>Feature sequence001 157 1179 gene locus_tag LOCUS_00010 157 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1176 2378 gene locus_tag LOCUS_00020 1176 2378 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIN0 protein_id gnl|my_center|LOCUS_00020 2392 2640 gene locus_tag LOCUS_00030 gene rpmE 2392 2640 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_00030 2701 3654 gene locus_tag LOCUS_00040 2701 3654 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016891.1 protein_id gnl|my_center|LOCUS_00040 3708 4718 gene locus_tag LOCUS_00050 gene prfA 3708 4718 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9V1 protein_id gnl|my_center|LOCUS_00050 4759 5613 gene locus_tag LOCUS_00060 gene prmC 4759 5613 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B2 protein_id gnl|my_center|LOCUS_00060 5715 6470 gene locus_tag LOCUS_00070 5715 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6467 9901 gene locus_tag LOCUS_00080 6467 9901 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0S8 protein_id gnl|my_center|LOCUS_00080 9916 10359 gene locus_tag LOCUS_00090 gene dtd 9916 10359 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RGF0 protein_id gnl|my_center|LOCUS_00090 11128 10370 gene locus_tag LOCUS_00100 gene wbbL 11128 10370 CDS product rhamnosyltransferase WbbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P36667 protein_id gnl|my_center|LOCUS_00100 11320 11724 gene locus_tag LOCUS_00110 11320 11724 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869042.1 protein_id gnl|my_center|LOCUS_00110 11726 12445 gene locus_tag LOCUS_00120 11726 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12450 13532 gene locus_tag LOCUS_00130 12450 13532 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831174.1 protein_id gnl|my_center|LOCUS_00130 13564 14295 gene locus_tag LOCUS_00140 13564 14295 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_00140 14316 14933 gene locus_tag LOCUS_00150 14316 14933 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081157.1 protein_id gnl|my_center|LOCUS_00150 14971 17868 gene locus_tag LOCUS_00160 14971 17868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403195.1 protein_id gnl|my_center|LOCUS_00160 19348 17873 gene locus_tag LOCUS_00170 19348 17873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20055 19336 gene locus_tag LOCUS_00180 20055 19336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20813 20052 gene locus_tag LOCUS_00190 20813 20052 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YE6 protein_id gnl|my_center|LOCUS_00190 21736 20810 gene locus_tag LOCUS_00200 21736 20810 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287494.1 protein_id gnl|my_center|LOCUS_00200 22065 21742 gene locus_tag LOCUS_00210 22065 21742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23255 22068 gene locus_tag LOCUS_00220 23255 22068 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_00220 25254 23248 gene locus_tag LOCUS_00230 gene ligA 25254 23248 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ER9 protein_id gnl|my_center|LOCUS_00230 25700 25251 gene locus_tag LOCUS_00240 25700 25251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26221 25694 gene locus_tag LOCUS_00250 26221 25694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26640 26221 gene locus_tag LOCUS_00260 26640 26221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 27617 26640 gene locus_tag LOCUS_00270 27617 26640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27689 28552 gene locus_tag LOCUS_00280 27689 28552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28632 29702 gene locus_tag LOCUS_00290 gene carA 28632 29702 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFI2 protein_id gnl|my_center|LOCUS_00290 29785 32973 gene locus_tag LOCUS_00300 gene carB 29785 32973 CDS product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_00300 33055 34452 gene locus_tag LOCUS_00310 33055 34452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34456 35019 gene locus_tag LOCUS_00320 34456 35019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36808 35009 gene locus_tag LOCUS_00330 36808 35009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056232.1 protein_id gnl|my_center|LOCUS_00330 37041 37472 gene locus_tag LOCUS_00340 37041 37472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 37547 37735 gene locus_tag LOCUS_00350 37547 37735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38519 37848 gene locus_tag LOCUS_00360 38519 37848 CDS product PqqC-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84616 protein_id gnl|my_center|LOCUS_00360 38625 39917 gene locus_tag LOCUS_00370 38625 39917 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_00370 39966 41831 gene locus_tag LOCUS_00380 39966 41831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_00380 42610 41825 gene locus_tag LOCUS_00390 42610 41825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_00390 45441 42628 gene locus_tag LOCUS_00400 gene gcvP 45441 42628 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DII3 protein_id gnl|my_center|LOCUS_00400 45725 46429 gene locus_tag LOCUS_00410 45725 46429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_00410 46859 48568 gene locus_tag LOCUS_00420 46859 48568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 48617 49768 gene locus_tag LOCUS_00430 gene mmgC 48617 49768 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011186.1 protein_id gnl|my_center|LOCUS_00430 49771 52092 gene locus_tag LOCUS_00440 49771 52092 CDS product 7TM receptor with intracellular metal dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404269.1 protein_id gnl|my_center|LOCUS_00440 52092 52529 gene locus_tag LOCUS_00450 gene ybeY 52092 52529 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDL8 protein_id gnl|my_center|LOCUS_00450 52543 53307 gene locus_tag LOCUS_00460 52543 53307 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880171.1 protein_id gnl|my_center|LOCUS_00460 53750 53331 gene locus_tag LOCUS_00470 53750 53331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_00470 54997 53750 gene locus_tag LOCUS_00480 54997 53750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404588.1 protein_id gnl|my_center|LOCUS_00480 56867 54999 gene locus_tag LOCUS_00490 56867 54999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 60282 56851 gene locus_tag LOCUS_00500 60282 56851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404554.1 protein_id gnl|my_center|LOCUS_00500 60962 60282 gene locus_tag LOCUS_00510 60962 60282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_00510 61098 62903 gene locus_tag LOCUS_00520 61098 62903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 62962 64161 gene locus_tag LOCUS_00530 62962 64161 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_00530 64167 65291 gene locus_tag LOCUS_00540 64167 65291 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933270.1 protein_id gnl|my_center|LOCUS_00540 65288 66784 gene locus_tag LOCUS_00550 gene metG 65288 66784 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AE2 protein_id gnl|my_center|LOCUS_00550 68130 66883 gene locus_tag LOCUS_00560 68130 66883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_00560 68653 68312 gene locus_tag LOCUS_00570 68653 68312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 70694 68751 gene locus_tag LOCUS_00580 70694 68751 CDS product spermidine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706745.1 protein_id gnl|my_center|LOCUS_00580 72029 70773 gene locus_tag LOCUS_00590 gene erg3 72029 70773 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_00590 73703 72033 gene locus_tag LOCUS_00600 73703 72033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 73766 74551 gene locus_tag LOCUS_00610 gene tatD 73766 74551 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_00610 74563 75330 gene locus_tag LOCUS_00620 gene rsmA 74563 75330 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRF4 protein_id gnl|my_center|LOCUS_00620 75422 75664 gene locus_tag LOCUS_00630 75422 75664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 75782 77119 gene locus_tag LOCUS_00640 gene pgm 75782 77119 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405085.1 protein_id gnl|my_center|LOCUS_00640 77177 78076 gene locus_tag LOCUS_00650 77177 78076 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403980.1 protein_id gnl|my_center|LOCUS_00650 78088 79536 gene locus_tag LOCUS_00660 78088 79536 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_00660 79585 80448 gene locus_tag LOCUS_00670 79585 80448 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403982.1 protein_id gnl|my_center|LOCUS_00670 80458 81252 gene locus_tag LOCUS_00680 80458 81252 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UET2 protein_id gnl|my_center|LOCUS_00680 81330 82637 gene locus_tag LOCUS_00690 gene deoA 81330 82637 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7J6 protein_id gnl|my_center|LOCUS_00690 82649 84061 gene locus_tag LOCUS_00700 82649 84061 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGF9 protein_id gnl|my_center|LOCUS_00700 >Feature sequence002 1308 73 gene locus_tag LOCUS_00710 gene kynU 1308 73 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_00710 2312 1305 gene locus_tag LOCUS_00720 2312 1305 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030812.1 protein_id gnl|my_center|LOCUS_00720 2856 2344 gene locus_tag LOCUS_00730 gene nbaC 2856 2344 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_00730 3282 2866 gene locus_tag LOCUS_00740 3282 2866 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_00740 3638 3279 gene locus_tag LOCUS_00750 3638 3279 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181227.1 protein_id gnl|my_center|LOCUS_00750 5100 3658 gene locus_tag LOCUS_00760 5100 3658 CDS product 2-hydroxymuconic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 protein_id gnl|my_center|LOCUS_00760 5972 5100 gene locus_tag LOCUS_00770 gene nadC 5972 5100 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092232.1 protein_id gnl|my_center|LOCUS_00770 6760 5972 gene locus_tag LOCUS_00780 6760 5972 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_00780 7845 6760 gene locus_tag LOCUS_00790 7845 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 8118 7849 gene locus_tag LOCUS_00800 8118 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 8441 11494 gene locus_tag LOCUS_00810 8441 11494 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_00810 11494 12813 gene locus_tag LOCUS_00820 11494 12813 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_00820 13066 14328 gene locus_tag LOCUS_00830 13066 14328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 15106 14354 gene locus_tag LOCUS_00840 15106 14354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 16178 15177 gene locus_tag LOCUS_00850 gene fabH2 16178 15177 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_00850 18509 16194 gene locus_tag LOCUS_00860 18509 16194 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079930.1 protein_id gnl|my_center|LOCUS_00860 19954 18536 gene locus_tag LOCUS_00870 19954 18536 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_00870 20140 21222 gene locus_tag LOCUS_00880 20140 21222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 21226 21831 gene locus_tag LOCUS_00890 21226 21831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 21828 23306 gene locus_tag LOCUS_00900 21828 23306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 23323 24285 gene locus_tag LOCUS_00910 gene fabH 23323 24285 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833199.1 protein_id gnl|my_center|LOCUS_00910 25347 24286 gene locus_tag LOCUS_00920 25347 24286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 27416 25347 gene locus_tag LOCUS_00930 27416 25347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 28479 27421 gene locus_tag LOCUS_00940 28479 27421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 30470 28479 gene locus_tag LOCUS_00950 30470 28479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 31346 30576 gene locus_tag LOCUS_00960 31346 30576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_00960 31641 31333 gene locus_tag LOCUS_00970 31641 31333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 33926 31638 gene locus_tag LOCUS_00980 33926 31638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 34010 34639 gene locus_tag LOCUS_00990 34010 34639 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149282.1 protein_id gnl|my_center|LOCUS_00990 34702 36003 gene locus_tag LOCUS_01000 34702 36003 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898767.1 protein_id gnl|my_center|LOCUS_01000 36086 36550 gene locus_tag LOCUS_01010 36086 36550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_01010 37662 36589 gene locus_tag LOCUS_01020 gene fbaA 37662 36589 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_01020 38868 37678 gene locus_tag LOCUS_01030 gene pfk 38868 37678 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UES2 protein_id gnl|my_center|LOCUS_01030 39015 40958 gene locus_tag LOCUS_01040 gene acs 39015 40958 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372280.1 protein_id gnl|my_center|LOCUS_01040 41953 40964 gene locus_tag LOCUS_01050 gene gap 41953 40964 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17721 protein_id gnl|my_center|LOCUS_01050 42969 41950 gene locus_tag LOCUS_01060 gene gapA 42969 41950 CDS product glyceraldehyde-3-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P09124 protein_id gnl|my_center|LOCUS_01060 43407 43066 gene locus_tag LOCUS_01070 43407 43066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 43787 43509 gene locus_tag LOCUS_01080 43787 43509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 44529 43789 gene locus_tag LOCUS_01090 44529 43789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946551.1 protein_id gnl|my_center|LOCUS_01090 45975 44800 gene locus_tag LOCUS_01100 45975 44800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 47002 45977 gene locus_tag LOCUS_01110 47002 45977 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392828.1 protein_id gnl|my_center|LOCUS_01110 47792 46974 gene locus_tag LOCUS_01120 47792 46974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582849.1 protein_id gnl|my_center|LOCUS_01120 48452 47802 gene locus_tag LOCUS_01130 48452 47802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 49587 48469 gene locus_tag LOCUS_01140 49587 48469 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_01140 50479 49679 gene locus_tag LOCUS_01150 50479 49679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 54437 50532 gene locus_tag LOCUS_01160 54437 50532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 55017 54430 gene locus_tag LOCUS_01170 55017 54430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 56404 54995 gene locus_tag LOCUS_01180 56404 54995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 57134 56625 gene locus_tag LOCUS_01190 57134 56625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 57688 57164 gene locus_tag LOCUS_01200 57688 57164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 58359 57691 gene locus_tag LOCUS_01210 58359 57691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 58852 58412 gene locus_tag LOCUS_01220 58852 58412 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 protein_id gnl|my_center|LOCUS_01220 59920 58886 gene locus_tag LOCUS_01230 59920 58886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 60904 59951 gene locus_tag LOCUS_01240 60904 59951 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209638.1 protein_id gnl|my_center|LOCUS_01240 60923 61222 gene locus_tag LOCUS_01250 60923 61222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 62459 61305 gene locus_tag LOCUS_01260 62459 61305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 64849 62462 gene locus_tag LOCUS_01270 64849 62462 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_01270 65042 64827 gene locus_tag LOCUS_01280 65042 64827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01280 65342 65136 gene locus_tag LOCUS_01290 65342 65136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01290 66285 65362 gene locus_tag LOCUS_01300 66285 65362 CDS product NAD-dependent nucleoside diphosphate-sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_01300 66969 66487 gene locus_tag LOCUS_01310 66969 66487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 68364 67012 gene locus_tag LOCUS_01320 68364 67012 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023958.1 protein_id gnl|my_center|LOCUS_01320 69272 68391 gene locus_tag LOCUS_01330 69272 68391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 <70118 69312 gene locus_tag LOCUS_01340 <70118 69312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877378.1:cryptochrome/photolyase family protein >Feature sequence003 2517 766 gene locus_tag LOCUS_01350 gene dnaG 2517 766 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33655 protein_id gnl|my_center|LOCUS_01350 3044 2517 gene locus_tag LOCUS_01360 3044 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 3500 3045 gene locus_tag LOCUS_01370 gene yqeY 3500 3045 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943713.1 protein_id gnl|my_center|LOCUS_01370 4317 3490 gene locus_tag LOCUS_01380 4317 3490 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EMC0 protein_id gnl|my_center|LOCUS_01380 4966 4337 gene locus_tag LOCUS_01390 4966 4337 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_01390 5045 5476 gene locus_tag LOCUS_01400 5045 5476 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 protein_id gnl|my_center|LOCUS_01400 5624 7600 gene locus_tag LOCUS_01410 5624 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 7597 8475 gene locus_tag LOCUS_01420 7597 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 9217 8498 gene locus_tag LOCUS_01430 9217 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 9320 9135 gene locus_tag LOCUS_01440 9320 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 9357 11594 gene locus_tag LOCUS_01450 9357 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 11594 12250 gene locus_tag LOCUS_01460 11594 12250 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_01460 12247 12630 gene locus_tag LOCUS_01470 gene cdd 12247 12630 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19079 protein_id gnl|my_center|LOCUS_01470 12646 13209 gene locus_tag LOCUS_01480 gene tdk 12646 13209 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZH4 protein_id gnl|my_center|LOCUS_01480 13209 14432 gene locus_tag LOCUS_01490 13209 14432 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZD9 protein_id gnl|my_center|LOCUS_01490 14449 15009 gene locus_tag LOCUS_01500 gene adk 14449 15009 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFD4 protein_id gnl|my_center|LOCUS_01500 15011 15607 gene locus_tag LOCUS_01510 gene coaE 15011 15607 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58897 protein_id gnl|my_center|LOCUS_01510 16150 15647 gene locus_tag LOCUS_01520 16150 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 16955 16152 gene locus_tag LOCUS_01530 16955 16152 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108474.1 protein_id gnl|my_center|LOCUS_01530 17987 16977 gene locus_tag LOCUS_01540 17987 16977 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z22 protein_id gnl|my_center|LOCUS_01540 19353 17989 gene locus_tag LOCUS_01550 19353 17989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_01550 19460 20320 gene locus_tag LOCUS_01560 gene htrB 19460 20320 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069787.1 protein_id gnl|my_center|LOCUS_01560 20342 20899 gene locus_tag LOCUS_01570 20342 20899 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880387.1 protein_id gnl|my_center|LOCUS_01570 20896 21603 gene locus_tag LOCUS_01580 20896 21603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 22765 21596 gene locus_tag LOCUS_01590 22765 21596 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI08 protein_id gnl|my_center|LOCUS_01590 23957 22812 gene locus_tag LOCUS_01600 gene dxr 23957 22812 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185R8 protein_id gnl|my_center|LOCUS_01600 24646 23957 gene locus_tag LOCUS_01610 24646 23957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 25087 24653 gene locus_tag LOCUS_01620 25087 24653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 25892 25428 gene locus_tag LOCUS_01630 gene fabZ 25892 25428 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61453 protein_id gnl|my_center|LOCUS_01630 26841 25885 gene locus_tag LOCUS_01640 26841 25885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01640 27857 26859 gene locus_tag LOCUS_01650 gene lpxD 27857 26859 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT5 protein_id gnl|my_center|LOCUS_01650 28397 27870 gene locus_tag LOCUS_01660 28397 27870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 30817 28415 gene locus_tag LOCUS_01670 30817 28415 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931958.1 protein_id gnl|my_center|LOCUS_01670 31569 30820 gene locus_tag LOCUS_01680 gene uppS 31569 30820 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4K8 protein_id gnl|my_center|LOCUS_01680 32801 31653 gene locus_tag LOCUS_01690 32801 31653 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGX2 protein_id gnl|my_center|LOCUS_01690 33146 32841 gene locus_tag LOCUS_01700 33146 32841 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_01700 33297 34703 gene locus_tag LOCUS_01710 gene glpK 33297 34703 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CG64 protein_id gnl|my_center|LOCUS_01710 36078 34729 gene locus_tag LOCUS_01720 gene pepC 36078 34729 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69192 protein_id gnl|my_center|LOCUS_01720 36603 36103 gene locus_tag LOCUS_01730 36603 36103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 37318 36611 gene locus_tag LOCUS_01740 37318 36611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 38264 37311 gene locus_tag LOCUS_01750 38264 37311 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_01750 38802 38383 gene locus_tag LOCUS_01760 38802 38383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 40061 38856 gene locus_tag LOCUS_01770 gene lipA 40061 38856 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517080.1 protein_id gnl|my_center|LOCUS_01770 40909 40058 gene locus_tag LOCUS_01780 40909 40058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 43226 40989 gene locus_tag LOCUS_01790 gene priA 43226 40989 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4T9 protein_id gnl|my_center|LOCUS_01790 43771 43328 gene locus_tag LOCUS_01800 gene rplI 43771 43328 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM4 protein_id gnl|my_center|LOCUS_01800 44013 43786 gene locus_tag LOCUS_01810 gene rpsR 44013 43786 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21475 protein_id gnl|my_center|LOCUS_01810 >Feature sequence004 1441 734 gene locus_tag LOCUS_01820 1441 734 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404765.1 protein_id gnl|my_center|LOCUS_01820 1879 1550 gene locus_tag LOCUS_01830 1879 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 2390 2055 gene locus_tag LOCUS_01840 2390 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 2960 2403 gene locus_tag LOCUS_01850 2960 2403 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_01850 3827 2973 gene locus_tag LOCUS_01860 gene yfhH 3827 2973 CDS product steroid 5-alpha reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905448.1 protein_id gnl|my_center|LOCUS_01860 4565 3837 gene locus_tag LOCUS_01870 4565 3837 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_01870 5662 4625 gene locus_tag LOCUS_01880 5662 4625 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942955.1 protein_id gnl|my_center|LOCUS_01880 6933 5665 gene locus_tag LOCUS_01890 gene cfa 6933 5665 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103434.1 