2 protein_id gnl|my_center|LOCUS_10380 120063 119284 gene locus_tag LOCUS_10390 120063 119284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_10390 120132 120902 gene locus_tag LOCUS_10400 120132 120902 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_10400 121144 122073 gene locus_tag LOCUS_10410 gene dppB 121144 122073 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311351.1 protein_id gnl|my_center|LOCUS_10410 122054 123034 gene locus_tag LOCUS_10420 122054 123034 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_10420 123037 124125 gene locus_tag LOCUS_10430 123037 124125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_10430 124125 125138 gene locus_tag LOCUS_10440 124125 125138 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261419.1 protein_id gnl|my_center|LOCUS_10440 125776 125150 gene locus_tag LOCUS_10450 125776 125150 CDS product DNA-3-methyladenine glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227863.1 protein_id gnl|my_center|LOCUS_10450 125802 126296 gene locus_tag LOCUS_10460 125802 126296 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKF2 protein_id gnl|my_center|LOCUS_10460 127687 126563 gene locus_tag LOCUS_10470 127687 126563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 129258 127684 gene locus_tag LOCUS_10480 129258 127684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 129369 130961 gene locus_tag LOCUS_10490 129369 130961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_10490 130968 132140 gene locus_tag LOCUS_10500 130968 132140 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229287.1 protein_id gnl|my_center|LOCUS_10500 132140 132820 gene locus_tag LOCUS_10510 132140 132820 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338973.1 protein_id gnl|my_center|LOCUS_10510 132823 133464 gene locus_tag LOCUS_10520 132823 133464 CDS product putative 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD41 protein_id gnl|my_center|LOCUS_10520 133614 134327 gene locus_tag LOCUS_10530 133614 134327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 135855 134392 gene locus_tag LOCUS_10540 gene gltD 135855 134392 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_10540 140430 135868 gene locus_tag LOCUS_10550 140430 135868 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731294.1 protein_id gnl|my_center|LOCUS_10550 140635 141948 gene locus_tag LOCUS_10560 gene apeB 140635 141948 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XA76 protein_id gnl|my_center|LOCUS_10560 141976 142527 gene locus_tag LOCUS_10570 141976 142527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 142596 143195 gene locus_tag LOCUS_10580 142596 143195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 144117 143212 gene locus_tag LOCUS_10590 144117 143212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 144474 145718 gene locus_tag LOCUS_10600 144474 145718 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence07 <1 705 gene locus_tag LOCUS_10610 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125527.1:molecular chaperone DnaK 792 1289 gene locus_tag LOCUS_10620 792 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1291 2232 gene locus_tag LOCUS_10630 1291 2232 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CMS9 protein_id gnl|my_center|LOCUS_10630 2605 2204 gene locus_tag LOCUS_10640 2605 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2812 3897 gene locus_tag LOCUS_10650 2812 3897 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_10650 3919 4422 gene locus_tag LOCUS_10660 3919 4422 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_10660 5175 4438 gene locus_tag LOCUS_10670 5175 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 5191 8733 gene locus_tag LOCUS_10680 gene dnaE1 5191 8733 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNT7 protein_id gnl|my_center|LOCUS_10680 8815 9483 gene locus_tag LOCUS_10690 8815 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 9500 10099 gene locus_tag LOCUS_10700 9500 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 12085 10100 gene locus_tag LOCUS_10710 12085 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 12105 12953 gene locus_tag LOCUS_10720 12105 12953 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QV10 protein_id gnl|my_center|LOCUS_10720 13784 12966 gene locus_tag LOCUS_10730 13784 12966 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701584.1 protein_id gnl|my_center|LOCUS_10730 14910 13810 gene locus_tag LOCUS_10740 gene menE 14910 13810 CDS product 2-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58730 protein_id gnl|my_center|LOCUS_10740 14972 15862 gene locus_tag LOCUS_10750 gene menA 14972 15862 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFJ4 protein_id gnl|my_center|LOCUS_10750 16681 15863 gene locus_tag LOCUS_10760 gene menH 16681 15863 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HC27 protein_id gnl|my_center|LOCUS_10760 16680 18377 gene locus_tag LOCUS_10770 gene menD 16680 18377 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB45 protein_id gnl|my_center|LOCUS_10770 19653 18367 gene locus_tag LOCUS_10780 19653 18367 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_10780 20363 19650 gene locus_tag LOCUS_10790 gene menG 20363 19650 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB34 protein_id gnl|my_center|LOCUS_10790 20869 20435 gene locus_tag LOCUS_10800 20869 20435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 21678 20884 gene locus_tag LOCUS_10810 21678 20884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10810 23641 22001 gene locus_tag LOCUS_10820 23641 22001 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728248.1 protein_id gnl|my_center|LOCUS_10820 24010 23648 gene locus_tag LOCUS_10830 24010 23648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 23968 24879 gene locus_tag LOCUS_10840 23968 24879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 25901 24804 gene locus_tag LOCUS_10850 gene rlmN 25901 24804 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFY6 protein_id gnl|my_center|LOCUS_10850 26518 25898 gene locus_tag LOCUS_10860 26518 25898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 26562 27203 gene locus_tag LOCUS_10870 gene nth 26562 27203 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NTL4 protein_id gnl|my_center|LOCUS_10870 27755 29059 gene locus_tag LOCUS_10880 gene hisD 27755 29059 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34651 protein_id gnl|my_center|LOCUS_10880 29056 30120 gene locus_tag LOCUS_10890 gene hisC 29056 30120 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16246 protein_id gnl|my_center|LOCUS_10890 30117 30731 gene locus_tag LOCUS_10900 gene hisB 30117 30731 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33564 protein_id gnl|my_center|LOCUS_10900 30728 31366 gene locus_tag LOCUS_10910 gene hisH 30728 31366 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60599 protein_id gnl|my_center|LOCUS_10910 31366 32097 gene locus_tag LOCUS_10920 gene hisA 31366 32097 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA6 protein_id gnl|my_center|LOCUS_10920 32132 32755 gene locus_tag LOCUS_10930 32132 32755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 32762 33535 gene locus_tag LOCUS_10940 32762 33535 CDS product imidazole glycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_10940 34058 33549 gene locus_tag LOCUS_10950 34058 33549 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_10950 34221 34589 gene locus_tag LOCUS_10960 34221 34589 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZQ4 protein_id gnl|my_center|LOCUS_10960 34650 35012 gene locus_tag LOCUS_10970 34650 35012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 35015 36541 gene locus_tag LOCUS_10980 gene trpE 35015 36541 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_10980 36558 37526 gene locus_tag LOCUS_10990 36558 37526 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141472.1 protein_id gnl|my_center|LOCUS_10990 37533 38075 gene locus_tag LOCUS_11000 37533 38075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 38099 38413 gene locus_tag LOCUS_11010 38099 38413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 38500 39204 gene locus_tag LOCUS_11020 gene trpC 38500 39204 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MBV4 protein_id gnl|my_center|LOCUS_11020 39240 40493 gene locus_tag LOCUS_11030 39240 40493 CDS product TrpB-like pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065635.1 protein_id gnl|my_center|LOCUS_11030 40549 41181 gene locus_tag LOCUS_11040 gene trpF 40549 41181 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56320 protein_id gnl|my_center|LOCUS_11040 41191 42348 gene locus_tag LOCUS_11050 41191 42348 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877267.1 protein_id gnl|my_center|LOCUS_11050 42345 43175 gene locus_tag LOCUS_11060 gene trpA 42345 43175 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68816 protein_id gnl|my_center|LOCUS_11060 43172 43615 gene locus_tag LOCUS_11070 43172 43615 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896076.1 protein_id gnl|my_center|LOCUS_11070 43824 44108 gene locus_tag LOCUS_11080 gene hup1 43824 44108 CDS product DNA-binding protein HU 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3H5 protein_id gnl|my_center|LOCUS_11080 44234 44698 gene locus_tag LOCUS_11090 44234 44698 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257872.1 protein_id gnl|my_center|LOCUS_11090 44695 45120 gene locus_tag LOCUS_11100 gene fabZ 44695 45120 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLY7 protein_id gnl|my_center|LOCUS_11100 45124 45591 gene locus_tag LOCUS_11110 45124 45591 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0A4 protein_id gnl|my_center|LOCUS_11110 46781 45600 gene locus_tag LOCUS_11120 gene fabF 46781 45600 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67612 protein_id gnl|my_center|LOCUS_11120 47011 46778 gene locus_tag LOCUS_11130 gene acp 47011 46778 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4N3 protein_id gnl|my_center|LOCUS_11130 47792 47082 gene locus_tag LOCUS_11140 47792 47082 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_11140 48751 47789 gene locus_tag LOCUS_11150 gene fabH 48751 47789 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHA3 protein_id gnl|my_center|LOCUS_11150 49943 48774 gene locus_tag LOCUS_11160 gene fabD 49943 48774 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71019 protein_id gnl|my_center|LOCUS_11160 50144 50060 gene locus_tag LOCUS_t00180 50144 50060 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 50263 50541 gene locus_tag LOCUS_11170 50263 50541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 50604 51188 gene locus_tag LOCUS_11180 gene nasT 50604 51188 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_11180 51185 53872 gene locus_tag LOCUS_11190 51185 53872 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703350.1 protein_id gnl|my_center|LOCUS_11190 53841 54617 gene locus_tag LOCUS_11200 53841 54617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 54736 56145 gene locus_tag LOCUS_11210 gene rpsA 54736 56145 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_11210 56429 56169 gene locus_tag LOCUS_11220 56429 56169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 56512 57114 gene locus_tag LOCUS_11230 gene coaE 56512 57114 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2K7 protein_id gnl|my_center|LOCUS_11230 58524 57121 gene locus_tag LOCUS_11240 58524 57121 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_11240 59404 58505 gene locus_tag LOCUS_11250 59404 58505 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NLQ9 protein_id gnl|my_center|LOCUS_11250 60167 59406 gene locus_tag LOCUS_11260 60167 59406 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974130.1 protein_id gnl|my_center|LOCUS_11260 60271 62286 gene locus_tag LOCUS_11270 gene uvrB 60271 62286 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CK11 protein_id gnl|my_center|LOCUS_11270 62337 65183 gene locus_tag LOCUS_11280 gene uvrA 62337 65183 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z507 protein_id gnl|my_center|LOCUS_11280 66332 65211 gene locus_tag LOCUS_11290 gene nadA 66332 65211 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EBX6 protein_id gnl|my_center|LOCUS_11290 66493 68391 gene locus_tag LOCUS_11300 gene uvrC 66493 68391 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4X3 protein_id gnl|my_center|LOCUS_11300 68404 69144 gene locus_tag LOCUS_11310 68404 69144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 69155 70009 gene locus_tag LOCUS_11320 69155 70009 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z513 protein_id gnl|my_center|LOCUS_11320 70154 71164 gene locus_tag LOCUS_11330 gene gap 70154 71164 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z518 protein_id gnl|my_center|LOCUS_11330 71174 72298 gene locus_tag LOCUS_11340 71174 72298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 72291 73067 gene locus_tag LOCUS_11350 gene tpiA 72291 73067 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z520 protein_id gnl|my_center|LOCUS_11350 73081 73311 gene locus_tag LOCUS_11360 gene secG 73081 73311 CDS product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z469 protein_id gnl|my_center|LOCUS_11360 73318 74118 gene locus_tag LOCUS_11370 73318 74118 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_11370 74115 75467 gene locus_tag LOCUS_11380 74115 75467 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729222.1 protein_id gnl|my_center|LOCUS_11380 75469 76500 gene locus_tag LOCUS_11390 75469 76500 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226804.1 protein_id gnl|my_center|LOCUS_11390 77264 76497 gene locus_tag LOCUS_11400 77264 76497 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7T0 protein_id gnl|my_center|LOCUS_11400 77366 78034 gene locus_tag LOCUS_11410 77366 78034 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878704.1 protein_id gnl|my_center|LOCUS_11410 78031 79206 gene locus_tag LOCUS_11420 gene mshC 78031 79206 CDS product L-cysteine:1D-myo-inositol 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QZY0 protein_id gnl|my_center|LOCUS_11420 79257 81206 gene locus_tag LOCUS_11430 gene thrS 79257 81206 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ECS0 protein_id gnl|my_center|LOCUS_11430 81210 81734 gene locus_tag LOCUS_11440 81210 81734 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403826.1 protein_id gnl|my_center|LOCUS_11440 81909 82520 gene locus_tag LOCUS_11450 81909 82520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 82571 83095 gene locus_tag LOCUS_11460 82571 83095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 83142 83675 gene locus_tag LOCUS_11470 83142 83675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 84183 83695 gene locus_tag LOCUS_11480 84183 83695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 84241 84933 gene locus_tag LOCUS_11490 84241 84933 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742693.1 protein_id gnl|my_center|LOCUS_11490 84940 85896 gene locus_tag LOCUS_11500 84940 85896 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_11500 85898 86974 gene locus_tag LOCUS_11510 85898 86974 CDS product GDP-mannose-dependent alpha-(1-2)-phosphatidylinositol mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227144.1 protein_id gnl|my_center|LOCUS_11510 87011 87778 gene locus_tag LOCUS_11520 87011 87778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 87775 88968 gene locus_tag LOCUS_11530 87775 88968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_11530 89017 89922 gene locus_tag LOCUS_11540 gene pdxS 89017 89922 CDS product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D8V6 protein_id gnl|my_center|LOCUS_11540 89976 90563 gene locus_tag LOCUS_11550 gene pdxT 89976 90563 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCJ8 protein_id gnl|my_center|LOCUS_11550 90604 91353 gene locus_tag LOCUS_11560 90604 91353 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWH1 protein_id gnl|my_center|LOCUS_11560 91472 91942 gene locus_tag LOCUS_11570 gene bcp-2 91472 91942 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933657.1 protein_id gnl|my_center|LOCUS_11570 92900 91887 gene locus_tag LOCUS_11580 gene rsgA 92900 91887 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A60 protein_id gnl|my_center|LOCUS_11580 93360 92905 gene locus_tag LOCUS_11590 93360 92905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705064.1 protein_id gnl|my_center|LOCUS_11590 94284 93373 gene locus_tag LOCUS_11600 94284 93373 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028189.1 protein_id gnl|my_center|LOCUS_11600 94601 96004 gene locus_tag LOCUS_11610 94601 96004 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2Q6 protein_id gnl|my_center|LOCUS_11610 96020 97387 gene locus_tag LOCUS_11620 96020 97387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 97390 99114 gene locus_tag LOCUS_11630 97390 99114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 99131 100237 gene locus_tag LOCUS_11640 99131 100237 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_11640 100253 101116 gene locus_tag LOCUS_11650 100253 101116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 104608 101120 gene locus_tag LOCUS_11660 104608 101120 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_11660 104757 105323 gene locus_tag LOCUS_11670 104757 105323 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970094.1 protein_id gnl|my_center|LOCUS_11670 105360 106832 gene locus_tag LOCUS_11680 gene pepA 105360 106832 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2Q7 protein_id gnl|my_center|LOCUS_11680 107469 106813 gene locus_tag LOCUS_11690 107469 106813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 107998 107597 gene locus_tag LOCUS_11700 107998 107597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 108732 107995 gene locus_tag LOCUS_11710 108732 107995 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230619.1 protein_id gnl|my_center|LOCUS_11710 108809 109579 gene locus_tag LOCUS_11720 gene cobB2 108809 109579 CDS product NAD-dependent protein deacetylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJM9 protein_id gnl|my_center|LOCUS_11720 109676 110851 gene locus_tag LOCUS_11730 109676 110851 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_11730 111069 110854 gene locus_tag LOCUS_11740 111069 110854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 111068 113248 gene locus_tag LOCUS_11750 111068 113248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 113292 114386 gene locus_tag LOCUS_11760 113292 114386 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_11760 114726 114562 gene locus_tag LOCUS_11770 114726 114562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 114749 116665 gene locus_tag LOCUS_11780 114749 116665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 116757 118085 gene locus_tag LOCUS_11790 116757 118085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 118094 118702 gene locus_tag LOCUS_11800 118094 118702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 118709 119317 gene locus_tag LOCUS_11810 gene rfbC 118709 119317 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938000.1 protein_id gnl|my_center|LOCUS_11810 119352 120305 gene locus_tag LOCUS_11820 gene rfbB 119352 120305 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023679.1 protein_id gnl|my_center|LOCUS_11820 120309 121157 gene locus_tag LOCUS_11830 120309 121157 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_11830 121164 122522 gene locus_tag LOCUS_11840 121164 122522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 123442 124506 gene locus_tag LOCUS_11850 123442 124506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 124596 125399 gene locus_tag LOCUS_11860 124596 125399 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXZ7 protein_id gnl|my_center|LOCUS_11860 125404 126630 gene locus_tag LOCUS_11870 125404 126630 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_11870 126627 127634 gene locus_tag LOCUS_11880 126627 127634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 129878 127671 gene locus_tag LOCUS_11890 129878 127671 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222071.1 protein_id gnl|my_center|LOCUS_11890 131474 129882 gene locus_tag LOCUS_11900 131474 129882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 131977 131471 gene locus_tag LOCUS_11910 131977 131471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 132152 133357 gene locus_tag LOCUS_11920 132152 133357 CDS product UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876469.1 protein_id gnl|my_center|LOCUS_11920 133372 134112 gene locus_tag LOCUS_11930 133372 134112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 134109 135131 gene locus_tag LOCUS_11940 134109 135131 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730921.1 protein_id gnl|my_center|LOCUS_11940 135115 136863 gene locus_tag LOCUS_11950 135115 136863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence08 384 308 gene locus_tag LOCUS_t00190 384 308 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 492 419 gene locus_tag LOCUS_t00200 492 419 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 577 1071 gene locus_tag LOCUS_11960 gene yncA 577 1071 CDS product phosphinothricin acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038821.1 protein_id gnl|my_center|LOCUS_11960 1128 1212 gene locus_tag LOCUS_t00210 1128 1212 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1298 1786 gene locus_tag LOCUS_11970 1298 1786 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_11970 2278 1799 gene locus_tag LOCUS_11980 2278 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4233 2275 gene locus_tag LOCUS_11990 gene acsA 4233 2275 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X928 protein_id gnl|my_center|LOCUS_11990 5426 4326 gene locus_tag LOCUS_12000 5426 4326 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142380.1 protein_id gnl|my_center|LOCUS_12000 6944 5433 gene locus_tag LOCUS_12010 gene nuoN-1 6944 5433 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_12010 8508 6949 gene locus_tag LOCUS_12020 8508 6949 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_12020 10748 8526 gene locus_tag LOCUS_12030 10748 8526 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_12030 11068 10754 gene locus_tag LOCUS_12040 gene ndhE 11068 10754 CDS product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMW3 protein_id gnl|my_center|LOCUS_12040 11577 11068 gene locus_tag LOCUS_12050 11577 11068 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_12050 12086 11577 gene locus_tag LOCUS_12060 gene nuoI2 12086 11577 CDS product NADH-quinone oxidoreductase subunit I 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2V8 protein_id gnl|my_center|LOCUS_12060 13123 12086 gene locus_tag LOCUS_12070 gene nuoH 13123 12086 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2V9 protein_id gnl|my_center|LOCUS_12070 14295 13120 gene locus_tag LOCUS_12080 gene nuoD1 14295 13120 CDS product NADH-quinone oxidoreductase subunit D 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X853 protein_id gnl|my_center|LOCUS_12080 14966 14292 gene locus_tag LOCUS_12090 14966 14292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 15453 14953 gene locus_tag LOCUS_12100 15453 14953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 15818 15444 gene locus_tag LOCUS_12110 15818 15444 CDS product NADH-quinone oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2W2 protein_id gnl|my_center|LOCUS_12110 17585 15894 gene locus_tag LOCUS_12120 gene nuoN-1 17585 15894 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_12120 19234 17582 gene locus_tag LOCUS_12130 gene nuoM-1 19234 17582 CDS product NADH:ubiquinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_12130 21210 19234 gene locus_tag LOCUS_12140 gene nuoL-1 21210 19234 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_12140 21524 21216 gene locus_tag LOCUS_12150 gene nuoK 21524 21216 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWD6 protein_id gnl|my_center|LOCUS_12150 22126 21524 gene locus_tag LOCUS_12160 gene nuoJ 22126 21524 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312704.1 protein_id gnl|my_center|LOCUS_12160 22854 22129 gene locus_tag LOCUS_12170 22854 22129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 24062 22854 gene locus_tag LOCUS_12180 24062 22854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 26786 24111 gene locus_tag LOCUS_12190 gene nuoG 26786 24111 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYJ0 protein_id gnl|my_center|LOCUS_12190 28122 26779 gene locus_tag LOCUS_12200 28122 26779 CDS product NADH-quinone oxidoreductase, F subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702874.1 protein_id gnl|my_center|LOCUS_12200 28733 28119 gene locus_tag LOCUS_12210 28733 28119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 30091 28733 gene locus_tag LOCUS_12220 gene nuoD 30091 28733 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVN5 protein_id gnl|my_center|LOCUS_12220 30614 30072 gene locus_tag LOCUS_12230 30614 30072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 31204 30617 gene locus_tag LOCUS_12240 gene nuoB1 31204 30617 CDS product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAQ5 protein_id gnl|my_center|LOCUS_12240 31663 31205 gene locus_tag LOCUS_12250 gene nuoA1 31663 31205 CDS product NADH-quinone oxidoreductase subunit A 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA8 protein_id gnl|my_center|LOCUS_12250 32613 31669 gene locus_tag LOCUS_12260 32613 31669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 33713 32613 gene locus_tag LOCUS_12270 33713 32613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 34561 33713 gene locus_tag LOCUS_12280 34561 33713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 35369 34587 gene locus_tag LOCUS_12290 35369 34587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 36168 35380 gene locus_tag LOCUS_12300 36168 35380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 36692 36276 gene locus_tag LOCUS_12310 36692 36276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 37150 36695 gene locus_tag LOCUS_12320 37150 36695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 37455 38255 gene locus_tag LOCUS_12330 37455 38255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 39619 38354 gene locus_tag LOCUS_12340 gene hemL 39619 38354 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W050 protein_id gnl|my_center|LOCUS_12340 40550 39624 gene locus_tag LOCUS_12350 gene hemB 40550 39624 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54919 protein_id gnl|my_center|LOCUS_12350 42154 40619 gene locus_tag LOCUS_12360 42154 40619 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_12360 42320 42622 gene locus_tag LOCUS_12370 42320 42622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 44020 42626 gene locus_tag LOCUS_12380 44020 42626 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_12380 44913 44026 gene locus_tag LOCUS_12390 44913 44026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 44992 45483 gene locus_tag LOCUS_12400 gene ppa 44992 45483 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8I9 protein_id gnl|my_center|LOCUS_12400 45598 46233 gene locus_tag LOCUS_12410 45598 46233 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_12410 46281 47078 gene locus_tag LOCUS_12420 46281 47078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_12420 47080 49638 gene locus_tag LOCUS_12430 47080 49638 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_12430 49638 50033 gene locus_tag LOCUS_12440 49638 50033 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223396.1 protein_id gnl|my_center|LOCUS_12440 50075 50746 gene locus_tag LOCUS_12450 50075 50746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 52871 50754 gene locus_tag LOCUS_12460 52871 50754 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXS5 protein_id gnl|my_center|LOCUS_12460 53023 54090 gene locus_tag LOCUS_12470 gene hemE 53023 54090 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69861 protein_id gnl|my_center|LOCUS_12470 54087 54998 gene locus_tag LOCUS_12480 gene hemH 54087 54998 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32396 protein_id gnl|my_center|LOCUS_12480 54995 56404 gene locus_tag LOCUS_12490 gene hemY 54995 56404 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_12490 56585 57190 gene locus_tag LOCUS_12500 56585 57190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 57187 57849 gene locus_tag LOCUS_12510 57187 57849 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105021.1 protein_id gnl|my_center|LOCUS_12510 57905 58486 gene locus_tag LOCUS_12520 57905 58486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 58584 59648 gene locus_tag LOCUS_12530 58584 59648 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027145.1 protein_id gnl|my_center|LOCUS_12530 59692 60537 gene locus_tag LOCUS_12540 59692 60537 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978391.1 protein_id gnl|my_center|LOCUS_12540 60542 62038 gene locus_tag LOCUS_12550 gene lnt 60542 62038 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QZ13 protein_id gnl|my_center|LOCUS_12550 62229 63602 gene locus_tag LOCUS_12560 62229 63602 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_12560 63606 64352 gene locus_tag LOCUS_12570 63606 64352 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_12570 64349 65437 gene locus_tag LOCUS_12580 64349 65437 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_12580 66082 65459 gene locus_tag LOCUS_12590 66082 65459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028272.1 protein_id gnl|my_center|LOCUS_12590 66586 66083 gene locus_tag LOCUS_12600 66586 66083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 67865 66681 gene locus_tag LOCUS_12610 67865 66681 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_12610 67946 68797 gene locus_tag LOCUS_12620 gene tesB 67946 68797 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_12620 69058 70281 gene locus_tag LOCUS_12630 69058 70281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 70278 71117 gene locus_tag LOCUS_12640 70278 71117 CDS product inositol phosphorylceramide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028214.1 protein_id gnl|my_center|LOCUS_12640 72249 71101 gene locus_tag LOCUS_12650 72249 71101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 72558 72268 gene locus_tag LOCUS_12660 72558 72268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 72448 73137 gene locus_tag LOCUS_12670 72448 73137 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226564.1 protein_id gnl|my_center|LOCUS_12670 73134 74279 gene locus_tag LOCUS_12680 73134 74279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 75198 74257 gene locus_tag LOCUS_12690 75198 74257 CDS product luciferase-like hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701714.1 protein_id gnl|my_center|LOCUS_12690 75197 76033 gene locus_tag LOCUS_12700 75197 76033 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730131.1 protein_id gnl|my_center|LOCUS_12700 76026 76880 gene locus_tag LOCUS_12710 76026 76880 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897035.1 protein_id gnl|my_center|LOCUS_12710 77643 76867 gene locus_tag LOCUS_12720 77643 76867 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225669.1 protein_id gnl|my_center|LOCUS_12720 78335 77640 gene locus_tag LOCUS_12730 78335 77640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 78450 79841 gene locus_tag LOCUS_12740 78450 79841 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225043.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12740 79844 80476 gene locus_tag LOCUS_12750 79844 80476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 80547 81089 gene locus_tag LOCUS_12760 80547 81089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 81116 81967 gene locus_tag LOCUS_12770 81116 81967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_12770 82690 81974 gene locus_tag LOCUS_12780 82690 81974 CDS product sugar acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977515.1 protein_id gnl|my_center|LOCUS_12780 82745 83152 gene locus_tag LOCUS_12790 82745 83152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 83152 84696 gene locus_tag LOCUS_12800 83152 84696 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_12800 85592 84708 gene locus_tag LOCUS_12810 85592 84708 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224861.1 protein_id gnl|my_center|LOCUS_12810 86453 85608 gene locus_tag LOCUS_12820 86453 85608 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225035.1 protein_id gnl|my_center|LOCUS_12820 86898 86482 gene locus_tag LOCUS_12830 86898 86482 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 protein_id gnl|my_center|LOCUS_12830 86940 87167 gene locus_tag LOCUS_12840 86940 87167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 87444 87178 gene locus_tag LOCUS_12850 87444 87178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_12850 88379 87441 gene locus_tag LOCUS_12860 gene gluQ 88379 87441 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFW6 protein_id gnl|my_center|LOCUS_12860 89139 88393 gene locus_tag LOCUS_12870 89139 88393 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_12870 90671 89136 gene locus_tag LOCUS_12880 90671 89136 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_12880 91526 90735 gene locus_tag LOCUS_12890 91526 90735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_12890 92514 91576 gene locus_tag LOCUS_12900 92514 91576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12900 93965 92751 gene locus_tag LOCUS_12910 93965 92751 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089277.1 protein_id gnl|my_center|LOCUS_12910 95219 94002 gene locus_tag LOCUS_12920 95219 94002 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_12920 96023 95271 gene locus_tag LOCUS_12930 gene paaG 96023 95271 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228150.1 protein_id gnl|my_center|LOCUS_12930 97506 96061 gene locus_tag LOCUS_12940 gene prr 97506 96061 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EIN3 protein_id gnl|my_center|LOCUS_12940 97714 98865 gene locus_tag LOCUS_12950 gene potA 97714 98865 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXF4 protein_id gnl|my_center|LOCUS_12950 98868 100034 gene locus_tag LOCUS_12960 98868 100034 CDS product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894684.1 protein_id gnl|my_center|LOCUS_12960 100044 100928 gene locus_tag LOCUS_12970 100044 100928 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894683.1 protein_id gnl|my_center|LOCUS_12970 100925 101749 gene locus_tag LOCUS_12980 100925 101749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894682.1 protein_id gnl|my_center|LOCUS_12980 101856 103250 gene locus_tag LOCUS_12990 101856 103250 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_12990 103247 104389 gene locus_tag LOCUS_13000 103247 104389 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S227 protein_id gnl|my_center|LOCUS_13000 105637 104411 gene locus_tag LOCUS_13010 105637 104411 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037500.1 protein_id gnl|my_center|LOCUS_13010 105715 106224 gene locus_tag LOCUS_13020 105715 106224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 106221 107021 gene locus_tag LOCUS_13030 106221 107021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112739.1 protein_id gnl|my_center|LOCUS_13030 108039 107014 gene locus_tag LOCUS_13040 108039 107014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 107996 108211 gene locus_tag LOCUS_13050 107996 108211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 108985 108221 gene locus_tag LOCUS_13060 108985 108221 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_13060 109016 110221 gene locus_tag LOCUS_13070 109016 110221 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727666.1 protein_id gnl|my_center|LOCUS_13070 111349 110234 gene locus_tag LOCUS_13080 111349 110234 CDS product UPF0272 protein Cgl2470/cg2715 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NMU4 protein_id gnl|my_center|LOCUS_13080 112313 111516 gene locus_tag LOCUS_13090 112313 111516 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_13090 112335 113306 gene locus_tag LOCUS_13100 gene pheA 112335 113306 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC28 protein_id gnl|my_center|LOCUS_13100 113374 113461 gene locus_tag LOCUS_t00220 113374 113461 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 113507 113596 gene locus_tag LOCUS_t00230 113507 113596 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 114049 113663 gene locus_tag LOCUS_13110 gene vapC12 114049 113663 CDS product ribonuclease VapC12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WFA3 protein_id gnl|my_center|LOCUS_13110 114351 114046 gene locus_tag LOCUS_13120 114351 114046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 114470 116698 gene locus_tag LOCUS_13130 gene icd 114470 116698 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038863.1 