protein_id gnl|my_center|LOCUS_01890 7710 6934 gene locus_tag LOCUS_01900 7710 6934 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 protein_id gnl|my_center|LOCUS_01900 8951 7707 gene locus_tag LOCUS_01910 8951 7707 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263589.1 protein_id gnl|my_center|LOCUS_01910 9490 8960 gene locus_tag LOCUS_01920 gene blc 9490 8960 CDS product outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639462.2 protein_id gnl|my_center|LOCUS_01920 10171 9500 gene locus_tag LOCUS_01930 10171 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 10536 10168 gene locus_tag LOCUS_01940 10536 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 11565 10837 gene locus_tag LOCUS_01950 11565 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 12401 11562 gene locus_tag LOCUS_01960 12401 11562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 13260 12394 gene locus_tag LOCUS_01970 13260 12394 CDS product bacitracin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860754.1 protein_id gnl|my_center|LOCUS_01970 13891 13301 gene locus_tag LOCUS_01980 13891 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 13953 14540 gene locus_tag LOCUS_01990 13953 14540 CDS product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_01990 14537 15250 gene locus_tag LOCUS_02000 14537 15250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014109.1 protein_id gnl|my_center|LOCUS_02000 15356 15282 gene locus_tag LOCUS_t00010 15356 15282 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 17791 15401 gene locus_tag LOCUS_02010 gene lon 17791 15401 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKD3 protein_id gnl|my_center|LOCUS_02010 18542 17904 gene locus_tag LOCUS_02020 18542 17904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 19408 18539 gene locus_tag LOCUS_02030 19408 18539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 20228 19401 gene locus_tag LOCUS_02040 20228 19401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 21550 20228 gene locus_tag LOCUS_02050 21550 20228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 23554 21551 gene locus_tag LOCUS_02060 23554 21551 CDS product tungsten formylmethanofuran dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403352.1 protein_id gnl|my_center|LOCUS_02060 24198 23554 gene locus_tag LOCUS_02070 gene lipB 24198 23554 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND22 protein_id gnl|my_center|LOCUS_02070 25620 24235 gene locus_tag LOCUS_02080 gene lpdA2 25620 24235 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_02080 26183 25620 gene locus_tag LOCUS_02090 gene folE 26183 25620 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SH52 protein_id gnl|my_center|LOCUS_02090 26844 26185 gene locus_tag LOCUS_02100 26844 26185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_02100 27257 26844 gene locus_tag LOCUS_02110 27257 26844 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_02110 27704 27360 gene locus_tag LOCUS_02120 27704 27360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 28072 27707 gene locus_tag LOCUS_02130 28072 27707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 28913 28065 gene locus_tag LOCUS_02140 28913 28065 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403958.1 protein_id gnl|my_center|LOCUS_02140 29887 28910 gene locus_tag LOCUS_02150 29887 28910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 30558 29905 gene locus_tag LOCUS_02160 30558 29905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 32423 30654 gene locus_tag LOCUS_02170 32423 30654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 34139 32499 gene locus_tag LOCUS_02180 34139 32499 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_02180 36300 34141 gene locus_tag LOCUS_02190 36300 34141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 37661 36387 gene locus_tag LOCUS_02200 gene gltA 37661 36387 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_02200 38382 37705 gene locus_tag LOCUS_02210 38382 37705 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023286.1 protein_id gnl|my_center|LOCUS_02210 39477 38383 gene locus_tag LOCUS_02220 39477 38383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 40544 39495 gene locus_tag LOCUS_02230 40544 39495 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074271.1 protein_id gnl|my_center|LOCUS_02230 41640 40537 gene locus_tag LOCUS_02240 41640 40537 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583980.1 protein_id gnl|my_center|LOCUS_02240 <42409 41655 gene locus_tag LOCUS_02250 <42409 41655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817136.1:phosphonopyruvate decarboxylase >Feature sequence005 217 789 gene locus_tag LOCUS_02260 gene maf 217 789 CDS product septum formation protein Maf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q02169 protein_id gnl|my_center|LOCUS_02260 786 1205 gene locus_tag LOCUS_02270 786 1205 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957569.1 protein_id gnl|my_center|LOCUS_02270 1261 2091 gene locus_tag LOCUS_02280 1261 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 2247 2711 gene locus_tag LOCUS_02290 gene mraZ 2247 2711 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S536 protein_id gnl|my_center|LOCUS_02290 2711 3604 gene locus_tag LOCUS_02300 gene rsmH 2711 3604 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZX6 protein_id gnl|my_center|LOCUS_02300 3607 3930 gene locus_tag LOCUS_02310 3607 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 3927 5909 gene locus_tag LOCUS_02320 gene ftsI 3927 5909 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_02320 5906 7354 gene locus_tag LOCUS_02330 gene murE 5906 7354 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819Q0 protein_id gnl|my_center|LOCUS_02330 7351 8691 gene locus_tag LOCUS_02340 gene murF 7351 8691 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA1 protein_id gnl|my_center|LOCUS_02340 8691 9794 gene locus_tag LOCUS_02350 gene mraY 8691 9794 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFT8 protein_id gnl|my_center|LOCUS_02350 9791 11176 gene locus_tag LOCUS_02360 gene murD 9791 11176 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S530 protein_id gnl|my_center|LOCUS_02360 11169 12323 gene locus_tag LOCUS_02370 gene ftsW 11169 12323 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_02370 12316 13422 gene locus_tag LOCUS_02380 gene murG 12316 13422 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_02380 13473 14816 gene locus_tag LOCUS_02390 gene murC 13473 14816 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S527 protein_id gnl|my_center|LOCUS_02390 14813 15727 gene locus_tag LOCUS_02400 gene murB 14813 15727 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7A3 protein_id gnl|my_center|LOCUS_02400 15729 16496 gene locus_tag LOCUS_02410 15729 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 16493 17770 gene locus_tag LOCUS_02420 gene ftsA 16493 17770 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_02420 17798 19009 gene locus_tag LOCUS_02430 17798 19009 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_02430 19348 19112 gene locus_tag LOCUS_02440 gene rpmB 19348 19112 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY93 protein_id gnl|my_center|LOCUS_02440 19457 20437 gene locus_tag LOCUS_02450 gene dusB 19457 20437 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F5 protein_id gnl|my_center|LOCUS_02450 20591 22213 gene locus_tag LOCUS_02460 gene pruA 20591 22213 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_02460 22276 23202 gene locus_tag LOCUS_02470 22276 23202 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_02470 23205 24392 gene locus_tag LOCUS_02480 gene sucC 23205 24392 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3H9 protein_id gnl|my_center|LOCUS_02480 24394 25272 gene locus_tag LOCUS_02490 gene sucD 24394 25272 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPH4 protein_id gnl|my_center|LOCUS_02490 25328 25753 gene locus_tag LOCUS_02500 gene ndk 25328 25753 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3M6 protein_id gnl|my_center|LOCUS_02500 25798 26607 gene locus_tag LOCUS_02510 25798 26607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 26597 27739 gene locus_tag LOCUS_02520 26597 27739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 27830 28336 gene locus_tag LOCUS_02530 27830 28336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583304.1 protein_id gnl|my_center|LOCUS_02530 28346 28522 gene locus_tag LOCUS_02540 gene rpmF 28346 28522 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYQ4 protein_id gnl|my_center|LOCUS_02540 28536 29543 gene locus_tag LOCUS_02550 28536 29543 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_02550 29533 30510 gene locus_tag LOCUS_02560 gene fabH 29533 30510 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAP2 protein_id gnl|my_center|LOCUS_02560 30520 31440 gene locus_tag LOCUS_02570 30520 31440 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M6 protein_id gnl|my_center|LOCUS_02570 31433 32179 gene locus_tag LOCUS_02580 31433 32179 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_02580 32193 32423 gene locus_tag LOCUS_02590 gene acpP 32193 32423 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXX4 protein_id gnl|my_center|LOCUS_02590 32432 33673 gene locus_tag LOCUS_02600 32432 33673 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_02600 33670 34395 gene locus_tag LOCUS_02610 gene rnc 33670 34395 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXX3 protein_id gnl|my_center|LOCUS_02610 34940 34392 gene locus_tag LOCUS_02620 34940 34392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_02620 35976 34927 gene locus_tag LOCUS_02630 35976 34927 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_02630 36935 35976 gene locus_tag LOCUS_02640 36935 35976 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_02640 38305 36935 gene locus_tag LOCUS_02650 38305 36935 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869220.1 protein_id gnl|my_center|LOCUS_02650 >Feature sequence006 154 1431 gene locus_tag LOCUS_02660 154 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 1534 1860 gene locus_tag LOCUS_02670 gene trxA 1534 1860 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747I5 protein_id gnl|my_center|LOCUS_02670 1883 2812 gene locus_tag LOCUS_02680 gene trxB 1883 2812 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE48 protein_id gnl|my_center|LOCUS_02680 2858 3622 gene locus_tag LOCUS_02690 2858 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 3698 4669 gene locus_tag LOCUS_02700 gene rfaE 3698 4669 CDS product RfaE bifunctional protein, domain I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_02700 4683 6311 gene locus_tag LOCUS_02710 4683 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 6293 7570 gene locus_tag LOCUS_02720 6293 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 7567 8364 gene locus_tag LOCUS_02730 7567 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702890.1 protein_id gnl|my_center|LOCUS_02730 8448 9473 gene locus_tag LOCUS_02740 8448 9473 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404386.1 protein_id gnl|my_center|LOCUS_02740 9480 10280 gene locus_tag LOCUS_02750 9480 10280 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766925.1 protein_id gnl|my_center|LOCUS_02750 10267 10743 gene locus_tag LOCUS_02760 10267 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 10743 12491 gene locus_tag LOCUS_02770 10743 12491 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583753.1 protein_id gnl|my_center|LOCUS_02770 12502 13731 gene locus_tag LOCUS_02780 gene rodA 12502 13731 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931982.1 protein_id gnl|my_center|LOCUS_02780 13804 14625 gene locus_tag LOCUS_02790 13804 14625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 14647 15477 gene locus_tag LOCUS_02800 14647 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 15500 16729 gene locus_tag LOCUS_02810 15500 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 16713 17975 gene locus_tag LOCUS_02820 16713 17975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 17978 19255 gene locus_tag LOCUS_02830 17978 19255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 19260 20549 gene locus_tag LOCUS_02840 gene glyA 19260 20549 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC36 protein_id gnl|my_center|LOCUS_02840 20519 21403 gene locus_tag LOCUS_02850 20519 21403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 21364 22374 gene locus_tag LOCUS_02860 21364 22374 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 protein_id gnl|my_center|LOCUS_02860 22384 24198 gene locus_tag LOCUS_02870 22384 24198 CDS product TRAP transporter subunit DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682335.1 protein_id gnl|my_center|LOCUS_02870 24348 25694 gene locus_tag LOCUS_02880 24348 25694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 25705 28476 gene locus_tag LOCUS_02890 25705 28476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 28476 31418 gene locus_tag LOCUS_02900 28476 31418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 31393 32307 gene locus_tag LOCUS_02910 31393 32307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 32315 33082 gene locus_tag LOCUS_02920 32315 33082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 33079 33657 gene locus_tag LOCUS_02930 gene nadD 33079 33657 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ5 protein_id gnl|my_center|LOCUS_02930 34603 33662 gene locus_tag LOCUS_02940 gene yrbG 34603 33662 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_02940 34789 35442 gene locus_tag LOCUS_02950 34789 35442 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564191.1 protein_id gnl|my_center|LOCUS_02950 35442 36314 gene locus_tag LOCUS_02960 gene ftsX 35442 36314 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7B4 protein_id gnl|my_center|LOCUS_02960 >Feature sequence007 1811 1197 gene locus_tag LOCUS_02970 gene pdxT 1811 1197 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYU3 protein_id gnl|my_center|LOCUS_02970 2686 1805 gene locus_tag LOCUS_02980 gene pdxS 2686 1805 CDS product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMJ0 protein_id gnl|my_center|LOCUS_02980 3542 2679 gene locus_tag LOCUS_02990 gene ispH 3542 2679 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749Y8 protein_id gnl|my_center|LOCUS_02990 4564 3539 gene locus_tag LOCUS_03000 4564 3539 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_03000 5108 4566 gene locus_tag LOCUS_03010 5108 4566 CDS product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_03010 6535 5108 gene locus_tag LOCUS_03020 6535 5108 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937338.1 protein_id gnl|my_center|LOCUS_03020 6585 6830 gene locus_tag LOCUS_03030 6585 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 7815 6820 gene locus_tag LOCUS_03040 7815 6820 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_03040 9103 7871 gene locus_tag LOCUS_03050 gene nqrF 9103 7871 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_03050 9732 9100 gene locus_tag LOCUS_03060 gene nqrE 9732 9100 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS1 protein_id gnl|my_center|LOCUS_03060 10367 9741 gene locus_tag LOCUS_03070 gene nqrD 10367 9741 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6X3 protein_id gnl|my_center|LOCUS_03070 11068 10373 gene locus_tag LOCUS_03080 gene nqrC 11068 10373 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CG54 protein_id gnl|my_center|LOCUS_03080 12242 11058 gene locus_tag LOCUS_03090 gene nqrB 12242 11058 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_03090 13577 12249 gene locus_tag LOCUS_03100 gene nqrA 13577 12249 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA6 protein_id gnl|my_center|LOCUS_03100 15094 13604 gene locus_tag LOCUS_03110 gene ndhB 15094 13604 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB3 protein_id gnl|my_center|LOCUS_03110 16648 15104 gene locus_tag LOCUS_03120 gene ndhD 16648 15104 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_03120 18721 16673 gene locus_tag LOCUS_03130 gene ndhF 18721 16673 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932456.1 protein_id gnl|my_center|LOCUS_03130 19026 18721 gene locus_tag LOCUS_03140 gene nuoK 19026 18721 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB6 protein_id gnl|my_center|LOCUS_03140 19514 19026 gene locus_tag LOCUS_03150 gene ndhG 19514 19026 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_03150 20107 19523 gene locus_tag LOCUS_03160 gene ndhI 20107 19523 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932453.1 protein_id gnl|my_center|LOCUS_03160 21185 20112 gene locus_tag LOCUS_03170 gene nuoH 21185 20112 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB9 protein_id gnl|my_center|LOCUS_03170 22303 21182 gene locus_tag LOCUS_03180 gene nuoD 22303 21182 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC0 protein_id gnl|my_center|LOCUS_03180 23211 22294 gene locus_tag LOCUS_03190 23211 22294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 23702 23208 gene locus_tag LOCUS_03200 gene nuoB 23702 23208 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC2 protein_id gnl|my_center|LOCUS_03200 24119 23703 gene locus_tag LOCUS_03210 24119 23703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 24260 25162 gene locus_tag LOCUS_03220 gene fadM 24260 25162 CDS product proline dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32179 protein_id gnl|my_center|LOCUS_03220 26168 25287 gene locus_tag LOCUS_03230 gene nadK 26168 25287 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I303 protein_id gnl|my_center|LOCUS_03230 26401 26165 gene locus_tag LOCUS_03240 gene xseB 26401 26165 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTL1 protein_id gnl|my_center|LOCUS_03240 27629 26412 gene locus_tag LOCUS_03250 27629 26412 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_03250 28081 27782 gene locus_tag LOCUS_03260 28081 27782 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404129.1 protein_id gnl|my_center|LOCUS_03260 29722 28118 gene locus_tag LOCUS_03270 29722 28118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 30245 29784 gene locus_tag LOCUS_03280 gene tagD1 30245 29784 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_03280 30995 30291 gene locus_tag LOCUS_03290 30995 30291 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Z9 protein_id gnl|my_center|LOCUS_03290 32264 30996 gene locus_tag LOCUS_03300 gene serS 32264 30996 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37464 protein_id gnl|my_center|LOCUS_03300 32530 34110 gene locus_tag LOCUS_03310 32530 34110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 34112 35308 gene locus_tag LOCUS_03320 34112 35308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880293.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence008 2527 623 gene locus_tag LOCUS_03330 2527 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03330 3799 2612 gene locus_tag LOCUS_03340 gene kbl 3799 2612 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC15 protein_id gnl|my_center|LOCUS_03340 4882 3857 gene locus_tag LOCUS_03350 gene tdh 4882 3857 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQV6 protein_id gnl|my_center|LOCUS_03350 5100 5864 gene locus_tag LOCUS_03360 5100 5864 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933511.1 protein_id gnl|my_center|LOCUS_03360 5854 6726 gene locus_tag LOCUS_03370 5854 6726 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_03370 6733 7521 gene locus_tag LOCUS_03380 6733 7521 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545938.1 protein_id gnl|my_center|LOCUS_03380 7514 7852 gene locus_tag LOCUS_03390 7514 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 7867 8136 gene locus_tag LOCUS_03400 7867 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 8136 8483 gene locus_tag LOCUS_03410 8136 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 8513 9442 gene locus_tag LOCUS_03420 gene atpB 8513 9442 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2I8 protein_id gnl|my_center|LOCUS_03420 9464 9679 gene locus_tag LOCUS_03430 9464 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 9700 10275 gene locus_tag LOCUS_03440 9700 10275 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462233.1 protein_id gnl|my_center|LOCUS_03440 10265 10804 gene locus_tag LOCUS_03450 gene atpH 10265 10804 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03A21 protein_id gnl|my_center|LOCUS_03450 10819 12342 gene locus_tag LOCUS_03460 10819 12342 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_03460 12348 13196 gene locus_tag LOCUS_03470 gene atpG 12348 13196 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW9 protein_id gnl|my_center|LOCUS_03470 13222 14619 gene locus_tag LOCUS_03480 gene atpD 13222 14619 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY0 protein_id gnl|my_center|LOCUS_03480 14626 15024 gene locus_tag LOCUS_03490 gene atpC 14626 15024 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05434 protein_id gnl|my_center|LOCUS_03490 15128 16885 gene locus_tag LOCUS_03500 gene aspS 15128 16885 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D56 protein_id gnl|my_center|LOCUS_03500 17282 16932 gene locus_tag LOCUS_03510 17282 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 17906 17295 gene locus_tag LOCUS_03520 17906 17295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 18214 17903 gene locus_tag LOCUS_03530 18214 17903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 19108 18230 gene locus_tag LOCUS_03540 19108 18230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 19153 20100 gene locus_tag LOCUS_03550 19153 20100 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_03550 20185 21366 gene locus_tag LOCUS_03560 gene atoB 20185 21366 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947551.1 protein_id gnl|my_center|LOCUS_03560 21363 22505 gene locus_tag LOCUS_03570 21363 22505 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_03570 22502 23530 gene locus_tag LOCUS_03580 gene ilvE 22502 23530 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_03580 23562 24002 gene locus_tag LOCUS_03590 gene nusB 23562 24002 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6K8 protein_id gnl|my_center|LOCUS_03590 24008 27049 gene locus_tag LOCUS_03600 gene secA 24008 27049 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD18 protein_id gnl|my_center|LOCUS_03600 27049 28209 gene locus_tag LOCUS_03610 27049 28209 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201908.1 protein_id gnl|my_center|LOCUS_03610 28336 31113 gene locus_tag LOCUS_03620 28336 31113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 31136 31219 gene locus_tag LOCUS_t00020 31136 31219 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31292 33058 gene locus_tag LOCUS_03630 31292 33058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence009 1231 3240 gene locus_tag LOCUS_03640 1231 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 3260 6187 gene locus_tag LOCUS_03650 3260 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 6209 7762 gene locus_tag LOCUS_03660 6209 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 7759 10515 gene locus_tag LOCUS_03670 7759 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 10515 11519 gene locus_tag LOCUS_03680 10515 11519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 11516 12829 gene locus_tag LOCUS_03690 11516 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 12830 13792 gene locus_tag LOCUS_03700 12830 13792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 13789 14562 gene locus_tag LOCUS_03710 13789 14562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 14573 15331 gene locus_tag LOCUS_03720 14573 15331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 15339 16841 gene locus_tag LOCUS_03730 15339 16841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 16878 19313 gene locus_tag LOCUS_03740 