protein_id gnl|my_center|LOCUS_13130 118453 116711 gene locus_tag LOCUS_13140 gene ilvD 118453 116711 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QP06 protein_id gnl|my_center|LOCUS_13140 118979 118665 gene locus_tag LOCUS_13150 118979 118665 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225051.1 protein_id gnl|my_center|LOCUS_13150 119533 119042 gene locus_tag LOCUS_13160 gene purE 119533 119042 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZY2 protein_id gnl|my_center|LOCUS_13160 120699 119530 gene locus_tag LOCUS_13170 gene purK 120699 119530 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHL9 protein_id gnl|my_center|LOCUS_13170 120796 121911 gene locus_tag LOCUS_13180 120796 121911 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412289.1 protein_id gnl|my_center|LOCUS_13180 124329 121921 gene locus_tag LOCUS_13190 124329 121921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 124406 124480 gene locus_tag LOCUS_t00240 124406 124480 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence09 105 749 gene locus_tag LOCUS_13200 105 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 792 1805 gene locus_tag LOCUS_13210 gene uppP3 792 1805 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KML1 protein_id gnl|my_center|LOCUS_13210 3182 1815 gene locus_tag LOCUS_13220 3182 1815 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 protein_id gnl|my_center|LOCUS_13220 4522 3179 gene locus_tag LOCUS_13230 4522 3179 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_13230 5910 4519 gene locus_tag LOCUS_13240 5910 4519 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_13240 6054 7148 gene locus_tag LOCUS_13250 6054 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 7303 9168 gene locus_tag LOCUS_13260 gene dxs1 7303 9168 CDS product 1-deoxy-D-xylulose-5-phosphate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X7W3 protein_id gnl|my_center|LOCUS_13260 9193 9969 gene locus_tag LOCUS_13270 9193 9969 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_13270 9966 10358 gene locus_tag LOCUS_13280 9966 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 11996 10365 gene locus_tag LOCUS_13290 11996 10365 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729559.1 protein_id gnl|my_center|LOCUS_13290 12496 12002 gene locus_tag LOCUS_13300 12496 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 13329 12493 gene locus_tag LOCUS_13310 13329 12493 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222197.1 protein_id gnl|my_center|LOCUS_13310 14565 13408 gene locus_tag LOCUS_13320 14565 13408 CDS product putative lipid carrier protein or keto acyl-COA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704896.1 protein_id gnl|my_center|LOCUS_13320 15632 14562 gene locus_tag LOCUS_13330 15632 14562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704895.1 protein_id gnl|my_center|LOCUS_13330 16654 15632 gene locus_tag LOCUS_13340 16654 15632 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224428.1 protein_id gnl|my_center|LOCUS_13340 17483 16827 gene locus_tag LOCUS_13350 gene nfuA 17483 16827 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_13350 18744 17587 gene locus_tag LOCUS_13360 18744 17587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 18993 20759 gene locus_tag LOCUS_13370 18993 20759 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_13370 20792 22357 gene locus_tag LOCUS_13380 20792 22357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 22354 23100 gene locus_tag LOCUS_13390 22354 23100 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903387.1 protein_id gnl|my_center|LOCUS_13390 23104 23937 gene locus_tag LOCUS_13400 23104 23937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_13400 23971 24684 gene locus_tag LOCUS_13410 23971 24684 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_13410 24926 25732 gene locus_tag LOCUS_13420 24926 25732 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203150.1 protein_id gnl|my_center|LOCUS_13420 26076 25753 gene locus_tag LOCUS_13430 26076 25753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 26914 26066 gene locus_tag LOCUS_13440 26914 26066 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_13440 27017 27466 gene locus_tag LOCUS_13450 27017 27466 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_13450 28188 27478 gene locus_tag LOCUS_13460 gene queC 28188 27478 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSY8 protein_id gnl|my_center|LOCUS_13460 29693 28185 gene locus_tag LOCUS_13470 29693 28185 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_13470 30063 29785 gene locus_tag LOCUS_13480 30063 29785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 29950 31299 gene locus_tag LOCUS_13490 29950 31299 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704045.1 protein_id gnl|my_center|LOCUS_13490 31362 32618 gene locus_tag LOCUS_13500 gene bioA 31362 32618 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818W8 protein_id gnl|my_center|LOCUS_13500 32615 33763 gene locus_tag LOCUS_13510 gene bioF 32615 33763 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749W3 protein_id gnl|my_center|LOCUS_13510 33760 34422 gene locus_tag LOCUS_13520 gene bioD 33760 34422 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I426 protein_id gnl|my_center|LOCUS_13520 34536 35384 gene locus_tag LOCUS_13530 34536 35384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 36357 35392 gene locus_tag LOCUS_13540 36357 35392 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_13540 37219 36380 gene locus_tag LOCUS_13550 37219 36380 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_13550 38850 37216 gene locus_tag LOCUS_13560 gene cbiO 38850 37216 CDS product cobalt ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_13560 39947 38847 gene locus_tag LOCUS_13570 39947 38847 CDS product cobalt ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028280.1 protein_id gnl|my_center|LOCUS_13570 40438 39944 gene locus_tag LOCUS_13580 40438 39944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 41143 42060 gene locus_tag LOCUS_13590 41143 42060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113910.1 protein_id gnl|my_center|LOCUS_13590 42860 42090 gene locus_tag LOCUS_13600 gene fabG 42860 42090 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225891.1 protein_id gnl|my_center|LOCUS_13600 43037 43462 gene locus_tag LOCUS_13610 gene ptpA 43037 43462 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_13610 43508 45334 gene locus_tag LOCUS_13620 43508 45334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 45393 46685 gene locus_tag LOCUS_13630 45393 46685 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_13630 46682 47488 gene locus_tag LOCUS_13640 46682 47488 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230360.1 protein_id gnl|my_center|LOCUS_13640 47485 47982 gene locus_tag LOCUS_13650 47485 47982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 48042 48551 gene locus_tag LOCUS_13660 48042 48551 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_13660 50733 48628 gene locus_tag LOCUS_13670 50733 48628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461379.1 protein_id gnl|my_center|LOCUS_13670 51235 50846 gene locus_tag LOCUS_13680 51235 50846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 52900 51359 gene locus_tag LOCUS_13690 52900 51359 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728258.1 protein_id gnl|my_center|LOCUS_13690 53082 54242 gene locus_tag LOCUS_13700 53082 54242 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 protein_id gnl|my_center|LOCUS_13700 54245 55690 gene locus_tag LOCUS_13710 54245 55690 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528760.1 protein_id gnl|my_center|LOCUS_13710 55739 56335 gene locus_tag LOCUS_13720 55739 56335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700836.1 protein_id gnl|my_center|LOCUS_13720 56354 57106 gene locus_tag LOCUS_13730 56354 57106 CDS product putative short-chain type dehydrogenase/reductase y4lA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55541 protein_id gnl|my_center|LOCUS_13730 58663 57119 gene locus_tag LOCUS_13740 58663 57119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 58760 59305 gene locus_tag LOCUS_13750 58760 59305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919683.1 protein_id gnl|my_center|LOCUS_13750 59328 60263 gene locus_tag LOCUS_13760 59328 60263 CDS product threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228883.1 protein_id gnl|my_center|LOCUS_13760 60531 60280 gene locus_tag LOCUS_13770 60531 60280 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230558.1 protein_id gnl|my_center|LOCUS_13770 61195 60539 gene locus_tag LOCUS_13780 61195 60539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702311.1 protein_id gnl|my_center|LOCUS_13780 61255 61890 gene locus_tag LOCUS_13790 61255 61890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 62263 61919 gene locus_tag LOCUS_13800 62263 61919 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDG9 protein_id gnl|my_center|LOCUS_13800 62579 62277 gene locus_tag LOCUS_13810 62579 62277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804628.1 protein_id gnl|my_center|LOCUS_13810 63132 62680 gene locus_tag LOCUS_13820 gene rplS 63132 62680 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2Q6 protein_id gnl|my_center|LOCUS_13820 63883 63158 gene locus_tag LOCUS_13830 gene trmD 63883 63158 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CFB7 protein_id gnl|my_center|LOCUS_13830 64368 63889 gene locus_tag LOCUS_13840 64368 63889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 64660 64373 gene locus_tag LOCUS_13850 64660 64373 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4M5 protein_id gnl|my_center|LOCUS_13850 64920 64657 gene locus_tag LOCUS_13860 gene rpsP 64920 64657 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BB8 protein_id gnl|my_center|LOCUS_13860 66545 65043 gene locus_tag LOCUS_13870 66545 65043 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_13870 67809 66610 gene locus_tag LOCUS_13880 gene ftsY 67809 66610 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBP9 protein_id gnl|my_center|LOCUS_13880 68934 67957 gene locus_tag LOCUS_13890 68934 67957 CDS product putative serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701822.1 protein_id gnl|my_center|LOCUS_13890 68994 69266 gene locus_tag LOCUS_13900 68994 69266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 70645 69341 gene locus_tag LOCUS_13910 gene cutS 70645 69341 CDS product sensor protein CutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4I7 protein_id gnl|my_center|LOCUS_13910 71352 70642 gene locus_tag LOCUS_13920 71352 70642 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224495.1 protein_id gnl|my_center|LOCUS_13920 71503 72558 gene locus_tag LOCUS_13930 gene moxR 71503 72558 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_13930 72633 73556 gene locus_tag LOCUS_13940 72633 73556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64854 protein_id gnl|my_center|LOCUS_13940 73553 74512 gene locus_tag LOCUS_13950 73553 74512 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_13950 78011 74550 gene locus_tag LOCUS_13960 gene smc 78011 74550 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYI4 protein_id gnl|my_center|LOCUS_13960 78847 78011 gene locus_tag LOCUS_13970 78847 78011 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_13970 79412 78840 gene locus_tag LOCUS_13980 79412 78840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 79371 79589 gene locus_tag LOCUS_13990 79371 79589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 79860 79570 gene locus_tag LOCUS_14000 79860 79570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 80967 79972 gene locus_tag LOCUS_14010 80967 79972 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_14010 81163 80984 gene locus_tag LOCUS_14020 81163 80984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 81781 81239 gene locus_tag LOCUS_14030 81781 81239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65058 protein_id gnl|my_center|LOCUS_14030 82675 81785 gene locus_tag LOCUS_14040 82675 81785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 83151 82672 gene locus_tag LOCUS_14050 gene coaD 83151 82672 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJS9 protein_id gnl|my_center|LOCUS_14050 83678 83148 gene locus_tag LOCUS_14060 83678 83148 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223682.1 protein_id gnl|my_center|LOCUS_14060 83741 83917 gene locus_tag LOCUS_14070 83741 83917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 83932 84366 gene locus_tag LOCUS_14080 83932 84366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 85050 84385 gene locus_tag LOCUS_14090 85050 84385 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228255.1 protein_id gnl|my_center|LOCUS_14090 87230 85074 gene locus_tag LOCUS_14100 gene recG 87230 85074 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D041 protein_id gnl|my_center|LOCUS_14100 88891 87227 gene locus_tag LOCUS_14110 gene dhaK 88891 87227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289723.1 protein_id gnl|my_center|LOCUS_14110 88878 89234 gene locus_tag LOCUS_14120 88878 89234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 89252 89524 gene locus_tag LOCUS_14130 89252 89524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 89682 91472 gene locus_tag LOCUS_14140 gene pckG 89682 91472 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93JL5 protein_id gnl|my_center|LOCUS_14140 91716 91537 gene locus_tag LOCUS_14150 91716 91537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 91636 92130 gene locus_tag LOCUS_14160 91636 92130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 92499 92134 gene locus_tag LOCUS_14170 92499 92134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 92880 92515 gene locus_tag LOCUS_14180 92880 92515 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 protein_id gnl|my_center|LOCUS_14180 93045 93863 gene locus_tag LOCUS_14190 gene map 93045 93863 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKR2 protein_id gnl|my_center|LOCUS_14190 93865 94176 gene locus_tag LOCUS_14200 93865 94176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 94216 94515 gene locus_tag LOCUS_14210 94216 94515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 95353 94520 gene locus_tag LOCUS_14220 95353 94520 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_14220 96501 95353 gene locus_tag LOCUS_14230 96501 95353 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_14230 97409 96534 gene locus_tag LOCUS_14240 97409 96534 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_14240 97509 98360 gene locus_tag LOCUS_14250 gene galT 97509 98360 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DIK1 protein_id gnl|my_center|LOCUS_14250 98363 99385 gene locus_tag LOCUS_14260 98363 99385 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250782.1 protein_id gnl|my_center|LOCUS_14260 100035 99397 gene locus_tag LOCUS_14270 100035 99397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 100086 102152 gene locus_tag LOCUS_14280 100086 102152 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MEY1 protein_id gnl|my_center|LOCUS_14280 102883 102164 gene locus_tag LOCUS_14290 102883 102164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 103656 102883 gene locus_tag LOCUS_14300 103656 102883 CDS product putative exodeoxyribonuclease III protein XthA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704916.1 protein_id gnl|my_center|LOCUS_14300 103735 107364 gene locus_tag LOCUS_14310 gene kgd 103735 107364 CDS product alpha-ketoglutarate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_14310 108747 107392 gene locus_tag LOCUS_14320 108747 107392 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015415.1 protein_id gnl|my_center|LOCUS_14320 109216 >109388 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaagaagcgggcggccaagaag >Feature sequence10 1907 2914 gene locus_tag LOCUS_14330 1907 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2911 4074 gene locus_tag LOCUS_14340 2911 4074 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_14340 5139 4093 gene locus_tag LOCUS_14350 5139 4093 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_14350 5250 6455 gene locus_tag LOCUS_14360 5250 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLL9 protein_id gnl|my_center|LOCUS_14360 6546 6470 gene locus_tag LOCUS_t00250 6546 6470 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7099 6569 gene locus_tag LOCUS_14370 7099 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 7972 7109 gene locus_tag LOCUS_14380 7972 7109 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879859.1 protein_id gnl|my_center|LOCUS_14380 7886 8449 gene locus_tag LOCUS_14390 7886 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 8464 8955 gene locus_tag LOCUS_14400 8464 8955 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946270.1 protein_id gnl|my_center|LOCUS_14400 9021 9977 gene locus_tag LOCUS_14410 9021 9977 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTH0 protein_id gnl|my_center|LOCUS_14410 10572 9970 gene locus_tag LOCUS_14420 10572 9970 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888427.1 protein_id gnl|my_center|LOCUS_14420 11255 10575 gene locus_tag LOCUS_14430 11255 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888428.1 protein_id gnl|my_center|LOCUS_14430 11462 11387 gene locus_tag LOCUS_t00260 11462 11387 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11549 11476 gene locus_tag LOCUS_t00270 11549 11476 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 11816 11634 gene locus_tag LOCUS_14440 11816 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 13171 11816 gene locus_tag LOCUS_14450 13171 11816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 14996 13164 gene locus_tag LOCUS_14460 gene dnaG 14996 13164 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S1N4 protein_id gnl|my_center|LOCUS_14460 16364 15033 gene locus_tag LOCUS_14470 gene glyS 16364 15033 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBH4 protein_id gnl|my_center|LOCUS_14470 18811 16376 gene locus_tag LOCUS_14480 18811 16376 CDS product putative CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95149 protein_id gnl|my_center|LOCUS_14480 19633 18896 gene locus_tag LOCUS_14490 gene recO 19633 18896 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCB6 protein_id gnl|my_center|LOCUS_14490 20371 19646 gene locus_tag LOCUS_14500 gene uppS2 20371 19646 CDS