16878 19313 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_03740 19366 20361 gene locus_tag LOCUS_03750 19366 20361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 20504 21070 gene locus_tag LOCUS_03760 20504 21070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 21713 21060 gene locus_tag LOCUS_03770 gene spoU 21713 21060 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE14 protein_id gnl|my_center|LOCUS_03770 21737 22657 gene locus_tag LOCUS_03780 gene queG 21737 22657 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_03780 23834 22671 gene locus_tag LOCUS_03790 23834 22671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 25397 24162 gene locus_tag LOCUS_03800 25397 24162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 26372 25437 gene locus_tag LOCUS_03810 gene mdh 26372 25437 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7K1 protein_id gnl|my_center|LOCUS_03810 26679 26425 gene locus_tag LOCUS_03820 gene rpmA 26679 26425 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA26 protein_id gnl|my_center|LOCUS_03820 27069 26683 gene locus_tag LOCUS_03830 27069 26683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 28643 27096 gene locus_tag LOCUS_03840 gene cafA 28643 27096 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_03840 28850 29641 gene locus_tag LOCUS_03850 gene ygaJ 28850 29641 CDS product putative peptidase YgaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71089 protein_id gnl|my_center|LOCUS_03850 29641 30240 gene locus_tag LOCUS_03860 29641 30240 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_03860 30287 31063 gene locus_tag LOCUS_03870 gene cysQ 30287 31063 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084702.1 protein_id gnl|my_center|LOCUS_03870 31112 31750 gene locus_tag LOCUS_03880 gene omt 31112 31750 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 protein_id gnl|my_center|LOCUS_03880 >Feature sequence010 312 1541 gene locus_tag LOCUS_03890 312 1541 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_03890 1702 2265 gene locus_tag LOCUS_03900 1702 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 2475 3146 gene locus_tag LOCUS_03910 2475 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 3434 4069 gene locus_tag LOCUS_03920 3434 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 4356 5060 gene locus_tag LOCUS_03930 4356 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 5131 5565 gene locus_tag LOCUS_03940 5131 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 5693 6175 gene locus_tag LOCUS_03950 5693 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 6212 6706 gene locus_tag LOCUS_03960 6212 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 6706 7188 gene locus_tag LOCUS_03970 6706 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 7190 7750 gene locus_tag LOCUS_03980 7190 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 7743 9638 gene locus_tag LOCUS_03990 7743 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 9775 10197 gene locus_tag LOCUS_04000 9775 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 10227 13109 gene locus_tag LOCUS_04010 10227 13109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 13109 14143 gene locus_tag LOCUS_04020 13109 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 14157 14705 gene locus_tag LOCUS_04030 14157 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 14695 16005 gene locus_tag LOCUS_04040 14695 16005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 16015 18906 gene locus_tag LOCUS_04050 16015 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 18980 23149 gene locus_tag LOCUS_04060 18980 23149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 23185 25878 gene locus_tag LOCUS_04070 23185 25878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 25887 26348 gene locus_tag LOCUS_04080 25887 26348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 27126 26356 gene locus_tag LOCUS_04090 27126 26356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 31865 27234 gene locus_tag LOCUS_04100 31865 27234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence011 2571 1309 gene locus_tag LOCUS_04110 gene folC 2571 1309 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_04110 3355 2558 gene locus_tag LOCUS_04120 gene murI 3355 2558 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFY7 protein_id gnl|my_center|LOCUS_04120 4833 3358 gene locus_tag LOCUS_04130 4833 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 5328 5113 gene locus_tag LOCUS_04140 5328 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 5600 5391 gene locus_tag LOCUS_04150 5600 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 6841 5756 gene locus_tag LOCUS_04160 6841 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 7926 6838 gene locus_tag LOCUS_04170 7926 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 9165 7936 gene locus_tag LOCUS_04180 9165 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 10132 9152 gene locus_tag LOCUS_04190 10132 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 11010 10129 gene locus_tag LOCUS_04200 11010 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 12458 11010 gene locus_tag LOCUS_04210 12458 11010 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931965.1 protein_id gnl|my_center|LOCUS_04210 13430 12462 gene locus_tag LOCUS_04220 13430 12462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 13549 14835 gene locus_tag LOCUS_04230 13549 14835 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815650.1 protein_id gnl|my_center|LOCUS_04230 14832 15188 gene locus_tag LOCUS_04240 14832 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 15760 15185 gene locus_tag LOCUS_04250 15760 15185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 16485 15760 gene locus_tag LOCUS_04260 16485 15760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 17300 16491 gene locus_tag LOCUS_04270 17300 16491 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_04270 18209 17382 gene locus_tag LOCUS_04280 18209 17382 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_04280 19057 18206 gene locus_tag LOCUS_04290 19057 18206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 19756 19067 gene locus_tag LOCUS_04300 19756 19067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 21288 19822 gene locus_tag LOCUS_04310 gene proS 21288 19822 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ6 protein_id gnl|my_center|LOCUS_04310 21488 23056 gene locus_tag LOCUS_04320 21488 23056 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_04320 23049 23786 gene locus_tag LOCUS_04330 gene spoU 23049 23786 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475968.1 protein_id gnl|my_center|LOCUS_04330 23892 24692 gene locus_tag LOCUS_04340 23892 24692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 24689 26059 gene locus_tag LOCUS_04350 24689 26059 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2VFK6 protein_id gnl|my_center|LOCUS_04350 26060 27151 gene locus_tag LOCUS_04360 26060 27151 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_04360 27148 27837 gene locus_tag LOCUS_04370 27148 27837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 27830 28213 gene locus_tag LOCUS_04380 27830 28213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 28210 28638 gene locus_tag LOCUS_04390 gene aroQ 28210 28638 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I322 protein_id gnl|my_center|LOCUS_04390 28639 29361 gene locus_tag LOCUS_04400 28639 29361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 <30494 29436 gene locus_tag LOCUS_04410 <30494 29436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase >Feature sequence012 136 1248 gene locus_tag LOCUS_04420 gene dnaN 136 1248 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6M1 protein_id gnl|my_center|LOCUS_04420 1270 2361 gene locus_tag LOCUS_04430 gene recF 1270 2361 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N32 protein_id gnl|my_center|LOCUS_04430 2361 2636 gene locus_tag LOCUS_04440 2361 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405456.1 protein_id gnl|my_center|LOCUS_04440 2633 4609 gene locus_tag LOCUS_04450 gene gyrB 2633 4609 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_04450 4626 7133 gene locus_tag LOCUS_04460 gene gyrA 4626 7133 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG27 protein_id gnl|my_center|LOCUS_04460 7130 7801 gene locus_tag LOCUS_04470 7130 7801 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583598.1 protein_id gnl|my_center|LOCUS_04470 8783 7809 gene locus_tag LOCUS_04480 8783 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 10097 9171 gene locus_tag LOCUS_04490 10097 9171 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002071.1 protein_id gnl|my_center|LOCUS_04490 10149 10409 gene locus_tag LOCUS_04500 10149 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 10409 11827 gene locus_tag LOCUS_04510 gene norM 10409 11827 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783536.1 protein_id gnl|my_center|LOCUS_04510 11892 14546 gene locus_tag LOCUS_04520 11892 14546 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU96 protein_id gnl|my_center|LOCUS_04520 14550 15794 gene locus_tag LOCUS_04530 gene pdhC 14550 15794 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E68 protein_id gnl|my_center|LOCUS_04530 15803 17230 gene locus_tag LOCUS_04540 gene lpdA 15803 17230 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E67 protein_id gnl|my_center|LOCUS_04540 17232 19778 gene locus_tag LOCUS_04550 17232 19778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403224.1 protein_id gnl|my_center|LOCUS_04550 19809 22622 gene locus_tag LOCUS_04560 19809 22622 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072980.1 protein_id gnl|my_center|LOCUS_04560 22632 23081 gene locus_tag LOCUS_04570 22632 23081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 23078 24691 gene locus_tag LOCUS_04580 23078 24691 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640435.1 protein_id gnl|my_center|LOCUS_04580 24696 27092 gene locus_tag LOCUS_04590 24696 27092 CDS product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_04590 27192 27881 gene locus_tag LOCUS_04600 gene glpQ 27192 27881 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861199.1 protein_id gnl|my_center|LOCUS_04600 27889 28203 gene locus_tag LOCUS_04610 27889 28203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 >Feature sequence013 354 1961 gene locus_tag LOCUS_04620 354 1961 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254471.1 protein_id gnl|my_center|LOCUS_04620 3135 1972 gene locus_tag LOCUS_04630 3135 1972 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140377.1 protein_id gnl|my_center|LOCUS_04630 4207 3152 gene locus_tag LOCUS_04640 gene rlmN 4207 3152 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X240 protein_id gnl|my_center|LOCUS_04640 4377 5372 gene locus_tag LOCUS_04650 gene moxR 4377 5372 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404542.1 protein_id gnl|my_center|LOCUS_04650 5375 6277 gene locus_tag LOCUS_04660 5375 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_04660 7397 6285 gene locus_tag LOCUS_04670 7397 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 8481 7486 gene locus_tag LOCUS_04680 8481 7486 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140793.1 protein_id gnl|my_center|LOCUS_04680 8621 9403 gene locus_tag LOCUS_04690 8621 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 9460 10572 gene locus_tag LOCUS_04700 9460 10572 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_04700 10593 11645 gene locus_tag LOCUS_04710 gene mnmA 10593 11645 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK0 protein_id gnl|my_center|LOCUS_04710 11712 12179 gene locus_tag LOCUS_04720 11712 12179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 12180 12722 gene locus_tag LOCUS_04730 12180 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 12723 13106 gene locus_tag LOCUS_04740 12723 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 13078 14712 gene locus_tag LOCUS_04750 gene argS 13078 14712 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W3 protein_id gnl|my_center|LOCUS_04750 22747 14741 gene locus_tag LOCUS_04760 22747 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 23355 22792 gene locus_tag LOCUS_04770 23355 22792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 24270 23359 gene locus_tag LOCUS_04780 24270 23359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 24760 24272 gene locus_tag LOCUS_04790 24760 24272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 25727 24741 gene locus_tag LOCUS_04800 25727 24741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 26132 26677 gene locus_tag LOCUS_04810 26132 26677 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108735.1 protein_id gnl|my_center|LOCUS_04810 26742 27620 gene locus_tag LOCUS_04820 26742 27620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 >Feature sequence014 65 817 gene locus_tag LOCUS_04830 65 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 878 4819 gene locus_tag LOCUS_04840 878 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 4950 5363 gene locus_tag LOCUS_04850 4950 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 5369 6421 gene locus_tag LOCUS_04860 gene pilT-1 5369 6421 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218487.1 protein_id gnl|my_center|LOCUS_04860 6424 6900 gene locus_tag LOCUS_04870 6424 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 6897 7529 gene locus_tag LOCUS_04880 6897 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 7522 9768 gene locus_tag LOCUS_04890 7522 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 9785 10843 gene locus_tag LOCUS_04900 9785 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 10836 11429 gene locus_tag LOCUS_04910 10836 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 11438 12010 gene locus_tag LOCUS_04920 11438 12010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 12010 12597 gene locus_tag LOCUS_04930 12010 12597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 12630 14063 gene locus_tag LOCUS_04940 12630 14063 CDS product general secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080304.1 protein_id gnl|my_center|LOCUS_04940 14056 16977 gene locus_tag LOCUS_04950 14056 16977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 16997 18715 gene locus_tag LOCUS_04960 gene pilB 16997 18715 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_04960 18715 19962 gene locus_tag LOCUS_04970 gene pilC 18715 19962 CDS product pilus biosynthesis protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_04970 19964 20605 gene locus_tag LOCUS_04980 19964 20605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 20614 24198 gene locus_tag LOCUS_04990 20614 24198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 24305 25405 gene locus_tag LOCUS_05000 gene capB 24305 25405 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020724.1 protein_id gnl|my_center|LOCUS_05000 25398 25841 gene locus_tag LOCUS_05010 gene capC 25398 25841 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329558.1 protein_id gnl|my_center|LOCUS_05010 25834 26985 gene locus_tag LOCUS_05020 25834 26985 CDS product poly-gamma-glutamate system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078607.1 protein_id gnl|my_center|LOCUS_05020 26963 27217 gene locus_tag LOCUS_05030 26963 27217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 27255 27842 gene locus_tag LOCUS_05040 27255 27842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 >Feature sequence015 130 2340 gene locus_tag LOCUS_05050 130 2340 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948281.1 protein_id gnl|my_center|LOCUS_05050 2362 3375 gene locus_tag LOCUS_05060 2362 3375 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338853.1 protein_id gnl|my_center|LOCUS_05060 3366 4493 gene locus_tag LOCUS_05070 3366 4493 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979323.1 protein_id gnl|my_center|LOCUS_05070 4522 5694 gene locus_tag LOCUS_05080 4522 5694 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_05080 9264 5719 gene locus_tag LOCUS_05090 9264 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 9446 10396 gene locus_tag LOCUS_05100 9446 10396 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265797.1 protein_id gnl|my_center|LOCUS_05100 11146 10388 gene locus_tag LOCUS_05110 11146 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 11664 11146 gene locus_tag LOCUS_05120 11664 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932444.1 protein_id gnl|my_center|LOCUS_05120 13219 11726 gene locus_tag LOCUS_05130 13219 11726 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_05130 13932 13219 gene locus_tag LOCUS_05140 13932 13219 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_05140 14163 14705 gene locus_tag LOCUS_05150 14163 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 14705 15838 gene locus_tag LOCUS_05160 14705 15838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 protein_id gnl|my_center|LOCUS_05160 15900 16301 gene locus_tag LOCUS_05170 15900 16301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 16310 16636 gene locus_tag LOCUS_05180 16310 16636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_05180 17231 16650 gene locus_tag LOCUS_05190 17231 16650 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_05190 17506 18276 gene locus_tag LOCUS_05200 gene etfB 17506 18276 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933796.1 protein_id gnl|my_center|LOCUS_05200 18280 19215 gene locus_tag LOCUS_05210 18280 19215 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_05210 19225 21237 gene locus_tag LOCUS_05220 19225 21237 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228453.1 protein_id gnl|my_center|LOCUS_05220 22465 21266 gene locus_tag LOCUS_05230 22465 21266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 22935 22504 gene locus_tag LOCUS_05240 22935 22504 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932428.1 protein_id gnl|my_center|LOCUS_05240 23186 22932 gene locus_tag LOCUS_05250 23186 22932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 24390 23188 gene locus_tag LOCUS_05260 gene sufS 24390 23188 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32164 protein_id gnl|my_center|LOCUS_05260 24927 24391 gene locus_tag LOCUS_05270 24927 24391 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_05270 25331 24924 gene locus_tag LOCUS_05280 25331 24924 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_05280 26596 25328 gene locus_tag LOCUS_05290 gene sufD 26596 25328 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_05290 27333 26596 gene locus_tag LOCUS_05300 gene sufC 27333 26596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771014.1 protein_id gnl|my_center|LOCUS_05300 <27957 27351 gene locus_tag LOCUS_05310 <27957 27351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141370.1:Fe-S cluster assembly protein SufB >Feature sequence016 2886 1222 gene locus_tag LOCUS_05320 gene pilB1 2886 1222 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_05320 3700 2888 gene locus_tag LOCUS_05330 3700 2888 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E229 protein_id gnl|my_center|LOCUS_05330 4074 3697 gene locus_tag LOCUS_05340 4074 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 4284 5285 gene locus_tag LOCUS_05350 4284 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 5287 6591 gene locus_tag LOCUS_05360 5287 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05360 6623 8245 gene locus_tag LOCUS_05370 gene yidK 6623 8245 CDS product putative symporter YidK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31448 protein_id gnl|my_center|LOCUS_05370 8309 9664 gene locus_tag LOCUS_05380 gene nagA 8309 9664 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_05380 9871 10890 gene locus_tag LOCUS_05390 9871 10890 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250425.1 protein_id gnl|my_center|LOCUS_05390 14492 10905 gene locus_tag LOCUS_05400 14492 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 16328 14499 gene locus_tag LOCUS_05410 16328 14499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 19737 16348 gene locus_tag LOCUS_05420 19737 16348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 21100 19751 gene locus_tag LOCUS_05430 gene srfJ 21100 19751 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636452.2 protein_id gnl|my_center|LOCUS_05430 22513 21116 gene locus_tag LOCUS_05440 22513 21116 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 protein_id gnl|my_center|LOCUS_05440 24161 22515 gene locus_tag LOCUS_05450 24161 22515 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975031.1 protein_id gnl|my_center|LOCUS_05450 25083 24154 gene locus_tag LOCUS_05460 25083 24154 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230098.1 protein_id gnl|my_center|LOCUS_05460 26077 25091 gene locus_tag LOCUS_05470 26077 25091 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776034.1 protein_id gnl|my_center|LOCUS_05470 27510 26074 gene locus_tag LOCUS_05480 27510 26074 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706882.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence017 761 276 gene locus_tag LOCUS_05490 761 276 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124198.1 protein_id gnl|my_center|LOCUS_05490 1533 805 gene locus_tag LOCUS_05500 1533 805 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_05500 3023 1536 gene locus_tag LOCUS_05510 3023 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3113 4069 gene locus_tag LOCUS_05520 3113 4069 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948636.1 protein_id gnl|my_center|LOCUS_05520 4062 5930 gene locus_tag LOCUS_05530 4062 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 7233 5938 gene locus_tag LOCUS_05540 gene rimO 7233 5938 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BJ2 protein_id gnl|my_center|LOCUS_05540 8151 7267 gene locus_tag LOCUS_05550 gene ftsY 8151 7267 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ40 protein_id gnl|my_center|LOCUS_05550 8725 8141 gene locus_tag LOCUS_05560 gene pgsA 8725 8141 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111646.1 protein_id gnl|my_center|LOCUS_05560 10031 8712 gene locus_tag LOCUS_05570 10031 8712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986509.1 protein_id gnl|my_center|LOCUS_05570 11307 10024 gene locus_tag LOCUS_05580 11307 10024 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_05580 12290 11304 gene locus_tag LOCUS_05590 12290 11304 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 protein_id gnl|my_center|LOCUS_05590 13285 12296 gene locus_tag LOCUS_05600 13285 12296 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932877.1 protein_id gnl|my_center|LOCUS_05600 14054 13326 gene locus_tag LOCUS_05610 gene tatC 14054 13326 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD48 protein_id gnl|my_center|LOCUS_05610 14991 14047 gene locus_tag LOCUS_05620 14991 14047 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_05620 15675 14992 gene locus_tag LOCUS_05630 15675 14992 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_05630 15854 16108 gene locus_tag LOCUS_05640 gene rpst 15854 16108 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGP1 protein_id gnl|my_center|LOCUS_05640 17601 16132 gene locus_tag LOCUS_05650 gene guaB 17601 16132 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B47 protein_id gnl|my_center|LOCUS_05650 19130 17604 gene locus_tag LOCUS_05660 gene hutH 19130 17604 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSW6 protein_id gnl|my_center|LOCUS_05660 22024 19214 gene locus_tag LOCUS_05670 gene dinG 22024 19214 CDS product ATP-dependent helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044941.1 protein_id gnl|my_center|LOCUS_05670 23247 22036 gene locus_tag LOCUS_05680 23247 22036 CDS product geranylgeranyl hydrogenase BchP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_05680 24080 23247 gene locus_tag LOCUS_05690 24080 23247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 25484 24081 gene locus_tag LOCUS_05700 25484 24081 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4E6 protein_id gnl|my_center|LOCUS_05700 25869 25477 gene locus_tag LOCUS_05710 25869 25477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 26275 25895 gene locus_tag LOCUS_05720 26275 25895 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_05720 26725 26282 gene locus_tag LOCUS_05730 26725 26282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546500.1 protein_id gnl|my_center|LOCUS_05730 <27595 26731 gene locus_tag LOCUS_05740 <27595 26731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18BE7:alanine--tRNA ligase >Feature sequence018 23 95 gene locus_tag LOCUS_t00030 23 95 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 146 571 gene locus_tag LOCUS_05750 146 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 2955 568 gene locus_tag LOCUS_05760 2955 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 3551 2979 gene locus_tag LOCUS_05770 gene yceI 3551 2979 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_05770 4239 3565 gene locus_tag LOCUS_05780 4239 3565 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870604.1 protein_id gnl|my_center|LOCUS_05780 7593 4303 gene locus_tag LOCUS_05790 7593 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 8529 7693 gene locus_tag LOCUS_05800 8529 7693 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_05800 9457 8576 gene locus_tag LOCUS_05810 9457 8576 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_05810 9750 10967 gene locus_tag LOCUS_05820 9750 10967 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958523.1 protein_id gnl|my_center|LOCUS_05820 12901 10991 gene locus_tag LOCUS_05830 12901 10991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 14166 12955 gene locus_tag LOCUS_05840 14166 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 15722 14166 gene locus_tag LOCUS_05850 15722 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 17215 15725 gene locus_tag LOCUS_05860 17215 15725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 18302 17232 gene locus_tag LOCUS_05870 18302 17232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 21811 18299 gene locus_tag LOCUS_05880 21811 18299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 24513 21814 gene locus_tag LOCUS_05890 24513 21814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 <27252 24587 gene locus_tag LOCUS_05900 <27252 24587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase >Feature sequence019 202 1164 gene locus_tag LOCUS_05910 gene yhaM 202 1164 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y556 protein_id gnl|my_center|LOCUS_05910 1151 1675 gene locus_tag LOCUS_05920 1151 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 1672 3291 gene locus_tag LOCUS_05930 1672 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 4301 3288 gene locus_tag LOCUS_05940 4301 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766582.1 protein_id gnl|my_center|LOCUS_05940 6257 4314 gene locus_tag LOCUS_05950 6257 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 6678 7397 gene locus_tag LOCUS_05960 6678 7397 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_05960 7400 7945 gene locus_tag LOCUS_05970 7400 7945 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_05970 7971 8951 gene locus_tag LOCUS_05980 gene trpS 7971 8951 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221812.1 protein_id gnl|my_center|LOCUS_05980 8954 9682 gene locus_tag LOCUS_05990 gene scpA 8954 9682 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG32 protein_id gnl|my_center|LOCUS_05990 9682 10305 gene locus_tag LOCUS_06000 gene scpB 9682 10305 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFR3 protein_id gnl|my_center|LOCUS_06000 10309 11004 gene locus_tag LOCUS_06010 10309 11004 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFE9 protein_id gnl|my_center|LOCUS_06010 11094 11750 gene locus_tag LOCUS_06020 gene cmk 11094 11750 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749Y7 protein_id gnl|my_center|LOCUS_06020 11754 13682 gene locus_tag LOCUS_06030 11754 13682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 13709 14686 gene locus_tag LOCUS_06040 13709 14686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 14683 15678 gene locus_tag LOCUS_06050 gene tsaD 14683 15678 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CP0 protein_id gnl|my_center|LOCUS_06050 15675 17777 gene locus_tag LOCUS_06060 15675 17777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 17810 19114 gene locus_tag LOCUS_06070 17810 19114 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_06070 19118 19663 gene locus_tag LOCUS_06080 gene rfbC 19118 19663 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_06080 19665 20042 gene locus_tag LOCUS_06090 19665 20042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06090 20014 20715 gene locus_tag LOCUS_06100 20014 20715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06100 20715 21584 gene locus_tag LOCUS_06110 gene rmlA 20715 21584 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ53 protein_id gnl|my_center|LOCUS_06110 22897 21581 gene locus_tag LOCUS_06120 22897 21581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 24385 22952 gene locus_tag LOCUS_06130 gene cpsE 24385 22952 CDS product galactosyl transferase CpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AFI0 protein_id gnl|my_center|LOCUS_06130 25558 24461 gene locus_tag LOCUS_06140 25558 24461 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_06140 26026 25565 gene locus_tag LOCUS_06150 26026 25565 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_06150 <26693 26029 gene locus_tag LOCUS_06160 <26693 26029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257502.1:oxidoreductase >Feature sequence020 150 1517 gene locus_tag LOCUS_06170 150 1517 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933237.1 protein_id gnl|my_center|LOCUS_06170 1540 2049 gene locus_tag LOCUS_06180 1540 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 2431 2033 gene locus_tag LOCUS_06190 2431 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 2566 4920 gene locus_tag LOCUS_06200 2566 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 6038 4932 gene locus_tag LOCUS_06210 6038 4932 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460323.1 protein_id gnl|my_center|LOCUS_06210 6520 6038 gene locus_tag LOCUS_06220 6520 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 7638 6556 gene locus_tag LOCUS_06230 gene add 7638 6556 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403444.1 protein_id gnl|my_center|LOCUS_06230 9552 7654 gene locus_tag LOCUS_06240 gene oliA 9552 7654 CDS product oligopeptide transporter, OPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 protein_id gnl|my_center|LOCUS_06240 9958 11289 gene locus_tag LOCUS_06250 gene ffh 9958 11289 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB9 protein_id gnl|my_center|LOCUS_06250 11301 11849 gene locus_tag LOCUS_06260 11301 11849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 11898 12131 gene locus_tag LOCUS_06270 11898 12131 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84666 protein_id gnl|my_center|LOCUS_06270 12133 12636 gene locus_tag LOCUS_06280 gene rimM 12133 12636 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 protein_id gnl|my_center|LOCUS_06280 12633 13358 gene locus_tag LOCUS_06290 gene trmD 12633 13358 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BC2 protein_id gnl|my_center|LOCUS_06290 13351 13698 gene locus_tag LOCUS_06300 gene rplS 13351 13698 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88WJ1 protein_id gnl|my_center|LOCUS_06300 13941 15308 gene locus_tag LOCUS_06310 gene selA 13941 15308 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61736 protein_id gnl|my_center|LOCUS_06310 15312 17174 gene locus_tag LOCUS_06320 gene selB 15312 17174 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048014.1 protein_id gnl|my_center|LOCUS_06320 17167 19767 gene locus_tag LOCUS_06330 gene mutS 17167 19767 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG7 protein_id gnl|my_center|LOCUS_06330 19757 20800 gene locus_tag LOCUS_06340 19757 20800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 20906 21766 gene locus_tag LOCUS_06350 20906 21766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_06350 21766 22332 gene locus_tag LOCUS_06360 gene gmk 21766 22332 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X215 protein_id gnl|my_center|LOCUS_06360 22334 22612 gene locus_tag LOCUS_06370 22334 22612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 22613 23299 gene locus_tag LOCUS_06380 22613 23299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 23310 24659 gene locus_tag LOCUS_06390 gene dnaB 23310 24659 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EG4 protein_id gnl|my_center|LOCUS_06390 >Feature sequence021 1418 777 gene locus_tag LOCUS_06400 1418 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_06400 2543 1419 gene locus_tag LOCUS_06410 gene lpxB 2543 1419 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_06410 3124 2540 gene locus_tag LOCUS_06420 gene ste14 3124 2540 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_06420 4116 3121 gene locus_tag LOCUS_06430 4116 3121 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_06430 4228 4860 gene locus_tag LOCUS_06440 4228 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 6010 4910 gene locus_tag LOCUS_06450 gene ychF 6010 4910 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97H79 protein_id gnl|my_center|LOCUS_06450 6635 6087 gene locus_tag LOCUS_06460 gene fabA 6635 6087 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y2Y5 protein_id gnl|my_center|LOCUS_06460 6763 7545 gene locus_tag LOCUS_06470 6763 7545 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_06470 7946 7566 gene locus_tag LOCUS_06480 7946 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 9261 7984 gene locus_tag LOCUS_06490 gene pmrA 9261 7984 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390196.1 protein_id gnl|my_center|LOCUS_06490 10150 9254 gene locus_tag LOCUS_06500 10150 9254 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015631.1 protein_id gnl|my_center|LOCUS_06500 10788 10234 gene locus_tag LOCUS_06510 10788 10234 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMX9 protein_id gnl|my_center|LOCUS_06510 10938 13769 gene locus_tag LOCUS_06520 gene uvrA 10938 13769 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7B1 protein_id gnl|my_center|LOCUS_06520 13778 16099 gene locus_tag LOCUS_06530 13778 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 16218 17240 gene locus_tag LOCUS_06540 gene ruvB 16218 17240 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61532 protein_id gnl|my_center|LOCUS_06540 17237 18289 gene locus_tag LOCUS_06550 gene queA 17237 18289 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_06550 18305 19012 gene locus_tag LOCUS_06560 gene ispD 18305 19012 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z9 protein_id gnl|my_center|LOCUS_06560 18993 19493 gene locus_tag LOCUS_06570 gene ispF 18993 19493 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LX0 protein_id gnl|my_center|LOCUS_06570 19480 20319 gene locus_tag LOCUS_06580 gene ispE 19480 20319 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCC7 protein_id gnl|my_center|LOCUS_06580 20341 20412 gene locus_tag LOCUS_t00040 20341 20412 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20436 21380 gene locus_tag LOCUS_06590 gene prs 20436 21380 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4D0 protein_id gnl|my_center|LOCUS_06590 21395 22087 gene locus_tag LOCUS_06600 gene rplY 21395 22087 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8YAD3 protein_id gnl|my_center|LOCUS_06600 22094 22648 gene locus_tag LOCUS_06610 gene pth 22094 22648 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG54 protein_id gnl|my_center|LOCUS_06610 22669 24816 gene locus_tag LOCUS_06620 gene hppA1 22669 24816 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_06620 >Feature sequence022 4371 499 gene locus_tag LOCUS_06630 4371 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 6954 4381 gene locus_tag LOCUS_06640 6954 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 7199 8068 gene locus_tag LOCUS_06650 7199 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 8270 9529 gene locus_tag LOCUS_06660 8270 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 9609 10490 gene locus_tag LOCUS_06670 9609 10490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 10515 12128 gene locus_tag LOCUS_06680 10515 12128 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_06680 12195 12809 gene locus_tag LOCUS_06690 12195 12809 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_06690 12836 13237 gene locus_tag LOCUS_06700 12836 13237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 13234 13644 gene locus_tag LOCUS_06710 13234 13644 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 protein_id gnl|my_center|LOCUS_06710 13644 14258 gene locus_tag LOCUS_06720 13644 14258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 15062 14310 gene locus_tag LOCUS_06730 gene sdhB 15062 14310 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_06730 16980 15064 gene locus_tag LOCUS_06740 gene sdhA 16980 15064 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_06740 17657 16977 gene locus_tag LOCUS_06750 gene sdhC 17657 16977 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_06750 18178 17729 gene locus_tag LOCUS_06760 18178 17729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 19246 18179 gene locus_tag LOCUS_06770 19246 18179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 19631 20554 gene locus_tag LOCUS_06780 19631 20554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 20599 21420 gene locus_tag LOCUS_06790 20599 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 21620 24574 gene locus_tag LOCUS_06800 21620 24574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence023 3 854 gene locus_tag LOCUS_06810 3 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 847 1896 gene locus_tag LOCUS_06820 847 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 1928 4444 gene locus_tag LOCUS_06830 1928 4444 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_06830 4478 7024 gene locus_tag LOCUS_06840 4478 7024 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_06840 7065 7883 gene locus_tag LOCUS_06850 gene mutM 7065 7883 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FIV8 protein_id gnl|my_center|LOCUS_06850 9779 7896 gene locus_tag LOCUS_06860 9779 7896 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870173.1 protein_id gnl|my_center|LOCUS_06860 10799 9963 gene locus_tag LOCUS_06870 10799 9963 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262002.1 protein_id gnl|my_center|LOCUS_06870 11738 10830 gene locus_tag LOCUS_06880 11738 10830 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_06880 13091 11751 gene locus_tag LOCUS_06890 gene hslU 13091 11751 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S217 protein_id gnl|my_center|LOCUS_06890 13633 13088 gene locus_tag LOCUS_06900 gene hslV 13633 13088 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61478 protein_id gnl|my_center|LOCUS_06900 14519 13674 gene locus_tag LOCUS_06910 14519 13674 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E95 protein_id gnl|my_center|LOCUS_06910 15487 14519 gene locus_tag LOCUS_06920 15487 14519 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937987.1 protein_id gnl|my_center|LOCUS_06920 16853 15498 gene locus_tag LOCUS_06930 gene rpoN 16853 15498 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403901.1 protein_id gnl|my_center|LOCUS_06930 17593 16853 gene locus_tag LOCUS_06940 gene lptB 17593 16853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_06940 18114 17590 gene locus_tag LOCUS_06950 18114 17590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 18649 18119 gene locus_tag LOCUS_06960 18649 18119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938916.1 protein_id gnl|my_center|LOCUS_06960 19458 18646 gene locus_tag LOCUS_06970 gene kdsA 19458 18646 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE84 protein_id gnl|my_center|LOCUS_06970 21071 19455 gene locus_tag LOCUS_06980 21071 19455 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496746.1 protein_id gnl|my_center|LOCUS_06980 21806 21072 gene locus_tag LOCUS_06990 gene kdsB 21806 21072 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY2 protein_id gnl|my_center|LOCUS_06990 22414 21998 gene locus_tag LOCUS_07000 22414 21998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence024 1004 132 gene locus_tag LOCUS_07010 1004 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2253 1021 gene locus_tag LOCUS_07020 2253 1021 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583649.1 protein_id gnl|my_center|LOCUS_07020 3710 2298 gene locus_tag LOCUS_07030 3710 2298 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFM9 protein_id gnl|my_center|LOCUS_07030 4189 3818 gene locus_tag LOCUS_07040 gene apaG 4189 3818 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKS7 protein_id gnl|my_center|LOCUS_07040 4252 6063 gene locus_tag LOCUS_07050 4252 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 6894 6088 gene locus_tag LOCUS_07060 6894 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 7976 6894 gene locus_tag LOCUS_07070 7976 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 8189 9973 gene locus_tag LOCUS_07080 8189 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 10045 14223 gene locus_tag LOCUS_07090 10045 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 14342 15547 gene locus_tag LOCUS_07100 14342 15547 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_07100 15560 17689 gene locus_tag LOCUS_07110 15560 17689 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_07110 17747 19543 gene locus_tag LOCUS_07120 gene atuA 17747 19543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_07120 19555 20352 gene locus_tag LOCUS_07130 gene ech2 19555 20352 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207706.1 protein_id gnl|my_center|LOCUS_07130 20340 21362 gene locus_tag LOCUS_07140 20340 21362 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_07140 22043 21372 gene locus_tag LOCUS_07150 22043 21372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence025 <1 1779 gene locus_tag LOCUS_07160 <1 1779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963613.1:TonB-dependent receptor 1800 2342 gene locus_tag LOCUS_07170 1800 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2379 2768 gene locus_tag LOCUS_07180 2379 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790413.1 protein_id gnl|my_center|LOCUS_07180 3199 2765 gene locus_tag LOCUS_07190 3199 2765 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018151.1 protein_id gnl|my_center|LOCUS_07190 4357 3275 gene locus_tag LOCUS_07200 4357 3275 CDS product saccharopine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_07200 5411 4350 gene locus_tag LOCUS_07210 5411 4350 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_07210 5810 5421 gene locus_tag LOCUS_07220 gene queF 5810 5421 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZP8 protein_id gnl|my_center|LOCUS_07220 6169 5813 gene locus_tag LOCUS_07230 6169 5813 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0H2 protein_id gnl|my_center|LOCUS_07230 6876 6250 gene locus_tag LOCUS_07240 gene queE 6876 6250 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9F0 protein_id gnl|my_center|LOCUS_07240 7584 6904 gene locus_tag LOCUS_07250 gene queC 7584 6904 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSY8 protein_id gnl|my_center|LOCUS_07250 7938 9248 gene locus_tag LOCUS_07260 gene hemL 7938 9248 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHH6 protein_id gnl|my_center|LOCUS_07260 9252 10523 gene locus_tag LOCUS_07270 gene ordL 9252 10523 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973446.1 protein_id gnl|my_center|LOCUS_07270 10527 11984 gene locus_tag LOCUS_07280 10527 11984 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898767.1 protein_id gnl|my_center|LOCUS_07280 12106 13569 gene locus_tag LOCUS_07290 12106 13569 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256842.1 protein_id gnl|my_center|LOCUS_07290 13562 14881 gene locus_tag LOCUS_07300 13562 14881 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056263.1 protein_id gnl|my_center|LOCUS_07300 14896 16377 gene locus_tag LOCUS_07310 14896 16377 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256842.1 protein_id gnl|my_center|LOCUS_07310 16430 17914 gene locus_tag LOCUS_07320 gene mmsA 16430 17914 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224909.1 protein_id gnl|my_center|LOCUS_07320 18492 17911 gene locus_tag LOCUS_07330 18492 17911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 19311 18502 gene locus_tag LOCUS_07340 19311 18502 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_07340 19582 19931 gene locus_tag LOCUS_tm00010 19582 19931 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 <21791 19949 gene locus_tag LOCUS_07350 <21791 19949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203489.1:TonB-dependent receptor >Feature sequence026 211 137 gene locus_tag LOCUS_t00050 211 137 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 439 1776 gene locus_tag LOCUS_07360 gene gdhA 439 1776 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVJ7 protein_id gnl|my_center|LOCUS_07360 4791 1819 gene locus_tag LOCUS_07370 4791 1819 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_07370 4920 6107 gene locus_tag LOCUS_07380 gene pgk 4920 6107 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP7 protein_id gnl|my_center|LOCUS_07380 6109 6867 gene locus_tag LOCUS_07390 gene tpiA 6109 6867 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL53 protein_id gnl|my_center|LOCUS_07390 6864 7208 gene locus_tag LOCUS_07400 6864 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 7217 8182 gene locus_tag LOCUS_07410 7217 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 8202 9086 gene locus_tag LOCUS_07420 8202 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 9255 12422 gene locus_tag LOCUS_07430 9255 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 12539 12623 gene locus_tag LOCUS_t00060 12539 12623 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12727 13752 gene locus_tag LOCUS_07440 12727 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 13845 15143 gene locus_tag LOCUS_07450 13845 15143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 15149 15850 gene locus_tag LOCUS_07460 15149 15850 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249637.1 protein_id gnl|my_center|LOCUS_07460 15840 16202 gene locus_tag LOCUS_07470 gene acpS 15840 16202 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z8M5 protein_id gnl|my_center|LOCUS_07470 16202 17734 gene locus_tag LOCUS_07480 gene nnr 16202 17734 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM0 protein_id gnl|my_center|LOCUS_07480 17721 18071 gene locus_tag LOCUS_07490 17721 18071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 18064 19659 gene locus_tag LOCUS_07500 gene recN 18064 19659 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17894 protein_id gnl|my_center|LOCUS_07500 19666 20916 gene locus_tag LOCUS_07510 gene murA 19666 20916 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEX7 protein_id gnl|my_center|LOCUS_07510 >Feature sequence027 2049 274 gene locus_tag LOCUS_07520 2049 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 2191 2523 gene locus_tag LOCUS_07530 2191 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2523 3074 gene locus_tag LOCUS_07540 gene def 2523 3074 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDJ4 protein_id gnl|my_center|LOCUS_07540 3111 4040 gene locus_tag LOCUS_07550 