product isoprenyl transferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NNC1 protein_id gnl|my_center|LOCUS_14500 20423 22327 gene locus_tag LOCUS_14510 gene dinG 20423 22327 CDS product putative ATP-dependent helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMR5 protein_id gnl|my_center|LOCUS_14510 23173 22334 gene locus_tag LOCUS_14520 gene era 23173 22334 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DDP5 protein_id gnl|my_center|LOCUS_14520 24444 23170 gene locus_tag LOCUS_14530 24444 23170 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_14530 25037 24462 gene locus_tag LOCUS_14540 25037 24462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 25981 25034 gene locus_tag LOCUS_14550 25981 25034 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_14550 26050 26601 gene locus_tag LOCUS_14560 26050 26601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 26759 26535 gene locus_tag LOCUS_14570 26759 26535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 26885 27634 gene locus_tag LOCUS_14580 26885 27634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 27634 28938 gene locus_tag LOCUS_14590 27634 28938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 28935 30203 gene locus_tag LOCUS_14600 28935 30203 CDS product pilus assembly protein CpaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_14600 30200 31084 gene locus_tag LOCUS_14610 30200 31084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 31081 31980 gene locus_tag LOCUS_14620 31081 31980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 32012 32236 gene locus_tag LOCUS_14630 32012 32236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 32233 32667 gene locus_tag LOCUS_14640 32233 32667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 32664 33122 gene locus_tag LOCUS_14650 32664 33122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 33116 33562 gene locus_tag LOCUS_14660 33116 33562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 33626 34951 gene locus_tag LOCUS_14670 33626 34951 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_14670 36272 34956 gene locus_tag LOCUS_14680 gene murF 36272 34956 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2W8 protein_id gnl|my_center|LOCUS_14680 36330 37385 gene locus_tag LOCUS_14690 gene ddl 36330 37385 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG68 protein_id gnl|my_center|LOCUS_14690 38032 37370 gene locus_tag LOCUS_14700 38032 37370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 38079 40436 gene locus_tag LOCUS_14710 38079 40436 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_14710 40433 41650 gene locus_tag LOCUS_14720 40433 41650 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_14720 41643 43238 gene locus_tag LOCUS_14730 41643 43238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459733.1 protein_id gnl|my_center|LOCUS_14730 43247 44227 gene locus_tag LOCUS_14740 43247 44227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 45421 44240 gene locus_tag LOCUS_14750 45421 44240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 45699 46187 gene locus_tag LOCUS_14760 45699 46187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 46184 46738 gene locus_tag LOCUS_14770 46184 46738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 46786 49062 gene locus_tag LOCUS_14780 gene acn 46786 49062 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_14780 49971 49096 gene locus_tag LOCUS_14790 49971 49096 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707217.1 protein_id gnl|my_center|LOCUS_14790 50165 51115 gene locus_tag LOCUS_14800 50165 51115 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230083.1 protein_id gnl|my_center|LOCUS_14800 51115 52536 gene locus_tag LOCUS_14810 51115 52536 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972641.1 protein_id gnl|my_center|LOCUS_14810 52676 53944 gene locus_tag LOCUS_14820 gene gltA 52676 53944 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF3 protein_id gnl|my_center|LOCUS_14820 54965 53973 gene locus_tag LOCUS_14830 54965 53973 CDS product putative quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700961.1 protein_id gnl|my_center|LOCUS_14830 54988 57240 gene locus_tag LOCUS_14840 54988 57240 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 protein_id gnl|my_center|LOCUS_14840 58421 57246 gene locus_tag LOCUS_14850 58421 57246 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970398.1 protein_id gnl|my_center|LOCUS_14850 59642 58515 gene locus_tag LOCUS_14860 59642 58515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_14860 59784 59710 gene locus_tag LOCUS_t00280 59784 59710 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 59919 60719 gene locus_tag LOCUS_14870 59919 60719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 60734 60808 gene locus_tag LOCUS_t00290 60734 60808 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 61507 60902 gene locus_tag LOCUS_14880 61507 60902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 62445 61663 gene locus_tag LOCUS_14890 62445 61663 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726860.1 protein_id gnl|my_center|LOCUS_14890 64004 62526 gene locus_tag LOCUS_14900 64004 62526 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_14900 64993 64004 gene locus_tag LOCUS_14910 64993 64004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 65736 64948 gene locus_tag LOCUS_14920 65736 64948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 66877 65771 gene locus_tag LOCUS_14930 66877 65771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 67155 67080 gene locus_tag LOCUS_t00300 67155 67080 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 67866 67219 gene locus_tag LOCUS_14940 67866 67219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 68100 67879 gene locus_tag LOCUS_14950 68100 67879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 68345 68115 gene locus_tag LOCUS_14960 68345 68115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 69609 68824 gene locus_tag LOCUS_14970 gene mutM 69609 68824 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228777.1 protein_id gnl|my_center|LOCUS_14970 70799 69615 gene locus_tag LOCUS_14980 70799 69615 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_14980 72004 70796 gene locus_tag LOCUS_14990 gene metX 72004 70796 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHP2 protein_id gnl|my_center|LOCUS_14990 73674 72166 gene locus_tag LOCUS_15000 73674 72166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 74846 73677 gene locus_tag LOCUS_15010 74846 73677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 76081 74972 gene locus_tag LOCUS_15020 76081 74972 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_15020 76559 76089 gene locus_tag LOCUS_15030 76559 76089 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHW8 protein_id gnl|my_center|LOCUS_15030 77428 76556 gene locus_tag LOCUS_15040 gene lgt1 77428 76556 CDS product prolipoprotein diacylglyceryl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2U8 protein_id gnl|my_center|LOCUS_15040 79232 77433 gene locus_tag LOCUS_15050 gene mmgC 79232 77433 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_15050 79274 79954 gene locus_tag LOCUS_15060 gene paaG 79274 79954 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223909.1 protein_id gnl|my_center|LOCUS_15060 79965 80420 gene locus_tag LOCUS_15070 79965 80420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704461.1 protein_id gnl|my_center|LOCUS_15070 80432 81193 gene locus_tag LOCUS_15080 80432 81193 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_15080 81428 81207 gene locus_tag LOCUS_15090 81428 81207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 81460 82353 gene locus_tag LOCUS_15100 81460 82353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 82353 83105 gene locus_tag LOCUS_15110 82353 83105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 83352 83122 gene locus_tag LOCUS_15120 83352 83122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 84155 83367 gene locus_tag LOCUS_15130 84155 83367 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701581.1 protein_id gnl|my_center|LOCUS_15130 84213 85070 gene locus_tag LOCUS_15140 gene paaG 84213 85070 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_15140 86333 85083 gene locus_tag LOCUS_15150 86333 85083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 86968 86330 gene locus_tag LOCUS_15160 86968 86330 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_15160 87884 86985 gene locus_tag LOCUS_15170 87884 86985 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_15170 89476 87917 gene locus_tag LOCUS_15180 89476 87917 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730076.1 protein_id gnl|my_center|LOCUS_15180 91089 89482 gene locus_tag LOCUS_15190 gene fadD3 91089 89482 CDS product 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96843 protein_id gnl|my_center|LOCUS_15190 91234 92916 gene locus_tag LOCUS_15200 91234 92916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 92956 93765 gene locus_tag LOCUS_15210 gene paaG 92956 93765 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228963.1 protein_id gnl|my_center|LOCUS_15210 94571 93762 gene locus_tag LOCUS_15220 94571 93762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 94617 95441 gene locus_tag LOCUS_15230 gene fabG 94617 95441 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_15230 95917 95471 gene locus_tag LOCUS_15240 95917 95471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 96469 95957 gene locus_tag LOCUS_15250 96469 95957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975413.1 protein_id gnl|my_center|LOCUS_15250 97532 96453 gene locus_tag LOCUS_15260 97532 96453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 97581 97793 gene locus_tag LOCUS_15270 97581 97793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 99409 97940 gene locus_tag LOCUS_15280 99409 97940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 99655 100113 gene locus_tag LOCUS_15290 99655 100113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118347.1 protein_id gnl|my_center|LOCUS_15290 101194 100127 gene locus_tag LOCUS_15300 101194 100127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 101965 101240 gene locus_tag LOCUS_15310 101965 101240 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_15310 102149 102346 gene locus_tag LOCUS_15320 102149 102346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 102705 103907 gene locus_tag LOCUS_15330 102705 103907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 104365 103889 gene locus_tag LOCUS_15340 104365 103889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 104464 104913 gene locus_tag LOCUS_15350 104464 104913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703353.1 protein_id gnl|my_center|LOCUS_15350 104913 106115 gene locus_tag LOCUS_15360 104913 106115 CDS product putative lipid-transfer protein Ltp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703354.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence11 <1 543 gene locus_tag LOCUS_15370 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701352.1:putative acetyl-CoA acetyltransferase FadA 1819 620 gene locus_tag LOCUS_15380 1819 620 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_15380 3215 1812 gene locus_tag LOCUS_15390 3215 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930739.1 protein_id gnl|my_center|LOCUS_15390 3332 4369 gene locus_tag LOCUS_15400 3332 4369 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728253.1 protein_id gnl|my_center|LOCUS_15400 4374 6455 gene locus_tag LOCUS_15410 4374 6455 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728243.1 protein_id gnl|my_center|LOCUS_15410 6497 7744 gene locus_tag LOCUS_15420 6497 7744 CDS product lipid metabolism-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205107.1 protein_id gnl|my_center|LOCUS_15420 7741 8151 gene locus_tag LOCUS_15430 7741 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403880.1 protein_id gnl|my_center|LOCUS_15430 8899 8135 gene locus_tag LOCUS_15440 8899 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 10422 9001 gene locus_tag LOCUS_15450 10422 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 10606 12822 gene locus_tag LOCUS_15460 10606 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 12825 15635 gene locus_tag LOCUS_15470 12825 15635 CDS product branched-chain amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225675.1 protein_id gnl|my_center|LOCUS_15470 15645 16838 gene locus_tag LOCUS_15480 15645 16838 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064263.1 protein_id gnl|my_center|LOCUS_15480 18149 16848 gene locus_tag LOCUS_15490 18149 16848 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022607.1 protein_id gnl|my_center|LOCUS_15490 20451 18160 gene locus_tag LOCUS_15500 20451 18160 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_15500 21616 20459 gene locus_tag LOCUS_15510 21616 20459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896388.1 protein_id gnl|my_center|LOCUS_15510 22117 21662 gene locus_tag LOCUS_15520 22117 21662 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225005.1 protein_id gnl|my_center|LOCUS_15520 23215 22139 gene locus_tag LOCUS_15530 23215 22139 CDS product putative 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701355.1 protein_id gnl|my_center|LOCUS_15530 23973 23215 gene locus_tag LOCUS_15540 23973 23215 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_15540 24827 23970 gene locus_tag LOCUS_15550 24827 23970 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_15550 25619 24828 gene locus_tag LOCUS_15560 25619 24828 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897402.1 protein_id gnl|my_center|LOCUS_15560 25710 26465 gene locus_tag LOCUS_15570 25710 26465 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419313.1 protein_id gnl|my_center|LOCUS_15570 26470 27831 gene locus_tag LOCUS_15580 26470 27831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 28636 27875 gene locus_tag LOCUS_15590 gene fabG 28636 27875 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_15590 29817 28633 gene locus_tag LOCUS_15600 29817 28633 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701349.1 protein_id gnl|my_center|LOCUS_15600 30731 29838 gene locus_tag LOCUS_15610 30731 29838 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893604.1 protein_id gnl|my_center|LOCUS_15610 31242 30889 gene locus_tag LOCUS_15620 31242 30889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 31975 31268 gene locus_tag LOCUS_15630 31975 31268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393975.1 protein_id gnl|my_center|LOCUS_15630 32715 31972 gene locus_tag LOCUS_15640 32715 31972 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869390.1 protein_id gnl|my_center|LOCUS_15640 34916 32712 gene locus_tag LOCUS_15650 34916 32712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 36379 34997 gene locus_tag LOCUS_15660 36379 34997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 37315 36569 gene locus_tag LOCUS_15670 37315 36569 CDS product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970024.1 protein_id gnl|my_center|LOCUS_15670 38509 37403 gene locus_tag LOCUS_15680 38509 37403 CDS product putative zinc-dependent alcohol dehydrogenase AdhE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702606.1 protein_id gnl|my_center|LOCUS_15680 40034 38571 gene locus_tag LOCUS_15690 40034 38571 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228971.1 protein_id gnl|my_center|LOCUS_15690 40171 41904 gene locus_tag LOCUS_15700 40171 41904 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_15700 43054 41999 gene locus_tag LOCUS_15710 43054 41999 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224294.1 protein_id gnl|my_center|LOCUS_15710 44259 43072 gene locus_tag LOCUS_15720 44259 43072 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897303.1 protein_id gnl|my_center|LOCUS_15720 44081 44002 gene locus_tag LOCUS_t00310 44081 44002 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 44342 44926 gene locus_tag LOCUS_15730 44342 44926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 44917 45687 gene locus_tag LOCUS_15740 44917 45687 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084226.1 protein_id gnl|my_center|LOCUS_15740 45710 46621 gene locus_tag LOCUS_15750 45710 46621 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728665.1 protein_id gnl|my_center|LOCUS_15750 46665 47468 gene locus_tag LOCUS_15760 46665 47468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 47469 48395 gene locus_tag LOCUS_15770 47469 48395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 48398 49324 gene locus_tag LOCUS_15780 48398 49324 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939109.1 protein_id gnl|my_center|LOCUS_15780 49325 50116 gene locus_tag LOCUS_15790 49325 50116 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228103.1 protein_id gnl|my_center|LOCUS_15790 50969 50163 gene locus_tag LOCUS_15800 50969 50163 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_15800 51322 50966 gene locus_tag LOCUS_15810 51322 50966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 52075 51335 gene locus_tag LOCUS_15820 gene livF 52075 51335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225676.1 protein_id gnl|my_center|LOCUS_15820 52815 52072 gene locus_tag LOCUS_15830 52815 52072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393976.1 protein_id gnl|my_center|LOCUS_15830 55072 52802 gene locus_tag LOCUS_15840 55072 52802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 56856 55267 gene locus_tag LOCUS_15850 56856 55267 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727407.1 protein_id gnl|my_center|LOCUS_15850 57384 56905 gene locus_tag LOCUS_15860 57384 56905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 58560 57448 gene locus_tag LOCUS_15870 58560 57448 CDS product putative phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705205.1 protein_id gnl|my_center|LOCUS_15870 59253 58600 gene locus_tag LOCUS_15880 59253 58600 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702170.1 protein_id gnl|my_center|LOCUS_15880 60571 59261 gene locus_tag LOCUS_15890 60571 59261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 61821 60586 gene locus_tag LOCUS_15900 61821 60586 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730136.1 protein_id gnl|my_center|LOCUS_15900 63069 61927 gene locus_tag LOCUS_15910 63069 61927 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728240.1 protein_id