gene fmt 3111 4040 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182S2 protein_id gnl|my_center|LOCUS_07550 4037 5353 gene locus_tag LOCUS_07560 gene rsmB 4037 5353 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182R9 protein_id gnl|my_center|LOCUS_07560 5353 6108 gene locus_tag LOCUS_07570 5353 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_662095.1 protein_id gnl|my_center|LOCUS_07570 6207 6698 gene locus_tag LOCUS_07580 6207 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 6695 8755 gene locus_tag LOCUS_07590 6695 8755 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_07590 8755 10020 gene locus_tag LOCUS_07600 gene hflX 8755 10020 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCN0 protein_id gnl|my_center|LOCUS_07600 11522 10230 gene locus_tag LOCUS_07610 gene gltP 11522 10230 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_07610 13752 11647 gene locus_tag LOCUS_07620 13752 11647 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_07620 13828 15291 gene locus_tag LOCUS_07630 13828 15291 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_07630 15939 15340 gene locus_tag LOCUS_07640 15939 15340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 16037 16831 gene locus_tag LOCUS_07650 gene pyrF 16037 16831 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_07650 16845 17420 gene locus_tag LOCUS_07660 gene pyrE 16845 17420 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG85 protein_id gnl|my_center|LOCUS_07660 17417 18022 gene locus_tag LOCUS_07670 gene ppiB 17417 18022 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7T6 protein_id gnl|my_center|LOCUS_07670 >Feature sequence028 38 4801 gene locus_tag LOCUS_07680 38 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 5448 4810 gene locus_tag LOCUS_07690 5448 4810 CDS product putative phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705604.1 protein_id gnl|my_center|LOCUS_07690 5505 6125 gene locus_tag LOCUS_07700 5505 6125 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404709.1 protein_id gnl|my_center|LOCUS_07700 6122 6373 gene locus_tag LOCUS_07710 6122 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 6729 6400 gene locus_tag LOCUS_07720 6729 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 6842 7375 gene locus_tag LOCUS_07730 6842 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 7520 7446 gene locus_tag LOCUS_t00070 7520 7446 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7984 7577 gene locus_tag LOCUS_07740 7984 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 8121 11627 gene locus_tag LOCUS_07750 8121 11627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 11687 12025 gene locus_tag LOCUS_07760 11687 12025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 12022 13278 gene locus_tag LOCUS_07770 gene hisS 12022 13278 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX22 protein_id gnl|my_center|LOCUS_07770 13351 15876 gene locus_tag LOCUS_07780 gene topA 13351 15876 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR4 protein_id gnl|my_center|LOCUS_07780 15888 16334 gene locus_tag LOCUS_07790 15888 16334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 16374 17714 gene locus_tag LOCUS_07800 gene glyQS 16374 17714 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73RR5 protein_id gnl|my_center|LOCUS_07800 17821 18222 gene locus_tag LOCUS_07810 17821 18222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence029 89 397 gene locus_tag LOCUS_07820 gene rpsJ 89 397 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88XY7 protein_id gnl|my_center|LOCUS_07820 400 1017 gene locus_tag LOCUS_07830 gene rplC 400 1017 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK8 protein_id gnl|my_center|LOCUS_07830 1004 1645 gene locus_tag LOCUS_07840 gene rplD 1004 1645 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61055 protein_id gnl|my_center|LOCUS_07840 1661 1978 gene locus_tag LOCUS_07850 gene rplW 1661 1978 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH8 protein_id gnl|my_center|LOCUS_07850 1981 2805 gene locus_tag LOCUS_07860 gene rplB 1981 2805 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60401 protein_id gnl|my_center|LOCUS_07860 2812 3078 gene locus_tag LOCUS_07870 gene rpsS 2812 3078 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_07870 3085 3429 gene locus_tag LOCUS_07880 gene rplV 3085 3429 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42060 protein_id gnl|my_center|LOCUS_07880 3441 4073 gene locus_tag LOCUS_07890 gene rpsC 3441 4073 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3Q8 protein_id gnl|my_center|LOCUS_07890 4083 4496 gene locus_tag LOCUS_07900 gene rplP 4083 4496 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG40 protein_id gnl|my_center|LOCUS_07900 4496 4714 gene locus_tag LOCUS_07910 4496 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 4711 4980 gene locus_tag LOCUS_07920 4711 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 4982 5350 gene locus_tag LOCUS_07930 gene rplN 4982 5350 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFE5 protein_id gnl|my_center|LOCUS_07930 5352 5660 gene locus_tag LOCUS_07940 gene rplX 5352 5660 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRH1 protein_id gnl|my_center|LOCUS_07940 5663 6289 gene locus_tag LOCUS_07950 gene rplE 5663 6289 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYN1 protein_id gnl|my_center|LOCUS_07950 6289 6594 gene locus_tag LOCUS_07960 gene rpsN 6289 6594 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R550 protein_id gnl|my_center|LOCUS_07960 6606 7007 gene locus_tag LOCUS_07970 gene rpsH 6606 7007 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A1 protein_id gnl|my_center|LOCUS_07970 7013 7552 gene locus_tag LOCUS_07980 gene rplF 7013 7552 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH5 protein_id gnl|my_center|LOCUS_07980 7552 7923 gene locus_tag LOCUS_07990 gene rplR 7552 7923 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX6 protein_id gnl|my_center|LOCUS_07990 7933 8436 gene locus_tag LOCUS_08000 gene rpsE 7933 8436 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAI8 protein_id gnl|my_center|LOCUS_08000 8436 8630 gene locus_tag LOCUS_08010 gene rpmD 8436 8630 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EMD0 protein_id gnl|my_center|LOCUS_08010 8627 9064 gene locus_tag LOCUS_08020 gene rplO 8627 9064 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19946 protein_id gnl|my_center|LOCUS_08020 9061 10389 gene locus_tag LOCUS_08030 gene secY 9061 10389 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAJ1 protein_id gnl|my_center|LOCUS_08030 10389 11144 gene locus_tag LOCUS_08040 10389 11144 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_08040 11137 11364 gene locus_tag LOCUS_08050 gene infA 11137 11364 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD14 protein_id gnl|my_center|LOCUS_08050 11489 11860 gene locus_tag LOCUS_08060 gene rpsM 11489 11860 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5U9 protein_id gnl|my_center|LOCUS_08060 11882 12268 gene locus_tag LOCUS_08070 gene rpsK 11882 12268 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPN3 protein_id gnl|my_center|LOCUS_08070 12282 12899 gene locus_tag LOCUS_08080 gene rpsD 12282 12899 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59129 protein_id gnl|my_center|LOCUS_08080 12921 13895 gene locus_tag LOCUS_08090 gene rpoA 12921 13895 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3N9 protein_id gnl|my_center|LOCUS_08090 13900 14292 gene locus_tag LOCUS_08100 13900 14292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 14317 15456 gene locus_tag LOCUS_08110 14317 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 15482 17131 gene locus_tag LOCUS_08120 gene hutU 15482 17131 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFF0 protein_id gnl|my_center|LOCUS_08120 >Feature sequence030 512 1570 gene locus_tag LOCUS_08130 512 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1628 4663 gene locus_tag LOCUS_08140 1628 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4684 6996 gene locus_tag LOCUS_08150 4684 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 7027 10209 gene locus_tag LOCUS_08160 7027 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 10214 10453 gene locus_tag LOCUS_08170 gene grx 10214 10453 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_08170 10507 11319 gene locus_tag LOCUS_08180 10507 11319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 12984 11320 gene locus_tag LOCUS_08190 12984 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 13713 13093 gene locus_tag LOCUS_08200 13713 13093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 13886 15442 gene locus_tag LOCUS_08210 13886 15442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence031 1435 2427 gene locus_tag LOCUS_08220 1435 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 2408 3250 gene locus_tag LOCUS_08230 2408 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 4246 3242 gene locus_tag LOCUS_08240 4246 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5267 4239 gene locus_tag LOCUS_08250 5267 4239 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 protein_id gnl|my_center|LOCUS_08250 6206 5277 gene locus_tag LOCUS_08260 6206 5277 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932009.1 protein_id gnl|my_center|LOCUS_08260 6822 6208 gene locus_tag LOCUS_08270 6822 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 8204 6825 gene locus_tag LOCUS_08280 8204 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 10014 8308 gene locus_tag LOCUS_08290 10014 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 10624 10091 gene locus_tag LOCUS_08300 10624 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 11231 10644 gene locus_tag LOCUS_08310 11231 10644 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_08310 12192 11218 gene locus_tag LOCUS_08320 12192 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 13189 12182 gene locus_tag LOCUS_08330 13189 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08330 13631 13173 gene locus_tag LOCUS_08340 13631 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08340 14391 13633 gene locus_tag LOCUS_08350 gene uppP2 14391 13633 CDS product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HND2 protein_id gnl|my_center|LOCUS_08350 15128 14445 gene locus_tag LOCUS_08360 15128 14445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence032 203 1906 gene locus_tag LOCUS_08370 203 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_08370 1903 2646 gene locus_tag LOCUS_08380 1903 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_08380 2646 3077 gene locus_tag LOCUS_08390 2646 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 3187 3927 gene locus_tag LOCUS_08400 3187 3927 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62036 protein_id gnl|my_center|LOCUS_08400 3931 4407 gene locus_tag LOCUS_08410 gene ruvC 3931 4407 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RGS0 protein_id gnl|my_center|LOCUS_08410 4404 5003 gene locus_tag LOCUS_08420 gene ruvA 4404 5003 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZEU6 protein_id gnl|my_center|LOCUS_08420 5032 6228 gene locus_tag LOCUS_08430 5032 6228 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH36 protein_id gnl|my_center|LOCUS_08430 6232 7326 gene locus_tag LOCUS_08440 gene gcvT 6232 7326 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54378 protein_id gnl|my_center|LOCUS_08440 7412 8821 gene locus_tag LOCUS_08450 gene gltX 7412 8821 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIG1 protein_id gnl|my_center|LOCUS_08450 8814 10490 gene locus_tag LOCUS_08460 gene glnS 8814 10490 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727A5 protein_id gnl|my_center|LOCUS_08460 10543 11865 gene locus_tag LOCUS_08470 10543 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 11901 12410 gene locus_tag LOCUS_08480 11901 12410 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583584.1 protein_id gnl|my_center|LOCUS_08480 12394 14361 gene locus_tag LOCUS_08490 12394 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 14426 14629 gene locus_tag LOCUS_08500 14426 14629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 14705 15919 gene locus_tag LOCUS_08510 14705 15919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 15944 16018 gene locus_tag LOCUS_t00080 15944 16018 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence033 997 209 gene locus_tag LOCUS_08520 997 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 2103 997 gene locus_tag LOCUS_08530 2103 997 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105114.1 protein_id gnl|my_center|LOCUS_08530 2412 2113 gene locus_tag LOCUS_08540 2412 2113 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I508 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08540 2649 3113 gene locus_tag LOCUS_08550 2649 3113 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933079.1 protein_id gnl|my_center|LOCUS_08550 3139 4149 gene locus_tag LOCUS_08560 3139 4149 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKP2 protein_id gnl|my_center|LOCUS_08560 4347 4910 gene locus_tag LOCUS_08570 4347 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 5124 4972 gene locus_tag LOCUS_08580 5124 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 5990 6352 gene locus_tag LOCUS_08590 gene yuxK 5990 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_08590 6931 6443 gene locus_tag LOCUS_08600 6931 6443 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_08600 7597 6944 gene locus_tag LOCUS_08610 7597 6944 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_08610 7649 9025 gene locus_tag LOCUS_08620 7649 9025 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_08620 9022 9213 gene locus_tag LOCUS_08630 9022 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 9323 10615 gene locus_tag LOCUS_08640 gene purA 9323 10615 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97D87 protein_id gnl|my_center|LOCUS_08640 10615 12951 gene locus_tag LOCUS_08650 gene purL2 10615 12951 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUW4 protein_id gnl|my_center|LOCUS_08650 12948 13982 gene locus_tag LOCUS_08660 gene purM 12948 13982 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUW5 protein_id gnl|my_center|LOCUS_08660 13995 15251 gene locus_tag LOCUS_08670 gene purQ 13995 15251 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUW6 protein_id gnl|my_center|LOCUS_08670 >Feature sequence034 1039 800 gene locus_tag LOCUS_08680 1039 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 1296 2246 gene locus_tag LOCUS_08690 gene gldA 1296 2246 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_08690 2239 2952 gene locus_tag LOCUS_08700 2239 2952 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_08700 2956 4461 gene locus_tag LOCUS_08710 2956 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_08710 4454 5023 gene locus_tag LOCUS_08720 4454 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 5038 5418 gene locus_tag LOCUS_08730 gene groS1 5038 5418 CDS product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545317.1 protein_id gnl|my_center|LOCUS_08730 7526 5412 gene locus_tag LOCUS_08740 7526 5412 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_08740 8187 7543 gene locus_tag LOCUS_08750 gene cobB 8187 7543 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67919 protein_id gnl|my_center|LOCUS_08750 9088 8258 gene locus_tag LOCUS_08760 9088 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 9944 9099 gene locus_tag LOCUS_08770 9944 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 10765 9947 gene locus_tag LOCUS_08780 10765 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 11642 10776 gene locus_tag LOCUS_08790 11642 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 11970 11629 gene locus_tag LOCUS_08800 11970 11629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 13099 11972 gene locus_tag LOCUS_08810 13099 11972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258901.1 protein_id gnl|my_center|LOCUS_08810 14925 13117 gene locus_tag LOCUS_08820 14925 13117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence035 1350 610 gene locus_tag LOCUS_08830 gene lpxH 1350 610 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_08830 1495 4689 gene locus_tag LOCUS_08840 1495 4689 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405100.1 protein_id gnl|my_center|LOCUS_08840 4737 6086 gene locus_tag LOCUS_08850 gene radA 4737 6086 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YS2 protein_id gnl|my_center|LOCUS_08850 6126 7259 gene locus_tag LOCUS_08860 gene tgt 6126 7259 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9I0 protein_id gnl|my_center|LOCUS_08860 7259 7735 gene locus_tag LOCUS_08870 7259 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 7775 7906 gene locus_tag LOCUS_08880 7775 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08880 8063 8230 gene locus_tag LOCUS_08890 8063 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08890 9185 8256 gene locus_tag LOCUS_08900 9185 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 9863 9237 gene locus_tag LOCUS_08910 9863 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 11011 9863 gene locus_tag LOCUS_08920 11011 9863 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258372.1 protein_id gnl|my_center|LOCUS_08920 12077 11091 gene locus_tag LOCUS_08930 12077 11091 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674004.1 protein_id gnl|my_center|LOCUS_08930 13172 12078 gene locus_tag LOCUS_08940 gene hppD 13172 12078 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404122.1 protein_id gnl|my_center|LOCUS_08940 14254 13169 gene locus_tag LOCUS_08950 gene hisC 14254 13169 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH65 protein_id gnl|my_center|LOCUS_08950 14715 14257 gene locus_tag LOCUS_08960 gene lrp 14715 14257 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705740.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence036 4381 2318 gene locus_tag LOCUS_08970 4381 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 4805 4545 gene locus_tag LOCUS_08980 4805 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 8014 4898 gene locus_tag LOCUS_08990 8014 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 8216 8049 gene locus_tag LOCUS_09000 8216 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 9615 8461 gene locus_tag LOCUS_09010 9615 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 11059 10361 gene locus_tag LOCUS_09020 11059 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 12073 11093 gene locus_tag LOCUS_09030 12073 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 13717 12260 gene locus_tag LOCUS_09040 13717 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 14475 13996 gene locus_tag LOCUS_09050 gene greA 14475 13996 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJG9 protein_id gnl|my_center|LOCUS_09050 >Feature sequence037 3531 1513 gene locus_tag LOCUS_09060 3531 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 3890 3546 gene locus_tag LOCUS_09070 3890 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 4329 3910 gene locus_tag LOCUS_09080 4329 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 7572 4405 gene locus_tag LOCUS_09090 7572 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 9095 7575 gene locus_tag LOCUS_09100 9095 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 10762 9500 gene locus_tag LOCUS_09110 gene surA 10762 9500 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT1 protein_id gnl|my_center|LOCUS_09110 11553 10762 gene locus_tag LOCUS_09120 11553 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 <14543 11564 gene locus_tag LOCUS_09130 <14543 11564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5I7R4:transcription-repair-coupling factor >Feature sequence038 2346 2807 gene locus_tag LOCUS_09140 2346 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2830 4248 gene locus_tag LOCUS_09150 2830 4248 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_09150 4335 5387 gene locus_tag LOCUS_09160 4335 5387 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_09160 5570 5388 gene locus_tag LOCUS_09170 5570 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 5494 8562 gene locus_tag LOCUS_09180 5494 8562 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_09180 9296 8649 gene locus_tag LOCUS_09190 9296 8649 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871201.1 protein_id gnl|my_center|LOCUS_09190 9420 9626 gene locus_tag LOCUS_09200 9420 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 10172 9972 gene locus_tag LOCUS_09210 10172 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 10257 10475 gene locus_tag LOCUS_09220 10257 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 10529 11776 gene locus_tag LOCUS_09230 10529 11776 CDS product enoyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896009.1 protein_id gnl|my_center|LOCUS_09230 13094 11883 gene locus_tag LOCUS_09240 13094 11883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 13191 13361 gene locus_tag LOCUS_09250 13191 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 13369 13548 gene locus_tag LOCUS_09260 13369 13548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence039 1870 590 gene locus_tag LOCUS_09270 1870 590 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405551.1 protein_id gnl|my_center|LOCUS_09270 3219 1873 gene locus_tag LOCUS_09280 3219 1873 CDS product outer membrane efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545697.1 protein_id gnl|my_center|LOCUS_09280 4652 3231 gene locus_tag LOCUS_09290 4652 3231 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 protein_id gnl|my_center|LOCUS_09290 4821 5663 gene locus_tag LOCUS_09300 4821 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 6685 5633 gene locus_tag LOCUS_09310 6685 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 9642 6697 gene locus_tag LOCUS_09320 9642 6697 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933665.1 protein_id gnl|my_center|LOCUS_09320 9975 9646 gene locus_tag LOCUS_09330 9975 9646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 12134 10059 gene locus_tag LOCUS_09340 gene recG 12134 10059 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5W6 protein_id gnl|my_center|LOCUS_09340 13490 12150 gene locus_tag LOCUS_09350 13490 12150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 <14481 13490 gene locus_tag LOCUS_09360 <14481 13490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3Y009:valine--tRNA ligase >Feature sequence040 478 960 gene locus_tag LOCUS_09370 478 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 944 1396 gene locus_tag LOCUS_09380 944 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1457 1530 gene locus_tag LOCUS_t00090 1457 1530 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1592 2341 gene locus_tag LOCUS_09390 1592 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 5892 2338 gene locus_tag LOCUS_09400 5892 2338 CDS product fibronectin type III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942590.1 protein_id gnl|my_center|LOCUS_09400 7730 5892 gene locus_tag LOCUS_09410 7730 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 8603 7740 gene locus_tag LOCUS_09420 8603 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 8627 9340 gene locus_tag LOCUS_09430 8627 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 9337 9675 gene locus_tag LOCUS_09440 9337 9675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 9730 11637 gene locus_tag LOCUS_09450 9730 11637 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707195.1 protein_id gnl|my_center|LOCUS_09450 11642 12928 gene locus_tag LOCUS_09460 11642 12928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 12928 13986 gene locus_tag LOCUS_09470 gene yejE 12928 13986 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261416.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence041 808 1674 gene locus_tag LOCUS_09480 gene rmlD 808 1674 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_09480 1638 2384 gene locus_tag LOCUS_09490 1638 2384 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_09490 2398 3447 gene locus_tag LOCUS_09500 2398 3447 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583473.1 protein_id gnl|my_center|LOCUS_09500 3458 4426 gene locus_tag LOCUS_09510 gene accA 3458 4426 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S032 protein_id gnl|my_center|LOCUS_09510 4423 4827 gene locus_tag LOCUS_09520 4423 4827 CDS product acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_09520 5660 4824 gene locus_tag LOCUS_09530 5660 4824 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139790.1 protein_id gnl|my_center|LOCUS_09530 7327 5729 gene locus_tag LOCUS_09540 7327 5729 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_09540 9212 7383 gene locus_tag LOCUS_09550 9212 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 9533 10201 gene locus_tag LOCUS_09560 9533 10201 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980489.1 protein_id gnl|my_center|LOCUS_09560 10204 12363 gene locus_tag LOCUS_09570 gene pepX1 10204 12363 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_09570 12448 12375 gene locus_tag LOCUS_t00100 12448 12375 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12535 13167 gene locus_tag LOCUS_09580 12535 13167 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence042 2708 807 gene locus_tag LOCUS_09590 gene dnaK 2708 807 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_09590 5312 2853 gene locus_tag LOCUS_09600 gene clpC 5312 2853 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_09600 5997 5320 gene locus_tag LOCUS_09610 gene lolD 5997 5320 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFV0 protein_id gnl|my_center|LOCUS_09610 7151 5985 gene locus_tag LOCUS_09620 7151 5985 CDS product lipoprotein ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947994.1 protein_id gnl|my_center|LOCUS_09620 8311 7148 gene locus_tag LOCUS_09630 8311 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 9808 8318 gene locus_tag LOCUS_09640 gene lysS 9808 8318 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCM7 protein_id gnl|my_center|LOCUS_09640 10821 9823 gene locus_tag LOCUS_09650 gene prfB 10821 9823 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AS3 protein_id gnl|my_center|LOCUS_09650 11783 11007 gene locus_tag LOCUS_09660 11783 11007 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_09660 12565 11780 gene locus_tag LOCUS_09670 gene folP 12565 11780 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJQ5 protein_id gnl|my_center|LOCUS_09670 <13339 12636 gene locus_tag LOCUS_09680 <13339 12636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C66:ATP-dependent zinc metalloprotease FtsH >Feature sequence043 <1 614 gene locus_tag LOCUS_09690 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963739.1:thiol:disulfide interchange protein DsbD 611 1186 gene locus_tag LOCUS_09700 611 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1189 4188 gene locus_tag LOCUS_09710 1189 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 4368 8174 gene locus_tag LOCUS_09720 4368 8174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 8285 9664 gene locus_tag LOCUS_09730 8285 9664 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933114.1 protein_id gnl|my_center|LOCUS_09730 9772 13068 gene locus_tag LOCUS_09740 gene ileS 9772 13068 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56690 protein_id gnl|my_center|LOCUS_09740 >Feature sequence044 970 38 gene locus_tag LOCUS_09750 gene phhA 970 38 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035413.1 protein_id gnl|my_center|LOCUS_09750 1354 1019 gene locus_tag LOCUS_09760 1354 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1414 2379 gene locus_tag LOCUS_09770 gene yhdN 1414 2379 CDS product general stress protein 69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80874 protein_id gnl|my_center|LOCUS_09770 4090 2381 gene locus_tag LOCUS_09780 4090 2381 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257624.1 protein_id gnl|my_center|LOCUS_09780 5597 4122 gene locus_tag LOCUS_09790 gene putP 5597 4122 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_09790 6658 5594 gene locus_tag LOCUS_09800 6658 5594 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_09800 6770 7933 gene locus_tag LOCUS_09810 6770 7933 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810429.1 protein_id gnl|my_center|LOCUS_09810 9609 7936 gene locus_tag LOCUS_09820 9609 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 9688 11103 gene locus_tag LOCUS_09830 9688 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 11169 12878 gene locus_tag LOCUS_09840 11169 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402920.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence045 2119 1586 gene locus_tag LOCUS_09850 gene hpt 2119 1586 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404455.1 protein_id gnl|my_center|LOCUS_09850 3495 2116 gene locus_tag LOCUS_09860 gene tilS 3495 2116 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_09860 4161 3511 gene locus_tag LOCUS_09870 4161 3511 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048078.1 protein_id gnl|my_center|LOCUS_09870 5222 4158 gene locus_tag LOCUS_09880 5222 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775723.1 protein_id gnl|my_center|LOCUS_09880 5995 5333 gene locus_tag LOCUS_09890 5995 5333 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065117.1 protein_id gnl|my_center|LOCUS_09890 6657 5995 gene locus_tag LOCUS_09900 6657 5995 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_09900 7273 6662 gene locus_tag LOCUS_09910 7273 6662 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546630.1 protein_id gnl|my_center|LOCUS_09910 7541 7275 gene locus_tag LOCUS_09920 7541 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 9505 7538 gene locus_tag LOCUS_09930 gene ccmF 9505 7538 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997623.1 protein_id gnl|my_center|LOCUS_09930 9930 9502 gene locus_tag LOCUS_09940 9930 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 11604 9946 gene locus_tag LOCUS_09950 11604 9946 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249802.1 protein_id gnl|my_center|LOCUS_09950 <12353 11614 gene locus_tag LOCUS_09960 <12353 11614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67036:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence046 3769 6027 gene locus_tag LOCUS_09970 gene acn 3769 6027 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_09970 6033 7619 gene locus_tag LOCUS_09980 gene serA 6033 7619 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKK8 protein_id gnl|my_center|LOCUS_09980 7694 8122 gene locus_tag LOCUS_09990 7694 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 8209 9138 gene locus_tag LOCUS_10000 8209 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 9196 10479 gene locus_tag LOCUS_10010 gene miaB 9196 10479 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZF8 protein_id gnl|my_center|LOCUS_10010 10479 10805 gene locus_tag LOCUS_10020 10479 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 10808 11860 gene locus_tag LOCUS_10030 10808 11860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence047 <1 4164 gene locus_tag LOCUS_10040 <1 4164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase 4343 4759 gene locus_tag LOCUS_10050 4343 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 4794 5513 gene locus_tag LOCUS_10060 4794 5513 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_10060 6380 5520 gene locus_tag LOCUS_10070 6380 5520 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709054.1 protein_id gnl|my_center|LOCUS_10070 7785 6382 gene locus_tag LOCUS_10080 gene dapE 7785 6382 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946545.1 protein_id gnl|my_center|LOCUS_10080 8651 7845 gene locus_tag LOCUS_10090 8651 7845 CDS product phthiotriol/phenolphthiotriol dimycocerosates methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CD86 protein_id gnl|my_center|LOCUS_10090 10090 8693 gene locus_tag LOCUS_10100 10090 8693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 10580 10077 gene locus_tag LOCUS_10110 10580 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence048 2207 480 gene locus_tag LOCUS_10120 2207 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 4940 2223 gene locus_tag LOCUS_10130 4940 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 6739 4946 gene locus_tag LOCUS_10140 6739 4946 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_10140 8391 6745 gene locus_tag LOCUS_10150 8391 6745 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869295.1 protein_id gnl|my_center|LOCUS_10150 9887 8388 gene locus_tag LOCUS_10160 gene malQ 9887 8388 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DY3 protein_id gnl|my_center|LOCUS_10160 10815 10018 gene locus_tag LOCUS_10170 10815 10018 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432043.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence049 1821 727 gene locus_tag LOCUS_10180 1821 727 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_10180 3206 1818 gene locus_tag LOCUS_10190 gene dacB 3206 1818 CDS product peptidase S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957323.1 protein_id gnl|my_center|LOCUS_10190 3620 3207 gene locus_tag LOCUS_10200 3620 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 3682 4392 gene locus_tag LOCUS_10210 3682 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 5358 4378 gene locus_tag LOCUS_10220 gene kdsD 5358 4378 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_10220 5539 5712 gene locus_tag LOCUS_10230 5539 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 5714 6472 gene locus_tag LOCUS_10240 5714 6472 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_10240 6628 7899 gene locus_tag LOCUS_10250 6628 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 8030 8185 gene locus_tag LOCUS_10260 8030 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 8185 8808 gene locus_tag LOCUS_10270 gene lexA 8185 8808 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q8 protein_id gnl|my_center|LOCUS_10270 8819 9991 gene locus_tag LOCUS_10280 8819 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence050 <1 1195 gene locus_tag LOCUS_10290 <1 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87KT0:bifunctional purine biosynthesis protein PurH 1287 2390 gene locus_tag LOCUS_10300 1287 2390 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706804.1 protein_id gnl|my_center|LOCUS_10300 2422 3096 gene locus_tag LOCUS_10310 2422 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 3190 4371 gene locus_tag LOCUS_10320 3190 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 4826 4377 gene locus_tag LOCUS_10330 4826 4377 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962822.1 protein_id gnl|my_center|LOCUS_10330 5652 4816 gene locus_tag LOCUS_10340 5652 4816 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_10340 5807 7132 gene locus_tag LOCUS_10350 5807 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 7148 8926 gene locus_tag LOCUS_10360 7148 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 10733 9045 gene locus_tag LOCUS_10370 10733 9045 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986853.1 protein_id gnl|my_center|LOCUS_10370 11490 10789 gene locus_tag LOCUS_10380 gene phoB 11490 10789 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence051 44 526 gene locus_tag LOCUS_10390 44 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 526 684 gene locus_tag LOCUS_10400 526 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 748 1077 gene locus_tag LOCUS_10410 748 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1117 2832 gene locus_tag LOCUS_10420 gene ctaD 1117 2832 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_10420 2829 3431 gene locus_tag LOCUS_10430 2829 3431 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_10430 3443 3748 gene locus_tag LOCUS_10440 3443 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3751 3936 gene locus_tag LOCUS_10450 3751 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 3936 4157 gene locus_tag LOCUS_10460 3936 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4160 4996 gene locus_tag LOCUS_10470 4160 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 7362 5005 gene locus_tag LOCUS_10480 7362 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 9150 7381 gene locus_tag LOCUS_10490 9150 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 10582 9143 gene locus_tag LOCUS_10500 10582 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 10990 10592 gene locus_tag LOCUS_10510 10990 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 <11581 11016 gene locus_tag LOCUS_10520 <11581 11016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:GlyGly-CTERM sorting domain-containing protein >Feature sequence052 606 1061 gene locus_tag LOCUS_10530 606 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1076 1456 gene locus_tag LOCUS_10540 1076 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1801 3000 gene locus_tag LOCUS_10550 1801 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2984 3535 gene locus_tag LOCUS_10560 2984 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 3547 3870 gene locus_tag LOCUS_10570 3547 3870 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CA3 protein_id gnl|my_center|LOCUS_10570 3873 4466 gene locus_tag LOCUS_10580 gene recR 3873 4466 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CA2 protein_id gnl|my_center|LOCUS_10580 4520 5050 gene locus_tag LOCUS_10590 gene pgsA 4520 5050 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932027.1 protein_id gnl|my_center|LOCUS_10590 5047 5508 gene locus_tag LOCUS_10600 gene pgpA 5047 5508 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y504 protein_id gnl|my_center|LOCUS_10600 5505 6725 gene locus_tag LOCUS_10610 gene cinA 5505 6725 CDS product putative competence-damage inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYA4 protein_id gnl|my_center|LOCUS_10610 6718 7296 gene locus_tag LOCUS_10620 6718 7296 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Z9 protein_id gnl|my_center|LOCUS_10620 7306 8328 gene locus_tag LOCUS_10630 gene recA 7306 8328 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH9 protein_id gnl|my_center|LOCUS_10630 8261 8950 gene locus_tag LOCUS_10640 gene recX 8261 8950 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31575 protein_id gnl|my_center|LOCUS_10640 8947 10731 gene locus_tag LOCUS_10650 8947 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 11162 11078 gene locus_tag LOCUS_t00110 11162 11078 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence053 1709 1080 gene locus_tag LOCUS_10660 gene tmk 1709 1080 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCU7 protein_id gnl|my_center|LOCUS_10660 2391 1693 gene locus_tag LOCUS_10670 gene rsmI 2391 1693 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF6 protein_id gnl|my_center|LOCUS_10670 3713 2394 gene locus_tag LOCUS_10680 3713 2394 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403564.1 protein_id gnl|my_center|LOCUS_10680 5245 3716 gene locus_tag LOCUS_10690 5245 3716 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_10690 6608 5277 gene locus_tag LOCUS_10700 gene argD 6608 5277 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7L6 protein_id gnl|my_center|LOCUS_10700 8089 6707 gene locus_tag LOCUS_10710 8089 6707 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_10710 8980 8111 gene locus_tag LOCUS_10720 gene rimK 8980 8111 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_10720 9444 8980 gene locus_tag LOCUS_10730 9444 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10730 9672 9490 gene locus_tag LOCUS_10740 9672 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence054 1643 2764 gene locus_tag LOCUS_10750 1643 2764 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_10750 2791 4554 gene locus_tag LOCUS_10760 2791 4554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056425.1 protein_id gnl|my_center|LOCUS_10760 4639 5736 gene locus_tag LOCUS_10770 4639 5736 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304146.1 protein_id gnl|my_center|LOCUS_10770 5960 5754 gene locus_tag LOCUS_10780 5960 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 6171 7199 gene locus_tag LOCUS_10790 6171 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 7466 8110 gene locus_tag LOCUS_10800 7466 8110 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_10800 8219 9934 gene locus_tag LOCUS_10810 8219 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence055 5047 1424 gene locus_tag LOCUS_10820 5047 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402959.1 protein_id gnl|my_center|LOCUS_10820 5933 5049 gene locus_tag LOCUS_10830 5933 5049 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071881.1 protein_id gnl|my_center|LOCUS_10830 6703 5969 gene locus_tag LOCUS_10840 6703 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 7508 6858 gene locus_tag LOCUS_10850 7508 6858 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 protein_id gnl|my_center|LOCUS_10850 8228 7605 gene locus_tag LOCUS_10860 8228 7605 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948650.1 protein_id gnl|my_center|LOCUS_10860 8596 9063 gene locus_tag LOCUS_10870 8596 9063 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_10870 <10035 9158 gene locus_tag LOCUS_10880 <10035 9158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015839.1:membrane protein >Feature sequence056 201 485 gene locus_tag LOCUS_10890 201 485 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW8 protein_id gnl|my_center|LOCUS_10890 1069 500 gene locus_tag LOCUS_10900 gene bioY 1069 500 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ6 protein_id gnl|my_center|LOCUS_10900 1847 1089 gene locus_tag LOCUS_10910 1847 1089 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097194.1 protein_id gnl|my_center|LOCUS_10910 2792 1893 gene locus_tag LOCUS_10920 2792 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 3905 2793 gene locus_tag LOCUS_10930 3905 2793 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762566.1 protein_id gnl|my_center|LOCUS_10930 5193 3919 gene locus_tag LOCUS_10940 5193 3919 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_10940 6410 5193 gene locus_tag LOCUS_10950 6410 5193 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767086.1 protein_id gnl|my_center|LOCUS_10950 7342 6401 gene locus_tag LOCUS_10960 7342 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 8381 7335 gene locus_tag LOCUS_10970 8381 7335 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence057 1145 2560 gene locus_tag LOCUS_10980 1145 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3660 2566 gene locus_tag LOCUS_10990 3660 2566 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933214.1 protein_id gnl|my_center|LOCUS_10990 3722 5083 gene locus_tag LOCUS_11000 3722 5083 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451023.1 protein_id gnl|my_center|LOCUS_11000 5959 5078 gene locus_tag LOCUS_11010 gene prmA 5959 5078 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJR7 protein_id gnl|my_center|LOCUS_11010 5980 6876 gene locus_tag LOCUS_11020 gene murQ 5980 6876 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81HH1 protein_id gnl|my_center|LOCUS_11020 6873 7919 gene locus_tag LOCUS_11030 6873 7919 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CXS1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence058 546 821 gene locus_tag LOCUS_11040 546 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1927 827 gene locus_tag LOCUS_11050 1927 827 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_11050 2123 2572 gene locus_tag LOCUS_11060 gene smpB 2123 2572 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL97 protein_id gnl|my_center|LOCUS_11060 2569 3777 gene locus_tag LOCUS_11070 gene tyrS 2569 3777 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S238 protein_id gnl|my_center|LOCUS_11070 3888 5387 gene locus_tag LOCUS_11080 gene pafA 3888 5387 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_11080 5389 6276 gene locus_tag LOCUS_11090 gene yhaQ 5389 6276 CDS product putative ABC transporter ATP-binding protein YhaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0SPB4 protein_id gnl|my_center|LOCUS_11090 6273 7499 gene locus_tag LOCUS_11100 6273 7499 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024244.1 protein_id gnl|my_center|LOCUS_11100 7543 8586 gene locus_tag LOCUS_11110 7543 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_11110 8671 9039 gene locus_tag LOCUS_11120 8671 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 9048 9136 gene locus_tag LOCUS_t00120 9048 9136 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence059 1894 875 gene locus_tag LOCUS_11130 1894 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 5115 1891 gene locus_tag LOCUS_11140 5115 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 8558 5112 gene locus_tag LOCUS_11150 8558 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence060 216 917 gene locus_tag LOCUS_11160 gene sfsA 216 917 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXT1 protein_id gnl|my_center|LOCUS_11160 1097 936 gene locus_tag LOCUS_11170 1097 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1255 2637 gene locus_tag LOCUS_11180 1255 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2639 3697 gene locus_tag LOCUS_11190 gene manC 2639 3697 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_11190 3697 3957 gene locus_tag LOCUS_11200 3697 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 4037 6112 gene locus_tag LOCUS_11210 gene fusA 4037 6112 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_11210 6126 6626 gene locus_tag LOCUS_11220 6126 6626 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_11220 6619 6921 gene locus_tag LOCUS_11230 6619 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 6921 8768 gene locus_tag LOCUS_11240 6921 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8833 8906 gene locus_tag LOCUS_t00130 8833 8906 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence061 495 1733 gene locus_tag LOCUS_11250 495 1733 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_11250 1743 3185 gene locus_tag LOCUS_11260 1743 3185 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056233.1 protein_id gnl|my_center|LOCUS_11260 3185 4507 gene locus_tag LOCUS_11270 3185 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056219.1 protein_id gnl|my_center|LOCUS_11270 4511 5608 gene locus_tag LOCUS_11280 4511 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 5611 6042 gene locus_tag LOCUS_11290 5611 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 <8930 6029 gene locus_tag LOCUS_11300 <8930 6029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18D66:DNA helicase >Feature sequence062 101 28 gene locus_tag LOCUS_t00140 101 28 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 262 885 gene locus_tag LOCUS_11310 262 885 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_11310 914 7270 gene locus_tag LOCUS_11320 914 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 7272 8213 gene locus_tag LOCUS_11330 7272 8213 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence063 333 848 gene locus_tag LOCUS_11340 gene rplJ 333 848 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273085.1 protein_id gnl|my_center|LOCUS_11340 880 1257 gene locus_tag LOCUS_11350 gene rplL 880 1257 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0X1 protein_id gnl|my_center|LOCUS_11350 1312 5088 gene locus_tag LOCUS_11360 gene rpoB 1312 5088 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1Q5 protein_id gnl|my_center|LOCUS_11360 >Feature sequence064 <1 2219 gene locus_tag LOCUS_11370 <1 2219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 2216 3217 gene locus_tag LOCUS_11380 2216 