gnl|my_center|LOCUS_15910 64096 63071 gene locus_tag LOCUS_15920 64096 63071 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728239.1 protein_id gnl|my_center|LOCUS_15920 65688 64093 gene locus_tag LOCUS_15930 65688 64093 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730889.1 protein_id gnl|my_center|LOCUS_15930 66761 65751 gene locus_tag LOCUS_15940 66761 65751 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730894.1 protein_id gnl|my_center|LOCUS_15940 67622 66819 gene locus_tag LOCUS_15950 gene ditI 67622 66819 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973229.1 protein_id gnl|my_center|LOCUS_15950 68976 67768 gene locus_tag LOCUS_15960 68976 67768 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_15960 70629 69127 gene locus_tag LOCUS_15970 70629 69127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704555.1 protein_id gnl|my_center|LOCUS_15970 71606 70626 gene locus_tag LOCUS_15980 71606 70626 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225255.1 protein_id gnl|my_center|LOCUS_15980 72880 71603 gene locus_tag LOCUS_15990 72880 71603 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_15990 73089 73625 gene locus_tag LOCUS_16000 73089 73625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 74637 73681 gene locus_tag LOCUS_16010 74637 73681 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268971.1 protein_id gnl|my_center|LOCUS_16010 74713 75330 gene locus_tag LOCUS_16020 74713 75330 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_16020 78242 75450 gene locus_tag LOCUS_16030 gene nrdA 78242 75450 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_16030 78550 78840 gene locus_tag LOCUS_16040 78550 78840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 78955 79698 gene locus_tag LOCUS_16050 78955 79698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_16050 80159 79680 gene locus_tag LOCUS_16060 gene nrdR 80159 79680 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SM09 protein_id gnl|my_center|LOCUS_16060 80652 80254 gene locus_tag LOCUS_16070 80652 80254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence12 311 1366 gene locus_tag LOCUS_16080 311 1366 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_16080 1837 1376 gene locus_tag LOCUS_16090 1837 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 2691 1834 gene locus_tag LOCUS_16100 2691 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3973 2732 gene locus_tag LOCUS_16110 gene menJ 3973 2732 CDS product menaquinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QRI8 protein_id gnl|my_center|LOCUS_16110 4606 4016 gene locus_tag LOCUS_16120 4606 4016 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_16120 4747 4675 gene locus_tag LOCUS_t00320 4747 4675 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5416 4814 gene locus_tag LOCUS_16130 5416 4814 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228374.1 protein_id gnl|my_center|LOCUS_16130 6833 5418 gene locus_tag LOCUS_16140 gene gltX 6833 5418 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86528 protein_id gnl|my_center|LOCUS_16140 6988 7857 gene locus_tag LOCUS_16150 6988 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 8460 7900 gene locus_tag LOCUS_16160 8460 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 10115 8472 gene locus_tag LOCUS_16170 gene cimA 10115 8472 CDS product (R)-citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66682 protein_id gnl|my_center|LOCUS_16170 11022 10105 gene locus_tag LOCUS_16180 gene ilvE 11022 10105 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705670.1 protein_id gnl|my_center|LOCUS_16180 12014 11034 gene locus_tag LOCUS_16190 gene leuB 12014 11034 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94631 protein_id gnl|my_center|LOCUS_16190 12199 12011 gene locus_tag LOCUS_16200 12199 12011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 12265 12729 gene locus_tag LOCUS_16210 gene greA 12265 12729 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG08 protein_id gnl|my_center|LOCUS_16210 12743 13615 gene locus_tag LOCUS_16220 12743 13615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 15257 13686 gene locus_tag LOCUS_16230 gene ppx 15257 13686 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249635.1 protein_id gnl|my_center|LOCUS_16230 15895 15254 gene locus_tag LOCUS_16240 15895 15254 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775885.1 protein_id gnl|my_center|LOCUS_16240 16021 17424 gene locus_tag LOCUS_16250 gene leuC 16021 17424 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUY9 protein_id gnl|my_center|LOCUS_16250 17441 18037 gene locus_tag LOCUS_16260 gene leuD 17441 18037 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDL7 protein_id gnl|my_center|LOCUS_16260 19619 18039 gene locus_tag LOCUS_16270 gene leuA 19619 18039 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG97 protein_id gnl|my_center|LOCUS_16270 21410 19854 gene locus_tag LOCUS_16280 21410 19854 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z564 protein_id gnl|my_center|LOCUS_16280 21972 21481 gene locus_tag LOCUS_16290 21972 21481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 21893 22174 gene locus_tag LOCUS_16300 21893 22174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 22756 22292 gene locus_tag LOCUS_16310 22756 22292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 24802 22775 gene locus_tag LOCUS_16320 24802 22775 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_16320 26015 24810 gene locus_tag LOCUS_16330 26015 24810 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0L5 protein_id gnl|my_center|LOCUS_16330 26144 27268 gene locus_tag LOCUS_16340 gene serC 26144 27268 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2Y1 protein_id gnl|my_center|LOCUS_16340 28237 27281 gene locus_tag LOCUS_16350 28237 27281 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266773.1 protein_id gnl|my_center|LOCUS_16350 29000 28230 gene locus_tag LOCUS_16360 29000 28230 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 protein_id gnl|my_center|LOCUS_16360 30410 29100 gene locus_tag LOCUS_16370 30410 29100 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_16370 30553 30843 gene locus_tag LOCUS_16380 30553 30843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 30845 31237 gene locus_tag LOCUS_16390 gene vapC5 30845 31237 CDS product ribonuclease VapC5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96917 protein_id gnl|my_center|LOCUS_16390 32415 31381 gene locus_tag LOCUS_16400 gene ilvC 32415 31381 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYR6 protein_id gnl|my_center|LOCUS_16400 33011 32523 gene locus_tag LOCUS_16410 gene ilvH 33011 32523 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054813.1 protein_id gnl|my_center|LOCUS_16410 34738 33008 gene locus_tag LOCUS_16420 gene ilvB 34738 33008 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1V7 protein_id gnl|my_center|LOCUS_16420 35709 35335 gene locus_tag LOCUS_16430 35709 35335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 36502 35984 gene locus_tag LOCUS_16440 36502 35984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 38071 36578 gene locus_tag LOCUS_16450 gene gatB 38071 36578 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZH0 protein_id gnl|my_center|LOCUS_16450 39522 38068 gene locus_tag LOCUS_16460 gene gatA 39522 38068 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D7B9 protein_id gnl|my_center|LOCUS_16460 39826 39524 gene locus_tag LOCUS_16470 gene gatC 39826 39524 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYQ1 protein_id gnl|my_center|LOCUS_16470 39911 40327 gene locus_tag LOCUS_16480 39911 40327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 41932 40370 gene locus_tag LOCUS_16490 41932 40370 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_16490 43937 41970 gene locus_tag LOCUS_16500 43937 41970 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028146.1 protein_id gnl|my_center|LOCUS_16500 44051 44530 gene locus_tag LOCUS_16510 44051 44530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 45228 44593 gene locus_tag LOCUS_16520 45228 44593 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083783.1 protein_id gnl|my_center|LOCUS_16520 47300 45225 gene locus_tag LOCUS_16530 gene ligA 47300 45225 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCA1 protein_id gnl|my_center|LOCUS_16530 48197 47340 gene locus_tag LOCUS_16540 48197 47340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546406.1 protein_id gnl|my_center|LOCUS_16540 48503 49402 gene locus_tag LOCUS_16550 48503 49402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 50459 49389 gene locus_tag LOCUS_16560 gene mnmA 50459 49389 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUW3 protein_id gnl|my_center|LOCUS_16560 51592 50459 gene locus_tag LOCUS_16570 51592 50459 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728292.1 protein_id gnl|my_center|LOCUS_16570 51644 52411 gene locus_tag LOCUS_16580 51644 52411 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804409.1 protein_id gnl|my_center|LOCUS_16580 52435 52899 gene locus_tag LOCUS_16590 52435 52899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 53673 52882 gene locus_tag LOCUS_16600 53673 52882 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730271.1 protein_id gnl|my_center|LOCUS_16600 54586 53810 gene locus_tag LOCUS_16610 54586 53810 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_16610 55498 54620 gene locus_tag LOCUS_16620 55498 54620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 56548 55601 gene locus_tag LOCUS_16630 gene argK 56548 55601 CDS product LAO/AO transport system kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223478.1 protein_id gnl|my_center|LOCUS_16630 56856 56590 gene locus_tag LOCUS_16640 56856 56590 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_16640 56933 57118 gene locus_tag LOCUS_16650 56933 57118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 57118 57741 gene locus_tag LOCUS_16660 57118 57741 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976167.1 protein_id gnl|my_center|LOCUS_16660 58007 57849 gene locus_tag LOCUS_16670 58007 57849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 58086 59282 gene locus_tag LOCUS_16680 58086 59282 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031662.1 protein_id gnl|my_center|LOCUS_16680 59859 59296 gene locus_tag LOCUS_16690 59859 59296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 60431 59856 gene locus_tag LOCUS_16700 60431 59856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 60634 61590 gene locus_tag LOCUS_16710 gene glpX 60634 61590 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHU9 protein_id gnl|my_center|LOCUS_16710 61687 62826 gene locus_tag LOCUS_16720 61687 62826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 63804 62836 gene locus_tag LOCUS_16730 63804 62836 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VY35 protein_id gnl|my_center|LOCUS_16730 64656 63811 gene locus_tag LOCUS_16740 64656 63811 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730112.1 protein_id gnl|my_center|LOCUS_16740 65613 64975 gene locus_tag LOCUS_16750 65613 64975 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_16750 66271 65642 gene locus_tag LOCUS_16760 66271 65642 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728249.1 protein_id gnl|my_center|LOCUS_16760 66477 67703 gene locus_tag LOCUS_16770 66477 67703 CDS product putative acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701934.1 protein_id gnl|my_center|LOCUS_16770 67840 69372 gene locus_tag LOCUS_16780 gene fadD 67840 69372 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228959.1 protein_id gnl|my_center|LOCUS_16780 71242 69386 gene locus_tag LOCUS_16790 gene ilvD1 71242 69386 CDS product dihydroxy-acid dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LK8 protein_id gnl|my_center|LOCUS_16790 71416 71341 gene locus_tag LOCUS_t00330 71416 71341 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 72013 71477 gene locus_tag LOCUS_16800 72013 71477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 72718 72212 gene locus_tag LOCUS_16810 gene moaC 72718 72212 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGL3 protein_id gnl|my_center|LOCUS_16810 72656 72820 gene locus_tag LOCUS_16820 72656 72820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 72825 73793 gene locus_tag LOCUS_16830 72825 73793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022102.1 protein_id gnl|my_center|LOCUS_16830 74807 73812 gene locus_tag LOCUS_16840 gene moaA 74807 73812 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJ31 protein_id gnl|my_center|LOCUS_16840 76049 74817 gene locus_tag LOCUS_16850 76049 74817 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence13 1047 193 gene locus_tag LOCUS_16860 1047 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1920 1102 gene locus_tag LOCUS_16870 gene tauD 1920 1102 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530602.1 protein_id gnl|my_center|LOCUS_16870 2009 2812 gene locus_tag LOCUS_16880 gene drb0080 2009 2812 CDS product 3-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035607.1 protein_id gnl|my_center|LOCUS_16880 2818 3765 gene locus_tag LOCUS_16890 2818 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3789 4595 gene locus_tag LOCUS_16900 3789 4595 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705355.1 protein_id gnl|my_center|LOCUS_16900 5575 4610 gene locus_tag LOCUS_16910 5575 4610 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225667.1 protein_id gnl|my_center|LOCUS_16910 6405 5572 gene locus_tag LOCUS_16920 6405 5572 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730868.1 protein_id gnl|my_center|LOCUS_16920 7329 6508 gene locus_tag LOCUS_16930 7329 6508 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_16930 8561 7329 gene locus_tag LOCUS_16940 gene ddhC 8561 7329 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261040.1 protein_id gnl|my_center|LOCUS_16940 9043 8558 gene locus_tag LOCUS_16950 9043 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 9118 9624 gene locus_tag LOCUS_16960 9118 9624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16960 9742 10695 gene locus_tag LOCUS_16970 9742 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16970 11965 10712 gene locus_tag LOCUS_16980 11965 10712 CDS product cytochrome P450 steroid C27-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730960.1 protein_id gnl|my_center|LOCUS_16980 12990 12070 gene locus_tag LOCUS_16990 12990 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728549.1 protein_id gnl|my_center|LOCUS_16990 13142 13501 gene locus_tag LOCUS_17000 13142 13501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 13707 13632 gene locus_tag LOCUS_t00340 13707 13632 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14474 13821 gene locus_tag LOCUS_17010 14474 13821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 15386 14553 gene locus_tag LOCUS_17020 gene tesB 15386 14553 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972544.1 protein_id gnl|my_center|LOCUS_17020 15538 16293 gene locus_tag LOCUS_17030 gene aqpZ 15538 16293 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLV8 protein_id gnl|my_center|LOCUS_17030 17855 16404 gene locus_tag LOCUS_17040 17855 16404 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 protein_id gnl|my_center|LOCUS_17040 19211 17895 gene locus_tag LOCUS_17050 19211 17895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 20853 19297 gene locus_tag LOCUS_17060 20853 19297 CDS product D-glutamate deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090039.1 protein_id gnl|my_center|LOCUS_17060 21708 20908 gene locus_tag LOCUS_17070 21708 20908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 22499 21705 gene locus_tag LOCUS_17080 22499 21705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 23218 22610 gene locus_tag LOCUS_17090 23218 22610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 24566 23271 gene locus_tag LOCUS_17100 24566 23271 CDS product putative PhoH-like protein PhoH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701981.1 protein_id gnl|my_center|LOCUS_17100 25579 24800 gene locus_tag LOCUS_17110 25579 24800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 26133 25576 gene locus_tag LOCUS_17120 26133 25576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 26269 28116 gene locus_tag LOCUS_17130 26269 28116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 28279 29937 gene locus_tag LOCUS_17140 28279 29937 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022987.1 protein_id gnl|my_center|LOCUS_17140 30061 31719 gene locus_tag LOCUS_17150 30061 31719 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021270.1 protein_id gnl|my_center|LOCUS_17150 31759 32466 gene locus_tag LOCUS_17160 gene rnhB 31759 32466 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69989 protein_id gnl|my_center|LOCUS_17160 32502 32927 gene locus_tag LOCUS_17170 32502 32927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 32896 33264 gene locus_tag LOCUS_17180 32896 33264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 33409 34026 gene locus_tag LOCUS_17190 33409 34026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222725.1 protein_id gnl|my_center|LOCUS_17190 34039 35619 gene locus_tag LOCUS_17200 34039 35619 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727778.1 protein_id gnl|my_center|LOCUS_17200 35976 37931 gene locus_tag LOCUS_17210 35976 37931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 37986 41273 gene locus_tag LOCUS_17220 gene dnaE 37986 41273 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX54 protein_id gnl|my_center|LOCUS_17220 41371 41952 gene locus_tag LOCUS_17230 41371 41952 CDS product doxX subfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896605.1 protein_id gnl|my_center|LOCUS_17230 43077 42034 gene locus_tag LOCUS_17240 43077 42034 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_17240 43168 43980 gene locus_tag LOCUS_17250 43168 43980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 44651 43983 gene locus_tag LOCUS_17260 44651 43983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 46695 44989 gene locus_tag LOCUS_17270 46695 44989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 47203 48054 gene locus_tag LOCUS_17280 gene mca 47203 48054 CDS product mycothiol S-conjugate amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DI54 protein_id gnl|my_center|LOCUS_17280 48208 49143 gene locus_tag LOCUS_17290 48208 49143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 