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 3214 4062 gene locus_tag LOCUS_11390 3214 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 4909 4067 gene locus_tag LOCUS_11400 4909 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_11400 5442 4906 gene locus_tag LOCUS_11410 5442 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 5801 5439 gene locus_tag LOCUS_11420 5801 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 5863 6249 gene locus_tag LOCUS_11430 5863 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 8558 6291 gene locus_tag LOCUS_11440 8558 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence065 598 2385 gene locus_tag LOCUS_11450 gene fadD 598 2385 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_11450 2392 3387 gene locus_tag LOCUS_11460 gene gpsA 2392 3387 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182W5 protein_id gnl|my_center|LOCUS_11460 3443 5749 gene locus_tag LOCUS_11470 3443 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence066 34 1701 gene locus_tag LOCUS_11480 34 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 2249 1731 gene locus_tag LOCUS_11490 2249 1731 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228315.1 protein_id gnl|my_center|LOCUS_11490 3132 2242 gene locus_tag LOCUS_11500 gene ctaB 3132 2242 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S012 protein_id gnl|my_center|LOCUS_11500 3720 3133 gene locus_tag LOCUS_11510 gene ypmQ 3720 3133 CDS product SCO1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54178 protein_id gnl|my_center|LOCUS_11510 4645 3713 gene locus_tag LOCUS_11520 gene ctaA 4645 3713 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087694.1 protein_id gnl|my_center|LOCUS_11520 4792 6099 gene locus_tag LOCUS_11530 4792 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 6679 7473 gene locus_tag LOCUS_11540 6679 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 7478 8035 gene locus_tag LOCUS_11550 gene petC 7478 8035 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F722 protein_id gnl|my_center|LOCUS_11550 >Feature sequence067 1775 4450 gene locus_tag LOCUS_11560 1775 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 5738 4587 gene locus_tag LOCUS_11570 gene clpX 5738 4587 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI39 protein_id gnl|my_center|LOCUS_11570 6343 5735 gene locus_tag LOCUS_11580 gene clpP1 6343 5735 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180F0 protein_id gnl|my_center|LOCUS_11580 7622 6333 gene locus_tag LOCUS_11590 gene tig 7622 6333 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U2 protein_id gnl|my_center|LOCUS_11590 8338 7709 gene locus_tag LOCUS_11600 8338 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence068 142 807 gene locus_tag LOCUS_11610 gene rpe 142 807 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y193 protein_id gnl|my_center|LOCUS_11610 811 2835 gene locus_tag LOCUS_11620 811 2835 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257698.1 protein_id gnl|my_center|LOCUS_11620 2832 3269 gene locus_tag LOCUS_11630 2832 3269 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804783.1 protein_id gnl|my_center|LOCUS_11630 3353 4768 gene locus_tag LOCUS_11640 3353 4768 CDS product NadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081268.1 protein_id gnl|my_center|LOCUS_11640 4765 5649 gene locus_tag LOCUS_11650 4765 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5741 6973 gene locus_tag LOCUS_11660 gene gdhA 5741 6973 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96110 protein_id gnl|my_center|LOCUS_11660 7015 7821 gene locus_tag LOCUS_11670 7015 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence069 1168 653 gene locus_tag LOCUS_11680 1168 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1513 1187 gene locus_tag LOCUS_11690 1513 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2042 1596 gene locus_tag LOCUS_11700 2042 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3017 2043 gene locus_tag LOCUS_11710 gene lepB 3017 2043 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCH1 protein_id gnl|my_center|LOCUS_11710 3980 3051 gene locus_tag LOCUS_11720 3980 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 4118 5692 gene locus_tag LOCUS_11730 gene alsT 4118 5692 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125688.1 protein_id gnl|my_center|LOCUS_11730 5676 6470 gene locus_tag LOCUS_11740 gene suhB 5676 6470 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_11740 7131 6463 gene locus_tag LOCUS_11750 7131 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 7242 7168 gene locus_tag LOCUS_t00150 7242 7168 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <7878 7270 gene locus_tag LOCUS_11760 <7878 7270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase >Feature sequence070 4893 4333 gene locus_tag LOCUS_11770 4893 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 4983 6470 gene locus_tag LOCUS_11780 4983 6470 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932316.1 protein_id gnl|my_center|LOCUS_11780 6762 6523 gene locus_tag LOCUS_11790 6762 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 7227 6775 gene locus_tag LOCUS_11800 7227 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 <7856 7267 gene locus_tag LOCUS_11810 <7856 7267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8RFG1:imidazolonepropionase >Feature sequence071 5009 3393 gene locus_tag LOCUS_11820 gene pckA 5009 3393 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9E4 protein_id gnl|my_center|LOCUS_11820 5933 5025 gene locus_tag LOCUS_11830 gene xerD 5933 5025 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818Z7 protein_id gnl|my_center|LOCUS_11830 6897 5935 gene locus_tag LOCUS_11840 gene ylyB 6897 5935 CDS product putative RNA pseudouridine synthase YlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45480 protein_id gnl|my_center|LOCUS_11840 7370 6900 gene locus_tag LOCUS_11850 gene lspA 7370 6900 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG5 protein_id gnl|my_center|LOCUS_11850 7780 7385 gene locus_tag LOCUS_11860 7780 7385 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403235.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence072 2606 1767 gene locus_tag LOCUS_11870 2606 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3417 2593 gene locus_tag LOCUS_11880 gene lgt 3417 2593 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND43 protein_id gnl|my_center|LOCUS_11880 4175 3417 gene locus_tag LOCUS_11890 4175 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 4967 4257 gene locus_tag LOCUS_11900 4967 4257 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402891.1 protein_id gnl|my_center|LOCUS_11900 6775 4973 gene locus_tag LOCUS_11910 gene lepA 6775 4973 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCH0 protein_id gnl|my_center|LOCUS_11910 7307 6882 gene locus_tag LOCUS_11920 7307 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence073 376 218 gene locus_tag LOCUS_11930 376 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 469 951 gene locus_tag LOCUS_11940 469 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1846 965 gene locus_tag LOCUS_11950 1846 965 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616036.1 protein_id gnl|my_center|LOCUS_11950 1989 2141 gene locus_tag LOCUS_11960 1989 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 2882 2193 gene locus_tag LOCUS_11970 gene mip 2882 2193 CDS product outer membrane protein MIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXE0 protein_id gnl|my_center|LOCUS_11970 3104 2940 gene locus_tag LOCUS_11980 3104 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 3203 3865 gene locus_tag LOCUS_11990 3203 3865 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946517.1 protein_id gnl|my_center|LOCUS_11990 3868 4476 gene locus_tag LOCUS_12000 3868 4476 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104490.1 protein_id gnl|my_center|LOCUS_12000 4723 4520 gene locus_tag LOCUS_12010 gene cspC 4723 4520 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357053.1 protein_id gnl|my_center|LOCUS_12010 5253 4720 gene locus_tag LOCUS_12020 5253 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 5434 6087 gene locus_tag LOCUS_12030 5434 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 6283 6095 gene locus_tag LOCUS_12040 6283 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6844 6404 gene locus_tag LOCUS_12050 6844 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 <7759 6869 gene locus_tag LOCUS_12060 <7759 6869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056400.1:deoxyribodipyrimidine photo-lyase >Feature sequence074 1378 476 gene locus_tag LOCUS_12070 1378 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2197 1418 gene locus_tag LOCUS_12080 2197 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2225 2151 gene locus_tag LOCUS_t00160 2225 2151 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2594 2232 gene locus_tag LOCUS_12090 2594 2232 CDS product transcription regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546816.1 protein_id gnl|my_center|LOCUS_12090 3954 2665 gene locus_tag LOCUS_12100 3954 2665 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_12100 6197 4044 gene locus_tag LOCUS_12110 gene pnp 6197 4044 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS9 protein_id gnl|my_center|LOCUS_12110 6505 6236 gene locus_tag LOCUS_12120 gene rpsO 6505 6236 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJ76 protein_id gnl|my_center|LOCUS_12120 <7268 6514 gene locus_tag LOCUS_12130 <7268 6514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YJY1:riboflavin biosynthesis protein >Feature sequence075 <1 2429 gene locus_tag LOCUS_12140 <1 2429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18BB2:chromosome partition protein Smc 2442 3497 gene locus_tag LOCUS_12150 2442 3497 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_12150 3507 3872 gene locus_tag LOCUS_12160 3507 3872 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765183.1 protein_id gnl|my_center|LOCUS_12160 3946 4806 gene locus_tag LOCUS_12170 3946 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 4803 5240 gene locus_tag LOCUS_12180 gene dut 4803 5240 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97J61 protein_id gnl|my_center|LOCUS_12180 5458 5748 gene locus_tag LOCUS_12190 gene groS 5458 5748 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF03 protein_id gnl|my_center|LOCUS_12190 >Feature sequence076 332 2158 gene locus_tag LOCUS_12200 gene uvrC 332 2158 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S280 protein_id gnl|my_center|LOCUS_12200 2239 4242 gene locus_tag LOCUS_12210 gene uvrB 2239 4242 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180R0 protein_id gnl|my_center|LOCUS_12210 4239 5210 gene locus_tag LOCUS_12220 gene galE 4239 5210 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931718.1 protein_id gnl|my_center|LOCUS_12220 5243 6460 gene locus_tag LOCUS_12230 5243 6460 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933163.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence077 569 853 gene locus_tag LOCUS_12240 569 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1037 3430 gene locus_tag LOCUS_12250 1037 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3437 4009 gene locus_tag LOCUS_12260 3437 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 4002 4976 gene locus_tag LOCUS_12270 4002 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4979 5521 gene locus_tag LOCUS_12280 gene wcbN 4979 5521 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R80 protein_id gnl|my_center|LOCUS_12280 5512 6402 gene locus_tag LOCUS_12290 gene ddl 5512 6402 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFT1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence078 <1 1017 gene locus_tag LOCUS_12300 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZUW7:phosphoribosylaminoimidazole-succinocarboxamide synthase 1014 1400 gene locus_tag LOCUS_12310 gene purE 1014 1400 CDS product phosphoribosylaminoimidazole carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYW9 protein_id gnl|my_center|LOCUS_12310 1393 2742 gene locus_tag LOCUS_12320 gene purB 1393 2742 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WGE1 protein_id gnl|my_center|LOCUS_12320 2768 4243 gene locus_tag LOCUS_12330 gene purF 2768 4243 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUW8 protein_id gnl|my_center|LOCUS_12330 4296 5609 gene locus_tag LOCUS_12340 gene purD 4296 5609 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUW9 protein_id gnl|my_center|LOCUS_12340 5606 6184 gene locus_tag LOCUS_12350 gene purN 5606 6184 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUX0 protein_id gnl|my_center|LOCUS_12350 >Feature sequence079 197 361 gene locus_tag LOCUS_12360 197 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 581 967 gene locus_tag LOCUS_12370 581 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 999 1709 gene locus_tag LOCUS_12380 999 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1789 4527 gene locus_tag LOCUS_12390 1789 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 5989 4592 gene locus_tag LOCUS_12400 gene yflS 5989 4592 CDS product putative malate transporter YflS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34726 protein_id gnl|my_center|LOCUS_12400 6046 6639 gene locus_tag LOCUS_12410 6046 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence080 858 4244 gene locus_tag LOCUS_12420 858 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 4241 5242 gene locus_tag LOCUS_12430 4241 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403960.1 protein_id gnl|my_center|LOCUS_12430 5302 6483 gene locus_tag LOCUS_12440 5302 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence081 360 1478 gene locus_tag LOCUS_12450 360 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1496 4474 gene locus_tag LOCUS_12460 1496 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 5318 4488 gene locus_tag LOCUS_12470 5318 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 5965 5381 gene locus_tag LOCUS_12480 5965 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence082 1298 879 gene locus_tag LOCUS_12490 1298 879 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45083 protein_id gnl|my_center|LOCUS_12490 1544 2281 gene locus_tag LOCUS_12500 1544 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2316 2579 gene locus_tag LOCUS_12510 2316 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 2726 2983 gene locus_tag LOCUS_12520 2726 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3038 4792 gene locus_tag LOCUS_12530 3038 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 4767 6233 gene locus_tag LOCUS_12540 4767 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence083 140 66 gene locus_tag LOCUS_t00170 140 66 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 368 595 gene locus_tag LOCUS_12550 368 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 795 1520 gene locus_tag LOCUS_12560 795 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1600 2820 gene locus_tag LOCUS_12570 1600 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3479 2817 gene locus_tag LOCUS_12580 gene plsY 3479 2817 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG75 protein_id gnl|my_center|LOCUS_12580 5256 3472 gene locus_tag LOCUS_12590 5256 3472 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939228.1 protein_id gnl|my_center|LOCUS_12590 5859 5266 gene locus_tag LOCUS_12600 5859 5266 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence084 171 1826 gene locus_tag LOCUS_12610 171 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403702.1 protein_id gnl|my_center|LOCUS_12610 1910 2752 gene locus_tag LOCUS_12620 1910 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2793 3602 gene locus_tag LOCUS_12630 2793 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3599 4450 gene locus_tag LOCUS_12640 3599 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 4456 5433 gene locus_tag LOCUS_12650 4456 5433 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971182.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence085 1016 42 gene locus_tag LOCUS_12660 1016 42 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_12660 2348 1104 gene locus_tag LOCUS_12670 2348 1104 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_12670 3099 2359 gene locus_tag LOCUS_12680 3099 2359 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_12680 4468 3230 gene locus_tag LOCUS_12690 4468 3230 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_12690 5068 4484 gene locus_tag LOCUS_12700 5068 4484 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_12700 5556 5077 gene locus_tag LOCUS_12710 5556 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence086 2568 2068 gene locus_tag LOCUS_12720 2568 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2594 2824 gene locus_tag LOCUS_12730 2594 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 3090 2800 gene locus_tag LOCUS_12740 3090 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 4852 3161 gene locus_tag LOCUS_12750 4852 3161 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680798.1 protein_id gnl|my_center|LOCUS_12750 5746 4868 gene locus_tag LOCUS_12760 5746 4868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966898.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence087 <1 2695 gene locus_tag LOCUS_12770 <1 2695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase 2743 3561 gene locus_tag LOCUS_12780 2743 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence088 73 492 gene locus_tag LOCUS_12790 73 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 596 988 gene locus_tag LOCUS_12800 596 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1059 1397 gene locus_tag LOCUS_12810 1059 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1413 2168 gene locus_tag LOCUS_12820 1413 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2656 2171 gene locus_tag LOCUS_12830 gene tadA 2656 2171 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFZ1 protein_id gnl|my_center|LOCUS_12830 3361 2660 gene locus_tag LOCUS_12840 3361 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 <5896 3358 gene locus_tag LOCUS_12850 <5896 3358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase >Feature sequence089 765 2369 gene locus_tag LOCUS_12860 765 2369 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_12860 2369 2695 gene locus_tag LOCUS_12870 2369 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 2730 4529 gene locus_tag LOCUS_12880 2730 4529 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence090 3093 2113 gene locus_tag LOCUS_12890 3093 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 5426 3141 gene locus_tag LOCUS_12900 5426 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence091 671 1459 gene locus_tag LOCUS_12910 gene pomA 671 1459 CDS product flagellar motor protein MotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937943.1 protein_id gnl|my_center|LOCUS_12910 1465 2295 gene locus_tag LOCUS_12920 1465 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2339 4099 gene locus_tag LOCUS_12930 2339 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 4118 5053 gene locus_tag LOCUS_12940 gene fliG 4118 5053 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY63 protein_id gnl|my_center|LOCUS_12940 5521 5129 gene locus_tag LOCUS_12950 5521 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence092 2966 3140 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atcagccattaaataattgggatgt >Feature sequence093 616 2262 gene locus_tag LOCUS_12960 616 2262 CDS product Na/Pi cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_12960 4305 2320 gene locus_tag LOCUS_12970 4305 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 5188 4658 gene locus_tag LOCUS_12980 5188 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence094 1254 436 gene locus_tag LOCUS_12990 1254 436 CDS product iron permease FTR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083270.1 protein_id gnl|my_center|LOCUS_12990 1518 1591 gene locus_tag LOCUS_t00180 1518 1591 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1820 3127 gene locus_tag LOCUS_13000 1820 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056019.1 protein_id gnl|my_center|LOCUS_13000 3220 3861 gene locus_tag LOCUS_13010 gene upp 3220 3861 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4B3 protein_id gnl|my_center|LOCUS_13010 4646 3918 gene locus_tag LOCUS_13020 4646 3918 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_13020 5557 4646 gene locus_tag LOCUS_13030 gene ilvE2 5557 4646 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence095 3488 5329 gene locus_tag LOCUS_13040 3488 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence096 1766 450 gene locus_tag LOCUS_13050 1766 450 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202933.1 protein_id gnl|my_center|LOCUS_13050 2974 1781 gene locus_tag LOCUS_13060 2974 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 4826 3000 gene locus_tag LOCUS_13070 gene msbA 4826 3000 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_13070 5259 4837 gene locus_tag LOCUS_13080 5259 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence097 <1 950 gene locus_tag LOCUS_13090 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404684.1:DNA-directed RNA polymerase sigma-70 factor 2306 999 gene locus_tag LOCUS_13100 2306 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2374 4839 gene locus_tag LOCUS_13110 2374 4839 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_13110 4839 5339 gene locus_tag LOCUS_13120 4839 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence098 613 1788 gene locus_tag LOCUS_13130 gene metK 613 1788 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YH5 protein_id gnl|my_center|LOCUS_13130 1800 3242 gene locus_tag LOCUS_13140 gene ahcY 1800 3242 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEG8 protein_id gnl|my_center|LOCUS_13140 >Feature sequence099 <1 3062 gene locus_tag LOCUS_13150 <1 3062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903921.1:halolysin 3129 4070 gene locus_tag LOCUS_13160 3129 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 4184 5194 gene locus_tag LOCUS_13170 4184 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence100 1281 814 gene locus_tag LOCUS_13180 gene accB 1281 814 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931852.1 protein_id gnl|my_center|LOCUS_13180 1862 1299 gene locus_tag LOCUS_13190 gene efp 1862 1299 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXQ9 protein_id gnl|my_center|LOCUS_13190 2824 1970 gene locus_tag LOCUS_13200 2824 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 3672 2824 gene locus_tag LOCUS_13210 3672 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_13210 4701 3706 gene locus_tag LOCUS_13220 4701 3706 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence101 485 823 gene locus_tag LOCUS_13230 485 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 857 1381 gene locus_tag LOCUS_13240 857 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1489 2976 gene locus_tag LOCUS_13250 1489 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 3012 4127 gene locus_tag LOCUS_13260 3012 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence102 2998 1004 gene locus_tag LOCUS_13270 2998 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence103 918 1655 gene locus_tag LOCUS_13280 918 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1682 3415 gene locus_tag LOCUS_13290 1682 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 4411 3467 gene locus_tag LOCUS_13300 4411 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence104 177 1499 gene locus_tag LOCUS_13310 177 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1914 1507 gene locus_tag LOCUS_13320 1914 1507 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_13320 2978 1947 gene locus_tag LOCUS_13330 2978 1947 CDS product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_13330 