49140 50000 gene locus_tag LOCUS_17300 49140 50000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 50883 50011 gene locus_tag LOCUS_17310 50883 50011 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WD3 protein_id gnl|my_center|LOCUS_17310 51545 50880 gene locus_tag LOCUS_17320 51545 50880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 52843 51665 gene locus_tag LOCUS_17330 gene atoB 52843 51665 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225687.1 protein_id gnl|my_center|LOCUS_17330 53153 52899 gene locus_tag LOCUS_17340 53153 52899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 53129 53944 gene locus_tag LOCUS_17350 53129 53944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 53944 54915 gene locus_tag LOCUS_17360 53944 54915 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_17360 55234 54920 gene locus_tag LOCUS_17370 55234 54920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 56232 55237 gene locus_tag LOCUS_17380 gene hmd 56232 55237 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_17380 56450 56620 gene locus_tag LOCUS_17390 56450 56620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 57308 56709 gene locus_tag LOCUS_17400 57308 56709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 58024 57362 gene locus_tag LOCUS_17410 58024 57362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 58918 58061 gene locus_tag LOCUS_17420 58918 58061 CDS product exonuclease RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226741.1 protein_id gnl|my_center|LOCUS_17420 59794 58964 gene locus_tag LOCUS_17430 59794 58964 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532942.1 protein_id gnl|my_center|LOCUS_17430 59824 60303 gene locus_tag LOCUS_17440 59824 60303 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_17440 61219 60317 gene locus_tag LOCUS_17450 61219 60317 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 protein_id gnl|my_center|LOCUS_17450 61385 61708 gene locus_tag LOCUS_17460 61385 61708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 61751 62782 gene locus_tag LOCUS_17470 61751 62782 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224840.1 protein_id gnl|my_center|LOCUS_17470 63757 62786 gene locus_tag LOCUS_17480 63757 62786 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_17480 65003 63729 gene locus_tag LOCUS_17490 gene menJ 65003 63729 CDS product menaquinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QRI8 protein_id gnl|my_center|LOCUS_17490 65325 65014 gene locus_tag LOCUS_17500 65325 65014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 65936 65418 gene locus_tag LOCUS_17510 65936 65418 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973393.1 protein_id gnl|my_center|LOCUS_17510 67053 65929 gene locus_tag LOCUS_17520 67053 65929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223005.1 protein_id gnl|my_center|LOCUS_17520 67081 67560 gene locus_tag LOCUS_17530 67081 67560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 67974 67579 gene locus_tag LOCUS_17540 67974 67579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 68292 69524 gene locus_tag LOCUS_17550 68292 69524 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_17550 69823 69542 gene locus_tag LOCUS_17560 69823 69542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 69842 70000 gene locus_tag LOCUS_17570 69842 70000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 70990 70127 gene locus_tag LOCUS_17580 70990 70127 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893604.1 protein_id gnl|my_center|LOCUS_17580 71307 71062 gene locus_tag LOCUS_17590 71307 71062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 72487 71429 gene locus_tag LOCUS_17600 72487 71429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804530.1 protein_id gnl|my_center|LOCUS_17600 73752 72523 gene locus_tag LOCUS_17610 73752 72523 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_17610 73878 74072 gene locus_tag LOCUS_17620 73878 74072 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730111.1 protein_id gnl|my_center|LOCUS_17620 74116 75348 gene locus_tag LOCUS_17630 74116 75348 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228991.1 protein_id gnl|my_center|LOCUS_17630 75348 75854 gene locus_tag LOCUS_17640 75348 75854 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226727.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence14 <1 1474 gene locus_tag LOCUS_17650 <1 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730132.1:CoA transferase 1513 2676 gene locus_tag LOCUS_17660 1513 2676 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_17660 2676 3458 gene locus_tag LOCUS_17670 2676 3458 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878463.1 protein_id gnl|my_center|LOCUS_17670 3499 5658 gene locus_tag LOCUS_17680 3499 5658 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055904.1 protein_id gnl|my_center|LOCUS_17680 5700 6413 gene locus_tag LOCUS_17690 5700 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671470.1 protein_id gnl|my_center|LOCUS_17690 6410 6907 gene locus_tag LOCUS_17700 6410 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 6916 7509 gene locus_tag LOCUS_17710 6916 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 7546 7854 gene locus_tag LOCUS_17720 7546 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 8358 9017 gene locus_tag LOCUS_17730 8358 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 9689 9027 gene locus_tag LOCUS_17740 9689 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 11769 11392 gene locus_tag LOCUS_17750 11769 11392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 13224 11782 gene locus_tag LOCUS_17760 gene glpK 13224 11782 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749I1 protein_id gnl|my_center|LOCUS_17760 13598 13221 gene locus_tag LOCUS_17770 13598 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 15110 13599 gene locus_tag LOCUS_17780 15110 13599 CDS product alkyldihydroxyacetonephosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_17780 16771 15110 gene locus_tag LOCUS_17790 gene glpA 16771 15110 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D6F1 protein_id gnl|my_center|LOCUS_17790 16931 17167 gene locus_tag LOCUS_17800 16931 17167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 17170 18204 gene locus_tag LOCUS_17810 gene trpD1 17170 18204 CDS product anthranilate phosphoribosyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68608 protein_id gnl|my_center|LOCUS_17810 19903 18176 gene locus_tag LOCUS_17820 gene dnaQ 19903 18176 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_17820 19971 20183 gene locus_tag LOCUS_17830 19971 20183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 20911 20162 gene locus_tag LOCUS_17840 20911 20162 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143495.1 protein_id gnl|my_center|LOCUS_17840 21012 21845 gene locus_tag LOCUS_17850 21012 21845 CDS product short-chain type dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_17850 21842 24109 gene locus_tag LOCUS_17860 21842 24109 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_17860 24106 25380 gene locus_tag LOCUS_17870 24106 25380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 25843 25370 gene locus_tag LOCUS_17880 25843 25370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 28136 25854 gene locus_tag LOCUS_17890 28136 25854 CDS product molybdopterin-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230850.1 protein_id gnl|my_center|LOCUS_17890 28262 28450 gene locus_tag LOCUS_17900 28262 28450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 28476 29525 gene locus_tag LOCUS_17910 28476 29525 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392044.1 protein_id gnl|my_center|LOCUS_17910 29522 30646 gene locus_tag LOCUS_17920 29522 30646 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028156.1 protein_id gnl|my_center|LOCUS_17920 30648 31205 gene locus_tag LOCUS_17930 30648 31205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 31226 31690 gene locus_tag LOCUS_17940 31226 31690 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_17940 31703 31921 gene locus_tag LOCUS_17950 31703 31921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 31982 33100 gene locus_tag LOCUS_17960 31982 33100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 33153 34058 gene locus_tag LOCUS_17970 gene glkA 33153 34058 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4E1 protein_id gnl|my_center|LOCUS_17970 34069 35250 gene locus_tag LOCUS_17980 34069 35250 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN8 protein_id gnl|my_center|LOCUS_17980 35342 36022 gene locus_tag LOCUS_17990 35342 36022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901515.1 protein_id gnl|my_center|LOCUS_17990 37535 36030 gene locus_tag LOCUS_18000 gene glpK 37535 36030 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PBZ5 protein_id gnl|my_center|LOCUS_18000 37473 38801 gene locus_tag LOCUS_18010 37473 38801 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_18010 38977 38825 gene locus_tag LOCUS_18020 38977 38825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 40239 38974 gene locus_tag LOCUS_18030 gene mtrB 40239 38974 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_18030 40270 40458 gene locus_tag LOCUS_18040 40270 40458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 41129 40449 gene locus_tag LOCUS_18050 gene regX 41129 40449 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_18050 41994 41197 gene locus_tag LOCUS_18060 gene suhB 41994 41197 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_18060 42428 41994 gene locus_tag LOCUS_18070 42428 41994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 42412 43152 gene locus_tag LOCUS_18080 42412 43152 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_18080 43156 43641 gene locus_tag LOCUS_18090 43156 43641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 43638 44930 gene locus_tag LOCUS_18100 gene dinB 43638 44930 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAG1 protein_id gnl|my_center|LOCUS_18100 45016 45396 gene locus_tag LOCUS_18110 45016 45396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 45450 46268 gene locus_tag LOCUS_18120 45450 46268 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_18120 46278 46547 gene locus_tag LOCUS_18130 46278 46547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 47401 46553 gene locus_tag LOCUS_18140 47401 46553 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 protein_id gnl|my_center|LOCUS_18140 47438 48100 gene locus_tag LOCUS_18150 47438 48100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 48419 48838 gene locus_tag LOCUS_18160 gene mraZ 48419 48838 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WJN9 protein_id gnl|my_center|LOCUS_18160 49072 50013 gene locus_tag LOCUS_18170 gene rsmH 49072 50013 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK87 protein_id gnl|my_center|LOCUS_18170 50010 50534 gene locus_tag LOCUS_18180 50010 50534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 50978 52831 gene locus_tag LOCUS_18190 gene ftsI 50978 52831 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_18190 52835 54268 gene locus_tag LOCUS_18200 52835 54268 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272490.1 protein_id gnl|my_center|LOCUS_18200 54265 55299 gene locus_tag LOCUS_18210 gene mraY 54265 55299 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56833 protein_id gnl|my_center|LOCUS_18210 55299 56666 gene locus_tag LOCUS_18220 gene murD 55299 56666 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK81 protein_id gnl|my_center|LOCUS_18220 56663 57820 gene locus_tag LOCUS_18230 56663 57820 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_18230 57820 58950 gene locus_tag LOCUS_18240 gene murG 57820 58950 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK79 protein_id gnl|my_center|LOCUS_18240 58934 60343 gene locus_tag LOCUS_18250 gene murC 58934 60343 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61679 protein_id gnl|my_center|LOCUS_18250 60340 61296 gene locus_tag LOCUS_18260 gene murB1 60340 61296 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEQ5 protein_id gnl|my_center|LOCUS_18260 61296 62087 gene locus_tag LOCUS_18270 61296 62087 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392366.1 protein_id gnl|my_center|LOCUS_18270 62169 63239 gene locus_tag LOCUS_18280 gene ftsZ 62169 63239 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45500 protein_id gnl|my_center|LOCUS_18280 63255 63944 gene locus_tag LOCUS_18290 63255 63944 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45497 protein_id gnl|my_center|LOCUS_18290 63941 64618 gene locus_tag LOCUS_18300 gene yggS 63941 64618 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_18300 64722 65306 gene locus_tag LOCUS_18310 64722 65306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 65316 65573 gene locus_tag LOCUS_18320 65316 65573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 65629 66537 gene locus_tag LOCUS_18330 65629 66537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 69711 66634 gene locus_tag LOCUS_18340 gene ileS 69711 66634 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2X5 protein_id gnl|my_center|LOCUS_18340 >Feature sequence15 874 572 gene locus_tag LOCUS_18350 874 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 950 1034 gene locus_tag LOCUS_t00350 950 1034 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1679 1251 gene locus_tag LOCUS_18360 1679 1251 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028879.1 protein_id gnl|my_center|LOCUS_18360 3222 1711 gene locus_tag LOCUS_18370 3222 1711 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727675.1 protein_id gnl|my_center|LOCUS_18370 3773 4945 gene locus_tag LOCUS_18380 gene yeiB 3773 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440933.1 protein_id gnl|my_center|LOCUS_18380 5239 5976 gene locus_tag LOCUS_18390 5239 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 5951 6154 gene locus_tag LOCUS_18400 5951 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 7702 6587 gene locus_tag LOCUS_18410 7702 6587 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170418.1 protein_id gnl|my_center|LOCUS_18410 7847 8632 gene locus_tag LOCUS_18420 7847 8632 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442797.1 protein_id gnl|my_center|LOCUS_18420 8629 9687 gene locus_tag LOCUS_18430 8629 9687 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_18430 11982 9775 gene locus_tag LOCUS_18440 gene fadE22 11982 9775 CDS product acyl-CoA dehydrogenase FadE22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902404.1 protein_id gnl|my_center|LOCUS_18440 12025 12999 gene locus_tag LOCUS_18450 12025 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WM03 protein_id gnl|my_center|LOCUS_18450 13067 14185 gene locus_tag LOCUS_18460 13067 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 15098 14193 gene locus_tag LOCUS_18470 15098 14193 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729146.1 protein_id gnl|my_center|LOCUS_18470 15219 16841 gene locus_tag LOCUS_18480 15219 16841 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459198.1 protein_id gnl|my_center|LOCUS_18480 17394 16855 gene locus_tag LOCUS_18490 17394 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 17421 17867 gene locus_tag LOCUS_18500 17421 17867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 17893 18693 gene locus_tag LOCUS_18510 17893 18693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 18715 19920 gene locus_tag LOCUS_18520 18715 19920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730416.1 protein_id gnl|my_center|LOCUS_18520 19917 21317 gene locus_tag LOCUS_18530 gene eutB 19917 21317 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093232.1 protein_id gnl|my_center|LOCUS_18530 21314 22102 gene locus_tag LOCUS_18540 gene eutC 21314 22102 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FL9 protein_id gnl|my_center|LOCUS_18540 22112 23161 gene locus_tag LOCUS_18550 gene citE 22112 23161 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_18550 23173 24045 gene locus_tag LOCUS_18560 gene citE 23173 24045 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_18560 25685 24063 gene locus_tag LOCUS_18570 gene caiA 25685 24063 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_18570 27397 25712 gene locus_tag LOCUS_18580 27397 25712 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_18580 27476 27991 gene locus_tag LOCUS_18590 27476 27991 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_18590 27995 28876 gene locus_tag LOCUS_18600 27995 28876 CDS product (Fe-S)-cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257325.1 protein_id gnl|my_center|LOCUS_18600 29796 28879 gene locus_tag LOCUS_18610 gene ephC 29796 28879 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 protein_id gnl|my_center|LOCUS_18610 29867 30700 gene locus_tag LOCUS_18620 29867 30700 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_18620 30713 31210 gene locus_tag LOCUS_18630 gene mmyF 30713 31210 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_18630 31214 31735 gene locus_tag LOCUS_18640 31214 31735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40882 protein_id gnl|my_center|LOCUS_18640 32225 31752 gene locus_tag LOCUS_18650 32225 31752 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035740.1 protein_id gnl|my_center|LOCUS_18650 32283 33164 gene locus_tag LOCUS_18660 32283 33164 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223587.1 protein_id gnl|my_center|LOCUS_18660 33205 34218 gene locus_tag LOCUS_18670 33205 34218 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259366.1 protein_id gnl|my_center|LOCUS_18670 34291 36663 gene locus_tag LOCUS_18680 34291 36663 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775775.1 protein_id gnl|my_center|LOCUS_18680 36660 37652 gene locus_tag LOCUS_18690 36660 37652 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775774.1 protein_id gnl|my_center|LOCUS_18690 37721 39124 gene locus_tag LOCUS_18700 37721 39124 CDS product putative FeS assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703482.1 protein_id gnl|my_center|LOCUS_18700 39205 40080 gene locus_tag LOCUS_18710 39205 40080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 40104 40448 gene locus_tag LOCUS_18720 40104 40448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 40551 41723 gene locus_tag LOCUS_18730 40551 41723 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_18730 41720 42034 gene locus_tag LOCUS_18740 41720 42034 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_18740 42036 42827 gene locus_tag LOCUS_18750 gene sufC 42036 42827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113429.1 protein_id gnl|my_center|LOCUS_18750 42824 43120 gene locus_tag LOCUS_18760 42824 43120 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC0 protein_id gnl|my_center|LOCUS_18760 43134 44345 gene locus_tag LOCUS_18770 43134 44345 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089277.1 protein_id gnl|my_center|LOCUS_18770 44843 44370 gene locus_tag LOCUS_18780 44843 44370 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_18780 46134 44887 gene locus_tag LOCUS_18790 46134 44887 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKN9 protein_id gnl|my_center|LOCUS_18790 46874 46125 gene locus_tag LOCUS_18800 gene sufC 46874 46125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929158.1 protein_id gnl|my_center|LOCUS_18800 47552 46947 gene locus_tag LOCUS_18810 47552 46947 CDS product beta-lactamase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703049.1 protein_id gnl|my_center|LOCUS_18810 47579 48568 gene locus_tag LOCUS_18820 47579 48568 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_18820 48696 49811 gene locus_tag LOCUS_18830 gene acd 48696 49811 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_18830 49839 50291 gene locus_tag LOCUS_18840 49839 50291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 50341 50562 gene locus_tag LOCUS_18850 50341 50562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 50563 51348 gene locus_tag LOCUS_18860 50563 51348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 54052 51350 gene locus_tag LOCUS_18870 gene aceE 54052 51350 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0B0 protein_id gnl|my_center|LOCUS_18870 54144 54731 gene locus_tag LOCUS_18880 gene rnhA 54144 54731 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E89 protein_id gnl|my_center|LOCUS_18880 54791 55570 gene locus_tag LOCUS_18890 54791 55570 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726748.1 protein_id gnl|my_center|LOCUS_18890 55652 56170 gene locus_tag LOCUS_18900 gene ruvC 55652 56170 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAF2 protein_id gnl|my_center|LOCUS_18900 56167 56769 gene locus_tag LOCUS_18910 gene ruvA 56167 56769 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A0 protein_id gnl|my_center|LOCUS_18910 56769 57854 gene locus_tag LOCUS_18920 gene ruvB 56769 57854 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183N8 protein_id gnl|my_center|LOCUS_18920 57892 58932 gene locus_tag LOCUS_18930 gene queA 57892 58932 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CLX2 protein_id gnl|my_center|LOCUS_18930 59235 58948 gene locus_tag LOCUS_18940 59235 58948 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK62 protein_id gnl|my_center|LOCUS_18940 59269 60453 gene locus_tag LOCUS_18950 gene tgt 59269 60453 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P1 protein_id gnl|my_center|LOCUS_18950 60548 60853 gene locus_tag LOCUS_18960 60548 60853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 60850 62394 gene locus_tag LOCUS_18970 60850 62394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 62391 63530 gene locus_tag LOCUS_18980 gene secF 62391 63530 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53956 protein_id gnl|my_center|LOCUS_18980 >Feature sequence16 3038 1893 gene locus_tag LOCUS_18990 3038 1893 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_18990 4993 3038 gene locus_tag LOCUS_19000 4993 3038 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_19000 5577 5068 gene locus_tag LOCUS_19010 5577 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 6410 5580 gene locus_tag LOCUS_19020 gene mreC 6410 5580 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CL66 protein_id gnl|my_center|LOCUS_19020 7512 6424 gene locus_tag LOCUS_19030 7512 6424 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_19030 8104 7697 gene locus_tag LOCUS_19040 8104 7697 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_19040 9465 8161 gene locus_tag LOCUS_19050 9465 8161 CDS product dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_19050 10770 9499 gene locus_tag LOCUS_19060 gene clpX 10770 9499 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F316 protein_id gnl|my_center|LOCUS_19060 11464 10799 gene locus_tag LOCUS_19070 gene clpP 11464 10799 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZF9 protein_id gnl|my_center|LOCUS_19070 12837 11461 gene locus_tag LOCUS_19080 gene tig 12837 11461 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DE09 protein_id gnl|my_center|LOCUS_19080 12946 13020 gene locus_tag LOCUS_t00360 12946 13020 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13057 14343 gene locus_tag LOCUS_19090 13057 14343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 14378 14452 gene locus_tag LOCUS_t00370 14378 14452 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14557 16110 gene locus_tag LOCUS_19100 14557 16110 CDS product iron-sulfur cluster-binding protein, RIESKE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700910.1 protein_id gnl|my_center|LOCUS_19100 17082 16132 gene locus_tag LOCUS_19110 17082 16132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 17217 18173 gene locus_tag LOCUS_19120 17217 18173 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726719.1 protein_id gnl|my_center|LOCUS_19120 19705 18188 gene locus_tag LOCUS_19130 19705 18188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 20583 19747 gene locus_tag LOCUS_19140 20583 19747 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090003.1 protein_id gnl|my_center|LOCUS_19140 21631 20585 gene locus_tag LOCUS_19150 21631 20585 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_19150 23123 21726 gene locus_tag LOCUS_19160 23123 21726 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223556.1 protein_id gnl|my_center|LOCUS_19160 23216 23142 gene locus_tag LOCUS_t00380 23216 23142 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 23323 23400 gene locus_tag LOCUS_t00390 23323 23400 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 23529 23604 gene locus_tag LOCUS_t00400 23529 23604 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 24203 23697 gene locus_tag LOCUS_19170 24203 23697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 25295 24327 gene locus_tag LOCUS_19180 25295 24327 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_19180 26090 25296 gene locus_tag LOCUS_19190 26090 25296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 27395 26133 gene locus_tag LOCUS_19200 27395 26133 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224485.1 protein_id gnl|my_center|LOCUS_19200 27497 28144 gene locus_tag LOCUS_19210 27497 28144 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9K4 protein_id gnl|my_center|LOCUS_19210 28179 28631 gene locus_tag LOCUS_19220 28179 28631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 29272 28670 gene locus_tag LOCUS_19230 gene clpP 29272 28670 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43867 protein_id gnl|my_center|LOCUS_19230 30172 29366 gene locus_tag LOCUS_19240 30172 29366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 30765 30169 gene locus_tag LOCUS_19250 gene rdgB 30765 30169 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3D3 protein_id gnl|my_center|LOCUS_19250 31505 30771 gene locus_tag LOCUS_19260 gene rph 31505 30771 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFY8 protein_id gnl|my_center|LOCUS_19260 31939 31502 gene locus_tag LOCUS_19270 31939 31502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 32314 32778 gene locus_tag LOCUS_19280 32314 32778 CDS product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WME3 protein_id gnl|my_center|LOCUS_19280 34704 32800 gene locus_tag LOCUS_19290 34704 32800 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385211.1 protein_id gnl|my_center|LOCUS_19290 35606 34704 gene locus_tag LOCUS_19300 gene cysD 35606 34704 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A881 protein_id gnl|my_center|LOCUS_19300 36514 35717 gene locus_tag LOCUS_19310 gene murI 36514 35717 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HD40 protein_id gnl|my_center|LOCUS_19310 37527 36577 gene locus_tag LOCUS_19320 gene cysK 37527 36577 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_19320 38044 37625 gene locus_tag LOCUS_19330 38044 37625 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229460.1 protein_id gnl|my_center|LOCUS_19330 38110 38631 gene locus_tag LOCUS_19340 38110 38631 CDS product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229261.1 protein_id gnl|my_center|LOCUS_19340 38670 39161 gene locus_tag LOCUS_19350 gene smpB 38670 39161 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QU63 protein_id gnl|my_center|LOCUS_19350 39503 39138 gene locus_tag LOCUS_19360 39503 39138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 39469 39852 gene locus_tag LOCUS_19370 39469 39852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 40298 39849 gene locus_tag LOCUS_19380 40298 39849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 40529 41530 gene locus_tag LOCUS_19390 40529 41530 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230171.1 protein_id gnl|my_center|LOCUS_19390 41634 42018 gene locus_tag LOCUS_tm00010 41634 42018 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 42027 42248 gene locus_tag LOCUS_19400 42027 42248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 42245 43396 gene locus_tag LOCUS_19410 42245 43396 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069707.1 protein_id gnl|my_center|LOCUS_19410 43443 43637 gene locus_tag LOCUS_19420 43443 43637 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085690.1 protein_id gnl|my_center|LOCUS_19420 43640 44851 gene locus_tag LOCUS_19430 43640 44851 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_19430 45287 44883 gene locus_tag LOCUS_19440 45287 44883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 46015 45308 gene locus_tag LOCUS_19450 gene fabG3 46015 45308 CDS product 3-alpha-(or 20-beta)-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69166 protein_id gnl|my_center|LOCUS_19450 46312 46671 gene locus_tag LOCUS_19460 46312 46671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 47627 47202 gene locus_tag LOCUS_19470 47627 47202 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_19470 47701 48060 gene locus_tag LOCUS_19480 47701 48060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 <49095 48183 gene locus_tag LOCUS_19490 <49095 48183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228941.1:amidohydrolase >Feature sequence17 288 653 gene locus_tag LOCUS_19500 288 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 698 1774 gene locus_tag LOCUS_19510 gene ychF 698 1774 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q926X1 protein_id gnl|my_center|LOCUS_19510 1923 2141 gene locus_tag LOCUS_19520 1923 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2150 2977 gene locus_tag LOCUS_19530 gene rsmI 2150 2977 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR7 protein_id gnl|my_center|LOCUS_19530 3860 3024 gene locus_tag LOCUS_19540 3860 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 4945 3911 gene locus_tag LOCUS_19550 4945 3911 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_19550 5829 4942 gene locus_tag LOCUS_19560 5829 4942 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660904.1 protein_id gnl|my_center|LOCUS_19560 6610 5831 gene locus_tag LOCUS_19570 gene crt 6610 5831 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52046 protein_id gnl|my_center|LOCUS_19570 6725 7585 gene locus_tag LOCUS_19580 6725 7585 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090614.1 protein_id gnl|my_center|LOCUS_19580 7590 8342 gene locus_tag LOCUS_19590 7590 8342 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 protein_id gnl|my_center|LOCUS_19590 8339 9355 gene locus_tag LOCUS_19600 8339 9355 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730117.1 protein_id gnl|my_center|LOCUS_19600 10130 9360 gene locus_tag LOCUS_19610 10130 9360 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814011.1 protein_id gnl|my_center|LOCUS_19610 10269 11786 gene locus_tag LOCUS_19620 gene metG 10269 11786 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2I9 protein_id gnl|my_center|LOCUS_19620 11797 12555 gene locus_tag LOCUS_19630 11797 12555 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074503.1 protein_id gnl|my_center|LOCUS_19630 13011 12766 gene locus_tag LOCUS_19640 13011 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 12983 13384 gene locus_tag LOCUS_19650 12983 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 13487 14308 gene locus_tag LOCUS_19660 gene ksgA 13487 14308 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGV9 protein_id gnl|my_center|LOCUS_19660 14313 15053 gene locus_tag LOCUS_19670 gene ispE 14313 15053 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5K7 protein_id gnl|my_center|LOCUS_19670 15472 15400 gene locus_tag LOCUS_t00410 15472 15400 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15534 16631 gene locus_tag LOCUS_19680 15534 16631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 16661 17641 gene locus_tag LOCUS_19690 gene prs 16661 17641 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3U0 protein_id gnl|my_center|LOCUS_19690 17843 18502 gene locus_tag LOCUS_19700 gene rplY 17843 18502 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE7 protein_id gnl|my_center|LOCUS_19700 18703 18398 gene locus_tag LOCUS_19710 18703 18398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 18614 19126 gene locus_tag LOCUS_19720 gene pth 18614 19126 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MKD8 protein_id gnl|my_center|LOCUS_19720 19526 19140 gene locus_tag LOCUS_19730 19526 19140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 21444 19528 gene locus_tag LOCUS_19740 21444 19528 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030882.1 protein_id gnl|my_center|LOCUS_19740 21746 25183 gene locus_tag LOCUS_19750 gene mfd 21746 25183 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R3C5 protein_id gnl|my_center|LOCUS_19750 25213 26286 gene locus_tag LOCUS_19760 25213 26286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 26300 27664 gene locus_tag LOCUS_19770 26300 27664 CDS product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014253.1 protein_id gnl|my_center|LOCUS_19770 27737 29020 gene locus_tag LOCUS_19780 gene eno 27737 29020 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLT8 protein_id gnl|my_center|LOCUS_19780 29023 29472 gene locus_tag LOCUS_19790 29023 29472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 29541 31850 gene locus_tag LOCUS_19800 gene cutL 29541 31850 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_19800 32020 32724 gene locus_tag LOCUS_19810 32020 32724 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891556.1 protein_id gnl|my_center|LOCUS_19810 32770 33681 gene locus_tag LOCUS_19820 32770 33681 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_19820 33682 34848 gene locus_tag LOCUS_19830 33682 34848 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_19830 34845 35159 gene locus_tag LOCUS_19840 34845 35159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 35165 35953 gene locus_tag LOCUS_19850 35165 35953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19850 36819 35992 gene locus_tag LOCUS_19860 gene cutM 36819 35992 CDS product carbon-monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_19860 37289 36816 gene locus_tag LOCUS_19870 gene coxS 37289 36816 CDS product carbon-monoxide dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227068.1 protein_id gnl|my_center|LOCUS_19870 37379 37969 gene locus_tag LOCUS_19880 37379 37969 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_19880 37957 38640 gene locus_tag LOCUS_19890 37957 38640 CDS product carbon monoxide dehydrogenase subunit G family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727165.1 protein_id gnl|my_center|LOCUS_19890 38646 39125 gene locus_tag LOCUS_19900 38646 39125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701909.1 protein_id gnl|my_center|LOCUS_19900 39122 40039 gene locus_tag LOCUS_19910 39122 40039 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_19910 40110 40700 gene locus_tag LOCUS_19920 40110 40700 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068732.1 protein_id gnl|my_center|LOCUS_19920 40697 42028 gene locus_tag LOCUS_19930 40697 42028 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_19930 43008 42046 gene locus_tag LOCUS_19940 43008 42046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 43202 43510 gene locus_tag LOCUS_19950 43202 43510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 44015 43848 gene locus_tag LOCUS_19960 44015 43848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence18 241 165 gene locus_tag LOCUS_t00420 241 165 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 302 1585 gene locus_tag LOCUS_19970 302 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1590 2372 gene locus_tag LOCUS_19980 1590 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2369 3229 gene locus_tag LOCUS_19990 2369 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192157.1 protein_id gnl|my_center|LOCUS_19990 3226 3909 gene locus_tag LOCUS_20000 3226 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 4427 3906 gene locus_tag LOCUS_20010 4427 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 5143 4553 gene locus_tag LOCUS_20020 5143 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 5203 5445 gene locus_tag LOCUS_20030 5203 5445 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879121.1 protein_id gnl|my_center|LOCUS_20030 5442 6206 gene locus_tag LOCUS_20040 5442 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 6288 7505 gene locus_tag LOCUS_20050 gene mshA 6288 7505 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CW71 protein_id gnl|my_center|LOCUS_20050 7509 7976 gene locus_tag LOCUS_20060 7509 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 8217 9008 gene locus_tag LOCUS_20070 gene proC 8217 9008 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QR08 protein_id gnl|my_center|LOCUS_20070 9032 9901 gene locus_tag LOCUS_20080 9032 9901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_20080 10767 9997 gene locus_tag LOCUS_20090 10767 9997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 10865 11557 gene locus_tag LOCUS_20100 gene rex 10865 11557 