4006 2969 gene locus_tag LOCUS_13340 4006 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_13340 4777 4007 gene locus_tag LOCUS_13350 4777 4007 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence105 <1 766 gene locus_tag LOCUS_13360 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64N34:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) 841 1275 gene locus_tag LOCUS_13370 841 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1489 1845 gene locus_tag LOCUS_13380 1489 1845 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QR6 protein_id gnl|my_center|LOCUS_13380 1846 2355 gene locus_tag LOCUS_13390 gene folK 1846 2355 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_13390 2352 2987 gene locus_tag LOCUS_13400 gene dck 2352 2987 CDS product deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403716.1 protein_id gnl|my_center|LOCUS_13400 2993 3169 gene locus_tag LOCUS_13410 2993 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 3169 3606 gene locus_tag LOCUS_13420 3169 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 3599 4183 gene locus_tag LOCUS_13430 3599 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 4180 4881 gene locus_tag LOCUS_13440 4180 4881 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_13440 >Feature sequence106 >Feature sequence107 2255 399 gene locus_tag LOCUS_13450 gene mnmG 2255 399 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KA85 protein_id gnl|my_center|LOCUS_13450 3584 2262 gene locus_tag LOCUS_13460 gene mnmE 3584 2262 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHA2 protein_id gnl|my_center|LOCUS_13460 <4869 3584 gene locus_tag LOCUS_13470 <4869 3584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KGG2:membrane protein insertase YidC >Feature sequence108 3860 1416 gene locus_tag LOCUS_13480 3860 1416 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_13480 4344 3913 gene locus_tag LOCUS_13490 4344 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence109 <1 612 gene locus_tag LOCUS_13500 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546063.1:potassium transporter TrkA 647 1705 gene locus_tag LOCUS_13510 647 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252907.1 protein_id gnl|my_center|LOCUS_13510 4106 1713 gene locus_tag LOCUS_13520 gene leuS 4106 1713 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P36430 protein_id gnl|my_center|LOCUS_13520 >Feature sequence110 <1 2546 gene locus_tag LOCUS_13530 <1 2546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase 2618 3370 gene locus_tag LOCUS_13540 2618 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3450 4256 gene locus_tag LOCUS_13550 3450 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4273 4674 gene locus_tag LOCUS_13560 4273 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence111 1050 2357 gene locus_tag LOCUS_13570 1050 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2402 3451 gene locus_tag LOCUS_13580 2402 3451 CDS product LPS biosynthesis protein RfbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876089.1 protein_id gnl|my_center|LOCUS_13580 3453 4415 gene locus_tag LOCUS_13590 3453 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence112 846 424 gene locus_tag LOCUS_13600 gene fur 846 424 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310199.1 protein_id gnl|my_center|LOCUS_13600 3083 912 gene locus_tag LOCUS_13610 3083 912 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S550 protein_id gnl|my_center|LOCUS_13610 4104 3061 gene locus_tag LOCUS_13620 4104 3061 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583236.1 protein_id gnl|my_center|LOCUS_13620 4219 4461 gene locus_tag LOCUS_13630 4219 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 4467 4543 gene locus_tag LOCUS_t00190 4467 4543 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence113 821 48 gene locus_tag LOCUS_13640 821 48 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_13640 901 1788 gene locus_tag LOCUS_13650 901 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_13650 2086 2298 gene locus_tag LOCUS_13660 2086 2298 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812875.1 protein_id gnl|my_center|LOCUS_13660 2353 2667 gene locus_tag LOCUS_13670 2353 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence114 <1 586 gene locus_tag LOCUS_13680 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q93SU4:phosphatidylserine decarboxylase proenzyme 583 1323 gene locus_tag LOCUS_13690 gene pssA 583 1323 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853992.1 protein_id gnl|my_center|LOCUS_13690 1339 1626 gene locus_tag LOCUS_13700 1339 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1643 1876 gene locus_tag LOCUS_13710 gene tatA 1643 1876 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XY4 protein_id gnl|my_center|LOCUS_13710 1979 2947 gene locus_tag LOCUS_13720 1979 2947 CDS product aerotolerance protein BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_13720 2947 3948 gene locus_tag LOCUS_13730 2947 3948 CDS product aerotolerance regulator BatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405281.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence115 1441 125 gene locus_tag LOCUS_13740 1441 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2751 1438 gene locus_tag LOCUS_13750 2751 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141303.1 protein_id gnl|my_center|LOCUS_13750 3564 2854 gene locus_tag LOCUS_13760 3564 2854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_13760 4210 4121 gene locus_tag LOCUS_t00200 4210 4121 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4364 4276 gene locus_tag LOCUS_t00210 4364 4276 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence116 673 990 gene locus_tag LOCUS_13770 673 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057944.1 protein_id gnl|my_center|LOCUS_13770 1013 1978 gene locus_tag LOCUS_13780 1013 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1975 2739 gene locus_tag LOCUS_13790 1975 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3490 2744 gene locus_tag LOCUS_13800 gene gpmA 3490 2744 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFC8 protein_id gnl|my_center|LOCUS_13800 3627 4319 gene locus_tag LOCUS_13810 3627 4319 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461702.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence117 926 1243 gene locus_tag LOCUS_13820 926 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 3510 1288 gene locus_tag LOCUS_13830 gene katG 3510 1288 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066164.1 protein_id gnl|my_center|LOCUS_13830 <4322 3698 gene locus_tag LOCUS_13840 <4322 3698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase >Feature sequence118 271 705 gene locus_tag LOCUS_13850 271 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 710 1246 gene locus_tag LOCUS_13860 gene tag 710 1246 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220466.1 protein_id gnl|my_center|LOCUS_13860 1227 2342 gene locus_tag LOCUS_13870 gene selU 1227 2342 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKA0 protein_id gnl|my_center|LOCUS_13870 2399 2845 gene locus_tag LOCUS_13880 gene rnhA 2399 2845 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH79 protein_id gnl|my_center|LOCUS_13880 3749 3081 gene locus_tag LOCUS_13890 3749 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932146.1 protein_id gnl|my_center|LOCUS_13890 4259 3789 gene locus_tag LOCUS_13900 4259 3789 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261761.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence119 1296 2753 gene locus_tag LOCUS_13910 gene pepA 1296 2753 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJQ9 protein_id gnl|my_center|LOCUS_13910 >Feature sequence120 767 1273 gene locus_tag LOCUS_13920 gene yhhF 767 1273 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871849.1 protein_id gnl|my_center|LOCUS_13920 1273 1752 gene locus_tag LOCUS_13930 gene coaD 1273 1752 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EQJ2 protein_id gnl|my_center|LOCUS_13930 1800 2075 gene locus_tag LOCUS_13940 1800 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2072 3298 gene locus_tag LOCUS_13950 2072 3298 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RU54 protein_id gnl|my_center|LOCUS_13950 >Feature sequence121 1403 516 gene locus_tag LOCUS_13960 1403 516 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_13960 1881 1408 gene locus_tag LOCUS_13970 1881 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 2329 1871 gene locus_tag LOCUS_13980 2329 1871 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYT8 protein_id gnl|my_center|LOCUS_13980 3378 2329 gene locus_tag LOCUS_13990 gene pyrD 3378 2329 CDS product dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HET0 protein_id gnl|my_center|LOCUS_13990 >Feature sequence122 <1 886 gene locus_tag LOCUS_14000 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545206.1:apolipoprotein N-acyltransferase 865 1482 gene locus_tag LOCUS_14010 865 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1482 2204 gene locus_tag LOCUS_14020 1482 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 2185 2925 gene locus_tag LOCUS_14030 gene truA 2185 2925 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P70830 protein_id gnl|my_center|LOCUS_14030 2918 3985 gene locus_tag LOCUS_14040 2918 3985 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081291.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence123 1157 630 gene locus_tag LOCUS_14050 1157 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence124 3848 105 gene locus_tag LOCUS_14060 3848 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence125 3624 898 gene locus_tag LOCUS_14070 3624 898 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082086.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence126 2130 1123 gene locus_tag LOCUS_14080 2130 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence127 2842 3216 gene locus_tag LOCUS_14090 2842 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence128 <1 969 gene locus_tag LOCUS_14100 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase 1128 2360 gene locus_tag LOCUS_14110 1128 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 <3660 2329 gene locus_tag LOCUS_14120 <3660 2329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67125:DNA polymerase III subunit alpha >Feature sequence129 1100 6 gene locus_tag LOCUS_14130 1100 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755866.1 protein_id gnl|my_center|LOCUS_14130 1511 1203 gene locus_tag LOCUS_14140 1511 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2230 1613 gene locus_tag LOCUS_14150 2230 1613 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289497.1 protein_id gnl|my_center|LOCUS_14150 2374 2649 gene locus_tag LOCUS_14160 2374 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3469 2684 gene locus_tag LOCUS_14170 3469 2684 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460167.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence130 <1 2308 gene locus_tag LOCUS_14180 <1 2308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KFT1:translation initiation factor IF-2 2305 2679 gene locus_tag LOCUS_14190 gene rbfA 2305 2679 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65970 protein_id gnl|my_center|LOCUS_14190 2669 3322 gene locus_tag LOCUS_14200 2669 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence131 >Feature sequence132 1672 266 gene locus_tag LOCUS_14210 gene nusA 1672 266 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2A2 protein_id gnl|my_center|LOCUS_14210 2068 1685 gene locus_tag LOCUS_14220 2068 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2875 2201 gene locus_tag LOCUS_14230 2875 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 2978 2906 gene locus_tag LOCUS_t00220 2978 2906 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence133 131 880 gene locus_tag LOCUS_14240 131 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 877 1338 gene locus_tag LOCUS_14250 877 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1338 2444 gene locus_tag LOCUS_14260 gene alr 1338 2444 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7C2 protein_id gnl|my_center|LOCUS_14260 2818 2486 gene locus_tag LOCUS_14270 2818 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence134 <3321 1715 gene locus_tag LOCUS_14280 <3321 1715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224493.1:solute:Na+ symporter, SSS family protein >Feature sequence135 <1 1700 gene locus_tag LOCUS_14290 <1 1700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002389909.1:alpha-mannosidase >Feature sequence136 1606 2943 gene locus_tag LOCUS_14300 1606 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence137 1243 1704 gene locus_tag LOCUS_14310 1243 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1747 1971 gene locus_tag LOCUS_14320 1747 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2359 1973 gene locus_tag LOCUS_14330 2359 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2358 2666 gene locus_tag LOCUS_14340 2358 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence138 340 2547 gene locus_tag LOCUS_14350 340 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529100.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence139 2826 301 gene locus_tag LOCUS_14360 2826 301 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403608.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence140 188 1264 gene locus_tag LOCUS_14370 188 1264 CDS product 3-phosphoserine/phosphohydroxythreonine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_14370 1810 1265 gene locus_tag LOCUS_14380 gene msrA 1810 1265 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F024 protein_id gnl|my_center|LOCUS_14380 2817 1852 gene locus_tag LOCUS_14390 2817 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence141 1714 413 gene locus_tag LOCUS_14400 1714 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121423.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence142 1365 223 gene locus_tag LOCUS_14410 gene pntA 1365 223 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence143 <1 1942 gene locus_tag LOCUS_14420 <1 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9WZS9:phenylalanine--tRNA ligase beta subunit 1939 2124 gene locus_tag LOCUS_14430 1939 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2126 2416 gene locus_tag LOCUS_14440 2126 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence144 <1 1320 gene locus_tag LOCUS_14450 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1P4:kynurenine 3-monooxygenase 1317 2504 gene locus_tag LOCUS_14460 1317 2504 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence145 1243 215 gene locus_tag LOCUS_14470 1243 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2096 1344 gene locus_tag LOCUS_14480 2096 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 2675 2148 gene locus_tag LOCUS_14490 2675 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence146 547 2082 gene locus_tag LOCUS_14500 547 2082 CDS product 2-hydroxy-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438093.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence147 <1 1004 gene locus_tag LOCUS_14510 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454756.1:coproporphyrinogen III oxidase 1801 1022 gene locus_tag LOCUS_14520 1801 1022 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_14520 2411 2728 gene locus_tag LOCUS_14530 gene ycf64 2411 2728 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI5 protein_id gnl|my_center|LOCUS_14530 >Feature sequence148 324 130 gene locus_tag LOCUS_14540 gene cspD 324 130 CDS product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816H3 protein_id gnl|my_center|LOCUS_14540 1596 421 gene locus_tag LOCUS_14550 1596 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1876 1700 gene locus_tag LOCUS_14560 1876 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence149 46 119 gene locus_tag LOCUS_t00230 46 119 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 267 1223 gene locus_tag LOCUS_14570 267 1223 CDS product glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_14570 1207 2262 gene locus_tag LOCUS_14580 1207 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence150 <2786 1220 gene locus_tag LOCUS_14590 <2786 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000466031.1:alpha-glucosidase >Feature sequence151 109 2616 gene locus_tag LOCUS_14600 109 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence152 761 252 gene locus_tag LOCUS_14610 761 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1159 839 gene locus_tag LOCUS_14620 1159 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1592 1281 gene locus_tag LOCUS_14630 1592 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 2194 1592 gene locus_tag LOCUS_14640 2194 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence153 67 792 gene locus_tag LOCUS_14650 67 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 873 1826 gene locus_tag LOCUS_14660 873 1826 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967250.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence154 348 260 gene locus_tag LOCUS_t00240 348 260 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 708 1736 gene locus_tag LOCUS_14670 708 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 <2494 1779 gene locus_tag LOCUS_14680 <2494 1779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VB59:NAD(P) transhydrogenase subunit beta >Feature sequence155 1109 117 gene locus_tag LOCUS_14690 1109 117 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080078.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence156 2236 1640 gene locus_tag LOCUS_14700 2236 1640 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002036340.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence157 54 128 gene locus_tag LOCUS_t00250 54 128 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence158 <2384 259 gene locus_tag LOCUS_14710 <2384 259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667217.1:Crp/Fnr family transcriptional regulator >Feature sequence159 1791 1045 gene locus_tag LOCUS_14720 1791 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence160 <2348 427 gene locus_tag LOCUS_14730 <2348 427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase >Feature sequence161 885 304 gene locus_tag LOCUS_14740 885 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 <2325 936 gene locus_tag LOCUS_14750 <2325 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986883.1:GTP-binding protein >Feature sequence162 <1 1061 gene locus_tag LOCUS_14760 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942876.1:GTP pyrophosphokinase 1061 1369 gene locus_tag LOCUS_14770 gene hup 1061 1369 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403823.1 protein_id gnl|my_center|LOCUS_14770 1373 1777 gene locus_tag LOCUS_14780 1373 1777 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP6 protein_id gnl|my_center|LOCUS_14780 >Feature sequence163 >Feature sequence164 <1 845 gene locus_tag LOCUS_14790 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256609.1:deoxyribodipyrimidine photo-lyase 879 1784 gene locus_tag LOCUS_14800 879 1784 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399927.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence165 143 1330 gene locus_tag LOCUS_14810 143 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1338 1697 gene locus_tag LOCUS_14820 1338 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence166 942 280 gene locus_tag LOCUS_14830 942 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1040 1363 gene locus_tag LOCUS_14840 1040 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1369 1503 gene locus_tag LOCUS_14850 1369 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence167 <2143 1218 gene locus_tag LOCUS_14860 <2143 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405586.1:T9SS C-terminal target domain-containing protein >Feature sequence168 <2120 175 gene locus_tag LOCUS_14870 <2120 175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201933.1:sensor histidine kinase >Feature sequence169 >Feature sequence170 >Feature sequence171 217 1605 gene locus_tag LOCUS_14880 217 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence172 >Feature sequence173 576 1100 gene locus_tag LOCUS_14890 gene rpoD 576 1100 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HIL3 protein_id gnl|my_center|LOCUS_14890 1093 1485 gene locus_tag LOCUS_14900 1093 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence174 1688 1284 gene locus_tag LOCUS_14910 1688 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence175 >Feature sequence176 >Feature sequence177 <1 738 gene locus_tag LOCUS_14920 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459869.1:Trk system potassium transport protein TrkA >Feature sequence178 <1 1063 gene locus_tag LOCUS_14930 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P05648:chromosomal replication initiator protein DnaA >Feature sequence179 >Feature sequence180 1037 285 gene locus_tag LOCUS_14940 1037 285 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546281.1 protein_id gnl|my_center|LOCUS_14940 1166 1239 gene locus_tag LOCUS_t00260 1166 1239 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence181 89 400 gene locus_tag LOCUS_14950 89 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 402 572 gene locus_tag LOCUS_14960 402 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 784 963 gene locus_tag LOCUS_14970 784 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence182 258 527 gene locus_tag LOCUS_14980 258 527 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979253.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence183 129 950 gene locus_tag LOCUS_14990 129 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence184 138 1433 gene locus_tag LOCUS_15000 gene asnS 138 1433 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E184 protein_id gnl|my_center|LOCUS_15000 >Feature sequence185 294 827 gene locus_tag LOCUS_15010 gene nusG 294 827 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1Q0 protein_id gnl|my_center|LOCUS_15010 844 1269 gene locus_tag LOCUS_15020 gene rplK 844 1269 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG19 protein_id gnl|my_center|LOCUS_15020 >Feature sequence186 547 1038 gene locus_tag LOCUS_15030 547 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence187 680 87 gene locus_tag LOCUS_15040 680 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 <1510 757 gene locus_tag LOCUS_15050 <1510 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UGP4:endonuclease III >Feature sequence188 >Feature sequence189 404 69 gene locus_tag LOCUS_15060 404 69 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143408.1 protein_id gnl|my_center|LOCUS_15060 472 969 gene locus_tag LOCUS_15070 472 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1304 966 gene locus_tag LOCUS_15080 1304 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence190 <1 1192 gene locus_tag LOCUS_15090 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3MGC2:cysteine--tRNA ligase 1369 1442 gene locus_tag LOCUS_t00270 1369 1442 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence191 >Feature sequence192 <1 1357 gene locus_tag LOCUS_15100 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108846.1:hybrid sensor histidine kinase/response regulator >Feature sequence193 1283 207 gene locus_tag LOCUS_15110 1283 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence194 >Feature sequence195 >Feature sequence196 <1389 129 gene locus_tag LOCUS_15120 <1389 129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase >Feature sequence197 >Feature sequence198 <1286 68 gene locus_tag LOCUS_15130 <1286 68 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403605.1:amine oxidase >Feature sequence199 >Feature sequence200 >Feature sequence201 >Feature sequence202 >Feature sequence203 >Feature sequence204 >Feature sequence205