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WX14 protein_id gnl|my_center|LOCUS_20100 11559 12194 gene locus_tag LOCUS_20110 11559 12194 CDS product precorrin-2 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_20110 12170 13429 gene locus_tag LOCUS_20120 gene hemA 12170 13429 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16618 protein_id gnl|my_center|LOCUS_20120 13437 14375 gene locus_tag LOCUS_20130 gene hemC 13437 14375 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NFA7 protein_id gnl|my_center|LOCUS_20130 14381 15034 gene locus_tag LOCUS_20140 14381 15034 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853622.1 protein_id gnl|my_center|LOCUS_20140 15055 16548 gene locus_tag LOCUS_20150 15055 16548 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918532.1 protein_id gnl|my_center|LOCUS_20150 16561 18510 gene locus_tag LOCUS_20160 16561 18510 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223434.1 protein_id gnl|my_center|LOCUS_20160 18725 18519 gene locus_tag LOCUS_20170 18725 18519 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256480.1 protein_id gnl|my_center|LOCUS_20170 21010 18728 gene locus_tag LOCUS_20180 21010 18728 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_20180 21868 21044 gene locus_tag LOCUS_20190 21868 21044 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L016 protein_id gnl|my_center|LOCUS_20190 22162 23496 gene locus_tag LOCUS_20200 22162 23496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703450.1 protein_id gnl|my_center|LOCUS_20200 23508 24797 gene locus_tag LOCUS_20210 23508 24797 CDS product Mn transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_20210 24852 25220 gene locus_tag LOCUS_20220 24852 25220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 25851 25189 gene locus_tag LOCUS_20230 25851 25189 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919073.1 protein_id gnl|my_center|LOCUS_20230 25918 27480 gene locus_tag LOCUS_20240 25918 27480 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389431.1 protein_id gnl|my_center|LOCUS_20240 27718 29136 gene locus_tag LOCUS_20250 27718 29136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 29323 30714 gene locus_tag LOCUS_20260 29323 30714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 31316 30861 gene locus_tag LOCUS_20270 31316 30861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118072.1 protein_id gnl|my_center|LOCUS_20270 31414 31340 gene locus_tag LOCUS_t00430 31414 31340 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence19 164 697 gene locus_tag LOCUS_20280 164 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 783 1691 gene locus_tag LOCUS_20290 783 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803834.1 protein_id gnl|my_center|LOCUS_20290 2498 1695 gene locus_tag LOCUS_20300 2498 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296133.1 protein_id gnl|my_center|LOCUS_20300 2559 3455 gene locus_tag LOCUS_20310 2559 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 3723 3514 gene locus_tag LOCUS_20320 3723 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 3840 5396 gene locus_tag LOCUS_20330 3840 5396 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_20330 5646 6803 gene locus_tag LOCUS_20340 5646 6803 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897714.1 protein_id gnl|my_center|LOCUS_20340 8785 6809 gene locus_tag LOCUS_20350 8785 6809 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_20350 9501 8818 gene locus_tag LOCUS_20360 gene aat 9501 8818 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJT7 protein_id gnl|my_center|LOCUS_20360 10386 9532 gene locus_tag LOCUS_20370 10386 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 10463 11044 gene locus_tag LOCUS_20380 10463 11044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 11041 11718 gene locus_tag LOCUS_20390 11041 11718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 12417 11734 gene locus_tag LOCUS_20400 12417 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 13348 12503 gene locus_tag LOCUS_20410 13348 12503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 13409 14641 gene locus_tag LOCUS_20420 13409 14641 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI7 protein_id gnl|my_center|LOCUS_20420 14716 15765 gene locus_tag LOCUS_20430 gene asd 14716 15765 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1Z5 protein_id gnl|my_center|LOCUS_20430 15904 15828 gene locus_tag LOCUS_t00440 15904 15828 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16411 15956 gene locus_tag LOCUS_20440 16411 15956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 17509 16433 gene locus_tag LOCUS_20450 17509 16433 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_20450 18477 17506 gene locus_tag LOCUS_20460 18477 17506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 18498 19877 gene locus_tag LOCUS_20470 18498 19877 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_20470 19987 20250 gene locus_tag LOCUS_20480 19987 20250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 20408 20884 gene locus_tag LOCUS_20490 20408 20884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 20877 21725 gene locus_tag LOCUS_20500 20877 21725 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_20500 23045 21744 gene locus_tag LOCUS_20510 23045 21744 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890734.1 protein_id gnl|my_center|LOCUS_20510 24208 23141 gene locus_tag LOCUS_20520 24208 23141 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 protein_id gnl|my_center|LOCUS_20520 24866 24300 gene locus_tag LOCUS_20530 gene orn 24866 24300 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEU2 protein_id gnl|my_center|LOCUS_20530 24865 25347 gene locus_tag LOCUS_20540 gene dut 24865 25347 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2A4 protein_id gnl|my_center|LOCUS_20540 27784 25421 gene locus_tag LOCUS_20550 27784 25421 CDS product magnesium-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028834.1 protein_id gnl|my_center|LOCUS_20550 28239 27808 gene locus_tag LOCUS_20560 28239 27808 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_20560 28721 28254 gene locus_tag LOCUS_20570 28721 28254 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D99 protein_id gnl|my_center|LOCUS_20570 28849 29427 gene locus_tag LOCUS_20580 28849 29427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 29424 30152 gene locus_tag LOCUS_20590 29424 30152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 30455 30757 gene locus_tag LOCUS_20600 30455 30757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence20 390 878 gene locus_tag LOCUS_20610 390 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 959 1942 gene locus_tag LOCUS_20620 959 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2017 2916 gene locus_tag LOCUS_20630 2017 2916 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730141.1 protein_id gnl|my_center|LOCUS_20630 2999 3652 gene locus_tag LOCUS_20640 2999 3652 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109570.1 protein_id gnl|my_center|LOCUS_20640 5029 3653 gene locus_tag LOCUS_20650 5029 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 5134 6288 gene locus_tag LOCUS_20660 5134 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 6340 7158 gene locus_tag LOCUS_20670 6340 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 7155 7421 gene locus_tag LOCUS_20680 7155 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 7467 8390 gene locus_tag LOCUS_20690 7467 8390 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730443.1 protein_id gnl|my_center|LOCUS_20690 8433 9302 gene locus_tag LOCUS_20700 8433 9302 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_20700 10141 9305 gene locus_tag LOCUS_20710 10141 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 11309 10233 gene locus_tag LOCUS_20720 11309 10233 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903765.1 protein_id gnl|my_center|LOCUS_20720 12259 11306 gene locus_tag LOCUS_20730 12259 11306 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729469.1 protein_id gnl|my_center|LOCUS_20730 12329 13321 gene locus_tag LOCUS_20740 12329 13321 CDS product putative luciferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704367.1 protein_id gnl|my_center|LOCUS_20740 13414 14625 gene locus_tag LOCUS_20750 13414 14625 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 protein_id gnl|my_center|LOCUS_20750 14944 15948 gene locus_tag LOCUS_20760 gene gutB 14944 15948 CDS product threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228993.1 protein_id gnl|my_center|LOCUS_20760 15945 16697 gene locus_tag LOCUS_20770 15945 16697 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066671.1 protein_id gnl|my_center|LOCUS_20770 16712 17965 gene locus_tag LOCUS_20780 16712 17965 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_20780 17962 19236 gene locus_tag LOCUS_20790 17962 19236 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272198.1 protein_id gnl|my_center|LOCUS_20790 19509 19249 gene locus_tag LOCUS_20800 19509 19249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 19836 20645 gene locus_tag LOCUS_20810 19836 20645 CDS product putative short-chain type dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R518 protein_id gnl|my_center|LOCUS_20810 21127 20642 gene locus_tag LOCUS_20820 21127 20642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 21402 22088 gene locus_tag LOCUS_20830 21402 22088 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223914.1 protein_id gnl|my_center|LOCUS_20830 22210 22383 gene locus_tag LOCUS_20840 22210 22383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 22470 23546 gene locus_tag LOCUS_20850 22470 23546 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812034.1 protein_id gnl|my_center|LOCUS_20850 23543 24292 gene locus_tag LOCUS_20860 23543 24292 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876244.1 protein_id gnl|my_center|LOCUS_20860 24289 25125 gene locus_tag LOCUS_20870 24289 25125 CDS product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 protein_id gnl|my_center|LOCUS_20870 26427 25126 gene locus_tag LOCUS_20880 26427 25126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 27284 26424 gene locus_tag LOCUS_20890 27284 26424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 28231 27281 gene locus_tag LOCUS_20900 28231 27281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 29669 28224 gene locus_tag LOCUS_20910 29669 28224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 29968 30456 gene locus_tag LOCUS_20920 29968 30456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 30502 30771 gene locus_tag LOCUS_20930 30502 30771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence21 577 359 gene locus_tag LOCUS_20940 577 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 748 1674 gene locus_tag LOCUS_20950 748 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_20950 2049 1690 gene locus_tag LOCUS_20960 2049 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 3061 2174 gene locus_tag LOCUS_20970 3061 2174 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_20970 3109 4230 gene locus_tag LOCUS_20980 3109 4230 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730164.1 protein_id gnl|my_center|LOCUS_20980 5079 4204 gene locus_tag LOCUS_20990 5079 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 5648 5079 gene locus_tag LOCUS_21000 5648 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 5750 6811 gene locus_tag LOCUS_21010 5750 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_21010 6813 7361 gene locus_tag LOCUS_21020 6813 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 7365 8174 gene locus_tag LOCUS_21030 gene hdhA 7365 8174 CDS product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483362.1 protein_id gnl|my_center|LOCUS_21030 8167 8415 gene locus_tag LOCUS_21040 8167 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 9281 8505 gene locus_tag LOCUS_21050 9281 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 9385 9233 gene locus_tag LOCUS_21060 9385 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 9405 9794 gene locus_tag LOCUS_21070 9405 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 10293 10835 gene locus_tag LOCUS_21080 10293 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 11131 11628 gene locus_tag LOCUS_21090 gene ectA 11131 11628 CDS product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230320.1 protein_id gnl|my_center|LOCUS_21090 11863 13188 gene locus_tag LOCUS_21100 gene ectB 11863 13188 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93RW1 protein_id gnl|my_center|LOCUS_21100 13185 13589 gene locus_tag LOCUS_21110 gene ectC 13185 13589 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFQ1 protein_id gnl|my_center|LOCUS_21110 13592 14491 gene locus_tag LOCUS_21120 gene ectD 13592 14491 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230318.1 protein_id gnl|my_center|LOCUS_21120 15464 15739 gene locus_tag LOCUS_21130 15464 15739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 16615 17073 gene locus_tag LOCUS_21140 16615 17073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 >Feature sequence22 <1 3320 gene locus_tag LOCUS_21150 <1 3320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WMQ3:RecBCD enzyme subunit RecB 3317 5149 gene locus_tag LOCUS_21160 gene recD 3317 5149 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFU7 protein_id gnl|my_center|LOCUS_21160 5913 5170 gene locus_tag LOCUS_21170 gene fabG2 5913 5170 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707219.1 protein_id gnl|my_center|LOCUS_21170 6573 5974 gene locus_tag LOCUS_21180 6573 5974 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015571.1 protein_id gnl|my_center|LOCUS_21180 7691 6621 gene locus_tag LOCUS_21190 7691 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705206.1 protein_id gnl|my_center|LOCUS_21190 8406 7738 gene locus_tag LOCUS_21200 8406 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 9260 8445 gene locus_tag LOCUS_21210 9260 8445 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705355.1 protein_id gnl|my_center|LOCUS_21210 9385 9762 gene locus_tag LOCUS_21220 gene mscL 9385 9762 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSH7 protein_id gnl|my_center|LOCUS_21220 10849 9818 gene locus_tag LOCUS_21230 10849 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence23 792 190 gene locus_tag LOCUS_21240 792 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1014 2780 gene locus_tag LOCUS_21250 1014 2780 CDS product acetyl-/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222846.1 protein_id gnl|my_center|LOCUS_21250 3840 2788 gene locus_tag LOCUS_21260 gene dapB 3840 2788 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 protein_id gnl|my_center|LOCUS_21260 4425 3907 gene locus_tag LOCUS_21270 4425 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 5770 4412 gene locus_tag LOCUS_21280 5770 4412 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727859.1 protein_id gnl|my_center|LOCUS_21280 6637 5855 gene locus_tag LOCUS_21290 6637 5855 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932769.1 protein_id gnl|my_center|LOCUS_21290 7347 6634 gene locus_tag LOCUS_21300 7347 6634 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392686.1 protein_id gnl|my_center|LOCUS_21300 7393 9537 gene locus_tag LOCUS_21310 gene mcmA 7393 9537 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_21310 9534 10529 gene locus_tag LOCUS_21320 9534 10529 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence24 257 604 gene locus_tag LOCUS_21330 257 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 627 1445 gene locus_tag LOCUS_21340 627 1445 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_21340 2063 1461 gene locus_tag LOCUS_21350 2063 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 2200 3636 gene locus_tag LOCUS_21360 2200 3636 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_21360 3740 4783 gene locus_tag LOCUS_21370 3740 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 5208 4858 gene locus_tag LOCUS_21380 gene queF 5208 4858 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F719 protein_id gnl|my_center|LOCUS_21380 >Feature sequence25 1100 135 gene locus_tag LOCUS_21390 1100 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 1185 2744 gene locus_tag LOCUS_21400 1185 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225305.1 protein_id gnl|my_center|LOCUS_21400 2882 4309 gene locus_tag LOCUS_21410 2882 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225305.1 protein_id gnl|my_center|LOCUS_21410 4306 5187 gene locus_tag LOCUS_21420 4306 5187 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence26 633 169 gene locus_tag LOCUS_21430 633 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 829 1197 gene locus_tag LOCUS_21440 829 1197 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082958.1 protein_id gnl|my_center|LOCUS_21440 1790 1275 gene locus_tag LOCUS_21450 1790 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1865 2794 gene locus_tag LOCUS_21460 1865 2794 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_21460 3177 2797 gene locus_tag LOCUS_21470 3177 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 4399 3308 gene locus_tag LOCUS_21480 4399 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence27 1402 557 gene locus_tag LOCUS_21490 1402 557 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894238.1 protein_id gnl|my_center|LOCUS_21490 2290 1409 gene locus_tag LOCUS_21500 2290 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence28 620 165 gene locus_tag LOCUS_21510 620 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2310 658 gene locus_tag LOCUS_21520 2310 658 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727728.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence29 859 341 gene locus_tag LOCUS_21530 859 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 1051 1251 gene locus_tag LOCUS_21540 1051 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence30 993 1868 gene locus_tag LOCUS_21550 993 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence31 >Feature sequence32 872 1753 gene locus_tag LOCUS_21560 872 1753 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence33 3 536 gene locus_tag LOCUS_21570 3 536 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089163.1 protein_id gnl|my_center|LOCUS_21570 1777 572 gene locus_tag LOCUS_21580 1777 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence34 36 917 gene locus_tag LOCUS_21590 36 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590